- Email: [email protected]
A YAC Contig Encompassing the XRCC5 (Ku80) DNA Repair Gene and Complementation of Defective Cells by YAC Protoplast Fusion
GENOMICS
30, 320–328 (1995)
A YAC Contig Encompassing the XRCC5 (Ku80) DNA Repair Gene and Complementation of Defective Cells by YAC Protoplast Fusion TRACY BLUNT,* GUILLERMO E. TACCIOLI,† ANNE PRIESTLEY,* MAJID HAFEZPARAST,*,1 TREVOR MCMILLAN,*,2 JING LIU,‡ CHARLOTTE C. COLE,§ JACQUELINE WHITE,Ø FREDERICK W. ALT,† STEPHEN P. JACKSON,\ ERWIN SCHURR,‡ ALAN R. LEHMANN,* AND PENNY A. JEGGO*,3 *MRC Cell Mutation Unit, University of Sussex, Brighton BN1 9RR, United Kingdom; and †Howard Hughes Medical Institute, The Childrens Hospital and Department of Genetics and Center for Blood Research, Harvard University Medical School, Boston, Massachusetts 02115; ‡McGill Centre for the Study of Host Resistance, Montreal General Hospital Research Institute, 1650 Cedar Avenue, Montreal H3G1A4, Quebec, Canada; §The Sanger Centre, Hinxton Hall, Hinxton, Cambridge CB10 1RQ, United Kingdom; ØDepartment of Medicine, Level 5, Addenbrooks Hospital, Cambridge CB2 2QQ, United Kingdom; and \Wellcome CRC Institute, Tennis Court Road, Cambridge CB2 1QR, United Kingdom Received May 18, 1995; accepted September 11, 1995
The Chinese hamster ovary xrs mutants are sensitive to ionizing radiation, defective in DNA double-strand break rejoining, and unable to carry out V(D)J recombination effectively. Recently, the gene defective in these mutants, XRCC5, has been shown to encode Ku80, a component of the Ku protein and DNA-dependent protein kinase. We present here a YAC contig involving 25 YACs mapping to the region 2q33–q34, which encompasses the XRCC5 gene. Eight new markers for this region of chromosome 2 are identified. YACs encoding the Ku80 gene were transferred to xrs cells by protoplast fusion, and complementation of all the defective phenotypes has been obtained with two YACs. We discuss the advantages and disadvantages of this approach as a strategy for cloning human genes complementing defective rodent cell lines. q 1995 Academic Press, Inc.
INTRODUCTION
The use of several different approaches for the cloning of the genes involved in DNA repair may be necessary to obtain the entire spectrum of such genes. One approach is the use of cloned genes from lower organisms for the isolation of mammalian homologues, using techniques of degenerate PCR and Southern hybridization (Morita et al., 1993; Shinohara et al., 1993; Muris et al., 1994; Murray et al., 1994). A second approach is the use of mammalian cell mutants that exhibit sensitivities to DNA-damaging agents, including UV radiation, ionizing radiation, cross-linking agents, and alkylating agents (Collins, 1993). 1 Current address: Institute of Urology and Nephrology, University College, 67 Riding House Street, London W1P 7PN, UK. 2 Current address: Institute of Cancer Research, Cotswold Road, Belmont, Sutton, Surrey SM2 5NG, UK. 3 To whom correspondence should be addressed.
0888-7543/95 $12.00 Copyright q 1995 by Academic Press, Inc. All rights of reproduction in any form reserved.
/ m4534$3756
10-26-95 00:13:02
One strategy that has proved successful for the isolation of mammalian DNA repair genes using such repair defective mutant strains involves the correction of their defective phenotype by DNA transfection using either human genomic DNA or cDNA libraries (Troelstra et al., 1990 and references therein; Legerski and Peterson, 1992; Jeggo et al., 1994). However, some mutant strains are unsuitable for this approach. The reasons for this are numerous but include the revertability of some of the mutant strains and insufficient sensitivity to any DNA-damaging agent to allow selection for complemented cells. The Chinese hamster ovary xrs mutants, which belong to ionizing radiation complementation group 5, are highly sensitive to ionizing radiation, have a defect in double-strand break (dsb) rejoining, and are defective in their ability to carry out V(D)J recombination (Kemp et al., 1984; Taccioli et al., 1993). These combined defects show that XRCC5, the gene defective in xrs cells, not only acts in a pathway for the repair of damage-induced DNA dsbs, but also is recruited to participate in the rejoining of site-specific dsbs introduced during V(D)J recombination, a developmental process enhancing immune diversity. The xrs cells have been particularly refractory to cloning by DNA transfection, probably due to their ability to revert both spontaneously and following azacytidine treatment (Jeggo and Holliday, 1986). As an alternative approach to clone the XRCC5 gene, we embarked on a positional cloning strategy that did not necessitate selection for radioresistance, merely the screening of otherwise selected clones for resistance or sensitivity to ionizing radiation. The steps involved in this strategy included the identification of a complementing human chromosome, the localization of the gene to a subchromosomal fragment in a hamster/human hybrid bearing less than 10 Mb human DNA, the isolation of YACs covering the human DNA present in
320
gnma
AP-Genomics
YAC CONTIG ENCOMPASSING XRCC5
the hybrid, the identification of a complementing YAC, and the cloning of a complementing gene from the YAC. The first step of this approach was achieved with the demonstration that human chromosome 2 could complement the radiosensitivity of xrs cells (Jeggo et al., 1992). Using the technique of irradiation fusion gene transter (IFGT), we constructed a panel of reduced hybrids, with some complementing and others not complementing the radiosensitivity of xrs cells, and hence regionally localized XRCC5 to 2q33–q35 (Hafezparast et al., 1993). Before achieving our next goal of obtaining a complementing YAC, this analysis alone enabled us to identify a candidate gene, Ku80, that also mapped to the region 2q33–q35 (Cai et al., 1994). Ku80 is a subunit of the Ku protein and has the property of binding to double-stranded DNA ends. Since the xrs cells had been reported to be lacking DNA end-binding activity, this made Ku80 an exciting candidate (Getts and Stamato, 1994; Rathmell and Chu, 1994). Subsequent analysis by us and others indeed identified Ku80 as the product of the XRCC5 gene, since Ku80 cDNA was able to complement the radiosensitivity of xrs cells (Smider et al., 1994; Taccioli et al., 1994). In this paper we present the characterization of a YAC contig encompassing the XRCC5 (Ku80) gene and describe our results on the transfer of these YACs to xrs-6 cells and the identification of two complementing YACs. The completion of a YAC contig in this region will facilitate the identification of neighboring genes and their organization. Our analysis of YAC fusion hybrids derived by protoplast fusion highlights some difficulties associated with this technique and is useful for evaluating this approach to gene cloning. MATERIALS AND METHODS Mammalian cell culture conditions. The hybrid XR-V15B/H22 D2 was obtained by fusion of irradiated microcell hybrids with xrs-6 cells as described previously (Hafezparast et al., 1993; Taccioli et al., 1994). All strains were routinely cultured in Gibco MEM supplemented with nonessential amino acids and 10% fetal calf serum. All other conditions were as described previously (Jeggo and Kemp, 1983). Estimation of g-ray sensitivity was as described previously (Hafezparast et al., 1993). YAC library screening using Alu-PCR products. The majority of Alu-PCR products used as probes were obtained using primers ALE1 and ALE34 together on hybrid D2-X-38 as described previously (Cole et al., 1991a,b). Two products, ST6 and ST30, were obtained using Alu primers TC-65 (Nelson et al., 1989). The cloning of Alu-PCR products and their use as hybridization probes for YAC library screening was followed as described previously, with minor modifications (Cole et al., 1992). The PCR products were cloned into a T vector derived from pGEM5fZ(/) (Kovalic et al., 1991). The Alu-PCR products were amplified from this vector using M13 forward and reverse primers, and the primer PDK1 (5*GAATTGGGCCCGACGTCGCATGCTC3*) located close to the cloning site was used for labeling of probes by linear PCR amplification as described previously (Cole et al., 1992). Additionally, primers Alu S/J and Alu 263-282.12 were used to generate the Alu-PCR products from YAC clones and to screen pools of YAC-derived inter-Alu fragments as described previously (Liu et al., 1995). To examine whether the Alu-PCR products derived from D2-X-38 originated from the region 2q33–q35, AluPCR amplification using primers ALE1 and ALE34 was carried out
/ m4534$3756
10-26-95 00:13:02
gnma
321
on a panel of radiation-reduced hybrids (which had been previously constructed in our laboratory), including D2-X-38 and the hamster parent xrs-6. One microliter of amplification product was loaded onto 0.8% agarose gels, and the products were separated by gel electrophoresis. These products were transferred to nylon filters and subjected to hybridization using a single, cloned Alu-PCR product as a probe. Products hybridizing to complementing hybrids containing the region 2q33–q35 were used as probes. To examine the overlap between YACs, the panel of YACs was amplified by Alu-PCR, and the products were separated by gel electrophoresis as above, transferred to nylon filters, and used in Southern hybridization. The probe was either a single, cloned Alu-PCR product from a specific YAC or the entire pool of Alu-PCR products from the YAC. Cross-hybridization to other YACs was clearly distinguished from background hybridization to nonoverlapping YACs. All these experiments required extensive competing with COT-1 DNA as described previously (Cole et al., 1992). Markers used for YAC mapping. PCR primers used in this analysis included S25, 5*CCCTGGTGGAGTAGGCCTCTAG3* and 5*TCCTTGACAACTTCCTCCCACC3*; ST6, 5*CTATCTATTCGCCCCCTTGTGGT3* and 5*TCTTGAACTCCTGAGCTCAAGTG3*; and ST30, 5*ACTGTGTTGCTATTGTTGTCTAG3* and 5*GTCACTCACATGTAATCCTAGCC3*. Other primers used to amplify the 3 *UTR region of the Ku80 gene, TNP, villin, and FN and all PCR conditions were as described previously (Taccioli et al., 1994; Jeggo et al., 1993; Hafezparast et al., 1993). Alu-PCR products used as probes for Southern hybridization were obtained as described above. The end of YAC ICRFy 900D0120 (S25) was obtained by the vectorette method as described previously (Riley et al., 1990), and vector–Alu PCR was used to obtain the end of YAC 807_f_1(AV 807_f_1) using Alu primer ALE34 and primer 1089 for the pYAC4 vector arm (Nelson et al., 1989; Riley et al., 1990; Cole et al., 1991a,b). YAC library screening. Four YAC libraries were screened; the ICRF libraries, kindly supplied by Dr. H. Lehrach, were a human 4X and 4Y library (Larin et al., 1991; and M. Ross, unpublished), the first generation Ceph (Centre d’Etude de Polymorphisme Humaine) Mark 1 YAC library (Albertsen et al., 1990), and the original Washington University YAC library (Burke et al., 1987). Additional mega YACs were supplied by Dr. LePaslier (Ge´ne´thon). YAC growth conditions, retrofitting, and pulse-field gel analysis. Yeast cultures containing YACs were grown according to Green and Olson in SD medium containing adenine, tryptophan, and tyrosine but lacking uracil. The dominant selectable marker, the neoR gene, was introduced into YACs by a retrofitting technique as described (Markie et al., 1993), and retrofitted YACs were grown in medium containing uracil, tryptophan, and tyrosine but lacking adenine. The sizes of YACs were estimated before and after retrofitting by pulsefield gel electrophoresis (PFGE) using a Waltzer Apparatus (Southern et al., 1987). Transfer of YACs to mammalian cells by protoplast fusion. Yeast cells containing retrofitted YACs at a density of 1 1 107 cells/ml were pelleted, washed first in ddH2O, then in 1 M sorbitol, and resuspended in 20 ml SCE (1 M sorbitol; 0.1 M sodium citrate; 10 mM EDTA, pH 5.8). Thirty-two micromolar b-mercaptoethanol and 800 units of lyticase were added, and the cells were incubated at 307C until 75% had formed spheroplasts. The cells were gently resuspended in 1 M sorbitol, pelleted again, and resuspended in 20 ml STC (1 M sorbitol; 10 mM CaCl2 ; 10 mM Tris, pH 7.5) to a concentration of 1 1 108/ml. The spheroplasts were maintained at 187C while the mammalian cells were trypsinized, washed in serum-free (SF) medium, and resuspended at 1.5 1 106/ml. Mammalian cells were gently layered onto the spheroplasts, pelleted, and resuspended in 50 ml SF medium. Five hundred microliters of PEG solution (PEG 1500; Boehringer; 50% in 75 mM Hepes; 5 mM CaCl2 ; 50 mM b-mercaptoethanol) was added and after a 2-min incubation, SF medium was slowly added, and the cells were left for 10 min. After gentle pelleting, cells were resuspended in growth medium and incubated at 377C. G418 (GIBCO) (800 mg/ml) was added after 48 h. Individual G418R clones were subcloned after 7–10 days incubation and maintained in 600 mg/ml G418.
AP-Genomics
322
BLUNT ET AL.
Southern hybridization of YAC fusion hybrids. Southern hybridization was carried out using standard protocols. The probe for Ku80 contained the ORF and was derived from Ku80 cDNA (kindly supplied by W. Reeves) by PCR and radiolabeled by random priming.
of human DNA present in the hybrid D2-X-38. Pools of Alu-PCR products from D2-X-38 were cloned and used in pools of 4–10 as hybridization probes. Probes were radiolabeled by linear PCR amplification and preassociated with excess Cot-1 DNA to compete out repetitive sequences as described previously (Cole et al., 1992). To optimize the information gained from each library screening, the size of each cloned Alu-PCR product was estimated by gel electrophoresis, and only Alu-PCR products of different sizes were utilized as probes. A second procedure was also used to eliminate redundant probes. AluPCR amplification was carried out on the hybrid D2-X38, control xrs-6 cells, and other hybrids containing small amounts of human DNA both complementing and not complementing the xrs defect. These Alu-PCR products were separated by gel electrophoresis and transferred to filters for Southern hybridization. Each candidate cloned Alu-PCR product was used as a probe against such filters, and only those probes giving strong signals specifically with complementing hybrids were utilized. This avoided the use as a probe of occasional Alu-PCR products that did not appear to map back to the human DNA present in the D2-X-38 hybrid, as well as any products that did not contain unique DNA sequences. This technique produced rapid and reliable results, since the multiple copies of each Alu-PCR product on the filter gave strong hybridization signals. Additionally, the technique provided a source of markers for subsequent mapping of the YACs obtained (e.g., markers prefixed by AP in Table 2 (see below). Most YACs (see below for the exceptions) isolated from the ICRF libraries were obtained using these AluPCR clones as hybridization probes. Further YACs were also obtained by a number of additional approaches. YACs ICRFy900D0120,ICRFy900B0280,ICRFy900C02127, and ICRFy901C065 were obtained by screening the ICRF libraries with TNP-1 (White et al., 1994). YACs 700-_c_12, 678_e_1, 807_f_1, 817_b_12, 929_b_6, and 929_f_9 were obtained from the Ceph Mega YAC library since they contained the microsatellite markers D2S164,
RESULTS
Generation of a Complementing Hybrid Containing Less Than 5 Mb Human DNA To isolate region-specific YACs, we utilized a technique designed and tested previously by one of us (Cole et al., 1992) that necessitated the construction of a hamster–human hybrid bearing a single fragment of human DNA less than 10–15 Mb. We have previously described the construction of a hamster–human hybrid (D2-X-38) bearing a single fragment of human DNA that complemented the radiosensitivity and V(D)J recombination defects of xrs-6 cells (Taccioli et al., 1994). In Table 1, we outline the derivation of this hybrid and identify additional microsatellite markers linked to the XRCC5 gene. Human linkage analysis has indicated that the flanking markers fibronectin and villin are less than 10 Mb apart, suggesting that D2-X-38, which does not carry either flanking marker, contains less than 10 Mb human DNA. These data were supported by analysis using a PCR-based technique described previously (Cole et al., 1991a,b), by which we estimated that D2-X-38 contained around 3 Mb human DNA. On the basis of these observations, D2-X-38 was chosen as a suitable hybrid for the next stage of our cloning strategy, namely the isolation of region-specific markers for YAC library screening. Identification of YACs from the Region of Human DNA Present in the Hybrid D2-X-38 To generate probes for YAC library hybridization screening, we utilized a procedure (Cole et al., 1992) whereby Alu element-mediated PCR (Alu-PCR) (Nelson et al., 1989) is used to generate markers from the region
TABLE 1 Derivation of Hybrid D2-X-38 from Hybrid XR-V15B/H22 D2 Markers D2S164
D2S301
TNP-1
Hybrid
GNT1 2q36
villin 2q35
XR-V15B/H22 D2
/
0
/
/
/
D2-X-3 D2-X-5 D2-X-38 D2-X-7
/ / 0 0
0 0 0 0
/ 0 / 0
/ 0 / 0
/ 0 / 0
DS137 FN 2q33
g-Ray sensitivity
/
0
R
/ 0 / 0
0 0 0 0
R S R S
2q33–35
Note. XR-V15B/H22 D2 is a complementing hybrid, as described previously (Jeggo et al., 1993; Taccioli et al., 1994). Twenty-one subclones derived from this hybrid were analyzed and could be characterized into the four types represented by D2-X-3, D2-X-5, D2-X-38, and D2-X7, indicating the presence of two independently segregating fragments. Villin and FN (fibronectin) are markers flanking the TNP-1 locus. D2S137, D2S164, and D2S301 are microsatellite markers identified by Ge´ne´thon as mapping to this region of chromosome 2. D2S137 is identical to the previously described marker D2S211 (Hafezparast et al., 1994; Barber et al., 1993).
/ m4534$3756
10-26-95 00:13:02
gnma
AP-Genomics
323
YAC CONTIG ENCOMPASSING XRCC5
TABLE 2 YAC Contig Encompassing XRCC5 Markers
Size (kb)
YAC name Hybrid D2X38 ICRFy900B0280 ICRFy900C02127 ICRFy901C065a ICRFy900D0120 CEPH 678_e_1 CEPH 817_b_12 CEPH 807_f_1 CEPH 929_b_6 ICRFy900E0952 CEPH 929_f_9 CEPH 225_b-5 CEPH 11_c_9 CEPH 372_d_5 CEPH 4_b_11 CEPH 55_c_9 CEPH55_d_10 CEPH 265_d_11 CEPH 321_a_2 ICRFy905C112 ICRFy900B0465a ICRFy900D0525 CEPH 229_h_7 CEPH 254_g_4 CEPH 700_c_12 CEPH 206_f_11
650 500 800 450 730 950 1050 330 1300
AP 14
D2S 164
D2S 301
S TNP
S 25
AP A5
AP B10
S T6
AV 807 _f_1
Alu 900_ E0952
S Ku80
H Ku80
AP B12
S T30
D2S 137
AP 53
S FN
0
/
/
/
/
/
/
/
/
/
/
/
/
/
/
/
0
/ / 0 0 / / 0 0
/ / 0 0 / / / / 0 0
/ / 0 / / / / / 0 0
/ / / / / / / / 0 /
0 0 0 / / / / / 0 0
0 0 0 0 0 0 / / 0 /
0 0 0 0 0 0 / / 0 /
0 0
0 0
0 0
0 0 0 0 0 0 / / / / 0 0 0 0 0 0 0 0 0 0 0 0
0 0
0 0
0 0
0 0 0 0 0 / 0 / 0 0 / / / / / 0 / / / 0 0
0 0 0 0 0 0 0 0 0 / 0 / 0 0 / / / / / 0 / / / / 0
0 / 0 / 0 0 0 0 0 / / 0 / 0 / / 0
0 0 0 0 0 0 0 0 0 / 0 0 0 0 0 0 0 0 0 0 0 0 0 0 /
0
480 500 880
580
0 450
0 0
/ / / / / 0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0 / / / / / / 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 / / / / / / / / 0 0 0 0 0
0 0 / / / / / / / / / / /
0 0 0
0 0
0 0 0 0 0 / / / / / / / / / / / 0 0 0 0 0
Note. Markers prefixed with AP were derived by Alu-PCR; AV807_f_1 represented the YAC end obtained by Alu–vector-PCR; HKu80 represented Ku80 cDNA. Alu 900E952 was as described in the text. All the above markers were analyzed by Southern hybridization. Markers prefixed S were analyzed by PCR using primers described in the text. YAC sizes were as given by the CEPH database or as estimated in this study by PFGE. a YACs identified as being chimeric, although the lack of chimerism has not necessarily been verified in the unmarked YACs.
D2S301, or D2S137, which were present in D2-X-38. YACs 321_a_2, 265_d_11, 229_h_7, and 206_f_11 were isolated as part of a chromosome 2 sublibrary, as described elsewhere (Liu et al., 1995), and found to be part of a contig overlapping the FN locus. YACs 372_d_5 and 225_b_5 were obtained by hybridization screening of the CEPH Mark 1 library using an inter-Alu segment probe derived from YAC 905C112. Construction of a YAC Contig Encompassing the XRCC5 Gene To order the YACs into a contig, a range of markers were utilized, including TNP-1 and the three Ceph microsatellite markers (D2S301, 164, and 137) that mapped to this region of chromosome 2. The contig constructed is shown in Table 2. Markers prefixed AP (Alu-PCR products) were derived by Alu-PCR amplification from the hybrid D2-X-38 or from one of the YACs as outlined above. The presence of these latter markers in the YACs was examined by using the markers as probes for Southern hybridization to filters containing gel-separated Alu-
/ m4534$3756
10-26-95 00:13:02
gnma
PCR products derived from each YAC (see Materials and Methods). A few selected Alu-PCR products were sequenced, and primers were derived from nonrepetitive sequences. Markers prefixed S were examined by PCR amplification using these primers. Markers from the ends of certain YACs were also obtained by vectorette analysis (S 25) (Riley et al., 1990) or vector–Alu-PCR (AV807_f_1). Finally, to examine whether two YACs overlapped despite the absence of overlapping markers, pools of AluPCR products derived from two of the YACs were used to probe filters containing gel-separated Alu-PCR products derived from the other YACs (prefixed Alu in Table 2). In this way YAC 900EO952 was shown to overlap with YAC 11_c_9. Hybridization of Alu-PCR products to individual YACs or subsets of YAC libraries can cause false contig connection due to the presence of low-copy repeat sequences. To test for this possible error, a number of additional Alu-PCR probes were derived from YACs 807_f_1 and 929_f_9 and used to screen the CEPH Mark 1 library. This screen produced no evidence for low-copy repeats since only the expected YACs were detected, thus confirming the locus specificity of the Alu-PCR probes
AP-Genomics
324
BLUNT ET AL.
used in the contig analysis. Limited restriction analysis of some of the YACs by PFGE helped to establish the order of the markers from S14 to S25 (data not shown). YAC 929_f_9 appeared to contain an internal deletion, but this has not been verified by restriction analysis. The two flanking markers of the contig, AP 14 and FN, are not present in the hybrid D2-X-38, thus indicating that the entire region of human DNA present in the hybrid D2-X-38 is represented in the contig. Based on the size of the YACs, this region represents less than 3 Mb DNA, which is consistent with the estimated 4-cM genetic distance between the markers D2S164/D2S301 and D2S137 (Gyapay et al., 1994). Identification and Integrity of XRCC5 within the Contig While this work was in progress, we discovered that Ku80, an 80-kDa subunit of the heterodimeric Ku protein, was the product of the XRCC5 gene (Smider et al., 1994; Taccioli et al., 1994). We therefore PCR-screened additional libraries using primers from the 3*UTR region of the Ku80 gene and identified YACs 11_c_9, 55_c_9, 4_b_11, and 55_d_10 from the chromosome 2 sublibrary.
We examined these and the other YACs within our contig for the presence of the Ku80 gene both by PCR, using primers from the 3*UTR region of the gene, and by Southern hybridization, using Ku80 cDNA as a probe (Yaneva et al., 1989). Positive YACs identified by these two approaches are shown in Table 2, and hybridization analysis of some of the positive YACs is shown in Fig. 1A. First, these results verify that Ku80 is present within our YAC contig, but surprisingly, whereas the PCR analysis identified only 7 positive YACs, hybridization analysis identified 11 YACs containing Ku80 sequences. All the YACs missing the 3*UTR region also contained deletions identifiable by our hybridization analysis. Band X (Fig. 1A) was frequently missing in these YACs, suggesting that it may map to the 3* region of the gene. These data indicated that the Ku80 gene was frequently disrupted in these YACs but 929_f_9, 11_c_9, 55_c_9, 4_b_11, 225_b_5, 372_d_5, and 55_d_10 did appear to carry an intact gene. Complementation of the Defects of xrs Cells by Protoplast Fusion To examine whether any of these YACs could complement the defects identified in xrs cells, a dominant se-
FIG. 1. (a) Presence and integrity of the Ku80 gene in the YACs. One microgram of yeast DNA containing YACs was digested with HindIII, separated by gel electrophoresis, transferred to nylon filters, and hybridized using Ku80 cDNA as a probe. Eight of eleven positive YACs are shown. The three YACs not shown (4_b_11; 372_d_5; and 55_d_10) gave patterns identical to YACs 55_c_9; 11_c_9; 225_b_5; and 929_f_9. (b) Presence and integrity of the Ku80 gene in YAC fusion hybrids. Ten micrograms of DNA from hamster hybrids was subjected to Southern hybridization as described in a. Data are only shown for two hybrids containing YAC 929_f_9, two hybrids containing YAC 55_c_9, and one hybrid containing YAC 11_c_9. Hybrid 55_c_9-A gave a pattern similar to that of hybrids 929_f_9_H1 and H4, indicating the absence of human Ku80 sequences.
/ m4534$3756
10-26-95 00:13:02
gnma
AP-Genomics
325
YAC CONTIG ENCOMPASSING XRCC5
lectable marker (the agpt gene, which confers resistance to the antibiotic G418) was introduced using a retrofitting technique (Markie et al., 1993). Protoplasts prepared from yeast containing retrofitted YACs carrying the G418R marker were fused to xrs cells, YAC fusion hybrids were selected using G418, and individual clones were screened for radiosensitivity and for ability to carry out V(D)J recombination. Table 3 shows the YACs used in fusion experiments. Two YACs (11_c_9 and 55_c_9) yielded fusion hybrids that showed complementation for the radiosensitive phenotype (Fig. 2), and significantly both these YACs contained an intact Ku80 gene. Surprisingly, YAC 929_f_9, which also appeared to contain the Ku80 gene intact, yielded noncomplementing fusion hybrids. To examine the integrity of the Ku80 gene in these hybrids, DNA from them was analyzed by Southern hybridization using Ku80 cDNA as a probe (Fig. 1B). While the parent YAC 929_f_9 appeared to contain an intact Ku80 gene (Fig. 1A), this was clearly not transferred to any of the hybrids derived. Similarly, the noncomplementing hybrid derived from YAC 55_c_9 (hybrid A) also had no integrated Ku80 sequences (data not shown). In contrast, the Ku80 gene appeared to be intact in the four complementing fusion hybrids derived from YACs 11_c_9 and 55_c_9 (Fig. 1B). Other markers identified as being present in these parent YACs were also examined in the fusion hybrids (Table 4). The markers were also checked in the YACs pre- and postretrofitting, and surprisingly we discovered that one YAC (55_c_9) had lost the D2S137 and ST30 markers during or subsequent to the retrofitting procedure. Following retrofitting, all YACs were checked for size by PFGE, and no gross change in size was observed. These data also show that the four hybrids derived from YAC 929_f_9 were disrupted during protoplast fusion, and only markers from one end of the YAC were transferred. Extracts from the four complementing hybrids were also examined for the expression of human Ku80 protein by Western blotting. In all cases, material cross-reacting with Ku80 antibodies was detected, demonstrating the presence of human Ku80 protein (data not shown). One complementing (55_c_9-H1) and one noncomplementing hybrid (11_C_9-A) were also examined for complementation of the defect in V(D)J recombination. The compleTABLE 3 Radiation Resistance of YAC Fusion Hybrids YAC
g-rayR neoR hybrids
neoR hybrids
905C112 900E0952 900B0280 900D0120 900C02127 901C065 929_f_9 11_c_9 55_c_9
0 0 0 0 0 0 0 3 1
2 5 2 10 7 7 4 4 1
/ m4534$3756
10-26-95 00:13:02
gnma
menting hybrid regained the ability to carry out signal join formation, whereas the noncomplementing hybrid retained the characteristic defect of the xrs cells (data not shown). These results verify previous observations by us and others that the Ku80 gene can complement the defect in xrs cells (Smider et al., 1994; Taccioli et al., 1994). Additionally, the results show that the technique of protoplast fusion can be used to transfer a YAC to cultured cells and to obtain complementation of a DNA repair-defective phenotype. DISCUSSION
Using a hamster–human hybrid containing a single small fragment of human DNA, we have identified 25 YACs mapping to the region 2q33–q34. These YACs have been ordered into a contig encompassing the XRCC5 gene and eight new markers for this region of chromosome 2. Some of these YACs have been transferred to xrs-6 cells, which are defective in XRCC5, and complementation of the defective phenotypes has been observed with two YACs. An important observation from our results is that the XRCC5 gene was frequently disrupted, either in the isolated YAC or during the protoplast fusion procedure. We have also recently isolated YACs containing the DNA–PKCS gene, which interacts with the Ku protein to form the DNA–PK complex, and have obtained complementation of hamster V3 cells by the transfer of these DNA–PKCS YACs (Blunt et al., 1995). In this latter study, we also found evidence for disruption of the gene, both in the YAC and during transfer, and will therefore discuss these data in conjunction. In our present study, of 11 YACs containing Ku80 sequences, regions of the gene or 3*-flanking sequences were clearly absent in four of them. Similarly, from our examination of nine YACs containing DNA–PKCS , hybridization analysis using probes from the 3*, 5*, and middle region of the gene enabled us to identify obvious deletions in five of them. Our analyses do not enable us to determine a mechanism for the lack of integrity of the genes, although in two cases (YACs 35D, H8 and 35D, G12) the hybridization data suggested the presence of internal deletions within the DNA–PKCS gene. Internal deletions in YACs have been reported by others (Foote et al., 1992; Li et al., 1994). In the case of the Ku-80-containing YACs, all YACs missing the 3*UTR region were also lacking adjacent markers on one side of the YAC, suggesting, rather surprisingly, that the region of chromosome 2 DNA present in the YACs may terminate within the gene in all of these four YACs. Our data also indicate that disruption of the YAC can occur during the retrofitting procedure. We observed that about one-quarter of our retrofitted YACs incurred a change in size identifiable by PFGE compared to that of the unretrofitted parent YAC. These YACs were not used for protoplast fusion experiments. The loss of markers in the retrofitted YAC
AP-Genomics
326
BLUNT ET AL.
TABLE 4 Examination of YAC Fusion Hybrids for Markers by PCR g-Ray sensitivity YAC Ret YAC Hybrid Hybrid Hybrid Hybrid YAC Ret YAC Hybrid YAC Ret YAC Hybrid Hybrid Hybrid
929_f_9 929_f_9Ret 929_f_9-H1 929_f_9-H2 929_f_9-H3 929_f_9-H4 11_C_9 11_C_9Ret 11_C_9-H1 55_C_9 55_C_9Ret 55_C_9-A 55_C_9-B 55_C_9-D
S S S S
R
S R R
S TNP
S T6
Ku80 3*UTR
S T30
D2S 137
S FN
/ / / / / / 0 0 0 0 0 0 0 0
/ / / / / / 0 0 0 0 0 0 0 0
/ / 0 0 0 0 / / / / / 0 / /
/ / 0 0 0 0 / / 0 / 0 0 0 0
/ / 0 0 0 0 / / 0 / 0 0 0 0
/ / 0 0 0 0 0 0 0 0 0 0 0 0
Note. Ret YAC, retrofitted YAC.
55_c_9 was identified following PCR analysis, despite retaining a size similar to the parent YAC. In addition to the lack of integrity of the gene within the YACs, the gene itself or the YAC was also frequently disrupted during the procedure of transfer and integration into the mammalian cells, resulting in the complete absence of the gene in some cases or of specific hybridization bands in others. Indeed, in our combined studies, of 26 fusion hybrids generated and analyzed for their integrity, evidence for disruption of the YAC during the fusion process was observed in 16 of them. Some YACs gave a high probability of complementation (e.g., 3/4 hybrids derived from YAC 11_c_9 in the present study and 6/6 YACs derived from YAC 29F,C4 (147) in our previous study), whereas with other YACs an intact gene could not be detected in any of the fusion hybrids observed (e.g., 0/4 for both mega-YACs 929_f_9
FIG. 2. Survival of YAC fusion hybrids following exposure to gamma irradiation. j, CHO-K1; m, hybrid D2-X-38; l, xrs-6; h, YAC fusion hybrid 11_c_9-D; s, YAC fusion hybrid 11_c_9-A; n, YAC fusion hybrid 55_c_9-H1. Other complementing hybrids were similar to 11_c_9-D, and noncomplementing hybrids were similar to 11_c_9-A.
/ m4534$3756
10-26-95 00:13:02
gnma
and 943_g_4 (144)). The most likely explanation is that the closer the gene lies to the dominant selectable marker, the more likely it is to be found intact among the neoR clones. This has a greater likelihood of being the case for the smaller YACs compared to the mega YACs, and indeed we have been more successful in obtaining complementation with the smaller YACs. Despite these problems, our results support those of other studies showing that human DNA can be transferred to mammalian cells via YAC vectors and can result in expression of human genes and complementation of a defective phenotype (Pachnis et al., 1990; Gnirke et al., 1991; Huxley and Gnirke, 1991). In these previous studies involving complementation of a defective phenotype, selection was applied immediately for the complementing phenotype, so that noncomplementing fusion hybrids would have been eliminated and escaped detection. Our results here, in which expression of a functional gene was examined in YAC fusion hybrids selected using a marker on the YAC arm and subsequently screened for functionality of the human gene, show that the efficiency of transfer of an intact YAC is not high. Our data presented here represent two steps in a positional strategy for cloning genes using rodent cell lines defective for a screenable phenotype. Our results indicate that this is a feasible approach for cloning genes but indicate some potential difficulties. The technique of IFGT can be used to generate hybrids bearing sufficiently small fragments of human DNA to enable the isolation of region-specific markers using an Alu element-PCR technique. Recent advances in technology facilitate the construction of a YAC contig spanning the human DNA present in such a hybrid. Our data, however, indicate some problems to be encountered in attempting to identify a YAC complementing a defective phenotype and suggest that redundancy in the number of YACs analyzed is beneficial to identify a
AP-Genomics
YAC CONTIG ENCOMPASSING XRCC5
complementing YAC. Our results show that this approach is suitable for defective cell lines that have a screenable but not selectable phenotype, but care must be taken to examine the integrity of the YACs in the fusion hybrids. ACKNOWLEDGMENTS We thank Dr. R. S. Athwal for the mouse–human monochromosomal hybrid from which the hybrid used in this study was derived. We thank N. Finnie in the S.P.J. laboratory for his participation in this work and Drs. J. Blackwell, I. Durham, and members of the MRC CMU for their advice and support. Research in the MRC CMU is supported by European Community Grants F13PCT920007 and ERBSCICT920823, in the SPJ laboratory by Grants SP2143/0101 and SP2143/0201, and in the E.S. laboratory by a grant from the Canadian Genome Analysis and Technology Program (CGAT). G.E.T. is supported by a postdoctoral fellowship from the Irvington Institute and is a special fellow of the Leukemia Society of America.
REFERENCES Albertsen, H. M., Abderrahim, H., Cann, H. M., Dausset, J., Le, P. D., and Cohen, D. (1990). Construction and characterization of a yeast artificial chromosome library containing seven haploid human genome equivalents. Proc. Natl. Acad. Sci. USA 87: 4256– 4260. Barber, T. D., Morell, R., Johnson, D. H., Asher, J. H., and Friedman, T. B. (1993). A highly informative dinucleotide repeat polymorphism at the D2S211 locus linked to ALPP, FN1, and TNP1. Hum. Mol. Genet. 2: 88. Blunt, T., Finnie, N. J., Taccioli, G. E., Smith, G. C. M., Demengeot, J., Gottlieb, T. M., Mizuta, R., Varghese, A. J., Alt, F. W., Jeggo, P. A., and Jackson, S. P. (1995). Defective DNA-dependent protein kinase activity is linked to V(D)J recombination and DNA repair defects associated with the murine scid mutation. Cell 80: 813– 823. Burke, D. T., Carle, G. F., and Olson, M. V. (1987). Cloning of large segments of exogenous DNA into yeast by means of artificial chromosome vectors. Science 236: 806–812. Cai, Q.-Q., Plet, A., Imbert, J., Lafage-Pochitaloff, M., Cerdan, C., and Blanchard, J.-M. (1994). Chromosomal location and expression of the genes coding for Ku p70 and p80 in human cell lines and normal tissues. Cytogenet. Cell Genet. 65: 221–227. Cole, C. G., Goodfellow, P. N., Bobrow, M., and Bentley, D. R. (1991a). Errata—Generation of novel sequence tagged sites (STSs) from discrete chromosomal regions using Alu-PCR, 816–826, Vol. 10, number 3 (1991). Genomics 11: 782. Cole, C. G., Goodfellow, P. N., Bobrow, M., and Bentley, D. R. (1991b). Generation of novel sequence tagged sites (STSs) from discrete chromosomal regions using Alu-PCR. Genomics 10: 816–826. Cole, C. G., Patel, K., Shipley, J., Sheer, D., Bobrow, M., Bentley, D. R., and Dunham, I. (1992). Identification of region-specific yeast artificial chromosomes using pools of Alu element-mediated polymerase chain-reaction probes labelled via linear amplification. Genomics 14: 931–938. Collins, A. R. (1993). Mutant rodent cell lines sensitive to ultraviolet light, ionising radiation and cross-linking agents: A comprehensive survey of genetic and biochemical characteristics. Mutat. Res. 293: 99–118. Foote, S., Vollrath, D., Hilton, A., and Page, D. C. (1992). The human Y chromosome: Overlapping DNA clones spanning the euchromatic region. Science 258: 60–66. Getts, R. C., and Stamato, T. D. (1994). Absence of a Ku-like DNA end binding-activity in the xrs double-strand DNA repair-deficient mutant. J. Biol. Chem. 269: 15981–15984.
/ m4534$3756
10-26-95 00:13:02
gnma
327
Gnirke, A., Barnes, T. S., Patterson, D., Schild, D., Featherstone, T., and Olson, M. V. (1991). Cloning and in vivo expression of the human GART gene using yeast artificial chromosomes. EMBO J. 10: 1629–1634. Green, E. D., and Olson, M. V. (1990). Systematic screening of yeast artificial-chromosome libraries by use of the polymerase chain reaction. Proc. Natl. Acad. Sci. USA 87: 1213–1217. Gyapay, G., Morissette, J., Vignal, A., Dib, C., Fizames, C., Millasseau, P., Marc, S., Bernardi, G., Lathrop, M., and Weissenbach, J. (1994). The 1993–94 Ge´ne´thon human genetic linkage map. Nature Genet. 7: 246–249. Hafezparast, M., Kaur, G. P., Zdzienicka, M., Athwal, R. S., Lehmann, A. R., and Jeggo, P. A. (1993). Sub-chromosomal localisation of a gene (XRCC5) involved in double strand break repair to the region 2q34–36. Somat. Cell Mol. Genet. 19: 413–421. Hafezparast, M., Cole, C. G., Kaur, G. P., Athwal, R. S., and Jeggo, P. A. (1994). An extended panel of hamster–human hybrids for chromosome 2q. Somat. Cell Mol. Genet. 20: 541–548. Huxley, C., and Gnirke, A. (1991). Transfer of yeast artificial chromosome from yeast to mammalian cells. BioEssays 13: 545–550. Jeggo, P. A., Carr, A. M., and Lehmann, A. R. (1994). Cloning human DNA repair genes. Int. J. Radiat. Biol. 66: 573–577. Jeggo, P. A., Hafezparast, M., Thompson, A. F., Broughton, B. C., Kaur, G. P., Zdzienicka, M. Z., and Athwal, R. S. (1992). Localization of a DNA repair gene (XRCC5) involved in double-strand break rejoining to human chromosome 2. Proc. Natl. Acad. Sci. USA 89: 6423–6427. Jeggo, P. A., Hafezparast, M., Thompson, A. F., Kaur, G. P., Sandhu, A. K., and Athwal, R. S. (1993). A hamster-human sub-chromosomal hybrid cell panel for chromosome 2. Somat. Cell Mol. Genet. 19: 39–49. Jeggo, P. A., and Holliday, R. (1986). Azacytidine induced reactivation of a DNA repair gene in Chinese hamster ovary cells. Mol. Cell. Biol. 6: 2944–2949. Jeggo, P. A., and Kemp, L. M. (1983). X-ray sensitive mutants of Chinese hamster ovary cell line. Isolation and cross-sensitivity to other DNA damaging agents. Mutat. Res. 112: 313–327. Kemp, L. M., Sedgwick, S. G., and Jeggo, P. A. (1984). X-ray sensitive mutants of Chinese hamster ovary cells defective in double-strand break rejoining. Mutat. Res. 132: 189–196. Kovalic, D., Kwak, J.-H., and Weisblum, B. (1991). General method for direct cloning of DNA fragments generated by the polymerase chain reaction. Nucleic Acids Res. 19: 4560. Larin, Z., Monaco, A. P., and Lehrach, H. (1991). Yeast artificial chromosome libraries containing large inserts from mouse and human DNA. Proc. Natl. Acad. Sci. USA 88: 4123–4127. Legerski, R., and Peterson, C. (1992). Expression cloning of a human DNA repair gene involved in xeroderma pigmentosum group C. Nature 359: 70–73. Li, X., Wise, C. A., Le, P. D., Hawkins, A. L., Griffin, C. A., Pittler, S. J., Lovett, M., and Jabs, E. W. (1994). A YAC contig of approximately 3 Mb from human chromosome 5q31 r q33. Genomics 19: 470–477. Liu, J., Stanton, V., Fujiwara, M., Wang, J. X., Rezonzew, R., Gros, P., Morgan, K., Housman, D., and Schurr, E. (1995). Large scale cloning of human chromosome 2 specific yeast artificial chromosomes (YACs) using an interspersed-repetitive-sequences (IRS) PCR approach. Genomics 26: 178–191. Markie, D., Ragoussis, J., Singer, G., Rowan, A., and Sanson, D. (1993). New vector for transfer of yeast artificial chromosome to mammalian cells. Somat. Cell Mol. Genet. 19: 161–169. Morita, T., Yoshimura, Y., Yamamoto, A., Murata, K., Mori, M., Yamamoto, H., and Matsushiro, A. (1993). A mouse homolog of the Escherichia coli recA and Saccharomyces cerevisiae RAD51 genes. Proc. Natl. Acad. Sci. USA 90: 6577–6580. Muris, D., Bezzubova, O., Buerstedde, J. M., Vreeken, K., Balajee, A. S., Osgood, C. J., Troelstra, C., Hoeijmakers, J., Ostermann, K.,
AP-Genomics
328
BLUNT ET AL.
Schmidt, H., Natarajan, A. T., Eeken, J., Lohman, P., and Pastink, A. (1994). Cloning of human and mouse genes homologous to RAD52, a yeast gene involved in DNA repair and recombination. Mutat. Res. 315: 295–305. Murray, J. M., Tavassoli, M., Al-Harithy, R., Sheldrick, K. S., Lehmann, A. R., Carr, A. M., and Watts, F. Z. (1994). Structural and functional conservation of the human homologue of the S. pombe rad2 gene, which is required for chromosome segregation and recovery from DNA damage. Mol. Cell. Biol. 14: 4878–4888. Nelson, D. L., Ledbetter, S. A., Corbo, L., Victoria, M. F., RamirezSolis, R., Webster, T. D., Ledbetter, D. H., and Caskey, C. T. (1989). Alu polymerase chain reaction: A method for rapid isolation of human-specific sequences from complex DNA sources. Proc. Natl. Acad. Sci. USA 86: 6686–6690. Pachnis, V., Pevny, L., Rothstein, R., and Costantini, F. (1990). Transfer of a yeast artificial chromosome carrying human DNA from Saccharomyces cerevisiae into mammalian cells. Proc. Natl. Acad. Sci. USA 87: 5109–5113. Rathmell, W. K., and Chu, G. (1994). A DNA end-binding factor involved in double-strand break repair and v(d)j recombination. Mol. Cell. Biol. 14: 4741–4748. Riley, J., Butler, R., Ogilvie, D., Finniear, R., Jenner, D., Powell, S., Anand, R., Smith, J. C., and Markham, A. F. (1990). A novel, rapid method for the isolation of terminal sequences from yeast artificial chromosome (YAC) clones. Nucleic Acid. Res. 18: 2887–2890. Shinohara, A., Ogawa, H., Matsuda, Y., Ushio, N., Ikeo, K., and Ogawa, T. (1993). Cloning of human, mouse and fission yeast re-
/ m4534$3756
10-26-95 00:13:02
gnma
combination genes homologous to RAD51 and recA. Nature Genet. 4: 239–243. Smider, V., Rathmell, W. K., Lieber, M. R., and Chu, G. (1994). Restoration of X-ray resistance and V(D)J recombination in mutant-cells by Ku cDNA. Science 266: 288–291. Southern, E. M., Anand, R., Brown, W. R. A., and Fletcher, D. S. (1987). A model for the separation of large DNA molecules by crossed field gel electrophoresis. Nucleic Acids Res. 15: 5925–5943. Taccioli, G. E., Rathbun, G., Oltz, E., Stamato, T., Jeggo, P. A., and Alt, F. W. (1993). Impairment of V(D)J recombination in doublestrand break repair mutants. Science 260: 207–210. Taccioli, T. G., Gottlieb, T. M., Blunt, T., Priestley, A., Demengeot, J., Mizuta, R., Lehmann, A. R., Alt, F. W., Jackson, S. P., and Jeggo, P. A. (1994). Ku80: Product of the XRCC5 gene. Role in DNA repair and V(D)J recombination. Science 265: 1442–1445. Troelstra, C., Odijk, H., de Wit, J., Westerveld, A., Thompson, L. H., Bootsma, D., and Hoeijmakers, J. H. J. (1990). Molecular cloning of the human DNA repair gene ERCC6. Mol. Cell. Biol. 10: 5806– 5813. White, J. K., Shaw, M. A., Barton, C. H., Cerreti, D. P., Williams, H., Mock, B. A., Carter, N. P., Peacock, C. S., and Blackwell, J. M. (1994). Genetic and physical mapping of 2q35 in the region of the NRAMP and IL8R genes: Identification of a polymorphic repeat in exon 2 of NRAMP. Genomics 24: 295–302. Yaneva, M., Wen, J., Ayala, A., and Cook, R. (1989). cDNA-derived amino acid sequence of the 86-kDa subunit of the Ku antigen. J. Biol. Chem. 264: 13407–13411.
AP-Genomics
30, 320–328 (1995)
A YAC Contig Encompassing the XRCC5 (Ku80) DNA Repair Gene and Complementation of Defective Cells by YAC Protoplast Fusion TRACY BLUNT,* GUILLERMO E. TACCIOLI,† ANNE PRIESTLEY,* MAJID HAFEZPARAST,*,1 TREVOR MCMILLAN,*,2 JING LIU,‡ CHARLOTTE C. COLE,§ JACQUELINE WHITE,Ø FREDERICK W. ALT,† STEPHEN P. JACKSON,\ ERWIN SCHURR,‡ ALAN R. LEHMANN,* AND PENNY A. JEGGO*,3 *MRC Cell Mutation Unit, University of Sussex, Brighton BN1 9RR, United Kingdom; and †Howard Hughes Medical Institute, The Childrens Hospital and Department of Genetics and Center for Blood Research, Harvard University Medical School, Boston, Massachusetts 02115; ‡McGill Centre for the Study of Host Resistance, Montreal General Hospital Research Institute, 1650 Cedar Avenue, Montreal H3G1A4, Quebec, Canada; §The Sanger Centre, Hinxton Hall, Hinxton, Cambridge CB10 1RQ, United Kingdom; ØDepartment of Medicine, Level 5, Addenbrooks Hospital, Cambridge CB2 2QQ, United Kingdom; and \Wellcome CRC Institute, Tennis Court Road, Cambridge CB2 1QR, United Kingdom Received May 18, 1995; accepted September 11, 1995
The Chinese hamster ovary xrs mutants are sensitive to ionizing radiation, defective in DNA double-strand break rejoining, and unable to carry out V(D)J recombination effectively. Recently, the gene defective in these mutants, XRCC5, has been shown to encode Ku80, a component of the Ku protein and DNA-dependent protein kinase. We present here a YAC contig involving 25 YACs mapping to the region 2q33–q34, which encompasses the XRCC5 gene. Eight new markers for this region of chromosome 2 are identified. YACs encoding the Ku80 gene were transferred to xrs cells by protoplast fusion, and complementation of all the defective phenotypes has been obtained with two YACs. We discuss the advantages and disadvantages of this approach as a strategy for cloning human genes complementing defective rodent cell lines. q 1995 Academic Press, Inc.
INTRODUCTION
The use of several different approaches for the cloning of the genes involved in DNA repair may be necessary to obtain the entire spectrum of such genes. One approach is the use of cloned genes from lower organisms for the isolation of mammalian homologues, using techniques of degenerate PCR and Southern hybridization (Morita et al., 1993; Shinohara et al., 1993; Muris et al., 1994; Murray et al., 1994). A second approach is the use of mammalian cell mutants that exhibit sensitivities to DNA-damaging agents, including UV radiation, ionizing radiation, cross-linking agents, and alkylating agents (Collins, 1993). 1 Current address: Institute of Urology and Nephrology, University College, 67 Riding House Street, London W1P 7PN, UK. 2 Current address: Institute of Cancer Research, Cotswold Road, Belmont, Sutton, Surrey SM2 5NG, UK. 3 To whom correspondence should be addressed.
0888-7543/95 $12.00 Copyright q 1995 by Academic Press, Inc. All rights of reproduction in any form reserved.
/ m4534$3756
10-26-95 00:13:02
One strategy that has proved successful for the isolation of mammalian DNA repair genes using such repair defective mutant strains involves the correction of their defective phenotype by DNA transfection using either human genomic DNA or cDNA libraries (Troelstra et al., 1990 and references therein; Legerski and Peterson, 1992; Jeggo et al., 1994). However, some mutant strains are unsuitable for this approach. The reasons for this are numerous but include the revertability of some of the mutant strains and insufficient sensitivity to any DNA-damaging agent to allow selection for complemented cells. The Chinese hamster ovary xrs mutants, which belong to ionizing radiation complementation group 5, are highly sensitive to ionizing radiation, have a defect in double-strand break (dsb) rejoining, and are defective in their ability to carry out V(D)J recombination (Kemp et al., 1984; Taccioli et al., 1993). These combined defects show that XRCC5, the gene defective in xrs cells, not only acts in a pathway for the repair of damage-induced DNA dsbs, but also is recruited to participate in the rejoining of site-specific dsbs introduced during V(D)J recombination, a developmental process enhancing immune diversity. The xrs cells have been particularly refractory to cloning by DNA transfection, probably due to their ability to revert both spontaneously and following azacytidine treatment (Jeggo and Holliday, 1986). As an alternative approach to clone the XRCC5 gene, we embarked on a positional cloning strategy that did not necessitate selection for radioresistance, merely the screening of otherwise selected clones for resistance or sensitivity to ionizing radiation. The steps involved in this strategy included the identification of a complementing human chromosome, the localization of the gene to a subchromosomal fragment in a hamster/human hybrid bearing less than 10 Mb human DNA, the isolation of YACs covering the human DNA present in
320
gnma
AP-Genomics
YAC CONTIG ENCOMPASSING XRCC5
the hybrid, the identification of a complementing YAC, and the cloning of a complementing gene from the YAC. The first step of this approach was achieved with the demonstration that human chromosome 2 could complement the radiosensitivity of xrs cells (Jeggo et al., 1992). Using the technique of irradiation fusion gene transter (IFGT), we constructed a panel of reduced hybrids, with some complementing and others not complementing the radiosensitivity of xrs cells, and hence regionally localized XRCC5 to 2q33–q35 (Hafezparast et al., 1993). Before achieving our next goal of obtaining a complementing YAC, this analysis alone enabled us to identify a candidate gene, Ku80, that also mapped to the region 2q33–q35 (Cai et al., 1994). Ku80 is a subunit of the Ku protein and has the property of binding to double-stranded DNA ends. Since the xrs cells had been reported to be lacking DNA end-binding activity, this made Ku80 an exciting candidate (Getts and Stamato, 1994; Rathmell and Chu, 1994). Subsequent analysis by us and others indeed identified Ku80 as the product of the XRCC5 gene, since Ku80 cDNA was able to complement the radiosensitivity of xrs cells (Smider et al., 1994; Taccioli et al., 1994). In this paper we present the characterization of a YAC contig encompassing the XRCC5 (Ku80) gene and describe our results on the transfer of these YACs to xrs-6 cells and the identification of two complementing YACs. The completion of a YAC contig in this region will facilitate the identification of neighboring genes and their organization. Our analysis of YAC fusion hybrids derived by protoplast fusion highlights some difficulties associated with this technique and is useful for evaluating this approach to gene cloning. MATERIALS AND METHODS Mammalian cell culture conditions. The hybrid XR-V15B/H22 D2 was obtained by fusion of irradiated microcell hybrids with xrs-6 cells as described previously (Hafezparast et al., 1993; Taccioli et al., 1994). All strains were routinely cultured in Gibco MEM supplemented with nonessential amino acids and 10% fetal calf serum. All other conditions were as described previously (Jeggo and Kemp, 1983). Estimation of g-ray sensitivity was as described previously (Hafezparast et al., 1993). YAC library screening using Alu-PCR products. The majority of Alu-PCR products used as probes were obtained using primers ALE1 and ALE34 together on hybrid D2-X-38 as described previously (Cole et al., 1991a,b). Two products, ST6 and ST30, were obtained using Alu primers TC-65 (Nelson et al., 1989). The cloning of Alu-PCR products and their use as hybridization probes for YAC library screening was followed as described previously, with minor modifications (Cole et al., 1992). The PCR products were cloned into a T vector derived from pGEM5fZ(/) (Kovalic et al., 1991). The Alu-PCR products were amplified from this vector using M13 forward and reverse primers, and the primer PDK1 (5*GAATTGGGCCCGACGTCGCATGCTC3*) located close to the cloning site was used for labeling of probes by linear PCR amplification as described previously (Cole et al., 1992). Additionally, primers Alu S/J and Alu 263-282.12 were used to generate the Alu-PCR products from YAC clones and to screen pools of YAC-derived inter-Alu fragments as described previously (Liu et al., 1995). To examine whether the Alu-PCR products derived from D2-X-38 originated from the region 2q33–q35, AluPCR amplification using primers ALE1 and ALE34 was carried out
/ m4534$3756
10-26-95 00:13:02
gnma
321
on a panel of radiation-reduced hybrids (which had been previously constructed in our laboratory), including D2-X-38 and the hamster parent xrs-6. One microliter of amplification product was loaded onto 0.8% agarose gels, and the products were separated by gel electrophoresis. These products were transferred to nylon filters and subjected to hybridization using a single, cloned Alu-PCR product as a probe. Products hybridizing to complementing hybrids containing the region 2q33–q35 were used as probes. To examine the overlap between YACs, the panel of YACs was amplified by Alu-PCR, and the products were separated by gel electrophoresis as above, transferred to nylon filters, and used in Southern hybridization. The probe was either a single, cloned Alu-PCR product from a specific YAC or the entire pool of Alu-PCR products from the YAC. Cross-hybridization to other YACs was clearly distinguished from background hybridization to nonoverlapping YACs. All these experiments required extensive competing with COT-1 DNA as described previously (Cole et al., 1992). Markers used for YAC mapping. PCR primers used in this analysis included S25, 5*CCCTGGTGGAGTAGGCCTCTAG3* and 5*TCCTTGACAACTTCCTCCCACC3*; ST6, 5*CTATCTATTCGCCCCCTTGTGGT3* and 5*TCTTGAACTCCTGAGCTCAAGTG3*; and ST30, 5*ACTGTGTTGCTATTGTTGTCTAG3* and 5*GTCACTCACATGTAATCCTAGCC3*. Other primers used to amplify the 3 *UTR region of the Ku80 gene, TNP, villin, and FN and all PCR conditions were as described previously (Taccioli et al., 1994; Jeggo et al., 1993; Hafezparast et al., 1993). Alu-PCR products used as probes for Southern hybridization were obtained as described above. The end of YAC ICRFy 900D0120 (S25) was obtained by the vectorette method as described previously (Riley et al., 1990), and vector–Alu PCR was used to obtain the end of YAC 807_f_1(AV 807_f_1) using Alu primer ALE34 and primer 1089 for the pYAC4 vector arm (Nelson et al., 1989; Riley et al., 1990; Cole et al., 1991a,b). YAC library screening. Four YAC libraries were screened; the ICRF libraries, kindly supplied by Dr. H. Lehrach, were a human 4X and 4Y library (Larin et al., 1991; and M. Ross, unpublished), the first generation Ceph (Centre d’Etude de Polymorphisme Humaine) Mark 1 YAC library (Albertsen et al., 1990), and the original Washington University YAC library (Burke et al., 1987). Additional mega YACs were supplied by Dr. LePaslier (Ge´ne´thon). YAC growth conditions, retrofitting, and pulse-field gel analysis. Yeast cultures containing YACs were grown according to Green and Olson in SD medium containing adenine, tryptophan, and tyrosine but lacking uracil. The dominant selectable marker, the neoR gene, was introduced into YACs by a retrofitting technique as described (Markie et al., 1993), and retrofitted YACs were grown in medium containing uracil, tryptophan, and tyrosine but lacking adenine. The sizes of YACs were estimated before and after retrofitting by pulsefield gel electrophoresis (PFGE) using a Waltzer Apparatus (Southern et al., 1987). Transfer of YACs to mammalian cells by protoplast fusion. Yeast cells containing retrofitted YACs at a density of 1 1 107 cells/ml were pelleted, washed first in ddH2O, then in 1 M sorbitol, and resuspended in 20 ml SCE (1 M sorbitol; 0.1 M sodium citrate; 10 mM EDTA, pH 5.8). Thirty-two micromolar b-mercaptoethanol and 800 units of lyticase were added, and the cells were incubated at 307C until 75% had formed spheroplasts. The cells were gently resuspended in 1 M sorbitol, pelleted again, and resuspended in 20 ml STC (1 M sorbitol; 10 mM CaCl2 ; 10 mM Tris, pH 7.5) to a concentration of 1 1 108/ml. The spheroplasts were maintained at 187C while the mammalian cells were trypsinized, washed in serum-free (SF) medium, and resuspended at 1.5 1 106/ml. Mammalian cells were gently layered onto the spheroplasts, pelleted, and resuspended in 50 ml SF medium. Five hundred microliters of PEG solution (PEG 1500; Boehringer; 50% in 75 mM Hepes; 5 mM CaCl2 ; 50 mM b-mercaptoethanol) was added and after a 2-min incubation, SF medium was slowly added, and the cells were left for 10 min. After gentle pelleting, cells were resuspended in growth medium and incubated at 377C. G418 (GIBCO) (800 mg/ml) was added after 48 h. Individual G418R clones were subcloned after 7–10 days incubation and maintained in 600 mg/ml G418.
AP-Genomics
322
BLUNT ET AL.
Southern hybridization of YAC fusion hybrids. Southern hybridization was carried out using standard protocols. The probe for Ku80 contained the ORF and was derived from Ku80 cDNA (kindly supplied by W. Reeves) by PCR and radiolabeled by random priming.
of human DNA present in the hybrid D2-X-38. Pools of Alu-PCR products from D2-X-38 were cloned and used in pools of 4–10 as hybridization probes. Probes were radiolabeled by linear PCR amplification and preassociated with excess Cot-1 DNA to compete out repetitive sequences as described previously (Cole et al., 1992). To optimize the information gained from each library screening, the size of each cloned Alu-PCR product was estimated by gel electrophoresis, and only Alu-PCR products of different sizes were utilized as probes. A second procedure was also used to eliminate redundant probes. AluPCR amplification was carried out on the hybrid D2-X38, control xrs-6 cells, and other hybrids containing small amounts of human DNA both complementing and not complementing the xrs defect. These Alu-PCR products were separated by gel electrophoresis and transferred to filters for Southern hybridization. Each candidate cloned Alu-PCR product was used as a probe against such filters, and only those probes giving strong signals specifically with complementing hybrids were utilized. This avoided the use as a probe of occasional Alu-PCR products that did not appear to map back to the human DNA present in the D2-X-38 hybrid, as well as any products that did not contain unique DNA sequences. This technique produced rapid and reliable results, since the multiple copies of each Alu-PCR product on the filter gave strong hybridization signals. Additionally, the technique provided a source of markers for subsequent mapping of the YACs obtained (e.g., markers prefixed by AP in Table 2 (see below). Most YACs (see below for the exceptions) isolated from the ICRF libraries were obtained using these AluPCR clones as hybridization probes. Further YACs were also obtained by a number of additional approaches. YACs ICRFy900D0120,ICRFy900B0280,ICRFy900C02127, and ICRFy901C065 were obtained by screening the ICRF libraries with TNP-1 (White et al., 1994). YACs 700-_c_12, 678_e_1, 807_f_1, 817_b_12, 929_b_6, and 929_f_9 were obtained from the Ceph Mega YAC library since they contained the microsatellite markers D2S164,
RESULTS
Generation of a Complementing Hybrid Containing Less Than 5 Mb Human DNA To isolate region-specific YACs, we utilized a technique designed and tested previously by one of us (Cole et al., 1992) that necessitated the construction of a hamster–human hybrid bearing a single fragment of human DNA less than 10–15 Mb. We have previously described the construction of a hamster–human hybrid (D2-X-38) bearing a single fragment of human DNA that complemented the radiosensitivity and V(D)J recombination defects of xrs-6 cells (Taccioli et al., 1994). In Table 1, we outline the derivation of this hybrid and identify additional microsatellite markers linked to the XRCC5 gene. Human linkage analysis has indicated that the flanking markers fibronectin and villin are less than 10 Mb apart, suggesting that D2-X-38, which does not carry either flanking marker, contains less than 10 Mb human DNA. These data were supported by analysis using a PCR-based technique described previously (Cole et al., 1991a,b), by which we estimated that D2-X-38 contained around 3 Mb human DNA. On the basis of these observations, D2-X-38 was chosen as a suitable hybrid for the next stage of our cloning strategy, namely the isolation of region-specific markers for YAC library screening. Identification of YACs from the Region of Human DNA Present in the Hybrid D2-X-38 To generate probes for YAC library hybridization screening, we utilized a procedure (Cole et al., 1992) whereby Alu element-mediated PCR (Alu-PCR) (Nelson et al., 1989) is used to generate markers from the region
TABLE 1 Derivation of Hybrid D2-X-38 from Hybrid XR-V15B/H22 D2 Markers D2S164
D2S301
TNP-1
Hybrid
GNT1 2q36
villin 2q35
XR-V15B/H22 D2
/
0
/
/
/
D2-X-3 D2-X-5 D2-X-38 D2-X-7
/ / 0 0
0 0 0 0
/ 0 / 0
/ 0 / 0
/ 0 / 0
DS137 FN 2q33
g-Ray sensitivity
/
0
R
/ 0 / 0
0 0 0 0
R S R S
2q33–35
Note. XR-V15B/H22 D2 is a complementing hybrid, as described previously (Jeggo et al., 1993; Taccioli et al., 1994). Twenty-one subclones derived from this hybrid were analyzed and could be characterized into the four types represented by D2-X-3, D2-X-5, D2-X-38, and D2-X7, indicating the presence of two independently segregating fragments. Villin and FN (fibronectin) are markers flanking the TNP-1 locus. D2S137, D2S164, and D2S301 are microsatellite markers identified by Ge´ne´thon as mapping to this region of chromosome 2. D2S137 is identical to the previously described marker D2S211 (Hafezparast et al., 1994; Barber et al., 1993).
/ m4534$3756
10-26-95 00:13:02
gnma
AP-Genomics
323
YAC CONTIG ENCOMPASSING XRCC5
TABLE 2 YAC Contig Encompassing XRCC5 Markers
Size (kb)
YAC name Hybrid D2X38 ICRFy900B0280 ICRFy900C02127 ICRFy901C065a ICRFy900D0120 CEPH 678_e_1 CEPH 817_b_12 CEPH 807_f_1 CEPH 929_b_6 ICRFy900E0952 CEPH 929_f_9 CEPH 225_b-5 CEPH 11_c_9 CEPH 372_d_5 CEPH 4_b_11 CEPH 55_c_9 CEPH55_d_10 CEPH 265_d_11 CEPH 321_a_2 ICRFy905C112 ICRFy900B0465a ICRFy900D0525 CEPH 229_h_7 CEPH 254_g_4 CEPH 700_c_12 CEPH 206_f_11
650 500 800 450 730 950 1050 330 1300
AP 14
D2S 164
D2S 301
S TNP
S 25
AP A5
AP B10
S T6
AV 807 _f_1
Alu 900_ E0952
S Ku80
H Ku80
AP B12
S T30
D2S 137
AP 53
S FN
0
/
/
/
/
/
/
/
/
/
/
/
/
/
/
/
0
/ / 0 0 / / 0 0
/ / 0 0 / / / / 0 0
/ / 0 / / / / / 0 0
/ / / / / / / / 0 /
0 0 0 / / / / / 0 0
0 0 0 0 0 0 / / 0 /
0 0 0 0 0 0 / / 0 /
0 0
0 0
0 0
0 0 0 0 0 0 / / / / 0 0 0 0 0 0 0 0 0 0 0 0
0 0
0 0
0 0
0 0 0 0 0 / 0 / 0 0 / / / / / 0 / / / 0 0
0 0 0 0 0 0 0 0 0 / 0 / 0 0 / / / / / 0 / / / / 0
0 / 0 / 0 0 0 0 0 / / 0 / 0 / / 0
0 0 0 0 0 0 0 0 0 / 0 0 0 0 0 0 0 0 0 0 0 0 0 0 /
0
480 500 880
580
0 450
0 0
/ / / / / 0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0 / / / / / / 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 / / / / / / / / 0 0 0 0 0
0 0 / / / / / / / / / / /
0 0 0
0 0
0 0 0 0 0 / / / / / / / / / / / 0 0 0 0 0
Note. Markers prefixed with AP were derived by Alu-PCR; AV807_f_1 represented the YAC end obtained by Alu–vector-PCR; HKu80 represented Ku80 cDNA. Alu 900E952 was as described in the text. All the above markers were analyzed by Southern hybridization. Markers prefixed S were analyzed by PCR using primers described in the text. YAC sizes were as given by the CEPH database or as estimated in this study by PFGE. a YACs identified as being chimeric, although the lack of chimerism has not necessarily been verified in the unmarked YACs.
D2S301, or D2S137, which were present in D2-X-38. YACs 321_a_2, 265_d_11, 229_h_7, and 206_f_11 were isolated as part of a chromosome 2 sublibrary, as described elsewhere (Liu et al., 1995), and found to be part of a contig overlapping the FN locus. YACs 372_d_5 and 225_b_5 were obtained by hybridization screening of the CEPH Mark 1 library using an inter-Alu segment probe derived from YAC 905C112. Construction of a YAC Contig Encompassing the XRCC5 Gene To order the YACs into a contig, a range of markers were utilized, including TNP-1 and the three Ceph microsatellite markers (D2S301, 164, and 137) that mapped to this region of chromosome 2. The contig constructed is shown in Table 2. Markers prefixed AP (Alu-PCR products) were derived by Alu-PCR amplification from the hybrid D2-X-38 or from one of the YACs as outlined above. The presence of these latter markers in the YACs was examined by using the markers as probes for Southern hybridization to filters containing gel-separated Alu-
/ m4534$3756
10-26-95 00:13:02
gnma
PCR products derived from each YAC (see Materials and Methods). A few selected Alu-PCR products were sequenced, and primers were derived from nonrepetitive sequences. Markers prefixed S were examined by PCR amplification using these primers. Markers from the ends of certain YACs were also obtained by vectorette analysis (S 25) (Riley et al., 1990) or vector–Alu-PCR (AV807_f_1). Finally, to examine whether two YACs overlapped despite the absence of overlapping markers, pools of AluPCR products derived from two of the YACs were used to probe filters containing gel-separated Alu-PCR products derived from the other YACs (prefixed Alu in Table 2). In this way YAC 900EO952 was shown to overlap with YAC 11_c_9. Hybridization of Alu-PCR products to individual YACs or subsets of YAC libraries can cause false contig connection due to the presence of low-copy repeat sequences. To test for this possible error, a number of additional Alu-PCR probes were derived from YACs 807_f_1 and 929_f_9 and used to screen the CEPH Mark 1 library. This screen produced no evidence for low-copy repeats since only the expected YACs were detected, thus confirming the locus specificity of the Alu-PCR probes
AP-Genomics
324
BLUNT ET AL.
used in the contig analysis. Limited restriction analysis of some of the YACs by PFGE helped to establish the order of the markers from S14 to S25 (data not shown). YAC 929_f_9 appeared to contain an internal deletion, but this has not been verified by restriction analysis. The two flanking markers of the contig, AP 14 and FN, are not present in the hybrid D2-X-38, thus indicating that the entire region of human DNA present in the hybrid D2-X-38 is represented in the contig. Based on the size of the YACs, this region represents less than 3 Mb DNA, which is consistent with the estimated 4-cM genetic distance between the markers D2S164/D2S301 and D2S137 (Gyapay et al., 1994). Identification and Integrity of XRCC5 within the Contig While this work was in progress, we discovered that Ku80, an 80-kDa subunit of the heterodimeric Ku protein, was the product of the XRCC5 gene (Smider et al., 1994; Taccioli et al., 1994). We therefore PCR-screened additional libraries using primers from the 3*UTR region of the Ku80 gene and identified YACs 11_c_9, 55_c_9, 4_b_11, and 55_d_10 from the chromosome 2 sublibrary.
We examined these and the other YACs within our contig for the presence of the Ku80 gene both by PCR, using primers from the 3*UTR region of the gene, and by Southern hybridization, using Ku80 cDNA as a probe (Yaneva et al., 1989). Positive YACs identified by these two approaches are shown in Table 2, and hybridization analysis of some of the positive YACs is shown in Fig. 1A. First, these results verify that Ku80 is present within our YAC contig, but surprisingly, whereas the PCR analysis identified only 7 positive YACs, hybridization analysis identified 11 YACs containing Ku80 sequences. All the YACs missing the 3*UTR region also contained deletions identifiable by our hybridization analysis. Band X (Fig. 1A) was frequently missing in these YACs, suggesting that it may map to the 3* region of the gene. These data indicated that the Ku80 gene was frequently disrupted in these YACs but 929_f_9, 11_c_9, 55_c_9, 4_b_11, 225_b_5, 372_d_5, and 55_d_10 did appear to carry an intact gene. Complementation of the Defects of xrs Cells by Protoplast Fusion To examine whether any of these YACs could complement the defects identified in xrs cells, a dominant se-
FIG. 1. (a) Presence and integrity of the Ku80 gene in the YACs. One microgram of yeast DNA containing YACs was digested with HindIII, separated by gel electrophoresis, transferred to nylon filters, and hybridized using Ku80 cDNA as a probe. Eight of eleven positive YACs are shown. The three YACs not shown (4_b_11; 372_d_5; and 55_d_10) gave patterns identical to YACs 55_c_9; 11_c_9; 225_b_5; and 929_f_9. (b) Presence and integrity of the Ku80 gene in YAC fusion hybrids. Ten micrograms of DNA from hamster hybrids was subjected to Southern hybridization as described in a. Data are only shown for two hybrids containing YAC 929_f_9, two hybrids containing YAC 55_c_9, and one hybrid containing YAC 11_c_9. Hybrid 55_c_9-A gave a pattern similar to that of hybrids 929_f_9_H1 and H4, indicating the absence of human Ku80 sequences.
/ m4534$3756
10-26-95 00:13:02
gnma
AP-Genomics
325
YAC CONTIG ENCOMPASSING XRCC5
lectable marker (the agpt gene, which confers resistance to the antibiotic G418) was introduced using a retrofitting technique (Markie et al., 1993). Protoplasts prepared from yeast containing retrofitted YACs carrying the G418R marker were fused to xrs cells, YAC fusion hybrids were selected using G418, and individual clones were screened for radiosensitivity and for ability to carry out V(D)J recombination. Table 3 shows the YACs used in fusion experiments. Two YACs (11_c_9 and 55_c_9) yielded fusion hybrids that showed complementation for the radiosensitive phenotype (Fig. 2), and significantly both these YACs contained an intact Ku80 gene. Surprisingly, YAC 929_f_9, which also appeared to contain the Ku80 gene intact, yielded noncomplementing fusion hybrids. To examine the integrity of the Ku80 gene in these hybrids, DNA from them was analyzed by Southern hybridization using Ku80 cDNA as a probe (Fig. 1B). While the parent YAC 929_f_9 appeared to contain an intact Ku80 gene (Fig. 1A), this was clearly not transferred to any of the hybrids derived. Similarly, the noncomplementing hybrid derived from YAC 55_c_9 (hybrid A) also had no integrated Ku80 sequences (data not shown). In contrast, the Ku80 gene appeared to be intact in the four complementing fusion hybrids derived from YACs 11_c_9 and 55_c_9 (Fig. 1B). Other markers identified as being present in these parent YACs were also examined in the fusion hybrids (Table 4). The markers were also checked in the YACs pre- and postretrofitting, and surprisingly we discovered that one YAC (55_c_9) had lost the D2S137 and ST30 markers during or subsequent to the retrofitting procedure. Following retrofitting, all YACs were checked for size by PFGE, and no gross change in size was observed. These data also show that the four hybrids derived from YAC 929_f_9 were disrupted during protoplast fusion, and only markers from one end of the YAC were transferred. Extracts from the four complementing hybrids were also examined for the expression of human Ku80 protein by Western blotting. In all cases, material cross-reacting with Ku80 antibodies was detected, demonstrating the presence of human Ku80 protein (data not shown). One complementing (55_c_9-H1) and one noncomplementing hybrid (11_C_9-A) were also examined for complementation of the defect in V(D)J recombination. The compleTABLE 3 Radiation Resistance of YAC Fusion Hybrids YAC
g-rayR neoR hybrids
neoR hybrids
905C112 900E0952 900B0280 900D0120 900C02127 901C065 929_f_9 11_c_9 55_c_9
0 0 0 0 0 0 0 3 1
2 5 2 10 7 7 4 4 1
/ m4534$3756
10-26-95 00:13:02
gnma
menting hybrid regained the ability to carry out signal join formation, whereas the noncomplementing hybrid retained the characteristic defect of the xrs cells (data not shown). These results verify previous observations by us and others that the Ku80 gene can complement the defect in xrs cells (Smider et al., 1994; Taccioli et al., 1994). Additionally, the results show that the technique of protoplast fusion can be used to transfer a YAC to cultured cells and to obtain complementation of a DNA repair-defective phenotype. DISCUSSION
Using a hamster–human hybrid containing a single small fragment of human DNA, we have identified 25 YACs mapping to the region 2q33–q34. These YACs have been ordered into a contig encompassing the XRCC5 gene and eight new markers for this region of chromosome 2. Some of these YACs have been transferred to xrs-6 cells, which are defective in XRCC5, and complementation of the defective phenotypes has been observed with two YACs. An important observation from our results is that the XRCC5 gene was frequently disrupted, either in the isolated YAC or during the protoplast fusion procedure. We have also recently isolated YACs containing the DNA–PKCS gene, which interacts with the Ku protein to form the DNA–PK complex, and have obtained complementation of hamster V3 cells by the transfer of these DNA–PKCS YACs (Blunt et al., 1995). In this latter study, we also found evidence for disruption of the gene, both in the YAC and during transfer, and will therefore discuss these data in conjunction. In our present study, of 11 YACs containing Ku80 sequences, regions of the gene or 3*-flanking sequences were clearly absent in four of them. Similarly, from our examination of nine YACs containing DNA–PKCS , hybridization analysis using probes from the 3*, 5*, and middle region of the gene enabled us to identify obvious deletions in five of them. Our analyses do not enable us to determine a mechanism for the lack of integrity of the genes, although in two cases (YACs 35D, H8 and 35D, G12) the hybridization data suggested the presence of internal deletions within the DNA–PKCS gene. Internal deletions in YACs have been reported by others (Foote et al., 1992; Li et al., 1994). In the case of the Ku-80-containing YACs, all YACs missing the 3*UTR region were also lacking adjacent markers on one side of the YAC, suggesting, rather surprisingly, that the region of chromosome 2 DNA present in the YACs may terminate within the gene in all of these four YACs. Our data also indicate that disruption of the YAC can occur during the retrofitting procedure. We observed that about one-quarter of our retrofitted YACs incurred a change in size identifiable by PFGE compared to that of the unretrofitted parent YAC. These YACs were not used for protoplast fusion experiments. The loss of markers in the retrofitted YAC
AP-Genomics
326
BLUNT ET AL.
TABLE 4 Examination of YAC Fusion Hybrids for Markers by PCR g-Ray sensitivity YAC Ret YAC Hybrid Hybrid Hybrid Hybrid YAC Ret YAC Hybrid YAC Ret YAC Hybrid Hybrid Hybrid
929_f_9 929_f_9Ret 929_f_9-H1 929_f_9-H2 929_f_9-H3 929_f_9-H4 11_C_9 11_C_9Ret 11_C_9-H1 55_C_9 55_C_9Ret 55_C_9-A 55_C_9-B 55_C_9-D
S S S S
R
S R R
S TNP
S T6
Ku80 3*UTR
S T30
D2S 137
S FN
/ / / / / / 0 0 0 0 0 0 0 0
/ / / / / / 0 0 0 0 0 0 0 0
/ / 0 0 0 0 / / / / / 0 / /
/ / 0 0 0 0 / / 0 / 0 0 0 0
/ / 0 0 0 0 / / 0 / 0 0 0 0
/ / 0 0 0 0 0 0 0 0 0 0 0 0
Note. Ret YAC, retrofitted YAC.
55_c_9 was identified following PCR analysis, despite retaining a size similar to the parent YAC. In addition to the lack of integrity of the gene within the YACs, the gene itself or the YAC was also frequently disrupted during the procedure of transfer and integration into the mammalian cells, resulting in the complete absence of the gene in some cases or of specific hybridization bands in others. Indeed, in our combined studies, of 26 fusion hybrids generated and analyzed for their integrity, evidence for disruption of the YAC during the fusion process was observed in 16 of them. Some YACs gave a high probability of complementation (e.g., 3/4 hybrids derived from YAC 11_c_9 in the present study and 6/6 YACs derived from YAC 29F,C4 (147) in our previous study), whereas with other YACs an intact gene could not be detected in any of the fusion hybrids observed (e.g., 0/4 for both mega-YACs 929_f_9
FIG. 2. Survival of YAC fusion hybrids following exposure to gamma irradiation. j, CHO-K1; m, hybrid D2-X-38; l, xrs-6; h, YAC fusion hybrid 11_c_9-D; s, YAC fusion hybrid 11_c_9-A; n, YAC fusion hybrid 55_c_9-H1. Other complementing hybrids were similar to 11_c_9-D, and noncomplementing hybrids were similar to 11_c_9-A.
/ m4534$3756
10-26-95 00:13:02
gnma
and 943_g_4 (144)). The most likely explanation is that the closer the gene lies to the dominant selectable marker, the more likely it is to be found intact among the neoR clones. This has a greater likelihood of being the case for the smaller YACs compared to the mega YACs, and indeed we have been more successful in obtaining complementation with the smaller YACs. Despite these problems, our results support those of other studies showing that human DNA can be transferred to mammalian cells via YAC vectors and can result in expression of human genes and complementation of a defective phenotype (Pachnis et al., 1990; Gnirke et al., 1991; Huxley and Gnirke, 1991). In these previous studies involving complementation of a defective phenotype, selection was applied immediately for the complementing phenotype, so that noncomplementing fusion hybrids would have been eliminated and escaped detection. Our results here, in which expression of a functional gene was examined in YAC fusion hybrids selected using a marker on the YAC arm and subsequently screened for functionality of the human gene, show that the efficiency of transfer of an intact YAC is not high. Our data presented here represent two steps in a positional strategy for cloning genes using rodent cell lines defective for a screenable phenotype. Our results indicate that this is a feasible approach for cloning genes but indicate some potential difficulties. The technique of IFGT can be used to generate hybrids bearing sufficiently small fragments of human DNA to enable the isolation of region-specific markers using an Alu element-PCR technique. Recent advances in technology facilitate the construction of a YAC contig spanning the human DNA present in such a hybrid. Our data, however, indicate some problems to be encountered in attempting to identify a YAC complementing a defective phenotype and suggest that redundancy in the number of YACs analyzed is beneficial to identify a
AP-Genomics
YAC CONTIG ENCOMPASSING XRCC5
complementing YAC. Our results show that this approach is suitable for defective cell lines that have a screenable but not selectable phenotype, but care must be taken to examine the integrity of the YACs in the fusion hybrids. ACKNOWLEDGMENTS We thank Dr. R. S. Athwal for the mouse–human monochromosomal hybrid from which the hybrid used in this study was derived. We thank N. Finnie in the S.P.J. laboratory for his participation in this work and Drs. J. Blackwell, I. Durham, and members of the MRC CMU for their advice and support. Research in the MRC CMU is supported by European Community Grants F13PCT920007 and ERBSCICT920823, in the SPJ laboratory by Grants SP2143/0101 and SP2143/0201, and in the E.S. laboratory by a grant from the Canadian Genome Analysis and Technology Program (CGAT). G.E.T. is supported by a postdoctoral fellowship from the Irvington Institute and is a special fellow of the Leukemia Society of America.
REFERENCES Albertsen, H. M., Abderrahim, H., Cann, H. M., Dausset, J., Le, P. D., and Cohen, D. (1990). Construction and characterization of a yeast artificial chromosome library containing seven haploid human genome equivalents. Proc. Natl. Acad. Sci. USA 87: 4256– 4260. Barber, T. D., Morell, R., Johnson, D. H., Asher, J. H., and Friedman, T. B. (1993). A highly informative dinucleotide repeat polymorphism at the D2S211 locus linked to ALPP, FN1, and TNP1. Hum. Mol. Genet. 2: 88. Blunt, T., Finnie, N. J., Taccioli, G. E., Smith, G. C. M., Demengeot, J., Gottlieb, T. M., Mizuta, R., Varghese, A. J., Alt, F. W., Jeggo, P. A., and Jackson, S. P. (1995). Defective DNA-dependent protein kinase activity is linked to V(D)J recombination and DNA repair defects associated with the murine scid mutation. Cell 80: 813– 823. Burke, D. T., Carle, G. F., and Olson, M. V. (1987). Cloning of large segments of exogenous DNA into yeast by means of artificial chromosome vectors. Science 236: 806–812. Cai, Q.-Q., Plet, A., Imbert, J., Lafage-Pochitaloff, M., Cerdan, C., and Blanchard, J.-M. (1994). Chromosomal location and expression of the genes coding for Ku p70 and p80 in human cell lines and normal tissues. Cytogenet. Cell Genet. 65: 221–227. Cole, C. G., Goodfellow, P. N., Bobrow, M., and Bentley, D. R. (1991a). Errata—Generation of novel sequence tagged sites (STSs) from discrete chromosomal regions using Alu-PCR, 816–826, Vol. 10, number 3 (1991). Genomics 11: 782. Cole, C. G., Goodfellow, P. N., Bobrow, M., and Bentley, D. R. (1991b). Generation of novel sequence tagged sites (STSs) from discrete chromosomal regions using Alu-PCR. Genomics 10: 816–826. Cole, C. G., Patel, K., Shipley, J., Sheer, D., Bobrow, M., Bentley, D. R., and Dunham, I. (1992). Identification of region-specific yeast artificial chromosomes using pools of Alu element-mediated polymerase chain-reaction probes labelled via linear amplification. Genomics 14: 931–938. Collins, A. R. (1993). Mutant rodent cell lines sensitive to ultraviolet light, ionising radiation and cross-linking agents: A comprehensive survey of genetic and biochemical characteristics. Mutat. Res. 293: 99–118. Foote, S., Vollrath, D., Hilton, A., and Page, D. C. (1992). The human Y chromosome: Overlapping DNA clones spanning the euchromatic region. Science 258: 60–66. Getts, R. C., and Stamato, T. D. (1994). Absence of a Ku-like DNA end binding-activity in the xrs double-strand DNA repair-deficient mutant. J. Biol. Chem. 269: 15981–15984.
/ m4534$3756
10-26-95 00:13:02
gnma
327
Gnirke, A., Barnes, T. S., Patterson, D., Schild, D., Featherstone, T., and Olson, M. V. (1991). Cloning and in vivo expression of the human GART gene using yeast artificial chromosomes. EMBO J. 10: 1629–1634. Green, E. D., and Olson, M. V. (1990). Systematic screening of yeast artificial-chromosome libraries by use of the polymerase chain reaction. Proc. Natl. Acad. Sci. USA 87: 1213–1217. Gyapay, G., Morissette, J., Vignal, A., Dib, C., Fizames, C., Millasseau, P., Marc, S., Bernardi, G., Lathrop, M., and Weissenbach, J. (1994). The 1993–94 Ge´ne´thon human genetic linkage map. Nature Genet. 7: 246–249. Hafezparast, M., Kaur, G. P., Zdzienicka, M., Athwal, R. S., Lehmann, A. R., and Jeggo, P. A. (1993). Sub-chromosomal localisation of a gene (XRCC5) involved in double strand break repair to the region 2q34–36. Somat. Cell Mol. Genet. 19: 413–421. Hafezparast, M., Cole, C. G., Kaur, G. P., Athwal, R. S., and Jeggo, P. A. (1994). An extended panel of hamster–human hybrids for chromosome 2q. Somat. Cell Mol. Genet. 20: 541–548. Huxley, C., and Gnirke, A. (1991). Transfer of yeast artificial chromosome from yeast to mammalian cells. BioEssays 13: 545–550. Jeggo, P. A., Carr, A. M., and Lehmann, A. R. (1994). Cloning human DNA repair genes. Int. J. Radiat. Biol. 66: 573–577. Jeggo, P. A., Hafezparast, M., Thompson, A. F., Broughton, B. C., Kaur, G. P., Zdzienicka, M. Z., and Athwal, R. S. (1992). Localization of a DNA repair gene (XRCC5) involved in double-strand break rejoining to human chromosome 2. Proc. Natl. Acad. Sci. USA 89: 6423–6427. Jeggo, P. A., Hafezparast, M., Thompson, A. F., Kaur, G. P., Sandhu, A. K., and Athwal, R. S. (1993). A hamster-human sub-chromosomal hybrid cell panel for chromosome 2. Somat. Cell Mol. Genet. 19: 39–49. Jeggo, P. A., and Holliday, R. (1986). Azacytidine induced reactivation of a DNA repair gene in Chinese hamster ovary cells. Mol. Cell. Biol. 6: 2944–2949. Jeggo, P. A., and Kemp, L. M. (1983). X-ray sensitive mutants of Chinese hamster ovary cell line. Isolation and cross-sensitivity to other DNA damaging agents. Mutat. Res. 112: 313–327. Kemp, L. M., Sedgwick, S. G., and Jeggo, P. A. (1984). X-ray sensitive mutants of Chinese hamster ovary cells defective in double-strand break rejoining. Mutat. Res. 132: 189–196. Kovalic, D., Kwak, J.-H., and Weisblum, B. (1991). General method for direct cloning of DNA fragments generated by the polymerase chain reaction. Nucleic Acids Res. 19: 4560. Larin, Z., Monaco, A. P., and Lehrach, H. (1991). Yeast artificial chromosome libraries containing large inserts from mouse and human DNA. Proc. Natl. Acad. Sci. USA 88: 4123–4127. Legerski, R., and Peterson, C. (1992). Expression cloning of a human DNA repair gene involved in xeroderma pigmentosum group C. Nature 359: 70–73. Li, X., Wise, C. A., Le, P. D., Hawkins, A. L., Griffin, C. A., Pittler, S. J., Lovett, M., and Jabs, E. W. (1994). A YAC contig of approximately 3 Mb from human chromosome 5q31 r q33. Genomics 19: 470–477. Liu, J., Stanton, V., Fujiwara, M., Wang, J. X., Rezonzew, R., Gros, P., Morgan, K., Housman, D., and Schurr, E. (1995). Large scale cloning of human chromosome 2 specific yeast artificial chromosomes (YACs) using an interspersed-repetitive-sequences (IRS) PCR approach. Genomics 26: 178–191. Markie, D., Ragoussis, J., Singer, G., Rowan, A., and Sanson, D. (1993). New vector for transfer of yeast artificial chromosome to mammalian cells. Somat. Cell Mol. Genet. 19: 161–169. Morita, T., Yoshimura, Y., Yamamoto, A., Murata, K., Mori, M., Yamamoto, H., and Matsushiro, A. (1993). A mouse homolog of the Escherichia coli recA and Saccharomyces cerevisiae RAD51 genes. Proc. Natl. Acad. Sci. USA 90: 6577–6580. Muris, D., Bezzubova, O., Buerstedde, J. M., Vreeken, K., Balajee, A. S., Osgood, C. J., Troelstra, C., Hoeijmakers, J., Ostermann, K.,
AP-Genomics
328
BLUNT ET AL.
Schmidt, H., Natarajan, A. T., Eeken, J., Lohman, P., and Pastink, A. (1994). Cloning of human and mouse genes homologous to RAD52, a yeast gene involved in DNA repair and recombination. Mutat. Res. 315: 295–305. Murray, J. M., Tavassoli, M., Al-Harithy, R., Sheldrick, K. S., Lehmann, A. R., Carr, A. M., and Watts, F. Z. (1994). Structural and functional conservation of the human homologue of the S. pombe rad2 gene, which is required for chromosome segregation and recovery from DNA damage. Mol. Cell. Biol. 14: 4878–4888. Nelson, D. L., Ledbetter, S. A., Corbo, L., Victoria, M. F., RamirezSolis, R., Webster, T. D., Ledbetter, D. H., and Caskey, C. T. (1989). Alu polymerase chain reaction: A method for rapid isolation of human-specific sequences from complex DNA sources. Proc. Natl. Acad. Sci. USA 86: 6686–6690. Pachnis, V., Pevny, L., Rothstein, R., and Costantini, F. (1990). Transfer of a yeast artificial chromosome carrying human DNA from Saccharomyces cerevisiae into mammalian cells. Proc. Natl. Acad. Sci. USA 87: 5109–5113. Rathmell, W. K., and Chu, G. (1994). A DNA end-binding factor involved in double-strand break repair and v(d)j recombination. Mol. Cell. Biol. 14: 4741–4748. Riley, J., Butler, R., Ogilvie, D., Finniear, R., Jenner, D., Powell, S., Anand, R., Smith, J. C., and Markham, A. F. (1990). A novel, rapid method for the isolation of terminal sequences from yeast artificial chromosome (YAC) clones. Nucleic Acid. Res. 18: 2887–2890. Shinohara, A., Ogawa, H., Matsuda, Y., Ushio, N., Ikeo, K., and Ogawa, T. (1993). Cloning of human, mouse and fission yeast re-
/ m4534$3756
10-26-95 00:13:02
gnma
combination genes homologous to RAD51 and recA. Nature Genet. 4: 239–243. Smider, V., Rathmell, W. K., Lieber, M. R., and Chu, G. (1994). Restoration of X-ray resistance and V(D)J recombination in mutant-cells by Ku cDNA. Science 266: 288–291. Southern, E. M., Anand, R., Brown, W. R. A., and Fletcher, D. S. (1987). A model for the separation of large DNA molecules by crossed field gel electrophoresis. Nucleic Acids Res. 15: 5925–5943. Taccioli, G. E., Rathbun, G., Oltz, E., Stamato, T., Jeggo, P. A., and Alt, F. W. (1993). Impairment of V(D)J recombination in doublestrand break repair mutants. Science 260: 207–210. Taccioli, T. G., Gottlieb, T. M., Blunt, T., Priestley, A., Demengeot, J., Mizuta, R., Lehmann, A. R., Alt, F. W., Jackson, S. P., and Jeggo, P. A. (1994). Ku80: Product of the XRCC5 gene. Role in DNA repair and V(D)J recombination. Science 265: 1442–1445. Troelstra, C., Odijk, H., de Wit, J., Westerveld, A., Thompson, L. H., Bootsma, D., and Hoeijmakers, J. H. J. (1990). Molecular cloning of the human DNA repair gene ERCC6. Mol. Cell. Biol. 10: 5806– 5813. White, J. K., Shaw, M. A., Barton, C. H., Cerreti, D. P., Williams, H., Mock, B. A., Carter, N. P., Peacock, C. S., and Blackwell, J. M. (1994). Genetic and physical mapping of 2q35 in the region of the NRAMP and IL8R genes: Identification of a polymorphic repeat in exon 2 of NRAMP. Genomics 24: 295–302. Yaneva, M., Wen, J., Ayala, A., and Cook, R. (1989). cDNA-derived amino acid sequence of the 86-kDa subunit of the Ku antigen. J. Biol. Chem. 264: 13407–13411.
AP-Genomics