A novel ML domain-containing protein (SpMD2) functions as a potential LPS receptor involved in anti-Vibrio immune response

Journal Pre-proof A novel ML domain-containing protein (SpMD2) functions as a potential LPS receptor involved in anti-Vibrio immune response

Yue Wang, Shu Zhao, Bin Zhang, Hong-Yu Ma, Wen-Hong Fang, Wen-Quan Sheng, Li-Guo Yang, Xin-Cang Li PII:

S0145-305X(19)30425-2

DOI:

https://doi.org/10.1016/j.dci.2019.103529

Reference:

DCI 103529

To appear in:

Developmental and Comparative Immunology

Received Date:

08 September 2019

Accepted Date:

22 October 2019

Please cite this article as: Yue Wang, Shu Zhao, Bin Zhang, Hong-Yu Ma, Wen-Hong Fang, WenQuan Sheng, Li-Guo Yang, Xin-Cang Li, A novel ML domain-containing protein ( SpMD2) functions as a potential LPS receptor involved in anti-Vibrio immune response, Developmental and Comparative Immunology (2019), https://doi.org/10.1016/j.dci.2019.103529

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier.

Journal Pre-proof A novel ML domain-containing protein (SpMD2) functions as a potential LPS receptor involved in anti-Vibrio immune response Yue Wanga, b, Shu Zhaoa, Bin Zhangc, Hong-Yu Mab, Wen-Hong Fanga, Wen-Quan Shenga, Li-Guo Yanga, Xin-Cang Li* aKey Laboratory of East China Sea Fishery Resources Exploitation, Ministry of Agriculture; East China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Shanghai, 200090, China bGuangdong Provincial Key Laboratory of Marine Biotechnology, Shantou University, Shantou, 5 15063, China cSchool of business, Yantai Nanshan University, Yantai, 265706, China

*Corresponding author: Dr. Xin-Cang Li East China Sea Fisheries Research Institute Chinese Academy of Fishery Sciences Shanghai 200090 China E-mail: [email protected] (X.-C. Li)

1

Journal Pre-proof Abstract: The myeloid differentiation protein 2 (MD2)-related lipid-recognition (ML) proteins display diverse biological functions in host immunity and lipid metabolism by interacting with different lipids. Human MD2, an indispensable accessory protein in TLR4 signaling pathway, specifically recognizes lipopolysaccharides (LPS), thereby leading to the activation of TLR4 signaling pathway to produce many effectors that participate in inflammatory and immune responses against Gram-negative bacteria. Toll and immune deficiency (IMD) pathways are first characterized in Drosophila and are reportedly present in crustaceans, but the recognition and activation mechanism of these signaling pathways in crustaceans remains unclear. In the present study, a novel ML protein was characterized in mud crab (Scylla paramamosain) and designated as SpMD2. The complete SpMD2 cDNA sequence is 1114 bp long with a 465 bp open reading frame; it encodes a protein that contains 154 amino acids (aa). In the deduced protein, a signal peptide (1–21 aa residues) and a ML domain (43–151 aa residues) were predicted. SpMD2 shared a similar three-dimensional structure and a close evolutionary relationship with human MD2. SpMD2 was highly expressed in gills, hemocytes, intestine, and hepatopancreas and was upregulated in gills and hemocytes after challenges with bacteria, thereby suggesting its involvement in antibacterial defense. Western blot assay showed that SpMD2 possesses strong binding activities to different bacteria and two fungi. ELISA demonstrated that SpMD2 exhibits binding abilities to LPS, lipid A, peptidoglycan (PGN), and lipoteichoic acid (LTA). Its binding ability to LPS and lipid A were stronger than to PGN or LTA, implying that SpMD2 was an important LPS-binding protein in mud crab. Bacterial clearance assay revealed that the pre-incubation of Vibrio parahemolyticus with SpMD2 facilitates bacterial clearance in vivo and that knockdown of SpMD2 dramatically suppresses the bacterial clearance and decreases the expression of several antimicrobial peptides (AMPs). Furthermore, SpMD2 overexpression could enhance the promoter activity of SpALF2. These results revealed that SpMD2 affects bacterial clearance by regulating AMPs. Thus, by binding to LPS and by regulating AMPs, SpMD2 may function as a potential receptor, which is involved in the recognition and activation of a certain immune signaling pathway against Gram-negative bacteria. This study provides new insights into the diverse functions of ML proteins and into the antibacterial mechanisms of crustaceans. Keywords: ML protein; PRR; binding activity; bacterial clearance activity; AMPs; Scylla 2

Journal Pre-proof paramamosain Introduction Invertebrates lack an adaptive immune system and mainly rely on their innate immune system to protect against pathogens. Innate immunity is highly conserved in invertebrates and vertebrates, and pattern recognition receptors (PRRs) initiate innate immune responses to resist or eliminate pathogens (Peri et al., 2010). These PRRs, such as Toll-like receptors, C-type lectin receptors, peptidoglycan recognition proteins (PGRPs), and Gram-negative binding proteins (Kawai and Akira, 2011; Hughes, 2012; Wang and Wang, 2013; Kurata, 2014; Shiokawa et al., 2017), can recognize specific pathogen-associated molecule patterns (PAMPs), thereby leading to the activation of cellular or/and humoral immunity. PAMPs are conserved microbial components that include extracellular and intracellular components, such as bacterial lipopolysaccharide (LPS), peptidoglycan (PGN), lipoteichoic acid (LTA), nucleic acids, and fungal β-1,3-glucan. The myeloid differentiation protein 2 (MD2)-related lipid-recognition (ML) family contains a large set of proteins, including myeloid differentiation protein 1 (MD1), MD2, Niemann–Pick type C2 (NPC2), the GM2 activator, the house-dust mite allergen proteins, and multiple proteins of unknown physiological function in plants, animals, and fungi. All the reported ML proteins possess a putative signal peptide and a single ML domain with two pairs of highly conserved cysteine residues to maintain their three-dimensional (3D) structures and biological functions (Inohara and Nunez, 2002). Each single domain protein is predicted to form a β-rich fold, which contains multiple strands, and to mediate diverse biological functions through interacting with different ligands. Most ML proteins are reported to play important roles in lipid metabolism and host immune defenses. In mammals, human MD2 is an essential accessory protein in TLR4-LPS signaling, which is activated by LPS and is well established to participate in host defense against Gram-negative bacteria (himazu et al., 1999; Bryant et al., 2009). Several ML proteins in invertebrates, including Manduca sexta (MsML-1) (Ao et al., 2008), Drosophila melanogaster (DmNPC2) (Shi et al., 2012), Penaeus vannamei (PvML) (Liao et al., 2011), and Bombyx mori (BmEsr16) (Zhang et al., 2018), have been characterized. These proteins can bind to LPS, and some function as potential LPS receptors involved in LPS signaling. Moreover, NPC2 protein, another invertebrate from the antenna of the

3

Journal Pre-proof worker Japanese carpenter ant, can deliver various hydrophobic semiochemicals, which play a crucial role in chemical communication (Ishida et al., 2014). Vibrio is a major marine bacterial pathogen and has caused huge economic losses to the crustacean farming industry (Han et al., 2015; Lee et al., 2015). LPS, the primary surface glycolipid of Gram-negative bacteria, is composed of a lipid A (endotoxic component), a core oligosaccharide, and a variable O-specific chain. Lipid A is a highly conserved moiety in LPS among different species and can trigger the immune responses of vertebrates. LPS activates the TLR4 signaling pathway through the indispensable accessory protein MD2 (Shimazu et al., 1999). When engaged by LPS, the CD14/TLR4/MD2 complex transduces a signal across the membrane, thereby resulting in the activation of NF-κB transcription factors, which lead to the expression of several sets of genes involved in inflammatory and immune responses (Saitoh et al., 2004; West et al., 2006). In Drosophila, Toll and immune deficiency (IMD) pathways are crucial parts of the humoral immune defense system, which modulates the secretion of circulating antimicrobial peptides (AMPs) and other immune proteins to eradicate invading pathogens. These two pathways may also function in parallel in crustaceans in response to different microorganisms (Tassanakajon et al., 2018; Li et al., 2019). PGRPs, as classical PRRs in Drosophila, can sense different types of PAMPs and play an essential role in the activation of Toll and IMD pathways (Kurata, 2014). For instance, DAPtype PGN can be recognized and bound by an essential “long form” PGRP, thereby resulting in the transfer of this immune signal from outside to inside cells (Leone et al., 2008; Kleino and Silverman, 2014). PGRPs are high-abundance proteins in Drosophila and other insects, but to date, PGRP homologs have not been characterized in crustaceans. These homologs are also not found in the whole genome sequence of shrimp (P. vannamei) (Zhang et al., 2019). Therefore, the types of proteins that function like Drosophila PGRPs in crustaceans remain unclear. In this study, we identified a novel ML protein (SpMD2) in mud crab (Scylla paramamosain). SpMD2 shared a similar 3D structure and a close evolutionary relationship with human MD2. We planned to test the binding ability of SpMD2 to microbial polysaccharides, especially LPS and lipid A. We further explored whether SpMD2 affects bacterial clearance by regulating specific AMPs to determine whether SpMD2 functions as a candidate PRR involved in a certain immune response by sensing

4

Journal Pre-proof Gram-negative bacteria. This study revealed the possible roles of SpMD2 in mud crabs and provided new insights into the diverse functions of ML proteins.

2. Materials and methods 2.1. Reagents and chemicals RNAiso Plus, First-Strand cDNA Synthesis Kit, in vitro Transcription T7 Kit, and Taq Polymerase were obtained from TaKaRa Biotech (Dalian, China). Bacterial cell wall components, including LPS (from Escherichia coli 0111: B4), lipoteichoic acid (LTA, from Staphylococcus aureus), and PGN from Bacillus subtilis (similar to Gram-negative bacterial PGN), were provided by Sigma (St. Louis, MO, USA). 2.2. Immune challenges and tissue collection Mud crabs were collected from a crab farm in Chongming County (Shanghai, China) and were cultured in aerated seawater in 400 L tanks for a week prior to the experiments. The animal experiments were strictly conducted according to the regulations of the Institutional Animal Care and Use Committee of China. The SpMD2’s tissue distribution was analyzed using healthy individuals. The hemocytes was isolated based on the method used in a previous report (Li et al., 2013a). The crabs were placed in ice for about 5 min for anesthetization, and the hemolymph was subsequently harvested from the base of the legs by using a sterilized syringe preloaded with icecold anticoagulant buffer (0.45 M NaCl, 0.1 M glucose, 30 mM trisodium citrate, 26 mM citric acid, and 10 mM ethylenediaminetetraacetic acid; pH 4.6) (Soderhall and Smith, 1983). The hemocyte pellets were collected for RNA extraction after centrifugation (850 × g for 15 min) at 4 °C. Other tissues, such as gills, hepatopancreas, stomach, intestine, and muscle, were dissected, rinsed with sterile phosphate-buffered saline (PBS), and pooled from at least three individual crabs for total RNA isolation. The temporal expression pattern of SpMD2 was investigated after a challenge with 100 μL V. parahemolyticus (2 × 107 CFU) or 100 μL S. aureus (2 × 108 CFU) suspension, which was done by injecting the suspension into the base of the right fifth leg of each mud crab. The corresponding control was challenged with 100 μL sterile PBS (140 mM NaCl and 10 mM sodium phosphate; pH 7.4). The total RNA of the gills and hemocytes at 0, 2, 6, 12, 24, and 48 h after the challenges was extracted to investigate the temporal expression pattern of SpMD2. Extracted RNA 5

Journal Pre-proof was kept in 75% ethanol at −80 °C until use. Two other batches of RNA samples isolated previously at different times were used to eliminate differences among batches. 2.3. Total RNA isolation and cDNA synthesis RNAiso Plus reagent was used to extract the total RNA from hemocytes and other collected tissues. DNase I (Promega, USA) was added to the isolated total RNA to remove contaminated genomic DNA. First-Strand cDNA Synthesis Kit was used to synthesize the cDNA templates from the total RNA according to the manufacturer’s instructions. 2.4. cDNA cloning The original cDNA sequence encoding the putative SpMD2 was harvested through highthroughput transcriptome sequencing with the RNA mixture extracted from hemocytes, gills, and hepatopancreas. One pair of gene-specific primers (SpMD2F and SpMD2R, Table 1) was designed to verify the harvested cDNA sequence of SpMD2 by polymerase chain reaction (PCR). PCR was performed under the following parameters: 95 °C for 3 min; 35 cycles of 94 °C for 30 s, 54 °C for 30 s, and 72 °C for 30 s; followed by a final 5 min extension at 72 °C. The targeted DNA fragment was purified, subsequently cloned into a pMD-19T vector, and finally sequenced by Sangon Company (Shanghai, China). 2.5. Bioinformatics analyses The similarity analysis of SpMD2 with other ML proteins was performed using the online Basic Local Alignment Search Tool Program (BLASTP) (http://blast.ncbi.nlm.nih.gov/Blast.cgi). The deduced protein sequences were translated and predicted on http://web.expasy.org/translate/. The domain architecture was predicted using simple modular architecture research tool (SMART) (http://smart.embl-heidelberg.de). The ClustalX 2.0 program (http://www.ebi.ac.uk/tools/clustalw2) and the GENEDOC software were used to produce multiple alignments of nucleotide and amino acid sequences. The pI and molecular weight (MW) were calculated using an online software (http://web.expasy.org/compute_pi/). Signal peptide was predicted with SignalP (Nielsen et al., 1997). A neighbor-joining phylogenetic tree was performed with MEGA 7.0 (Kumar et al., 2016), and 1000 bootstraps were used to assess reliability. The 3D structure of SpMD2–lipid A complex was

predicted

by

docking

with

BSP-SLIM

ONLINE

software

(https://zhanglab.ccmb.med.umich.edu/BSP-SLIM/) and was displayed using the PyMOL program. 6

Journal Pre-proof 2.6. Quantitative real-time PCR (qRT-PCR) qRT-PCR was conducted to analyze the tissue distribution and temporal expression pattern of SpMD2 in a real-time thermal cycler Quantstudio 6 Flex (ABI, USA) in accordance with a previous protocol (Li et al., 2013b). A pair of gene-specific primers for SpMD2 (Table 1) was designed and synthesized. Another pair of specific primers for 18S rRNA (Table 1) was synthesized as internal reference. qRT-PCR was programmed following the manufacturer’s instructions. The reaction was performed in a 20 μL mixture containing 10 μL 2× SYBR Premix Ex Taq, 2 μL cDNA, and 4 μL of each primer. The amplification procedure consisted of an initial denaturation step at 95 °C for 3 min; 40 cycles at 95 °C for 10 s, and 60 °C for 30 s; and a melt curve analysis from 60 °C to 95 °C. All treatments were conducted thrice with individual templates. The relative expression levels of SpMD2 in different tissues were calculated using the 2−ΔCT method. The 2−ΔΔCT algorithm was used to investigate the temporal expression pattern of SpMD2 (Livak and Schmittgen, 2001). The obtained data were statistically analyzed. Significant differences were assessed using unpaired t-test (*, P < 0.05; **, P < 0.01). 2.7. Recombinant expression and purification of SpMD2 The cDNA sequence coding for the mature protein was amplified using a pair of primers (SpMD2EF and SpMD2ER, Table 1). The purified PCR product was completely digested by restriction enzymes (EcoR I/Xho I) and inserted into a pGEX4T1 expression vector. The recombinant plasmid pGEX4T1–SpMD2 was transformed into E. coli Rosetta (DE3) chemically competent cells grown at 37 °C in Luria–Bertani (LB) broth. Protein expression was induced with the addition of isopropyl-β-d-thiogalactoside (IPTG) to a final concentration of 0.5 mM at 37 °C for 6 h. The bacterial cells were collected by centrifugation, and the pellets were resuspended in PBS with 0.1% Triton X-100 and were lysed by probe sonication. SpMD2 was purified by Glutathione Sepharose 4B chromatography (Novagen, Merck, NJ, USA) according to a previously performed protocol (Wang et al., 2018). The recombinant SpMD2 was confirmed by performing Western blot with the antibody against GST-tag. Protein concentration was determined using the Bradford method for further investigation. 2.8. Microorganism-binding assay Nine types of microorganisms, including four Gram-negative bacteria (Vibrio harveyi, V. 7

Journal Pre-proof parahemolyticus, V. alginolyticus, and E. coli), three Gram-positive bacteria (S. aureus, B. subtilis, and B. megaterium), and two fungi (Candida albicans and Pichia pastoris), were used to investigate the microorganism-binding activity of SpMD2 by Western blot assay. The procedure was performed following our earlier study (Wang et al., 2018). Microorganisms were cultured in 10 mL LB broth for 6 h at 37 °C and were pelleted by centrifugation at 5000 × g for 5 min. The supernatant was removed, and the pellets were washed thrice with 1 mL TBS (50 mM Tris–HCl and 150 mM NaCl, pH 7.5). The microorganisms (1 × 108 CFU) were incubated with recombinant SpMD2 (100 μg) in 1 mL TBS by gentle rotation for 30 min at room temperature, pelleted, washed thrice with TBS, and eluted with 7% SDS by mild agitation for 5–10 min. The supernatants (eluates) were collected by centrifugation, and the final pellets were washed thrice. The eluates and pellets were subjected to 15% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS–PAGE). SpMD2 protein sample was also subjected to SDS-PAGE as positive control. After separation by SDS–PAGE, the protein samples were transferred onto nitrocellulose membranes, which were blocked by 5% nonfat milk for 1 h at room temperature and incubated with peroxidase-conjugated mouse monoclonal antibody against GST-tag for 2 h. SpMD2 protein signal was visualized using an ECL Western blot reagent kit. This assay was performed in three independent experiments. 2.9. Binding activity of SpMD2 to microbial polysaccharides Microbial polysaccharide-binding activity was performed using the enzyme-linked immunosorbent assay (ELISA) following a previous method (Wang et al., 2018). Briefly, 100 µL (20 µg/mL) of LPS from E. coli 0111: B4, Lipid A from LPS, LTA from S. aureus, or PGN from B. subtilis was used to coat each well of microtiter plates overnight at 37 °C. Plates were blocked with 200 μL BSA (2 mg/mL) for 2 h at 37 °C and were washed four times with TBST (0.05% Tween-20 in TBS). Subsequently, a series of diluted recombinant SpMD2 or GST proteins (0–1 μM in TBS containing 0.1 mg/mL BSA) was added to the microplates. The plates were incubated at 37 °C for 3 h. After washing the wells with TBST four times, the peroxidase-conjugated mouse monoclonal anti-GST antibody (1:5000 dilution in TBS with 1 mg/mL BSA) was added, and the plates were incubated at 37 °C for 2 h. After rewashing the wells with TBST four times, the plates had developed color using 0.01% 3,3′,5,5′-tetramethylbenzidine (Sigma, USA) liquid substrate in citric acid–Na2HPO4 buffer. The color reaction was stopped using 2 M H2SO4, and absorbance was 8

Journal Pre-proof read at 450 nm by using the Spark 10M microplate reader (Tecan, Switzerland). All assays were performed in triplicate. 2.10. RNA interference (RNAi) RNAi was conducted according to a previously described method with slight modifications (Zhang et al., 2016). In brief, a pair of gene-specific primers for SpMD2 (SpMD2iF and SpMD2iR, Table 1) was designed to synthesize a double-stranded RNA (dsSpMD2) by using the in vitro Transcription T7 Kit. Another pair of specific primers (GFPiF and GFPiR, Table 1) was synthesized and was used to generate dsGFP (EGFP dsRNA) as the negative control. Mud crabs (approximately 25 g each) were randomly divided into two groups. dsSpMD2 or dsGFP (25 μg) was injected into the crabs, and the injection was repeated after 24 h. At 40 h after the first injection, hemocytes were collected for RNA extraction. The RNAi efficiency in hemocytes was determined by semiquantitative RT-PCR using the total RNAs from hemocytes. 2.11. Bacterial clearance assay V. parahemolyticus was incubated with recombinant protein SpMD2 and was injected into crabs according to a previously described method with slight modification (Man et al., 2018) to test whether pre-incubating bacteria with SpMD2 accelerated bacterial clearance. Mud crabs were randomly divided into two groups. V. parahemolyticus was cultured in LB medium and harvested at the mid-logarithmic growth phase by centrifugation at 5000 × g for 5 min and resuspension in PBS (2 × 108 cells/mL) after washing thrice. SpMD2 or GST protein (1 mL) in PBS (500 μg/mL) was mixed with an equal volume of bacterial suspension with gentle rotation at room temperature for 15 min. GST served as the control. After incubation, the mixtures (200 μL) were injected into crabs. At each time point post-injection (5, 15, and 25 min), 200 μL of hemolymph was collected. After serial dilution with PBS, the diluted hemolymph (100 μL) was coated onto the LB plates. These plates were incubated at 37 °C overnight, and the number of bacterial colonies on the plates was counted. After validating that SpMD2 expression could be silenced by injection of dsSpMD2, we examined whether the knockdown of SpMD2 affected bacterial clearance. Mud crabs were injected with 200 μL of V. parahemolyticus suspension (2 × 107 cells) at 40 h after injection with dsSpMD2 or dsGFP. Hemolymph (200 μL) was collected at 5, 15, and 25 min after the injection with bacteria. The number of residual bacteria in the hemolymph was calculated using the method 9

Journal Pre-proof described above. Unpaired Student’s t-test was used to assess significant differences. (*, P < 0.05; **, P < 0.01). 2.12. Expression analysis of AMPs after SpMD2 knockdown AMP expression levels after injection with dsSpMD2 or dsGFP were investigated. The mud crabs were divided into two groups, and each group contained nine crabs. Each crab was injected twice with dsSpMD2 or dsGFP as described above. Total RNA was extracted at 40 h after dsRNA injection, and the cDNA was synthesized. The expression levels of AMPs, including anti-LPS factor 1 (SpALF1), SpALF2, SpALF3, SpALF4, SpALF5, and SpALF6, were examined with qRT-PCR. The gene-specific primers are listed in Table 1. 2.13. Plasmid constructions and dual-luciferase reporter assays One pair of gene-specific primers (Table 1) was designed to obtain the coding mature peptide sequence of SpMD2. The harvested fragment of SpMD2 was cloned into the EcoR I/Xho I site of pAc5.1/V5-His B vector (Invitrogen, USA) to generate the plasmid pAc5.1B-SpMD2. A luciferase reporter vector, namely PGL3-SpALF2p, which was previously constructed by cloning the promoter sequences of the mud crab SpALF2 into the PGL3-basic vector (unpublished data), was also used in this study. Drosophila Schneider 2 (S2) cells were cultured at 28 °C in Schneider’s Drosophila medium (Gibco) supplemented with 10% fetal bovine serum (Invitrogen, USA). In dual-luciferase reporter assay, cells were seeded in a 24-well plate (Corning, USA). After seeding for 2 h, cells were cotransfected with 0.5 μg firefly luciferase reporter plasmid (PGL3-basic or PGL3-SpALF2p), 0.05 μg pRL-TK Renilla luciferase plasmid (Promega), and 0.5 μg expression plasmid (pAc5.1/V5-HisB or pAc5.1B-SpMD2) per well by using the FuGENE HD Transfection Reagent (Promega). The pAc5.1/V5-HisB and PGL3-basic were used as negative and blank control plasmids, respectively. The Renilla luciferase plasmid pRL-TK was used as the internal reference. At 48 h post transfection, the activities of firefly and Renilla luciferases were measured using DualGlo® Luciferase Assay System kit (Promega) according to the manufacturer’s protocol. Each experiment was performed in triplicate. Unpaired Student’s t-test was used to analyze significant differences (*, P < 0.05; **, P < 0.01).

10

Journal Pre-proof 3. Results 3.1. cDNA cloning of SpMD2 The harvested full-length cDNA sequence of SpMD2 had 1114 bp, including a 126 bp 5′ untranslated region (UTR), a 465 bp open reading frame encoding a 154-amino acid polypeptide, and a 3′ noncoding region of 523 bp with a canonical polyadenylation signal AATAAA, and a poly(A) tail (GenBank Accession No. MK109797) (Fig. 1A). The domain architecture of SpMD2 based on the SMART analysis program is shown schematically (Fig. 1B). The deduced protein sequence of SpMD2 contained a signal peptide (1–21 aa residues) and ML domain (43–151 aa residues). The mature peptide of SpMD2 had a predicted MW of 15.6 kDa and a theoretical pI of 7.78. 3.2. Similarity and phylogenetic analyses The BLASTP search analysis demonstrated that SpMD2 shared more than 60% identity with two ML domain-containing proteins from Hyalella azteca (two isoforms: XP_018024550 and XP_018024548). SpMD2 also shared 27.5% identity with Spodoptera litura ML protein (XP_022827171), 19.75% identity with B. mori BmEsr16 (NP_001093080), 18.83% identity with M. sexta ML1 (ABY55152), 17.09% identity with PvML (ADX33319), and 16.37% identity with Homo sapiens MD2 (BAA78717). The alignment of the representative ML protein sequences revealed low similarity among them except for the five conserved cysteine residues present in each ML protein (Fig. 2). Four cysteine residues were well conserved in the ML superfamily and formed two disulfide bonds, which are essential for maintaining the structure and biological function of ML proteins. A phylogenetic tree was constructed to analyze their evolutionary relationships by using ML domain-containing proteins from BLASTP results and relevant reports in invertebrates and vertebrates. In this tree, ML proteins were divided into two large clusters (Fig. 3). SpMD2, HaML1, MsML1, and MD1 and MD2 from vertebrates formed a meaningful node value of 94, suggesting that they have a close evolutionary relationship. NPC2 and the ML proteins from Eriocheir sinensis, P. japonicus, P. vannamei, and B. mori formed another cluster (Fig. 3). 3.3. Molecular docking of SpMD2–lipid A complex

11

Journal Pre-proof Docking was performed with the receptor protein SpMD2 and ligand lipid A (a moiety of LPS) to investigate whether SpMD2 protein possesses LPS-binding potential. As shown in Fig. 4, the SpMD2 protein contained a deep hydrophobic cavity, which can accommodate the lipid A. The 3D structure of SpMD2–lipid A complex with the highest docking score (6.206) was similar to that of HsMD2–lipid A complex, which had a higher docking score (7.510). This result suggested that SpMD2 had the potential to bind to LPS. 3.4. SpMD2 was highly expressed in the gills qRT-PCR was conducted using the total RNA extracted from the different tissues of healthy crabs to investigate the tissue distribution of SpMD2. As shown in Fig. 5A, SpMD2 was detected in the hemocytes, gills, hepatopancreas, and intestine. The highest expression level of SpMD2 was observed in the gills, and no apparent expression was observed in the muscle and stomach. 3.5. SpMD2 was upregulated with bacterial challenges SpMD2 was highly expressed in the gills and hemocytes. As such, its temporal expression profiles in these tissues were further investigated after challenges with V. parahemolyticus and S. aureus. As shown in Fig. 5B, after injection with V. parahemolyticus, the expression level of SpMD2 in gills was significantly upregulated from 6 h to 24 h and returned to normal at 48 h post-injection. The highest transcriptional level of SpMD2, which was approximately a fourfold increase, was detected at 6 h after V. parahemolyticus injection. The injection of S. aureus caused a rapid increase of SpMD2, and the peak of expression was observed at 2 h. The expression of SpMD2 finally returned to normal at 12 h post-injection (Fig. 5C). Similarly, the transcripts of SpMD2 in hemocytes were also increased after a challenge with S. aureus or V. parahemolyticus (Fig. 5D and 5E). In the V. parahemolyticus-challenged experiments, the transcripts of SpMD2 in the hemocytes were remarkably elevated from 2 to 12 h and then recovered gradually. Its transcripts were increased by approximately threefold only at 6 h after injection with S. aureus. All the results suggested that SpMD2 might participate in antibacterial immune responses of mud crabs. 3.6 Recombinant expression and purification of SpMD2 SpMD2 was expressed as a GST-tagged fusion protein by using the E. coli expression system and was purified with glutathione resin. Purified SpMD2 contained a mature peptide (theoretical MW, ~15.6 kDa) and an approximately 27.9 kDa vector protein (containing a GST tag). As shown 12

Journal Pre-proof in Fig. 6, the predicted MW of recombinant SpMD2 was roughly consistent with the expected size of the single band that appeared in the purified protein lane. Furthermore, this single band was also specifically recognized by the antibody against GST-tag. 3.7. SpMD2 exhibited microorganism-binding activity Western blot assay was conducted to examine the microorganism-binding capacity of SpMD2. The recombinant protein was detected in pellets, thereby showing that SpMD2 possessed a strong binding activity, whereas the one only detected in elution meant that it exhibited weak binding activity. As shown in Fig. 7, SpMD2 was detected in the pellets of all nine microorganisms, thereby showing that it possessed strong binding activity to all these microbes, namely, four Gram-negative bacteria (V. alginolyticus, V. parahemolyticus, V. harveyi, and E. coli), three Gram-positive bacteria (S. aureus, B. subtilis, and B. megaterium), and two fungi (C. albicans and P. pastoris). Furthermore, the SpMD2 bands generated by binding to V. alginolyticus, V. parahemolyticus, V. harveyi, and E. coli were darker and bolder than those produced by binding to the other microbes. This result showed that SpMD2 exhibited more potent binding ability to Gram-negative bacteria than to other microorganisms. 3.8. SpMD2 exhibited strong binding activity to LPS and lipid A Given that SpMD2 exhibited strong binding activities to the tested microbial cells, we speculated that some components on the cell surface were recognized by SpMD2. ELISA was conducted to investigate the binding activity of SpMD2 to major microbial cell wall components. As shown in Fig. 8, SpMD2 bound to LPS, lipid A, PGN, and LTA in varying degrees. Moreover, it exhibited stronger binding activity to LPS than to PGN from B. subtilis. LPS was conjectured to be the major binding site on the surface of Gram-negative bacteria, because PGNs from B. subtilis and Gram-negative bacteria shared a common structure. SpMD2 also exhibited strong binding activity to lipid A (a moiety of LPS), thereby revealing that its binding activity to Gram-negative bacteria was mainly via binding to lipid A. In addition, SpMD2 displayed weak binding activity to LTA from S. aureus, thereby demonstrating that LTA was the binding site on the surface of Grampositive bacteria. These results revealed that SpMD2 possessed broad binding activity to microbial cell wall components, and it had the highest affinity to lipid A. 3.9. SpMD2 promoted V. parahemolyticus clearance in hemolymph 13

Journal Pre-proof SpMD2 exhibited strong binding abilities to Gram-negative bacteria and LPS. Thus, we investigated whether SpMD2 could facilitate the clearance of V. parahemolyticus in vivo through its binding activity. V. parahemolyticus, which was pre-incubated with SpMD2 or GST protein, was injected into healthy crabs. The number of bacteria in the hemolymph significantly decreased at 5, 15, and 25 min after injection with SpMD2-incubated V. parahemolyticus compared with that treated with GST (Fig. 9). At 25 min after the injection of bacteria treated with SpMD2, nearly 80% of V. parahemolyticus in hemolymph were eliminated compared with the control crabs. Preincubating V. parahemolyticus with SpMD2 accelerated bacterial clearance in vivo. 3.10. Knockdown of SpMD2 suppressed bacterial clearance in hemolymph RNAi of SpMD2 and bacterial clearance assays were conducted to investigate the function of SpMD2 in vivo. Semi-quantitative RT-PCR analysis showed that the transcripts of SpMD2 in hemocytes significantly declined at 40 h after the first injection of dsSpMD2 and that the amount of SpMD2 transcripts decreased by approximately 90% compared with that of the control crabs (Fig. 10A and 10B). This result indicated that the injection of dsSpMD2 into crabs could dramatically suppress SpMD2 expression. After SpMD2 knockdown, V. parahemolyticus was injected into crabs, and the residual number in hemolymph was counted to determine bacterial clearance ability. As shown in Fig. 10C, the number of residual bacteria in the hemolymph significantly increased at 5, 15, and 25 min post-injection compared with that in dsGFP group. This result revealed that the bacterial clearance ability was remarkably suppressed in SpMD2-silenced crabs. The AMP expression levels in hemocytes of mud crabs at 40 h after injection with dsSpMD2 or dsGFP were investigated by qRT-PCR to determine whether the presence of AMP in the hemolymph was relevant to bacterial clearance. The transcripts of SpALF1, SpALF2, SpALF3, and SpALF6 were significantly decreased in SpMD2-silenced crabs compared with the control group. However, no significant change was observed on SpALF4 and SpALF5 expressions in hemocytes between the abovementioned two groups (Fig. 10D). These results demonstrated that SpMD2 knockdown could significantly suppress the expression of some AMPs, thereby suggesting that the low expression of certain AMPs contributed to the decrease of bacterial clearance ability. 3.11. SpMD2 regulates the expression of SpALF2 SpALF2 might be the downstream gene of SpMD2, because the latter’s knockdown severely 14

Journal Pre-proof suppressed the former’s expression. Dual-luciferase reporter assays were conducted to further determine whether SpMD2 regulates SpALF2 expression. As shown in Fig. 11, SpMD2 overexpression increased the promoter activity of SpALF2 by about fivefold compared with the control group, thereby indicating that SpMD2 can regulate the expression of SpALF2, which acts as the upstream component of a certain signaling pathway. Discussion ML superfamily proteins are widely distributed in vertebrates and invertebrates and exhibit diverse physiological functions. In the present study, a novel ML protein (SpMD2) in S. paramamosain, which shares a similar 3D structure and has close evolutionary relationship with human MD2, was characterized. Like human MD2, SpMD2 displayed strong binding activity to LPS and lipid A. Furthermore, SpMD2 affected V. parahemolyticus clearance in vivo by regulating the expressions of several AMPs. These findings suggested that SpMD2 may function as a potential PRR in a certain immune signal pathway against Gram-negative bacteria. ML proteins have been classified into four groups based on the degree of sequence similarity (Inohara and Nunez, 2002). Human MD1 and MD2 belong to Group I. NPC2 and mite major allergen proteins comprise Group II. Group III contains multiple fungal and plant ML proteins, and group IV is composed of human GM2A and its orthologs. In this study, we found SpMD2 had a closer evolutionary relationship with human MD2 than most reported ML proteins in arthropods. Although SpMD2 shares low identity with human MD2, these two proteins have a similar dimensional structure, and the former participates in immune defense against Gram-negative bacteria by regulating the expression of AMPs, which is similar to the latter. Thus, we defined this protein as a homolog of MD2, namely SpMD2. The phylogenetic tree showed that SpMD2 and HaML (a crustacean ML protein) formed a unique meaningful cluster, which was different from another cluster containing the other reported crustacean ML proteins. Thus, we speculated that these two proteins are MD2 homologs. MD2 homologs may exist in crustaceans and possess close evolutionary relationships and similar biological functions. Human MD-2 mRNA is mainly expressed in the spleen, which is the “blood bank” and the largest lymphoid organ in the human body. During systemic infection, the MD2 protein concentration in human body fluids and MD2 mRNA expression in monocytes are positively 15

Journal Pre-proof regulated (Pugin et al., 2004). The upregulation of MD2 and its wide distribution facilitate the recognition of invading pathogens. Similarly, in invertebrates, MsML-1 and BmEsr16 are highly expressed in defense-related tissues, such as hemocytes and body fat, and are upregulated by bacterial challenge. They are shown to participate in humoral immunity by mediating LPS signaling in arthropods (Ao et al., 2008; Zhang et al., 2018). In contrast to these two genes that are highly expressed in several immune tissues, PvML is only distributed in the hepatopancreas (Liao et al., 2011). We speculate that the performing area of PvML is limited and that its biological function is different from the above MLs. In our study, SpMD2 can be positively induced after a challenge with bacteria and is highly expressed in gills and hemocytes. Hemocytes are expected to be widespread in mud crab, because the open circulating system is a typical feature of crustaceans and insects. Thus, SpMD2 in hemolymph may function as MD2 in human body fluids involved in humoral immunity. By binding to different components, ML proteins exhibit diverse biological functions. In mammals, human MD2 recognizes the Gram-negative bacterial component LPS by binding to lipid A, which functions as a pathogen recognition receptor in the human TLR4 signaling pathway. In arthropods, two MLs can specifically bind to LPS and function as LPS receptors involved in LPS signaling (Ao et al., 2008; Zhang et al., 2018). Moreover, some ML proteins possess binding activity to LTA and PGN (Shi et al., 2012; Zhang et al., 2018), and another ML protein from the antenna of the worker Japanese carpenter ant can deliver various hydrophobic semiochemicals, which play a crucial role in chemical communication (Ishida et al., 2014). These reports show that the arthropod members of the ML superfamily are multifunctional proteins that participate in different biological processes. In the present study, SpMD2 bound to a variety of pathogenic microorganisms, including Gram-negative and Gram-positive bacteria and some fungi, and exhibited broad binding abilities to microbial polysaccharides, including LPS, PGN, and LTA. These findings revealed that SpMD2 might be involved in several immune responses. Considering that SpMD2 possessed a higher affinity to LPS than to PGN and LTA, LPS should be the major polysaccharide bound by SpMD2. Therefore, SpMD2 is a crucial binding protein and may be involved in LPS-induced immune response in mud crab.

16

Journal Pre-proof PRRs participate in host immune defense by binding to specific ligands, thereby resulting in the occurrence of innate immune responses (Medzhitov and Janeway, 2002; Li and Xiang, 2013). By binding to LPS, human MD2 is the key component in the activation of the TLR4 signaling pathway, thereby leading to the generation of many downstream effectors to participate in immune defense (Saitoh et al., 2004; West et al., 2006). In Drosophila, PGRPs can sense different types of PAMPs that play an essential role in the activation of Toll and IMD pathways (Kurata, 2014). More evidence revealed that Toll and IMD signaling pathways may exist in crustaceans (Tassanakajon et al., 2018), but PGRP homologs have not been identified in any crustacean. The recognition and activation mechanism of these signaling pathways remains unclear. Given that PGRPs are highly abundant proteins in Drosophila and other insects, and similar molecules are not found even in the genome sequence of shrimp (Zhang et al., 2019), we speculated that crustaceans have some other proteins functioning as PGRPs, which mediate the activation of immune signaling pathways. SpMD2 exhibited specific binding ability to LPS and lipid A and suppressed V. parahemolyticus clearance by downregulating the expression of several AMP genes (including SpALF2). Moreover, SpMD2’s overexpression promoted the transcription of SpALF2. These findings suggested that SpMD2 is the upstream component in a signaling pathway against Gram-negative bacteria. Previous studies revealed that mud crab has a SpToll-mediated signaling pathway (Li et al., 2013a; Li et al., 2013b; Lin et al., 2012; Chen et al., 2018), which is responsible for anti-Vibrio defense by regulating the expression of some AMP genes, including SpALF2 and other AMPs. Thus, we speculated that SpMD2 is a receptor protein in SpToll signaling pathway and that it mediates the activation of this pathway by sensing LPS to regulate the expression of AMPs. However, whether SpMD2 was an indeed receptor in this pathway required further work to elucidate, because no evidence showed that SpMD2 interacted with any component in the SpToll signaling pathway. Moreover, SpMD2 possessed broad binding activities to several polysaccharides, implying that it might play roles not just in this signaling pathway. Nonetheless, SpMD2 could bind to LPS and facilitated bacterial clearance by upregulating the expression of AMPs. These results suggest that SpMD2 is a potential receptor that is involved in the activation of the immune response against Gram-negative bacteria. In conclusion, a novel ML protein, namely, SpMD2, was characterized in the present study. SpMD2 shares a similar 3D structure and close evolutionary relationship with human MD2. Like 17

Journal Pre-proof human MD2, SpMD2 can specifically bind to LPS and to its core moiety lipid A. Coating V. parahemolyticus with SpMD2 significantly promotes the bacterial clearance in vivo. The knockdown of SpMD2 dramatically suppresses bacterial clearance in hemolymph and declines the expression of some AMPs. Furthermore, SpMD2 overexpression can enhance the promoter activity of SpALF2. These results suggested that SpMD2 might function as a potential receptor that is involved in a certain immune signaling pathway against Gram-negative bacteria by sensing LPS to induce AMPs. This study provided new insights into the diverse functions of ML proteins and into the antibacterial mechanisms of crustaceans. Acknowledgements This work was supported by the Central Public-interest Scientific Institution Basal Research Foundation, CAFS (No. 2016RC-LX04), the Shanghai Municipal Natural Science Foundation (No. 16ZR1444800), and the National Natural Science Foundation of China (No. 31772886). References Ao, J.Q., Ling, E., Rao, X.J., Yu, X.Q., 2008. A novel ML protein from Manduca sexta may function as a key accessory protein for lipopolysaccharide signaling. Mol. Immunol. 45, 2772-81. Bryant, C.E., Spring, D.R., Gangloff, M., Gay, N.J., 2009. The molecular basis of the host response to lipopolysaccharide. Nat. Rev. Microbiol. 8, 8. Chen, Y., Aweya, J.J., Sun, W., Wei, X., Gong, Y., Ma, H., et al., 2018. SpToll1 and SpToll2 modulate the expression of antimicrobial peptides in Scylla paramamosain. Dev. Comp. Immunol. 87, 124-36. Han, J.E., Tang, K.F., Lightner, D.V., 2015. Genotyping of virulence plasmid from Vibrio parahaemolyticus isolates causing acute hepatopancreatic necrosis disease in shrimp. Dis. Aquat. Organ. 115, 245-51. Hou, Z.G., Wang, Y., Hui, K., Fang, W.H., Zhao, S., Zhang, J.X., et al., 2017. A novel antilipopolysaccharide factor SpALF6 in mud crab Scylla paramamosain exhibiting different antimicrobial activity from its single amino acid mutant. Dev. Comp. Immunol. 72, 44-56. Hughes, A.L., 2012. Evolution of the betaGRP/GNBP/beta-1,3-glucanase family of insects. Immunogenetics 64, 549-58. Inohara, N., Nunez, G., 2002. ML -- a conserved domain involved in innate immunity and lipid metabolism. Trends Biochem. Sci. 27, 219-21. Ishida, Y., Tsuchiya, W., Fujii, T., Fujimoto, Z., Miyazawa, M., Ishibashi, J., et al., 2014. NiemannPick type C2 protein mediating chemical communication in the worker ant. P. Natl. Acad. Sci. USA. 111, 3847-52. Kawai, T., Akira, S., 2011. Toll-like receptors and their crosstalk with other innate receptors in infection and immunity. Immunity 34, 637-50. Kleino, A., Silverman, N., 2014. The Drosophila IMD pathway in the activation of the humoral 18

Journal Pre-proof immune response. Dev. Comp. Immunol. 42, 25-35. Kumar, S., Stecher, G., Tamura, K., 2016. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 33, 1870-4. Kurata, S., 2014. Peptidoglycan recognition proteins in Drosophila immunity. Dev. Comp. Immunol. 42, 36-41. Lee, C.T., Chen, I.T., Yang, Y.T., Ko, T.P., Huang, Y.T., Huang, J.Y., et al., 2015. The opportunistic marine pathogen Vibrio parahaemolyticus becomes virulent by acquiring a plasmid that expresses a deadly toxin. P. Natl. Acad. Sci. USA. 112, 10798-803. Leone, P., Bischoff, V., Kellenberger, C., Hetru, C., Royet, J., Roussel, A., 2008. Crystal structure of Drosophila PGRP-SD suggests binding to DAP-type but not lysine-type peptidoglycan. Mol. Immunol. 45, 2521-30. Li, C., Wang, S., He, J., 2019. The Two NF-κB Pathways Regulating Bacterial and WSSV Infection of Shrimp. Front Immunol. 10, 1785. Li, F., Xiang, J., 2013. Recent advances in researches on the innate immunity of shrimp in China. Dev. Comp. Immunol. 39, 11-26. Li, X.C., Zhang, X.W., Zhou, J.F., Ma, H.Y., Liu, Z.D., Zhu, L., et al., 2013a. Identification, characterization, and functional analysis of Tube and Pelle homologs in the mud crab Scylla paramamosain. PloS one 8, e76728. Li, X.C., Zhu, L., Li, L.G., Ren, Q., Huang, Y.Q., Lu, J.X., et al., 2013b. A novel myeloid differentiation factor 88 homolog, SpMyD88, exhibiting SpToll-binding activity in the mud crab Scylla paramamosain. Dev. Comp. Immunol. 39, 313-22. Liao, J.X., Yin, Z.X., Huang, X.D., Weng, S.P., Yu, X.Q., He, J.G., 2011. Cloning and characterization of a shrimp ML superfamily protein. Fish shellfish Immunol. 30, 713-9. Lin, Z., Qiao, J., Zhang, Y., Guo, L., Huang, H., Yan, F., et al., 2012. Cloning and characterisation of the SpToll gene from green mud crab, Scylla paramamosain. Dev. Comp. Immunol. 37, 164-75. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402-8. Man, X., Pan, X.T., Zhang, H.W., Wang, Y., Li, X.C., Zhang, X.W., 2018. A mannose receptor is involved in the anti-Vibrio defense of red swamp crayfish. Fish shellfish Immunol. 82, 258-66. Medzhitov, R., Janeway, C.A., Jr., 2002. Decoding the patterns of self and nonself by the innate immune system. Science 296, 298-300. Nielsen, H., Engelbrecht, J., Brunak, S., von Heijne, G., 1997. Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Protein Eng. 10, 1-6. Peri, F., Piazza, M., Calabrese, V., Damore, G., Cighetti, R., 2010. Exploring the LPS/TLR4 signal pathway with small molecules. Biochem. Soc. Trans. 38, 1390-5. Pugin, J., Stern-Voeffray, S., Daubeuf, B., Matthay, M.A., Elson, G., Dunn-Siegrist, I., 2004. Soluble MD-2 activity in plasma from patients with severe sepsis and septic shock. Blood 104, 4071-9. Saitoh, S., Akashi, S., Yamada, T., Tanimura, N., Kobayashi, M., Konno, K., et al., 2004. Lipid A antagonist, lipid IVa, is distinct from lipid A in interaction with Toll-like receptor 4 (TLR4)MD-2 and ligand-induced TLR4 oligomerization. Int. Immunol. 16, 961-9. Shi, X.Z., Zhong, X., Yu, X.Q., 2012. Drosophila melanogaster NPC2 proteins bind bacterial cell wall components and may function in immune signal pathways. Insect Biochem. Molec. 42, 19

Journal Pre-proof 545-56. Shimazu, R., Akashi, S., Ogata, H., Nagai, Y., Fukudome, K., Miyake, K., et al., 1999. MD-2, a molecule that confers lipopolysaccharide responsiveness on Toll-like receptor 4. J. Exp. Med. 189, 1777-82. Shiokawa, M., Yamasaki, S., Saijo, S., 2017. C-type lectin receptors in anti-fungal immunity. Curr. Opin. Microbiol. 40, 123-30. Soderhall, K., Smith, V.J., 1983. Separation of the haemocyte populations of Carcinus maenas and other marine decapods, and prophenoloxidase distribution. Dev Comp Immunol. 7, 229-39. Tassanakajon, A., Rimphanitchayakit, V., Visetnan, S., Amparyup, P., Somboonwiwat, K., Charoensapsri, W., et al., 2018. Shrimp humoral responses against pathogens: antimicrobial peptides and melanization. Dev. Comp. Immunol. 80, 81-93. Wang, X.W., Wang, J.X., 2013. Pattern recognition receptors acting in innate immune system of shrimp against pathogen infections. Fish Shellfish Immunol. 34, 981-9. Wang, Y., Zhang, X.W., Wang, H., Fang, W.H., Ma, H., Zhang, F., et al., 2018. SpCrus3 and SpCrus4 share high similarity in mud crab (Scylla paramamosain) exhibiting different antibacterial activities. Dev. Comp. Immunol. 82, 139-51. West, A.P., Koblansky, A.A., Ghosh, S., 2006. Recognition and signaling by toll-like receptors. Annu. Rev. Cell Dev. Biol. 22, 409-37. Zhang, R.N., Ren, F.F., Zhou, C.B., Xu, J.F., Yi, H.Y., Ye, M.Q., et al., 2018. An ML protein from the silkworm Bombyx mori may function as a key accessory protein for lipopolysaccharide signaling. Dev. Comp. Immunol. 88, 94-103. Zhang, X., Yuan, J., Sun, Y., Li, S., Gao, Y., Yu, Y., et al., 2019. Penaeid shrimp genome provides insights into benthic adaptation and frequent molting. Nat. Commun. 10, 356. Zhang, X.W., Wang, Y., Wang, X.W., Wang, L., Mu, Y., Wang, J.X., 2016. A C-type lectin with an immunoglobulin-like domain promotes phagocytosis of hemocytes in crayfish Procambarus clarkii. Sci. Rep. 6, 29924.

20

Journal Pre-proof

Table 1. Primers used in this study. Primers

Sequence (5′–3′)

cDNA cloning SpMD2F

ATGAAGGGGCCATGTGCGGT

SpMD2R

CTATATGATGTTGATCTTGAAT

Real-time PCR SpMD2RF

CTGAGGGATTCCAACCACGAC

SpMD2RR

GCCCGTAGGTTGTGTGACTGA

18S rRNA 18SF

CAGACAAATCGCTCCACCAAC

18SR

GACTCAACACGGGGAACCTCA

Protein expression SpMD2EF

TACTCAGAATTCTTCCAACCACGACGTATC

SpMD2ER

TACTCACTCGAGCTATATGATGTTGATCTTG

Dual-luciferase reporter assays SpMD2DF

5′-CCGGAATTCTGCCATGGAGGGATTCCAACC-3′

SpMD2DR

5′-CCGCTCGAGCGTATGATGTTGATCTTG-3'

RNAi SpMD2iF

GCGTAATACGACTCACTATAGGGTTCCAACCACGACGTATC

SpMD2iR

GCGTAATACGACTCACTATAGGGTATGATGTTGATCTTGAAT

GFPiF

GCGTAATACGACTCACTATAGGGTGGTCCCAATTCTCGTGGAC

GFPiR

GCGTAATACGACTCACTATAGGGCTTGAAGTTGACCTTGATGCC

The expression of AMPs SpALF1RF

AACTCATCACGGAGAATAACGC

SpALF1RR

CTTCCTCGTTGTTTTCACCCTC

SpALF2RF

CTTCTCGTCGTGTTATCCATTG

SpALF2RR

GAGTCAGCGATTCTCCCTTG

SpALF3RF

GGGTCATCCAGGGAAGCCATC

SpALF3RR

TCGCTCTCCTCCTCGCACACT

SpALF4RF

CCGCAGTCCTCACATCTACAG

SpALF4RR

TCCTCGCCTTACAATCTTCTG

SpALF5RF

CTTGAAGGGACGAGGTGATGAG

SpALF5RR

TGACCAGCCCATTCGCTACAG

SpALF6RF

GGTGAACAGGGCTATCGCA

SpALF6RR

GCACACTATTTGTAGGTCCAGG

Restriction enzyme sites are in bold and italics, and Kozak translation initiation sequence is underlined.

21

Journal Pre-proof

Fig. 1. Full-length cDNA, deduced amino acid sequences, and schematic illustration of the SpMD2. (A) The signal peptide is shown in red, and the stop codon is indicated by an asterisk (*). The ML domain is shaded in gray. The conserved cysteine residues are highlighted in bold with blue font. Polyadenylation signal is boxed. (B) Schematic structure of SpMD2.

22

Journal Pre-proof

Fig. 2. Multiple alignment of SpMD2 with other representative ML domain-containing proteins. Mm, Mus musculus; Hs, Homo sapiens; Rn, Rattus norvegicus; Dm, Drosophila melanogaster; Pv, Penaeus vannamei; Es, Eriocheir sinensis; Pj, Penaeus japonicus; Bm, Bombyx mori; Ms, Manduca sexta; Ha, Hyalella azteca; Sp, Scylla paramamosain. The black triangle represents the highly conserved cysteine.

23

Journal Pre-proof

100 100

MmMD2 (BAA93619) RnMD2 (AAX73194) HsMD2 (BAA78717)

98

HsMD1 (NP 004262) 94

100

MmMD1 (NP 034875) MsML1 (ABY55152) HaML (XP 018024550)

43 100 63

SpMD2 DmNPC2 (AAN13595) BmEsr16(NP 001093080)

100

HsNPC2 (NP 006423) MmNPC2 (NP 075898) EsML (ADK66340)

70

PvML (ABD65303)

73 100

PjML (AKO69814)

Fig. 3. Phylogenetic analysis of SpMD2 and other retrieved ML domain-containing proteins by MEGA 7.0. Bootstrap analysis (1000 replications) values are shown at each node. SpMD2 is marked with red triangle. The corresponding GenBank accession numbers and names are listed in the figure. Mm, Mus musculus; Hs, Homo sapiens; Rn, Rattus norvegicus; Dm, Drosophila melanogaster; Pv, Penaeus vannamei; Es, Eriocheir sinensis; Pj, Penaeus japonicus; Bm, Bombyx mori; Ms, Manduca sexta; Ha, Hyalella azteca; Sp, Scylla paramamosain.

24

Journal Pre-proof

(A)

(B)

Fig. 4. The predicted 3D structure of SpMD2–Lipid A complex. The SpMD2–Lipid A complex with a docking score of 6.206 is displayed in two different manners (A, B). The structure shown in stick is (heptosyl)2-Kdo2-Lipid A.

25

Journal Pre-proof

(A)

(B)

(C)

(D)

(E)

Fig. 5. Tissue distribution and expression pattern of SpMD2 in mud crab. Tissue distribution of SpMD2 in normal mud crab (A). Time course expression profiles of SpMD2 in the gills after challenge with V. parahemolyticus (B) or S. aureus (C). The temporal expression profiles of SpMD2 in the hemocytes after a challenge with V. parahemolyticus (D) or S. aureus (E) were also detected by qRT-PCR. The asterisks indicate significant differences (*: P < 0.05) compared with the control.

26

Journal Pre-proof

4

Fig. 6. SDS–PAGE analysis of recombinant SpMD2 expressed in E. coli. Lane M, protein marker; Lane 1, total proteins obtained from E. coli containing expression vector without IPTG; Lane 2, total proteins obtained from E. coli containing expression vector with IPTG induction; Lane 3, purified SpMD2; Lane 4, recombinant SpMD2 was confirmed by performing Western blot with the antibody against GST-tag.

27

Journal Pre-proof

Eluates Pellets

Control

Gram—

Gram +

Fungi

Fig. 7. Western blot analysis of recombinant SpMD2’s binding to microorganisms. Three Grampositive bacteria, four Gram-negative bacteria, and two fungi were selected for the analysis of recombinant SpMD2’s binding activities. Top panel, eluate fractions; bottom panel, final pellet fractions. Recombinant SpMD2 was sampled as the positive control.

28

Journal Pre-proof

Fig. 8. Microbial polysaccharide-binding ability was examined using ELISA. LPS from E. coli 0111: B4 (A), Lipid A from LPS, peptidoglycan (PGN) from B. subtilis (C), or LTA from S. aureus (D) was used to coat plates. Recombinant SpMD2 and GST protein (negative control) were diluted and added to the coated plates. Results were obtained from three independent experiments.

29

Journal Pre-proof

Fig. 9. Bacterial clearance ability of SpMD2 in vivo. Vibrio parahemolyticus pre-incubated with SpMD2 was injected into mud crabs. The residual bacteria in hemolymph at 5, 15, or 25 min after injection were counted. GST was used as the negative control. Asterisks indicate significant differences (*: P < 0.05, **: P < 0.01).

30

Journal Pre-proof

Fig. 10. RNA interference efficiency and bacterial clearance ability of SpMD2. RNA interference was detected by semi-quantitative PCR after 40 h injection with dsGFP or dsSpMD2 (A). dsGFP was sampled as negative control. Based on the light density values of DNA electrophoresis bands generated from semi-quantitative PCR products, the RNAi efficiency was calculated (B). Bacterial clearance experiment upon RNA interference with dsGFP or dsSpMD2. The number of bacteria was detected at 5, 15, or 25 min post-bacteria injection (C). qRT-PCR analysis of the antimicrobial peptide genes (D). Asterisks indicate significant differences compared with the control (*: P < 0.05, **: P < 0.01).

31

Journal Pre-proof

Fig. 11. Dual-luciferase reporter assay in S2 cells. pGL3-SpALF2p was the recombinant luciferase reporter vector, and pGL3-basic and pAc5.1B served as blank and negative controls, respectively. Asterisks indicate significant differences (**: P < 0.01) compared with the control.

32

Journal Pre-proof SpMD2 shared similar 3D structure with human MD2. SpMD2 displayed strong binding activity to LPS and lipid A. SpMD2 knockdown suppressed bacterial clearance in vivo and some AMPs’ expression. SpMD2 might function as a potential PRR involved in anti-Vibrio immunity.