- Email: [email protected]
Construction of a 5-Mb YAC Contig from the Putative 10q25 Tumor-Suppressor Region for Glioblastomas
GENOMICS
41, 345–349 (1997) GE974664
ARTICLE NO.
Construction of a 5-Mb YAC Contig from the Putative 10q25 Tumor-Suppressor Region for Glioblastomas R. ALBAROSA, G. FINOCCHIARO,1 E. CHIARIELLO, G. RUSSO, L. SUSANI,* P. VEZZONI,*
AND
I. ZUCCHI*
Divisione di Biochimica e Genetica, Istituto Nazionale Neurologico ‘‘C. Besta,’’ 20133 Milan; and *Istituto per le Tecnologie Biomediche Avanzate, CNR, 20100 Milan, Italy Received October 31, 1996; accepted February 10, 1997
During the final step of the malignant progression to glioblastoma multiforme (GBM), the most frequent and malignant of primary brain tumors, more than 90% of the cases exhibit loss of genetic material on chromosome 10. We previously identified a 4-cM deletion interval in the 10q24–qter region that is common to all the GBM we have examined. A contig of 20 YACs spanning the 5 Mb of chromosomal DNA in the region has been assembled. Overlaps between YACs have been verified by STS content, fingerprinting analysis, and/or Alu–Alu PCR. The contig contains 17 known microsatellite markers, 15 new STSs derived from the insert ends of YACs, 9 ESTs, and 11 other STSs, for a total of 52 STSs (average marker density 1/100 kb). The physical map of this region will facilitate the search for a candidate tumor-suppressor gene(s) that is inactivated during the formation of GBM. q 1997 Academic Press
INTRODUCTION
Gliomas of astrocytic origin, in particular anaplastic astrocytomas and glioblastoma multiforme (GBM), are the most frequent primary brain tumors. During the malignant progression to GBM various chromosomal alterations can be observed, but the most frequent is the loss of chromosome 10 (Lang et al., 1994; Magnani et al., 1994). Loss of heterozygosity (LOH) on chromosome 10 has also been identified in other neoplasms, such as renal cell carcinomas (Morita et al., 1991), nonHodgkin lymphomas (Speaks et al., 1992), malignant meningiomas (Rempel et al., 1993), melanomas (Herbst et al., 1994), and endometrial cancers (Peiffer et al., 1995), indicating the presence of one or several putative tumor suppressor genes on this chromosome. By microsatellite analysis on 90 gliomas (37 anaplasSequence data from this article have been deposited with the GenBank Data Library under Accession Nos. U64663–U64673 and U75534–U75537. 1 To whom correspondence should be addressed at the Divisione di Biochimica e Genetica, via Celoria 11, 20133 Milan, Italy. Telephone: /39.2.2394-447 or -285. Fax: /39.2.2664236. E-mail: neurol@mbox. vol.it.
tic gliomas and 53 glioblastomas) we found LOH for the entire long arm of chromosome 10 in 19.2% of anaplastic astrocytomas and in 88.1% of GBM. A close relationship to malignant progression was supported by a further analysis that defined a common LOH region in 10q24–qter in 94.5% of GBM and in 24.2% of anaplastic gliomas. Subsequently, the study of a pediatric GBM suggested D10S221 and D10S209, respectively, as centromeric and telomeric markers of a 4-cM LOH region (Albarosa et al., 1996). Additional studies of contiguous samples in this tumor suggested the presence of a cellular population that harbors a larger deletion, extending to the more telomeric marker D10S214, and contains the minimal deletion region between markers D10S587 and D10S216 in another series of gliomas (Rasheed et al., 1995). We hypothesized that two tumor-suppressor genes might be present in the bigger deletion fragment of this pediatric tumor, even if the possibility that the loss of the first LOH region is preliminary to that of a critical locus between D10S587 and D10S216 cannot be ruled out. Here we report the assembly of a contig of yeast artificial chromosomes (YACs) that defines the physical map of the region flanked by markers D10S221 and D10S209. MATERIALS AND METHODS Yeast artificial chromosome selection and characterization. Sequence-tagged sites (STSs) D10S221, D10S190, D10S542, and D10S209 obtained from the literature (Gyapay et al., 1994; Weissenbach et al., 1992) were used to recover YACs from the Mega YAC library (Cohen et al., 1993) at the YAC Screening Center (S. Raffaele, Milan). Further YAC selection was done with STSs produced from YAC insert-ends described below by screening pooled Centre d’Etude de Polymorphismes Humaines (CEPH) Mega YAC and ICI libraries by STS PCR analysis (Green et al., 1991). YAC sizes, if not available in the literature, were estimated by pulsed-field gel electrophoresis of YAC DNA embedded in agarose plugs as described in Nagaraja et al. (1994). YACs comigrating with natural yeast chromosomes were sized by Southern blotting pulsed-field gels and hybridizing them to a human DNA probe. Contig construction and verification of YAC overlaps. Contig confirmation was done by L1 fingerprinting analysis as described by Porta et al. (1993). YAC DNA from individual clones was isolated, digested, electrophoresed, and blotted as described in Zucchi and Schlessinger (1992). Probe DNA (50 ng) was labeled with [a-32P]dCTP by random
345
AID
GENO 4664
/
6r2f$$$241
03-29-97 03:10:14
0888-7543/97 $25.00 Copyright q 1997 by Academic Press All rights of reproduction in any form reserved.
gnma
FIG. 1. 5-Mb YAC contig containing the D10S221 – D10S209 region of loss of heterozygosity in glioblastoma multiforme. Twenty YACs are present in the contig, and their size and origin are described in Table 1. The larger type indicates new STSs, while ESTs are in italic. YAC names are written normally when they are derived from the Mega YAC library from CEPH, while they are in italic when derived from the ICI library. The figure summarizes the results of PCR amplifications of STSs presented in Table 2.
346
AID
ALBAROSA ET AL.
GENO 4664
/
6r2f$$4664
03-29-97 03:10:14
gnma
347
A YAC CONTIG ON 10q25 RELEVANT IN BRAIN TUMORS
YAC contig. The STSs were derived from ligation-mediated PCR products from the YAC-specific fragments at the left or right ends. YAC-end specific fragments were obtained by digestion of YAC DNA with the frequent cutter enzymes AluI, RsaI, and HaeIII; linker ligation; and nested PCR amplification as described by Kere et al. (1992). Sequences derived from the corresponding right and left ends of the YACs were analyzed for homology to common repetitive elements by FASTA and BLAST (website http://www.ebi.ac.uk/). Primer selection for STS PCR analysis was done by Primer Designer (Version 1.01; Scientific and Educational Software). Primer pairs were verified to be chromosome-specific by PCR on DNA from a human–hamster hybrid cell line containing only human chromosome 10 (a gift of Mariano Rocchi, University of Bari, Italy). PCR fragments generated from the end of each YAC insert were sequenced by an Applied Biosystem Model 373A DNA sequencer, using protocols suggested by the manufacturer.
TABLE 1 YACs in the Contig Clone name
YAC size (kb)
Library
694D9 706C2 754F12 776F6 830C2 858H7 880C3 909D12 909F2 926A4 937A6 988H4 5DC10 15GD3 19GA7 19GB2 25DB2 26FB8 27GF4 37AD11
1190 920 1750 1180 850 1740 440 650 160 1680 1490 Not tested 420 280 450 150 450 250 250 360
CEPH CEPH CEPH CEPH CEPH CEPH CEPH CEPH CEPH CEPH CEPH CEPH ICI ICI ICI ICI ICI ICI ICI ICI
cDNA selection. Direct cDNA selection was performed as described by Lovett (1994). Genomic DNA was from YAC clones 5DC10 and 880C3, and cDNA was prepared from a human brain cDNA library in lgt 10 (Human Brain 5*-Stretch Plus; Clontech). Primaryand secondary-selected cDNAs were cloned in pCR II (TA cloning kit; Invitrogen) and sequences were analyzed for homologies by FASTA and BLAST. cDNAs not homologous to ribosomal or repetitive sequences were validated by PCR amplification on human and yeast genomic DNA and on DNA of YACs 5DC10 and 880C3.
priming (Rediprime DNA labeling system; Amersham). Hybridization and washing conditions are as reported (ibidem). Internal Alu–Alu PCR products generated from each YAC (Nelson et al., 1989) were used as repeat-free hybridization probes on a gridded YAC panel to confirm walking steps. YAC insert end isolation and generation of new STS. Eleven new STSs were produced, characterized, and mapped to construct the
Analysis of the MON1 polymorphism. Human genomic DNA, extracted from lymphocytes by cell lysis with guanidine thiocyanate (IsoQuick; MicroProbe), was amplified by primers FP1, GCACCATGTATGCCCTGT, and RP1, GGCTATTTATATTGGTCAGAAG (annealing temperature 527C). Labeling of PCR products was performed by fluorescent dUTP, as suggested by the manufacturers (Applied Biosystems, Perkin Elmer). The samples were run on a 6% polyacrylamide gel (19:1) with 50% urea, 11 TBE, at 20 W, for 9 h, and results were analyzed by the Applied Biosystem Sequencer 672 GeneScan software.
TABLE 2 STSs in the Contig No.
Locus
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26
926A4-L WI-4504 CHLC.GATA71C09 SHGC-5828 D10S221 WI-3716 WI-15012 D10S1693 D10S421 CHLC.GATA5A02 D10S1236 IB-3064 WI-8038 D10S610 SGC-35089 WI-15787 D10S190 MON-1 694D9-L D10S503 858H7-L WI-14638 SHGC-5523 WI-17887 NIB-1107 D10S1785
a
Genbank ID U75537 G04646 G08809 G17433 Z17129 G04397 H27764 Z52960 GDB:136744a G08796 G08792 T16057 T40903 G08796 H78573 R32301 Z16509 U75536 U64663 GDB:139667a U75534 R60031 G08796 R92206
EST ID
EST288311
EST EST91707 EST380872 EST202346
EST236786 EST333001
Z51828
No.
Locus
Genbank ID
27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52
D10S542 776F6-L SHGC-13633 WI-5255 D10S1792 AFM-338ZC9 D10S230E D10S2386 26FB8-L 880C3-R 988H4-L 15GD3-L 37AD11-L 25DB2-R 27GF4-L 754F12-L D10S209 SGC-35172 CHLC.ATA29CO3 706C2-L 988H4-R D10S281 D10S294 WI-16392 D10S2158 D10S2322
Z23314 U64664 G17525 G04834 Z51964 Z67078 GDB:133873a G13884 U64665 U64666 U64673 U64667 U64668 U64669 U64670 U64671 Z16807 H83701 G08777 U64672 U75535 GDB:135535a GDB:135548a H88483 G11394 G08765
The Genome Database ID.
AID
GENO 4664
/
6r2f$$$242
03-29-97 03:10:14
gnma
EST ID
EST386001
EST390792
348
ALBAROSA ET AL.
FIG. 2. Fingerprinting analysis of YACs relevant for the closure of the gap between markers D10S542 and D10S209. DNA from YACs indicated on top was digested by TaqI and hybridized to a LINE probe (see Materials and Methods). Overlapping YACs are indicated at the bottom, and bands relevant for the fingerprinting are indicated by arrows on the left.
RESULTS AND DISCUSSION
To initiate map assembly, 12 YAC clones containing STS markers D10S221, D10S190, D10S542, and D10S209 were recovered from the CEPH Mega YAC library. Eight of the 12 clones were found to be chimeric. Further analysis determined that YAC 858H7 contained the STSs D10S221 and D10S190, YACs 694D9 and 880C3 contained D10S542, and YACs 937A6 and 754F12 contained D10S209. Overlaps were confirmed by fingerprinting analysis. Fingerprinting data and PCR analysis of STSs on YACs confirmed that D10S221 is centromeric to D10S190 (Weissenbach et al., 1992) and demonstrated that D10S542 is telomeric to D10S190. To close the physical map we screened for additional clones with STSs from right (R) and left (L) ends of relevant YACs. First, we generated an insert-end STS for the left end of YAC 694D9 (Fig. 1). PCR amplification of the STS 694D9-L on YAC 858H7, containing markers D10S221 and D10S190, indicated that the left end of YAC 694D9 is oriented toward the centromere. To walk toward the telomere, the right-end of YAC 694D9 was not useful, since it contained an orphan repetitive sequence. Instead, to close the gap between YACs 694D9/880C3 and 754F12, we used end-clone STSs from YACs 880C3 and 754F12. These YACs, as mentioned above, contained markers D10S542 and D10S209, respectively. Both ends of YAC 880C3 were determined, and the right end was used for screening. Clones 909F2, 909D12, 26FB8, 15GD3, and 776F6 were identified by the 880C3-R STS. For YAC 754F12
AID
GENO 4664
/
6r2f$$$242
03-29-97 03:10:14
only the left end was recovered, and it detected clones 27GF4, 706C2, and 25DB2. Identification of the left end of YAC 27GF4 was critical to close the contig. This end, in fact, could be amplified in YAC 776F6, also selected by the right end of YAC 880C3 (Fig. 1). Other YACs selected by 27GF4L were 19GA7, 19GB2, 37AD11, and 693B5. This latter YAC, not shown in Fig. 1, was chimeric (the right end corresponds to EST AC H55649, mapping to chromosome 22) and contained only a small portion of chromosome 10 DNA. YACs that are part of the contig are indicated in Table 1. An overview of their relevant overlaps, detected by fingerprinting analysis, is shown in Fig. 2. Other confirmations of the closure of the contig came from the amplification of the left end of 15GD3 on YACs 19GA7 and 19GB2 and the amplification of the right end of 25DB2 on YACs 776F6 and 909D12. Furthermore, YAC 988H4, obtained by a subsequent search of the database with marker D10S209, contained STS D10S209 and 15GD3-L. The left end of 988H4 could also be amplified on YACs 909D12, 26FB8, 776F6, and 15GD3. The map was refined with additional STSs (776F6-L, 26FB8-L, 37AD11-L, 706C2-L, 858H7-L, 926A4-L, and 988H4-R) and by testing all YACs for microsatellites D10S421, D10S610, D10S503, D10S230E, D10S281, and D10S294 (Moschonas et al., 1996). The order of the markers and extent of the contig were thus confirmed. DNA sequences of the new STSs have been deposited in GenBank with Accession Nos. U64663–U64673 and U75534–U75537. A further round of database searches was performed to increase the density of STSs: 50 primer pairs were tested by PCR for their presence in the YAC contig and 27 scored positive. Their reciprocal order, however, could not be always determined. Furthermore, one new EST of 1367 bp (mon1) was identified by cDNA selection on YAC 5DC10 and amplified also on 858H7, 830C2, and 926A4. Sequence analysis revealed 11 TCCA repeats at position 385 (mon1P1) and 11 GA repeats at position 462 (mon1P2). Analysis of the mon1P2 repeat on DNA from 48 individuals showed the presence of three alleles with a frequency of heterozygosity of only 4.2%. On the contrary, mon1P1, when analyzed in 68 individuals, showed a frequency of heterozygosity of 57.3% in the presence of four alleles. Allele A (11 repeats) was present in 56.6% of the cases, allele B (9 repeats) in 20.6%, allele C (12 repeats) in 16.9%, and allele D (10 repeats) in 5.9%. A list of all the STSs of the contig, including 9 ESTs, is given in Table 2 with the corresponding accession number. Fingerprinting analysis suggests that YAC 776F6 contains YAC 880C3, but both PCR and Southern analysis show that D10S542 is present on YAC 880C3 but not on 776F6. However, the results of PCR analysis, also performed on the STSs obtained from database, suggest that YAC 880C3 is not fully contained in YAC 776F6 and presents a small deletion corresponding to the left end of 776F6. This deletion is probably causing
gnma
A YAC CONTIG ON 10q25 RELEVANT IN BRAIN TUMORS
the lack of amplification of STSs SHGC-13633, WI5255, D10S1792, and AFM338ZC9, which, on the contrary, are amplified on YAC 776F6. A further small deletion could be present on YAC 19GB2. It is suggested by the data that 19GB2 contains STSs 15GD3L and 25DB2R and should amplify STS 37AD11L, which lies between them (Fig. 1), but neither PCR nor Southern blot analysis confirmed the presence of this STS on YAC 19GB2. Thus, it is possible that a small deletion corresponding to STS 37AD11L causes the absence of this STS in the YAC. In conclusion, we have assembled a YAC contig spanning a 5-Mb region flanked by markers D10S221 and D10S209. The 20 YACs bridge the gap between contigs 082 and 085 of Moschonas et al. (1996) and WC10.13– WC10.15, presented in the website http://wwwgenome.wi.mit.edu/cgi-bin/contig/sts_by_chrom. Fifteen new STSs and another 37 from database (9 ESTs and 17 known microsatellites) fall in this region, providing an average density of 1 STS/100 kb. Since no apparent candidate tumor-suppressor gene has yet been reported in this interval, we have started to search for new genes in the region using CpG island and cDNA selection methods. ACKNOWLEDGMENTS We acknowledge the collaboration of Cinzia Sala and Daniela Toniolo (YAC Screening Center, DIBIT–Ospedale S. Raffaele, Milano), for the isolation of several YACs described in this paper; David Schlessinger, for the careful revision of the manuscript; and the personnel of the Department of Neuromuscular disorders for help in oligonucleotide synthesis. This is paper No. 5 of the Genome 2000/ ITBA project funded by Cariplo. This work has been supported by a grant from the Associazione Italiana per la Ricerca sul Cancro to G.F. and is dedicated to the memory of Monica Piano, a young patient who recently succumbed to glioblastoma multiforme.
REFERENCES Albarosa, R., Colombo, B. M., Roz, L., Magnani, I., Pollo, B., Cirenei, N., Giani, C., Fuhrman Conti, A. M., DiDonato, S., and Finocchiaro, G. (1996). Deletion mapping of gliomas suggests the presence of two small regions for candidate tumor suppressor genes in a 17 cM interval on chromosome 10q. Am. J. Hum. Genet. 58: 1260– 1267. Cohen, D., Chumakov, I., and Weissenbach, J. (1993). A first-generation physical map of the human genome. Nature 366: 698–701. Green, E. D., Mohr, R. M., Idol, J. R., Jones, M., Buckingham, J. M., Deaven, L. L., Moyzis, R. K., and Olson, M. V. (1991). Systematic generation of sequence-tagged sites for physical mapping of human chromosomes: Application to the mapping of human chromosome 7 using yeast artificial chromosomes. Genomics 11: 548–564. Gyapay, G., Morissette, J., Vignal, A., Dib, C., Fizames, C., Millasseau, P., Marc, S., Bernardi, G., Lathrop, M., and Weissenbach, J. (1994). The 1993–94 Genethon human genetic linkage map. Nature Genet. 7: 246–339. Herbst, R. A., Weiss, J., Ehnis, A., Cavenee, W. K., and Arden, K. C.
AID
GENO 4664
/
6r2f$$$242
03-29-97 03:10:14
349
(1994). Loss of heterozygosity for 10q22–10qter in malignant melanoma progression. Cancer Res. 54: 3111–3114. Kere, J., Nagaraja, R., Mumm, S., Ciccodicola, A., D’Urso, M., and Schlessinger, D. (1992). Mapping human chromosomes by walking with sequence-tagged sites from end-fragments of yeast artificial chromosomes inserts. Genomics 14: 241–248. Lang, F. F., Miller, D. C., Koslow, M., and Newcomb, E. W. (1994). Pathways leading to glioblastoma multiforme: A molecular analysis of genetic alterations in 65 astrocytic tumors. J. Neurosurg. 81: 427–436. Lovett, M. (1994). Direct selection of cDNAs using genomic contigs. In ‘‘Current Protocols in Human Genetics,’’ unit 6.3. Magnani, I., Guarneri, S., Pollo, B., Cirenei, N., Colombo, B. M., Broggi, G., Galli, C., Bugiani, O., DiDonato, S., Finocchiaro, G., and Fuhrman Conti, A. M. (1994). Increasing complexity of the karyotype in 50 human gliomas: Progressive evolution and de novo occurrence of cytogenetic alterations. Cancer Genet. Cytogenet. 75: 77–89. Morita, R., Saito, S., Ishikawa, J., Ogawa, O., Yoshida, O., Yamakawa, K., and Nakamura, Y. (1991). Common regions of deletion on chromosomes 5q, 6q and 10q in renal cell carcinoma. Cancer Res. 51: 5817–5820. Moschonas, N. K., Spurr, N. K., and Mao, J. (1996). Report of the First International Workshop on Human Chromosome 10 Mapping 1995. Cytogenet. Cell Genet. 72: 99–112. Nagaraja, R., Kere, J., MacMillan, S., Masisi, M. W. J., Johnson, D., Halley, G., Molini, B. A., Wein, K., Trusgnich, M., Ebel, B., Browstein, B. H., Railey, B., and Schlessinger, D. (1994). Characterization of four human YAC libraries for clone size, chimerism, and X chromosome sequence representation. Nucleic Acids Res. 22: 3406–3411. Nelson, D. L., Ledbetter, S. A., Corbo, L., Victoria, M. F., RamirezSolis, R., Webster, T. D., Ledbetter, D. H., and Caskey, C. T. (1989). Alu polymerase chain reaction: A method for rapid isolation of human-specific sequence from complex DNA sources. Proc. Natl. Acad. Sci. USA 86: 6686–6690. Peiffer, S. L., Herzog, T. J., Tribune, D. J., Mutch, D. G., Gersell, D. J., and Goodefellow, P. J. (1995). Allelic loss of sequences from the long arm of chromosome 10 and replication errors in endometrial cancers. Cancer Res. 55: 1922–1926. Porta, G., Zucchi, I., Hillier, L., Green, P., Nowotny, V., D’Urso, M., and Schlessinger, D. (1993). Alu and L1 sequence distribution in Xq24–q28, and their comparative utility in YAC contig assembly and verification. Genomics 16: 417–425. Rasheed, B. K., McLendon, R. E., Friedman, H. S., Friedman, A. H., Fuchs, H. E., Bigner, D. D., and Bigner, S. H. (1995). Chromosome 10 deletion mapping in human gliomas: A common deletion region in 10q25. Oncogene 10: 2243–2245. Rempel, S. A., Schwechheimer, K., Davis, R. L., Cavenee, W. K., and Rosenblum, M. L. (1993). Loss of heterozygosity for loci on chromosome 10 is associated with morphologically malignant meningioma progression. Cancer Res. 53: 2386–2392. Speaks, S. L., Sanger, W. G., Masih, A. S., Harrington, D. S., Hess, M., and Armitage, J. O. (1992). Recurrent abnormalities of chromosome bands 10q23–25 in non-Hodgkin’s lymphoma. Genes Chromosomes Cancer 5: 239–243. Weissenbach, J., Gyapay, G., Dib, C., Vignal, A., Morissette, J., Millasseau, P., Vaysseix, G., and Lathrop, M. (1992). A second-generation linkage map of the human genome. Nature 359: 794–801. Zucchi, I., and Schlessinger, D. (1992). Distribution of moderately repetitive sequences pTR5 and LF1 in Xq24–q28 human DNA and their use in assembling YAC contigs. Genomics 12: 264–275.
gnma
41, 345–349 (1997) GE974664
ARTICLE NO.
Construction of a 5-Mb YAC Contig from the Putative 10q25 Tumor-Suppressor Region for Glioblastomas R. ALBAROSA, G. FINOCCHIARO,1 E. CHIARIELLO, G. RUSSO, L. SUSANI,* P. VEZZONI,*
AND
I. ZUCCHI*
Divisione di Biochimica e Genetica, Istituto Nazionale Neurologico ‘‘C. Besta,’’ 20133 Milan; and *Istituto per le Tecnologie Biomediche Avanzate, CNR, 20100 Milan, Italy Received October 31, 1996; accepted February 10, 1997
During the final step of the malignant progression to glioblastoma multiforme (GBM), the most frequent and malignant of primary brain tumors, more than 90% of the cases exhibit loss of genetic material on chromosome 10. We previously identified a 4-cM deletion interval in the 10q24–qter region that is common to all the GBM we have examined. A contig of 20 YACs spanning the 5 Mb of chromosomal DNA in the region has been assembled. Overlaps between YACs have been verified by STS content, fingerprinting analysis, and/or Alu–Alu PCR. The contig contains 17 known microsatellite markers, 15 new STSs derived from the insert ends of YACs, 9 ESTs, and 11 other STSs, for a total of 52 STSs (average marker density 1/100 kb). The physical map of this region will facilitate the search for a candidate tumor-suppressor gene(s) that is inactivated during the formation of GBM. q 1997 Academic Press
INTRODUCTION
Gliomas of astrocytic origin, in particular anaplastic astrocytomas and glioblastoma multiforme (GBM), are the most frequent primary brain tumors. During the malignant progression to GBM various chromosomal alterations can be observed, but the most frequent is the loss of chromosome 10 (Lang et al., 1994; Magnani et al., 1994). Loss of heterozygosity (LOH) on chromosome 10 has also been identified in other neoplasms, such as renal cell carcinomas (Morita et al., 1991), nonHodgkin lymphomas (Speaks et al., 1992), malignant meningiomas (Rempel et al., 1993), melanomas (Herbst et al., 1994), and endometrial cancers (Peiffer et al., 1995), indicating the presence of one or several putative tumor suppressor genes on this chromosome. By microsatellite analysis on 90 gliomas (37 anaplasSequence data from this article have been deposited with the GenBank Data Library under Accession Nos. U64663–U64673 and U75534–U75537. 1 To whom correspondence should be addressed at the Divisione di Biochimica e Genetica, via Celoria 11, 20133 Milan, Italy. Telephone: /39.2.2394-447 or -285. Fax: /39.2.2664236. E-mail: neurol@mbox. vol.it.
tic gliomas and 53 glioblastomas) we found LOH for the entire long arm of chromosome 10 in 19.2% of anaplastic astrocytomas and in 88.1% of GBM. A close relationship to malignant progression was supported by a further analysis that defined a common LOH region in 10q24–qter in 94.5% of GBM and in 24.2% of anaplastic gliomas. Subsequently, the study of a pediatric GBM suggested D10S221 and D10S209, respectively, as centromeric and telomeric markers of a 4-cM LOH region (Albarosa et al., 1996). Additional studies of contiguous samples in this tumor suggested the presence of a cellular population that harbors a larger deletion, extending to the more telomeric marker D10S214, and contains the minimal deletion region between markers D10S587 and D10S216 in another series of gliomas (Rasheed et al., 1995). We hypothesized that two tumor-suppressor genes might be present in the bigger deletion fragment of this pediatric tumor, even if the possibility that the loss of the first LOH region is preliminary to that of a critical locus between D10S587 and D10S216 cannot be ruled out. Here we report the assembly of a contig of yeast artificial chromosomes (YACs) that defines the physical map of the region flanked by markers D10S221 and D10S209. MATERIALS AND METHODS Yeast artificial chromosome selection and characterization. Sequence-tagged sites (STSs) D10S221, D10S190, D10S542, and D10S209 obtained from the literature (Gyapay et al., 1994; Weissenbach et al., 1992) were used to recover YACs from the Mega YAC library (Cohen et al., 1993) at the YAC Screening Center (S. Raffaele, Milan). Further YAC selection was done with STSs produced from YAC insert-ends described below by screening pooled Centre d’Etude de Polymorphismes Humaines (CEPH) Mega YAC and ICI libraries by STS PCR analysis (Green et al., 1991). YAC sizes, if not available in the literature, were estimated by pulsed-field gel electrophoresis of YAC DNA embedded in agarose plugs as described in Nagaraja et al. (1994). YACs comigrating with natural yeast chromosomes were sized by Southern blotting pulsed-field gels and hybridizing them to a human DNA probe. Contig construction and verification of YAC overlaps. Contig confirmation was done by L1 fingerprinting analysis as described by Porta et al. (1993). YAC DNA from individual clones was isolated, digested, electrophoresed, and blotted as described in Zucchi and Schlessinger (1992). Probe DNA (50 ng) was labeled with [a-32P]dCTP by random
345
AID
GENO 4664
/
6r2f$$$241
03-29-97 03:10:14
0888-7543/97 $25.00 Copyright q 1997 by Academic Press All rights of reproduction in any form reserved.
gnma
FIG. 1. 5-Mb YAC contig containing the D10S221 – D10S209 region of loss of heterozygosity in glioblastoma multiforme. Twenty YACs are present in the contig, and their size and origin are described in Table 1. The larger type indicates new STSs, while ESTs are in italic. YAC names are written normally when they are derived from the Mega YAC library from CEPH, while they are in italic when derived from the ICI library. The figure summarizes the results of PCR amplifications of STSs presented in Table 2.
346
AID
ALBAROSA ET AL.
GENO 4664
/
6r2f$$4664
03-29-97 03:10:14
gnma
347
A YAC CONTIG ON 10q25 RELEVANT IN BRAIN TUMORS
YAC contig. The STSs were derived from ligation-mediated PCR products from the YAC-specific fragments at the left or right ends. YAC-end specific fragments were obtained by digestion of YAC DNA with the frequent cutter enzymes AluI, RsaI, and HaeIII; linker ligation; and nested PCR amplification as described by Kere et al. (1992). Sequences derived from the corresponding right and left ends of the YACs were analyzed for homology to common repetitive elements by FASTA and BLAST (website http://www.ebi.ac.uk/). Primer selection for STS PCR analysis was done by Primer Designer (Version 1.01; Scientific and Educational Software). Primer pairs were verified to be chromosome-specific by PCR on DNA from a human–hamster hybrid cell line containing only human chromosome 10 (a gift of Mariano Rocchi, University of Bari, Italy). PCR fragments generated from the end of each YAC insert were sequenced by an Applied Biosystem Model 373A DNA sequencer, using protocols suggested by the manufacturer.
TABLE 1 YACs in the Contig Clone name
YAC size (kb)
Library
694D9 706C2 754F12 776F6 830C2 858H7 880C3 909D12 909F2 926A4 937A6 988H4 5DC10 15GD3 19GA7 19GB2 25DB2 26FB8 27GF4 37AD11
1190 920 1750 1180 850 1740 440 650 160 1680 1490 Not tested 420 280 450 150 450 250 250 360
CEPH CEPH CEPH CEPH CEPH CEPH CEPH CEPH CEPH CEPH CEPH CEPH ICI ICI ICI ICI ICI ICI ICI ICI
cDNA selection. Direct cDNA selection was performed as described by Lovett (1994). Genomic DNA was from YAC clones 5DC10 and 880C3, and cDNA was prepared from a human brain cDNA library in lgt 10 (Human Brain 5*-Stretch Plus; Clontech). Primaryand secondary-selected cDNAs were cloned in pCR II (TA cloning kit; Invitrogen) and sequences were analyzed for homologies by FASTA and BLAST. cDNAs not homologous to ribosomal or repetitive sequences were validated by PCR amplification on human and yeast genomic DNA and on DNA of YACs 5DC10 and 880C3.
priming (Rediprime DNA labeling system; Amersham). Hybridization and washing conditions are as reported (ibidem). Internal Alu–Alu PCR products generated from each YAC (Nelson et al., 1989) were used as repeat-free hybridization probes on a gridded YAC panel to confirm walking steps. YAC insert end isolation and generation of new STS. Eleven new STSs were produced, characterized, and mapped to construct the
Analysis of the MON1 polymorphism. Human genomic DNA, extracted from lymphocytes by cell lysis with guanidine thiocyanate (IsoQuick; MicroProbe), was amplified by primers FP1, GCACCATGTATGCCCTGT, and RP1, GGCTATTTATATTGGTCAGAAG (annealing temperature 527C). Labeling of PCR products was performed by fluorescent dUTP, as suggested by the manufacturers (Applied Biosystems, Perkin Elmer). The samples were run on a 6% polyacrylamide gel (19:1) with 50% urea, 11 TBE, at 20 W, for 9 h, and results were analyzed by the Applied Biosystem Sequencer 672 GeneScan software.
TABLE 2 STSs in the Contig No.
Locus
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26
926A4-L WI-4504 CHLC.GATA71C09 SHGC-5828 D10S221 WI-3716 WI-15012 D10S1693 D10S421 CHLC.GATA5A02 D10S1236 IB-3064 WI-8038 D10S610 SGC-35089 WI-15787 D10S190 MON-1 694D9-L D10S503 858H7-L WI-14638 SHGC-5523 WI-17887 NIB-1107 D10S1785
a
Genbank ID U75537 G04646 G08809 G17433 Z17129 G04397 H27764 Z52960 GDB:136744a G08796 G08792 T16057 T40903 G08796 H78573 R32301 Z16509 U75536 U64663 GDB:139667a U75534 R60031 G08796 R92206
EST ID
EST288311
EST EST91707 EST380872 EST202346
EST236786 EST333001
Z51828
No.
Locus
Genbank ID
27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52
D10S542 776F6-L SHGC-13633 WI-5255 D10S1792 AFM-338ZC9 D10S230E D10S2386 26FB8-L 880C3-R 988H4-L 15GD3-L 37AD11-L 25DB2-R 27GF4-L 754F12-L D10S209 SGC-35172 CHLC.ATA29CO3 706C2-L 988H4-R D10S281 D10S294 WI-16392 D10S2158 D10S2322
Z23314 U64664 G17525 G04834 Z51964 Z67078 GDB:133873a G13884 U64665 U64666 U64673 U64667 U64668 U64669 U64670 U64671 Z16807 H83701 G08777 U64672 U75535 GDB:135535a GDB:135548a H88483 G11394 G08765
The Genome Database ID.
AID
GENO 4664
/
6r2f$$$242
03-29-97 03:10:14
gnma
EST ID
EST386001
EST390792
348
ALBAROSA ET AL.
FIG. 2. Fingerprinting analysis of YACs relevant for the closure of the gap between markers D10S542 and D10S209. DNA from YACs indicated on top was digested by TaqI and hybridized to a LINE probe (see Materials and Methods). Overlapping YACs are indicated at the bottom, and bands relevant for the fingerprinting are indicated by arrows on the left.
RESULTS AND DISCUSSION
To initiate map assembly, 12 YAC clones containing STS markers D10S221, D10S190, D10S542, and D10S209 were recovered from the CEPH Mega YAC library. Eight of the 12 clones were found to be chimeric. Further analysis determined that YAC 858H7 contained the STSs D10S221 and D10S190, YACs 694D9 and 880C3 contained D10S542, and YACs 937A6 and 754F12 contained D10S209. Overlaps were confirmed by fingerprinting analysis. Fingerprinting data and PCR analysis of STSs on YACs confirmed that D10S221 is centromeric to D10S190 (Weissenbach et al., 1992) and demonstrated that D10S542 is telomeric to D10S190. To close the physical map we screened for additional clones with STSs from right (R) and left (L) ends of relevant YACs. First, we generated an insert-end STS for the left end of YAC 694D9 (Fig. 1). PCR amplification of the STS 694D9-L on YAC 858H7, containing markers D10S221 and D10S190, indicated that the left end of YAC 694D9 is oriented toward the centromere. To walk toward the telomere, the right-end of YAC 694D9 was not useful, since it contained an orphan repetitive sequence. Instead, to close the gap between YACs 694D9/880C3 and 754F12, we used end-clone STSs from YACs 880C3 and 754F12. These YACs, as mentioned above, contained markers D10S542 and D10S209, respectively. Both ends of YAC 880C3 were determined, and the right end was used for screening. Clones 909F2, 909D12, 26FB8, 15GD3, and 776F6 were identified by the 880C3-R STS. For YAC 754F12
AID
GENO 4664
/
6r2f$$$242
03-29-97 03:10:14
only the left end was recovered, and it detected clones 27GF4, 706C2, and 25DB2. Identification of the left end of YAC 27GF4 was critical to close the contig. This end, in fact, could be amplified in YAC 776F6, also selected by the right end of YAC 880C3 (Fig. 1). Other YACs selected by 27GF4L were 19GA7, 19GB2, 37AD11, and 693B5. This latter YAC, not shown in Fig. 1, was chimeric (the right end corresponds to EST AC H55649, mapping to chromosome 22) and contained only a small portion of chromosome 10 DNA. YACs that are part of the contig are indicated in Table 1. An overview of their relevant overlaps, detected by fingerprinting analysis, is shown in Fig. 2. Other confirmations of the closure of the contig came from the amplification of the left end of 15GD3 on YACs 19GA7 and 19GB2 and the amplification of the right end of 25DB2 on YACs 776F6 and 909D12. Furthermore, YAC 988H4, obtained by a subsequent search of the database with marker D10S209, contained STS D10S209 and 15GD3-L. The left end of 988H4 could also be amplified on YACs 909D12, 26FB8, 776F6, and 15GD3. The map was refined with additional STSs (776F6-L, 26FB8-L, 37AD11-L, 706C2-L, 858H7-L, 926A4-L, and 988H4-R) and by testing all YACs for microsatellites D10S421, D10S610, D10S503, D10S230E, D10S281, and D10S294 (Moschonas et al., 1996). The order of the markers and extent of the contig were thus confirmed. DNA sequences of the new STSs have been deposited in GenBank with Accession Nos. U64663–U64673 and U75534–U75537. A further round of database searches was performed to increase the density of STSs: 50 primer pairs were tested by PCR for their presence in the YAC contig and 27 scored positive. Their reciprocal order, however, could not be always determined. Furthermore, one new EST of 1367 bp (mon1) was identified by cDNA selection on YAC 5DC10 and amplified also on 858H7, 830C2, and 926A4. Sequence analysis revealed 11 TCCA repeats at position 385 (mon1P1) and 11 GA repeats at position 462 (mon1P2). Analysis of the mon1P2 repeat on DNA from 48 individuals showed the presence of three alleles with a frequency of heterozygosity of only 4.2%. On the contrary, mon1P1, when analyzed in 68 individuals, showed a frequency of heterozygosity of 57.3% in the presence of four alleles. Allele A (11 repeats) was present in 56.6% of the cases, allele B (9 repeats) in 20.6%, allele C (12 repeats) in 16.9%, and allele D (10 repeats) in 5.9%. A list of all the STSs of the contig, including 9 ESTs, is given in Table 2 with the corresponding accession number. Fingerprinting analysis suggests that YAC 776F6 contains YAC 880C3, but both PCR and Southern analysis show that D10S542 is present on YAC 880C3 but not on 776F6. However, the results of PCR analysis, also performed on the STSs obtained from database, suggest that YAC 880C3 is not fully contained in YAC 776F6 and presents a small deletion corresponding to the left end of 776F6. This deletion is probably causing
gnma
A YAC CONTIG ON 10q25 RELEVANT IN BRAIN TUMORS
the lack of amplification of STSs SHGC-13633, WI5255, D10S1792, and AFM338ZC9, which, on the contrary, are amplified on YAC 776F6. A further small deletion could be present on YAC 19GB2. It is suggested by the data that 19GB2 contains STSs 15GD3L and 25DB2R and should amplify STS 37AD11L, which lies between them (Fig. 1), but neither PCR nor Southern blot analysis confirmed the presence of this STS on YAC 19GB2. Thus, it is possible that a small deletion corresponding to STS 37AD11L causes the absence of this STS in the YAC. In conclusion, we have assembled a YAC contig spanning a 5-Mb region flanked by markers D10S221 and D10S209. The 20 YACs bridge the gap between contigs 082 and 085 of Moschonas et al. (1996) and WC10.13– WC10.15, presented in the website http://wwwgenome.wi.mit.edu/cgi-bin/contig/sts_by_chrom. Fifteen new STSs and another 37 from database (9 ESTs and 17 known microsatellites) fall in this region, providing an average density of 1 STS/100 kb. Since no apparent candidate tumor-suppressor gene has yet been reported in this interval, we have started to search for new genes in the region using CpG island and cDNA selection methods. ACKNOWLEDGMENTS We acknowledge the collaboration of Cinzia Sala and Daniela Toniolo (YAC Screening Center, DIBIT–Ospedale S. Raffaele, Milano), for the isolation of several YACs described in this paper; David Schlessinger, for the careful revision of the manuscript; and the personnel of the Department of Neuromuscular disorders for help in oligonucleotide synthesis. This is paper No. 5 of the Genome 2000/ ITBA project funded by Cariplo. This work has been supported by a grant from the Associazione Italiana per la Ricerca sul Cancro to G.F. and is dedicated to the memory of Monica Piano, a young patient who recently succumbed to glioblastoma multiforme.
REFERENCES Albarosa, R., Colombo, B. M., Roz, L., Magnani, I., Pollo, B., Cirenei, N., Giani, C., Fuhrman Conti, A. M., DiDonato, S., and Finocchiaro, G. (1996). Deletion mapping of gliomas suggests the presence of two small regions for candidate tumor suppressor genes in a 17 cM interval on chromosome 10q. Am. J. Hum. Genet. 58: 1260– 1267. Cohen, D., Chumakov, I., and Weissenbach, J. (1993). A first-generation physical map of the human genome. Nature 366: 698–701. Green, E. D., Mohr, R. M., Idol, J. R., Jones, M., Buckingham, J. M., Deaven, L. L., Moyzis, R. K., and Olson, M. V. (1991). Systematic generation of sequence-tagged sites for physical mapping of human chromosomes: Application to the mapping of human chromosome 7 using yeast artificial chromosomes. Genomics 11: 548–564. Gyapay, G., Morissette, J., Vignal, A., Dib, C., Fizames, C., Millasseau, P., Marc, S., Bernardi, G., Lathrop, M., and Weissenbach, J. (1994). The 1993–94 Genethon human genetic linkage map. Nature Genet. 7: 246–339. Herbst, R. A., Weiss, J., Ehnis, A., Cavenee, W. K., and Arden, K. C.
AID
GENO 4664
/
6r2f$$$242
03-29-97 03:10:14
349
(1994). Loss of heterozygosity for 10q22–10qter in malignant melanoma progression. Cancer Res. 54: 3111–3114. Kere, J., Nagaraja, R., Mumm, S., Ciccodicola, A., D’Urso, M., and Schlessinger, D. (1992). Mapping human chromosomes by walking with sequence-tagged sites from end-fragments of yeast artificial chromosomes inserts. Genomics 14: 241–248. Lang, F. F., Miller, D. C., Koslow, M., and Newcomb, E. W. (1994). Pathways leading to glioblastoma multiforme: A molecular analysis of genetic alterations in 65 astrocytic tumors. J. Neurosurg. 81: 427–436. Lovett, M. (1994). Direct selection of cDNAs using genomic contigs. In ‘‘Current Protocols in Human Genetics,’’ unit 6.3. Magnani, I., Guarneri, S., Pollo, B., Cirenei, N., Colombo, B. M., Broggi, G., Galli, C., Bugiani, O., DiDonato, S., Finocchiaro, G., and Fuhrman Conti, A. M. (1994). Increasing complexity of the karyotype in 50 human gliomas: Progressive evolution and de novo occurrence of cytogenetic alterations. Cancer Genet. Cytogenet. 75: 77–89. Morita, R., Saito, S., Ishikawa, J., Ogawa, O., Yoshida, O., Yamakawa, K., and Nakamura, Y. (1991). Common regions of deletion on chromosomes 5q, 6q and 10q in renal cell carcinoma. Cancer Res. 51: 5817–5820. Moschonas, N. K., Spurr, N. K., and Mao, J. (1996). Report of the First International Workshop on Human Chromosome 10 Mapping 1995. Cytogenet. Cell Genet. 72: 99–112. Nagaraja, R., Kere, J., MacMillan, S., Masisi, M. W. J., Johnson, D., Halley, G., Molini, B. A., Wein, K., Trusgnich, M., Ebel, B., Browstein, B. H., Railey, B., and Schlessinger, D. (1994). Characterization of four human YAC libraries for clone size, chimerism, and X chromosome sequence representation. Nucleic Acids Res. 22: 3406–3411. Nelson, D. L., Ledbetter, S. A., Corbo, L., Victoria, M. F., RamirezSolis, R., Webster, T. D., Ledbetter, D. H., and Caskey, C. T. (1989). Alu polymerase chain reaction: A method for rapid isolation of human-specific sequence from complex DNA sources. Proc. Natl. Acad. Sci. USA 86: 6686–6690. Peiffer, S. L., Herzog, T. J., Tribune, D. J., Mutch, D. G., Gersell, D. J., and Goodefellow, P. J. (1995). Allelic loss of sequences from the long arm of chromosome 10 and replication errors in endometrial cancers. Cancer Res. 55: 1922–1926. Porta, G., Zucchi, I., Hillier, L., Green, P., Nowotny, V., D’Urso, M., and Schlessinger, D. (1993). Alu and L1 sequence distribution in Xq24–q28, and their comparative utility in YAC contig assembly and verification. Genomics 16: 417–425. Rasheed, B. K., McLendon, R. E., Friedman, H. S., Friedman, A. H., Fuchs, H. E., Bigner, D. D., and Bigner, S. H. (1995). Chromosome 10 deletion mapping in human gliomas: A common deletion region in 10q25. Oncogene 10: 2243–2245. Rempel, S. A., Schwechheimer, K., Davis, R. L., Cavenee, W. K., and Rosenblum, M. L. (1993). Loss of heterozygosity for loci on chromosome 10 is associated with morphologically malignant meningioma progression. Cancer Res. 53: 2386–2392. Speaks, S. L., Sanger, W. G., Masih, A. S., Harrington, D. S., Hess, M., and Armitage, J. O. (1992). Recurrent abnormalities of chromosome bands 10q23–25 in non-Hodgkin’s lymphoma. Genes Chromosomes Cancer 5: 239–243. Weissenbach, J., Gyapay, G., Dib, C., Vignal, A., Morissette, J., Millasseau, P., Vaysseix, G., and Lathrop, M. (1992). A second-generation linkage map of the human genome. Nature 359: 794–801. Zucchi, I., and Schlessinger, D. (1992). Distribution of moderately repetitive sequences pTR5 and LF1 in Xq24–q28 human DNA and their use in assembling YAC contigs. Genomics 12: 264–275.
gnma