A 500-kilobase region containing the tuberous sclerosis locus (TSC1) in a 1.7-megabase YAC and cosmid contig

GENOMICS 25,59-65

(1995)

A 500-Kilobase Region Containing the Tuberous Sclerosis Locus (TSCI) in a 1.7-Megabase YAC and Cosmid Contig J. MURRELL,* J. TROFATTER,* M. RUTTER,” 5. CUTONE,* C. STOTLER,* J. RULER,* A. TURNER,* L. DEAvEN,t A. BUCKLER,* AND M. K. MCCORMICK*,I *Molecular

K. LONG,*

Neurogenetics Unit, Massachusetts General Hospital and Department of Genetics, Harvard Medical School, Boston, Massachusetts 02 174; and tLife Sciences Division and Center for Human Genome Studies, Los Alamos National Laboratory Los Alamos, New Mexico 87545 Received

August

2, 1994;

revised September

20, 1994

gest that the TSCl gene is distal to DBH (Kwiatkowski et al., 1993; Gilbert et al., 1993) and D9SlO (Pitiot et al., 1994), which would reduce the candidate region to an -l- to ~-CM segment between DBH/DSSlO and D9S114 (Henske et al., 1993). Therefore, while it is possible that the TSCl candidate region includes the area between DBH and D9S149, our efforts have focused on the region most likely to contain the TSCl gene based on the genetic analysis in affected individuals only. An overlapping clone map of the TSCl candidate region would provide the starting material for isolation of TSCl candidate genes. Preliminary analysis of the region DBH-DSS114 by pulsed-field gel electrophoresis estimated the physical distance between these loci to be -2 Mb (Henske et al., 1993). Given this estimated size and the absence of clones covering chromosome region 9q34 in the first-generation physical map of the human genome (Cohen et al., 1993), construction of a YAC physical map of the TSCl candidate region was initiated. We describe here an -1.7-Mb overlapping clone map between loci DBH and D9S67 at an average resolution of 50 kb with a range of -10 to -300 kb, which includes the TSCl candidate region.

A complete overlapping clone map of a 1.7-Mb region from DBH to D9S67 that includes the TSCl candidate region has been constructed. The map includes YAC and cosmid clones, contains STS approximately every 50 kb on average, and establishes the order of five previously unordered loci. The overall physical length of this segment of chromosome 9q34 (1.7 Mb) is significantly less than expected compared to its estimated genetic length (-10 CM). Consequently, the physical length of the TSCl candidate region is substantially less than predicted by a genetic distance of -2 CM. 0 1996Academic Press, Inc.

INTRODUCTION

Tuberous sclerosis (TX) is an autosomal dominant disorder of heterogeneous genetic origin that affects 1 in 10,000 individuals and displays multiple clinical manifestations with variable expressivity (Gomez, 1988; Roach et al., 1992). Genetic linkage analysis has identified one TSC locus on chromosome 9 (TSCl) and another on chromosome 16 (TSCB). The TSC2 gene on chromosome 16 has recently been isolated (The European Chromosome 16 Tuberous Sclerosis Consortium, 1993), but the TSCl gene remains unidentified. Genetic linkage analysis of TSC families demonstrating linkage to chromosome 9 has implicated an -~-CM segment between loci D9S149 and D9S114 (Kwiatkowski et al., 1993; Gilbert et al., 1993) when recombination events in affected and unaffected individuals are considered. If linkage analysis in only affected individuals is considered, then the candidate region can be further defined. The basis for assessing affected individuals only is the difficulty associated with accurate diagnosis of at-risk individuals because of the variable expressivity associated with TSC. Two recombination events detected in affected individuals in unrelated families sug-

MATERIALSAND METHODS Libraries. YACs were identified from a chromosome g-specific YAC library constructed from flow-sorted chromosomal DNA (McCormick et al., 1993) and from a total human genomic YAC library constructed by CEPH (Albertsen et al., 1990). Cosmid clones were identified from chromosome g-specific libraries constructed at the Los Alamos and Lawrence Livermore National Laboratories. Colony grid filters were stamped in 2 x 2 density (chromosome g-specific YAC library) and 3 x 3 or 4 x 4 density (cosmid libraries). YAC colony filters were prepared for hybridization as described (McCormick et al., 1993). Cosmid colony filters were grown overnight at 37”C, denatured for 5 min in 0.5 N NaOH, neutralized 5 min in 1.0 M NaCl, 1.0 M Tris-HCl, pH 7.5, washed in 2~ SSC, and baked for 2 h before prewashing and hybridization. Library pools for PCR screening were generated from the chromosome g-specific (McCormick et al., 1993) and CEPH YAC libraries and from plate pools of the cosmid libraries. Alu-PCR products were generated from the same YAC library pools as used for PCR screening and spotted on filters for hybridization screening with Alu-PCR products from individual clones.

1To whom correspondence should be addressed. Telephone: (617) 724-9619. Fax: (617) 726-5736. 59

0888-7543/95 $6.00

Copyright Q 1995 by Academic Press, Inc. All rights of reproduction in any form reserved.

60

MURRELL

ET AL.

-------------

9HII-W II(19ocnlv

Jxsta

iE2z

ELIIHBP ‘S5LUI~h rSIZUOI“h

z 3 ~_________---------_------

4

PHYSICAL

MAP OF THE TSCl

Yeast genomic DNA containing YACs, in pools or indiAlu-PCR. vidual clones, was amplified with AZu primers S (5’-GAGGTTGCAGTGAGCCGAGAT-3 ’) and J (5’-GAGGCTGCAGTGAGCCGTGAT3’) in a 4:l ratio for 35 cycles (94”C, 30 s; 6O”C, 30 s; 72”C, 2 min) followed by purification from primer sequences on G50 Sephadex columns or by low-melt agarose gel electrophoresis. Both YAC ends from STS generation from YACs and cosmids. clones in the chromosome g-specific library were recovered by plasmid rescue as described @hero et al., 1991). Sequence analysis of YAC end clones and cosmid miniprep DNA was performed using a T3 (cosmid) and T7 (cosmid and YAC) primer, and resulting sequences were used to generate new STSs at each end of selected cosmid and YAC clones. Hybridization. Probes (gel-purified YAC DNA, Alu-PCR products, YAC end clones) were labeled by random priming (Feinberg and Vogelstein, 1984) with [(Y~~PI~ATP and Icu3xPldCTP and preannealed with human placental and/or Cot1 DNA (BRL) if necessary. Probes were mixed with 50 pg Cot1 DNA or 5 pg Cot1 and 2 mg of placental DNA in 5x SSC, 0.1% SDS and heated to 100°C for 5 min, followed by incubation at 65°C for 1 or 4 h, respectively, before adding to hybridization buffer. Hybridizations were performed in Church and Gilbert buffer at 65°C overnight. Filters were washed with 0.1~ SSC, 0.1% SDS at 65°C for AIu-PCR probes and with 0.5~ SSC, 0.1% SDS at 65°C for other probes and exposed to autoradiographic film from several hours to overnight. Genetic markers between and includPhysical mapping strategy. ing DBH and D9S67 were used to screen the YAC libraries by PCR. The YACs containing these loci were used to identify overlapping clones by hybridization ofAZu-PCR products from the individual YAC clones to Alu-PCR products from pools of YAC clones representing the libraries. If overlapping clones were not identified with this approach, then end clones were recovered from the chromosome 9specific YACs. These YAC end clones were sequenced and used to generate new STSs, which were used to screen the clones in the existing contig to distinguish the internal and extending YAC ends. The STS from the extending YAC end was then used to identify overlapping YACs by PCR screening of the YAC libraries. If overlapping YAC clones were not identified, then the cosmid libraries were screened by hybridization or PCR with the appropriate YAC end STS. Cosmids containing the YAC end clone probe were used to generate new STSs from both ends of the cosmid clone. The internal and extending ends of the cosmid were distinguished by PCR screening of the clones in the existing contig. The STS from the appropriate end of the cosmid was used to identify new overlapping YAC or cosmid clones by PCR. This combination of strategies was repeated until a complete overlapping clone map was obtained. The YACs and ST& composing this map were used to identify corresponding cosmid clones by hybridization of gel-purified YAC DNA to colony grids of the cosmid libraries or PCR of cosmid library plate pools and appropriate row and column pools. The clones described in the map and detailed in Fig. 1 and Tables 1 and 2 are available from the corresponding author. RESULTS

Initial screening of YAC libraries with genetic markers resulted in three YAC contigs around loci DBH,

REGION

IN 9q34

61

D9S114, and D9S67. These contigs were extended in both directions so that the orientation of each one on the chromosome would eventually be determined. Contig expansion was pursued utilizing Alu-PCR products and end clones from the YACs containing these loci to identify overlapping YAC clones and cosmid clones when necessary. Gaps in the YAC clone coverage were revealed by STS screening from YAC end clones 7G9.2Bc (DBH contig, distal end), 14G52Ba (D9S114 contig, proximal end), and 17B75Sa (D9S114 contig, distal end). These YAC end STSs were then used to identify cosmid clones. An STS generated from one cosmid (47A8) containing YAC end STS 7G9.2Bc did not identify any new YAC clones, but did identify four new cosmid clones. These four cosmid clones had previously been identified with the STS from YAC end clone 14G5.2Ba, which was part of the contig around D9S114. Therefore, the contigs around DBH and D9S114 were joined as a result of YAC and cosmid walking. At the distal end of the contig around D9S114, YAC end clone 17B75Sa STS was used to identify an overlapping cosmid clone (58Hll), which subsequently identified a new overlapping YAC clone, 7E12. Contig extension proceeded through YAC end clone and AluPCR walking. The YAC contig around D9S67 was extended with end clones and Alu-PCR products until an Alu-PCR walk from YAC lK5B4 identified YACs associated with the D9S114 contig (7E12, 6HlO). Therefore, the contigs around D9S114 and D9S67 were eventually joined as a result of YAC end clone and AZuPCR walking. The resultant YAC physical map of this region has 2 gaps that are covered by three cosmids and represents a 1.7-Mb region of chromosome 9q34 (Fig. 1A). The endpoints of the flow-sorted YAC clones correlate the clone map with a CZaI and Sac11 restriction map (Fig. 1Bl because the YACs were constructed by complete digestion with one of these restriction endonucleases (McCormick et al., 1993). The YAC clones and STSs composing this map were used to identify corresponding cosmid clones (Fig. 1A). Addition of the cosmids increases map resolution and provides more accurate estimates of the physical distance between loci. The minimum overlapping set of clones covering the region that includes loci DBH through D9S67, an estimated genetic distance of -9 CM (Kwiatkowski et al., 1993), is composed of 10 YACs and 3 cosmids that con-

FIG. 1. Physical map from DBH to D9S67. (A) Markers (STS, genes, and end clones) used to screen YACs and cosmids are represented by a label at the top of the map and a vertical line. YAC and cosmid clones are drawn to scale under the loci that they contain. YACs are indicated by horizontal lines with a corresponding name. YAC names followed by an asterisk are CEPH coordinates, and the remaining YACs are from the flow-sorted chromosome 9 library. Cosmids are indicated by numbered horizontal lines. The minimum overlapping clone map is represented by a subset of the YACs depicted and cosmid bins 01, 02, and 03. Additional cosmid bins corresponding to YAC clones are represented by groups 04 through 46. Bins 39 through 46 are considered unplaced within the YAC that identified them due to the absence of any markers that are present in the corresponding YAC in these cosmids. YAC clone lengths were estimated by pulsed-field gel electrophoresis. Cosmids are represented by a range from 30 to 45 kb. Distances between markers are estimated based on their presence or absence in the clones and the clone lengths. A kilobase and centimorgan scale is shown at the bottom. YAC and cosmid end clone STS information is in Table 1. Details regarding the numbered cosmid clone groups are presented in Table 2. (B) CZaI (Cl and Sac11 (S) sites corresponding to the ends of the flow-sorted YACs are correlated with the physical length scale of the region.

62

MURRELL

ET AL.

TABLE 1 Clones, Primer Sequences, Clone” 1Cl 87G6 306Dll 6HlO 7E12 7G9

Size (kbjb

End clone STS

375 175 125 275 175 175

No No No No No Yes Acentric end Centric end

7H3

235

Yes Acentric end Centric end

9F2 lOD2

175 200

No Yes Acentric end Centric end

llB8 14G5

15B6 16A4 17B7

140 100

75

No Yes Acentric end No No Yes Acentric end Centric end

20D9

95

Yes Acentric end Centric end

20F12 22ClO 22D3

125 150 90

No No Yes Acentric end Centric end

23Gl

200

Yes Acentric end Centric end

2433

115

Yes Acentric end Centric end

c7AlO

40

No

c67G9 (D9S67)

40

No

c47A8

40

Yes T3 end T7 end

and Origin of STSs Primer sequence

Product size (bp)

GATATAGGAGATACTACGTACGTG GACGTTATTTCCC’M-GTATTCAGC CGA’lTGCAAGGTCCTGCCGCC GTTGATGTCCTTGAGGTCGATGG

150

GTCCTAGGAG’M-GACACAGG GGGCATTGAGCTGGTTGG TGCCCAACTCCTATTCATTCTA GAAGACAAGGGAAAGTTGGTG

170

GGGGGATGTG’M’ATAAACGG GCTGGAGGACAATGGGGAG CCAGCACCAGCG’MTGTTCAG CCCAGCTCCCAGGCTGCC

167

ATCGATGGCTTGGGCTCGTCG GGGCCGTGTCTCCATGGCAG

87

150

160

180

CTCAGCCCTTTGAGTCCCG GTAGTGCTGAACATAGTGTGC CAAGTTCATGTACGTAGCACTG GGAGACACACCCGCCTGC

180

GCAAGTCACTGATCACAGCC CGGGCTAGGCTGCCCCTC C’ITCCTGGGGAGGCTGCAG CTCCAGACTTGCTACTGGGG

150

CACCCTCGAACCCCGGCCG GCTCCCGCCAGGCTAA’ITAGG AGGGCCGCTCTGGAGTCACC CCTCAGC’M’CTCCTTA4GCCC

180

160

98 160

GCCCCTGCGTGCACCTG GGGCCTGAGG’M’TGTCTCC GGGAGGCTCCGGCGCTG CACCGGCGTCCGGCCAG

174

GGAGT’M’GTGGGATGGAGAC CCAGGCTTGTTACTCCAGC TCCCAGAACCTCCACAGCC CCGGCTGTCCCGTTCAATC TGCCAAGGGGGACTGGGTG CTGCCAAGCCTCGGCCAC GGAATGAGGTCAGGCCCTG CATTI’CTCTTGAGAGAGGCTG

130

GCCCTGCCAAAACAGACTTC GAGGTAAAATATTTTCCTTTCC GCCCAGCCCTGCCTCTCC CTCG’M’TCATCAACTGCAACC

100

132

140 115 172

115

PHYSICAL

MAP OF THE TSCl

REGION

IN 9q34

63

TABLE l-Continued Clone”

Size (kb)*

End clone STS

40

No

c21OA2 (D9S14)

40

No

c65G5

40

No

c202Bll

(D9S23)

D9SlO c58Hll

40

Yes T3 end T7 end

DBH 5’ end’ DBH3’end’

Primer sequence CCCAACTCACATACTCTTAGG GAGGACAGGCTGTGTGGTC CCTGCAGGTGAGAGCAAAGC AGGACAGCCAGGAACGCAG CATGTTCACAGCTAATCTCAG AAGTCATCATGATCACGAAGG TACGTCCTCATCGACCTTCC CCTCTTG’PPI”I’CAAGGAC!ITGG GATGCAGATGGAGGGCCAG GGCTAGGTGTGGG’I’TGCAG CTGAGGAGCGTGTC‘I”I”I’GGG CCTCGAGCCGCAGCCAACC TTGGCTGCAGGGTGCATCTG GCTGGGGTGAGCTCTCTGG AAGGCACACTCCCTAAGTGGC GCCCTGACAACAACTATCAC

Product size (bp) 130 117 250 126

140 130 250 250

a Clone names preceded with a “c” are cosmids. AR others are YACs. b Average sizes for cosmids are used. ’ Kobayashi et al. (1989).

tain 34 STS and span a physical distance of -1.7 Mb based on average cosmid sizes of 40 kb and YAC sizes estimated by pulsed-field gel electrophoresis. This includes clone lengths that extend beyond the actual loci, DBH and D9S67, which are estimated to be -1.025 Mb apart. The minimum TSCl candidate region, from DBH to D9S114, is a physical distance of -500 kb compared to a genetic length of -2 CM. The previous order and genetic distances between the markers correlated with this physical map were DBH-(-1 cM)-(DSSlOD9S66-D9S1221-(-1 CM)-D9S114-(3 CM)-D9S23(4 CM)-{D9S67-D9S141. The order and physical distance of the genetic markers utilized in the construction of this physical map are DBH-(-75 kb)-D9S122(-110 kb)-D9SlO-(-20 kb)-D9S66-(-305 kb)D9S114-(-230 kb)-D9S23-(-225 kb)-D9S14-(-60 kb)-D9S67. The 34 STSs available in this 1.7-Mb segment result in an STS approximately every 50 kb on average. The largest regions flanked by STSs are - 150 kb (c7AlO to Ye23Gl.lBc), -225 kb (D9S23 to D9S14), and -375 kb (the proximal border of the contig to Ye7H3.1S). Each of these can efficiently be reduced to meet the human genome project goals by generation of new STSs from either cosmid or YAC end clones, as has already been accomplished for 20 of the 34 STSs described here. Characterization of the YAC and cosmid clones composing the map is summarized in Tables 1 and 2. The internal consistency of the physical map was verified in several ways. YAC clones that appeared to overlap each other or cosmid clones were individually confirmed by hybridization with Alu-PCR products or by PCR with end clone STSs and genetic markers that were expected to be present or absent in each clone. In addition, since the chromosome g-specific YACs were generated by complete digestion, some of these YACs are expected to be adjacent. This was confirmed in

three instances (between 7H3 and 7G9; 20D9 and 23Gl; 2433 and 20D9) by using opposite strand primers from adjacent YAC end clones to generate a PCR product from human genomic DNA across the cloning site shared by the two adjacent YACs. The YAC estimate of the overall physical length of this segment of 9q34 is consistent with the length estimate provided by the corresponding cosmid contig. The number of cosmids identified from the chromosome g-specific libraries is consistent with the number expected given the representation of the libraries (-fivefold coverage) and the size of the YAC probes. In addition, screening and ordering of these cosmids with the STS shown (Fig. 1) and others has resulted in an equivalent physical length estimate for this segment of chromosome 9 (unpublished results). DISCUSSION

The physical mapping strategy was designed to take maximum advantage of several chromosome g-specific reagents. The emphasis was on utilizing chromosome g-specific YACs for contig initiation and extension while relying on the CEPH YACs (AIbertsen et al., 1990) and chromosome 9 cosmids to bridge any gaps encountered. MegaYACs were not included in this analysis as this region of chromosome 9 was not represented by these clones (Cohen et al., 1993). This approach was based on several features of the chromosome g-specific YAC library such as (1) the low frequency of chimeric clones, (2) the ease of YAC end recovery by plasmid rescue due to the vector used in library construction @hero et al., 1991), (3) the ability to efficiently convert these end clones to STS, (4) the consequent ability to easily generate STS approximately every 200 kb, the average YAC size in the library, and (5) the concurrent generation of a CZaI and

64

MURRELL

ET AL.

TABLE 2 Cosmid Clones in the TSCl Region Inclusive positive loci or YAC hybridization

Cosmids in bin

Cosmid bin ID

Start (kb)

stop (kb)

01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23

770 790 1035 330 350 360 368 375 375 400 410 430 448 470 515 560 568 580 585 600 605 610 735

800 825 1075 375 385 400 412 405 415 435 450 465 488 505 550 595 607 620 620 635 640 645 770

24 25 26 27 28

765 790 850 865 885

795 825 885 905 920

c47AST7 . c47AST3 YelOD2.lBc. Ye14G5.2Ba Ye22D3.2Bc Ye22D3.2Bc. D9S114 D9S114

29 30

930 955

968 990

Ye22D3.1Ba Ye22D3.1Ba.

31 32 33 34 35

965 990 1005 1025 1105

1005 1025 1045 1060 1145

Ye22D3.1Ba. YelOD2.lSa YelOD2.lSa. Ye17B7.5Sa D9S23

36

1330

1365

D9S14

37 38

1380 1400

1415 1440

c67G9 end D9S67

39 40

490 665

525 700

41 42 43

910 973 1010

945 1003 1040

lOD2 lOD2/17B7 17B4

44

1260

1295

87G6

18

45 46

1350 1430

1380 1465

87G6/306Dll 306Dll

5 15

Ye23Gl.lBc. . c47AST3 . Ye14G5.2Ba c47AST3. Ye17B7.5Sa. . c58HllT3 Ye7H3.1Sa. Ye24E3.3Ba . DBH Ye7H3.1Sa. Ye7H3.1Sa DBH 5’ end Ye24E3.3Ba . . DBH 3’ end DBH.. DBH 5’ end DBH. .DBH3’end DBH 3 ’end DBH 3’ end. . D9S122 D9S122 . Ye20D9.2Ba D9S122 Ye24E3.1Sc. Ye20D9.2Ba c65G5 D9SlO . . D9S66 D9SlO. Ye7GS.lBa Ye23G1.5Ba. c7AlO D9S66 . . c7AlO Ye7H3.2Sc . c7AlO Ye7GS.lBa . c7AlO c7AlO c47AST7

7H3 7G9/23Gl

. Ye17B7.3Sc YelOD2.lSa

. Ye17B7.5Sa

2 5 1 4 1 2 2 1 2 3 1 1 1 6 6 4 5 1 1 1 1 2 9 2 1 5 5 11 1 9 2 3 1 3 9 9

. . D9S67

1 8 7 18

6 1 9

List of cosmids” L20F8, L140E12 L82C2, LlllAlO, L114G12, L160D12, L223Fl L58Hll 5G7, 38A4, 38El1, 157B4 47Fl 30Ell,211H3 86F4, lOOD3 296Dll 245A2, 254Cll 18233,282311,283C7 260D5 275c9 152F5 35A9, 84F7,132G4, 137B8,216C9, 275A5 37Bll,37C7,6505, 78H5,79B4,267311 252D7, L30B10, L144F10, L241Hll 104B4, 104C4, 108A10, 109H3, 12438 27OG3 242B6 L74B2 L158H7 L134B7, L161C8 L3Al1, L5OC1, L50E12, L163Al1, L169B7, L193E12, L198D10, L198E8, L221G7 L47A8, L197Hl LlDll 24F10,210D12,222AlO, L50H9, L124D6 L47D10, L141H4, L141H5, L191C10, L191E12 58H6,66A9, 138A10,17232, 18833, L90D6, L94C4, L136D5, L147C4, L197C2, L213A4 196A5 251B1, L13C3, L13D2, L41A3, L43F1, L86Dl1, L103F5, L182E2, L185B8 L213D8, L213G6 L14D12, L230B1, L23OC2 L27B8 L103C4, L162C3, L162C4 73D5, 103E2, 171H7,241Cl, 249G9, 253C8, 262311, 262F12,298H2 78B10, 104C2, 156B9, 176D3, 190B2, 192H12, 21OA2, 255H7, 276Fll 67G9 36A6,51Hll, 5319, lllH4, 112E10, 156F4,185HS, 279B3 46E1,92H5, 179D1, 203Hl1, 243D8,277HlO, 284A7 L6F4, L26A12, L42F1, L50F5, L56Fl1, L78F2, L78G2, L92E7, L96B9, LlOlDll, LlOSBll, L109E6, L112H5, L121A4, L164Al1, L183F7, L196C8, L209El L109C9, LllSEl, L136D4, L196E5, L196F5, L214A4 L7B2 LllD12, L202H3, L203G12, L205F12, L206G9, L212G10, L227H5, L228H5, L229A2 26H4, 31B4, 35A8, 77F9, 122B3, 123B5, 127D12, 155Cl1, 159C10, 19332, 194A4, 21OC1, 248B10, 250A12, 251D4, 273G7, 278C8, 284BlO 26A9, 76F10,208ElO, 208F6,269G6 lllC9, 161F4,174B4,181Bl, 191D2, 191E3,19738, 203C6,209B4, 225G4, 230D1, 23134,269C10, 295311,298Fll

a Cosmid clones were obtained from chromosome g-specific cosmid libraries generated at Los AIamos (names beginning with L) or Lawrence Livermore National Laboratories (names not beginning with LX

65

PHYSICAL MAP OF THE TSCl REGION IN 9q34

Sac11 restriction map of the region. The resultant physical map contains minimal artifacts, such as YAC clones with internal deletions or noncontiguous DNA segments, which is supported by corresponding cosmid clones. This contig also contains STS markers at an average resolution of 50 kb, which achieves the physical mapping goals of the human genome project for this segment of chromosome 9. The final physical map of this region emphasizes that no one strategy or single resource was sufficient for complete clone coverage. Closure of this physical map required YACs and cosmids, and the strategy utilized and benefitted from multiple YAC and cosmid libraries. Incorporating the flow-sorted chromosome 9 YACs into the map allowed correlation of the clone map with a restriction map. While this restriction map currently includes only two endonucleases, it is potentially useful for integrating additional markers that may be localized by hybridization to pulsed-field gel restriction fragments. The use of genetic markers in the construction of the physical map allowed the physical and genetic maps to be correlated and resulted in the ordering of five genetic markers that previously could not be distinguished from each other. The correlation of the two maps also allowed comparison of physical and genetic distances. Some of the physical distances established in this map are consistent with previous reports of physical lengths between several markers, such as DBH-D9SlO-D9S66 (Kwiatkowski et al., 1993). Overall, however, there is a significant reduction in expected physical length of this region based on the genetic length and the general assumption that 1 CM usually corresponds to 1 Mb. Approximately 5% (9 CM) of the genetic length of the chromosome represents
ACKNOWLEDGMENTS This work was supported by research grants from the National Institutes of Health, Division of Neurological Diseases and Stroke, and the National Center for Human Genome Research. REFERENCES Albertsen, H. M., Abderrahim, H., Cann, H. M., Dausset, J., Le Pasher, D., and Cohen, D. (1990). Construction and characterization of a yeast artificial chromosome library containing seven haploid human genome equivalents. Proc. Natl. Acad. Sci. USA 87: 4256. Cohen, D., Chumakov, I., and Weissenbach, J. (1993). A first-generation physical map of the human genome. Nature 366: 698-701. The European Chromosome 16 Tuberous Sclerosis Consortium (1993). Cell 75: 1305-1315. Feinberg, A. P., and Vogelstein, B. (1984). A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity (Addendum). Anal. Biochem. 137: 266-267. Gilbert, J. R., Kandt, R. S., Lennon, F., Gardner, R. J. M., Roses, A. D., and Pericak-Vance, M. A. (1993). Linkage and crossover analysis in tuberosis sclerosis (TSC). Am. J. Hum. Genet. 53: A1004. Gomez, M. R. (1988). “Tuberous Sclerosis,” Raven Press, New York. Henske, E. P., Ozelius, L., Gusella, J. F., Haines, J. L., and Kwiatkowski, D. (1993). Detailed genetic and physical mapping of the tuberous sclerosis region of 9q34. Am. J. Hum. Genet. 53: A1303. Kobayashi, K., Kurosawa, Y., Fujita, K., and Nagatsu, T. (1989). Human dopamine beta-hydroxylase gene: Two mRNA types having different 3 ‘-terminal regions are produced through alternative polyadenylation. Nucleic Acids Res. 17: 1089- 1102. Kwiatkowski, D., Armour, J., Bale, A., Fountain, J., Goudie, D., Haines, J., Knowles, M., Pilz, A., Slaugenhaupt, S., and Povey, S. Report and abstracts of the Second International Workshop on Human Chromosome 9 Mapping (1993). Cytogenet. Cell Genet. 64: 93-121. McCormick, M. K., Buckler, A., Bruno, W., Campbell, E., Shera, K., Torney, D., Deaven, L., and Moyzis, R. (19931. Construction and characterization of a YAC library with a low frequency of chimeric clones from flow-sorted human chromosome 9. Genomics 18: 553558. Pitiot, G., Waksman, E., Bragado-Nilsson, S., Jobert, S., Cornelis, F., and Mallet, J. (1994). Linkage analysis places TSCl gene distal to D9SlO. Third International Chromosome 9 Workshop, Cambridge, England. Roach, E. S., Smith, M., Huttenlocher, P., Bhat, M., Alcorn, D., and Hawley, L. (1992). Diagnostic criteria: Tuberous sclerosis complex. Report of the Diagnostic Criteria Committee of the National Tuberous Sclerosis Association. J. Child Neural. 7: 221-224. Shero, J., McCormick, M. K., Antonarakis, S. E., and Hieter, P. (1991). Yeast artificial chromosome vectors for efficient clone manipulation and mapping. Genomics 10: 505-508. Tanzi, R. E., Haines, J. L., Watkins, P. C., Stewart, G. D., Wallace, M. R., Hallewell, R., Wong, C., Wexler, N., Conneally, P. M., and Gusella, J. F. (1988). Genetic linkage map of human chromosome 21. Genomics 3: 129-136.