Adaptations of lipid metabolism and food intake in response to low and high fat diets in juvenile grass carp (Ctenopharyngodon idellus)

Aquaculture 457 (2016) 43–49

Contents lists available at ScienceDirect

Aquaculture journal homepage: www.elsevier.com/locate/aquaculture

Adaptations of lipid metabolism and food intake in response to low and high fat diets in juvenile grass carp (Ctenopharyngodon idellus) Aixuan Li a,1, Xiaochen Yuan a,1, Xu-Fang Liang a,⁎, Liwei Liu a, Jie Li a, Bin Li a, Jinguang Fang a, Jiao Li a, Shan He a, Min Xue b, Jia Wang b, Ya-Xiong Tao c a College of Fisheries, Key Lab of Freshwater Animal Breeding, Ministry of Agriculture, Huazhong Agricultural University, Hubei Collaborative Innovation Center for Freshwater Aquaculture, Wuhan, Hubei 430070, China b National Aquafeed Safety Assessment Station, Feed Research Institute, Chinese Academy of Agricultural Sciences, Beijing 100081, China c Department of Anatomy, Physiology, and Pharmacology, College of Veterinary Medicine, Auburn University, Auburn, AL 36849-5519, USA

a r t i c l e

i n f o

Article history: Received 13 September 2015 Received in revised form 18 January 2016 Accepted 19 January 2016 Available online 20 January 2016 Keyword: Dietary fat level Growth Lipid homeostasis Appetite Leptin

a b s t r a c t This study was conducted to examine the systemic metabolic strategies of grass carp to maintain lipid homeostasis when fed with low- or high-fat diets. The isonitrogenous diets with different fat levels (9.3, 48.7 and 107.9 g kg−1) were fed to grass carp for 8 weeks. After the feeding trial, the growth rate and feed intake of grass carp fed with low-lipid (LL) diet or high-lipid (HL) diet were lower than fish fed with medium-lipid (ML) diet. Serum triglyceride (TG) and total body fat contents were significantly increased in grass carp with increasing lipid intake. Gene expression data indicated that fish increased hepatic gk and pk expressions to elevate glycolysis, and enhanced acc and fas expressions to accelerate biosynthesis of fatty acid (FA) to adapt to low lipid intake. Meanwhile, fish fed with LL diet decreased hepatic cpt1 expression to depress lipolysis, leading to low contents of serum TG and body fat. In contrast, excess lipid intake increased g6pase, pepck and pparα expressions to stimulate gluconeogenesis and β-oxidative, while decreased acc and fas expressions to reduce lipid synthesis in fish liver. Moreover, increased β-oxidative-induced FA or gluconeogenesis-induced serum glucose might induce the appetite suppression by high dietary fat through modulation of leptin expression. This study could be a reference in the systemic adaptation of lipid metabolism responding to dietary fat in fish. Statement of relevance Systemic adaptation of lipid metabolism responding to dietary lipid. © 2016 Published by Elsevier B.V.

1. Introduction Dietary fat provides essential fatty acids, phospholipids for maintaining cell normal structure and biological function (Sargent et al., 1999). It is well known that appropriate levels of non-protein energy

Abbreviations: acc, acetyl-CoA carboxylase; agrp, agouti-related protein; b2m, beta-2microglobulin; β-actin, actin isoform B; cart, cocaine and amphetamine regulated transcript; cck, cholecystokinin; CHO, cholesterol; cpt1, carnitine palmitoyltransferase 1; ef1α, elongation factor 1-alpha; fas, fatty acid synthase; FI, feed intake; g6pase, glucose6-phosphatasegapdh, glyceraldehyde-3-phosphate dehydrogenase; gk, glucokinase; gp, glycogen phosphorylase; gs, glycogen synthase; HDL, high density lipoprotein; LDL, low density lipoprotein; npy, neuropeptide Y; pepck, phosphoenol pyruvate carboxykinase; PER, protein efficiency ratio; pk, pyruvate kinase; pomc, proopiomelanocortin; pparα, peroxisome proliferator-activated receptor type α; rpl13a, ribosomal protein L13a; SGR, specific growth ratio; SR, survival ratio; TG, triglyceride; tubα, tubulin alpha; WG, weight gain. ⁎ Corresponding author at: College of Fisheries, Huazhong Agricultural University, No. 1, Shizishan Street, Hongshan District, Wuhan, Hubei Province, 430070, China. E-mail address: [email protected] (X.-F. Liang). 1 Aixuan Li and Xiaochen Yuan contribute equally to this work.

http://dx.doi.org/10.1016/j.aquaculture.2016.01.014 0044-8486/© 2016 Published by Elsevier B.V.

sources determine the efficiency of protein utilization (Wilson and Halver, 1986). Dietary fat as an energy source have been widely used in economic fish aquaculture to save dietary protein and increase feed efficiency (Hillestad et al., 1998; Boujard et al., 2004). However, several studies have revealed that excessive fat in diets has a negative effect for fish growth, such as unwanted hepatic fat deposition (Lee et al., 2002; Du et al., 2005). Animals have developed an accurate and complicated metabolic system to adapt to different nutritional states (Soengas, 2014). In mammals, the mechanism of lipid metabolism responding to different dietary fat has been extremely discussed, especially high-fat diet (Lin et al., 2000; Buettner et al., 2007; Kohsaka et al., 2007). Mammals mostly store excess energy as neutral lipid (TG) in white adipose tissue. However, lipid also can be stored in liver and muscle in fish (Ando et al., 1993; Kaneko et al., 2013). A number of lipometabolic genes in some fishes have been cloned, and preliminary functions have also been illustrated (Morash et al., 2009; Cheng et al., 2011; Leng et al., 2012; He et al., 2014, 2015). Although a lot of existing literature dealing with lipid metabolism in many teleost species (Wang et al., 2005; Du

44

A. Li et al. / Aquaculture 457 (2016) 43–49

et al., 2006; Morash et al., 2009; Chatzifotis et al., 2010), the adaptive strategies to different fat intake have not been well understood. Appetite of mammals could be regulated by energy status (Gélineau and Boujard, 2001; Gélineau et al., 2001). Hypothalamic detection of nutrients, directly or indirectly afferent information, activates neurocircuits involved in the regulation of food intake, glucose homeostasis, lipid metabolism, and energy expenditure (Morton et al., 2006; Blouet and Schwartz, 2010). In addition to responding to changes in circulating metabolite levels, those neurons contain receptors for several hormones (such as leptin, ghrelin and cholecystokinin) allowing them to integrate multiple endocrine signals with information of nutritional status and energy reserves (Levin et al., 2004; Blouet and Schwartz, 2010). In teleost fish, evidences obtained in recent years pointed to the presence of sensor systems for glucose and fatty acids at central and peripheral locations, which are related to the control of food intake through changes in the expression of orexigenic (npy/agrp) and anorexigenic (cart/pomc) neuropeptides (Conde-Sieira et al., 2010; Librán-Pérez et al., 2012). However, it is still unclear that how metabolic information is integrated with the decision of changing food intake accordingly in fish brain (Soengas, 2014). Previous studies have reported that food intake of some carnivorous fish could be regulated by the nutrients level such as glucose and fatty acids through changes in the expression of anorexigenic and orexigenic neuropeptides (Librán-Pérez et al., 2012, 2015). However, the adaptation strategy of energy metabolism and metabolic feedback in herbivorous fish needs to be assessed (Soengas, 2014). In the present study, we investigated the effects of dietary fat on growth performance, food intake, and expressions of anorexigenic and orexigenic neuropeptide genes and hepatic glucose and lipid metabolic genes in juvenile grass carp (Ctenopharyngodon idellus), a typical herbivorous fish, in an attempt to clarify the systemic metabolic strategies to maintain lipid homeostasis in herbivorous fish with low or high lipid intake. 2. Materials and methods 2.1. Experimental diets Using casein as protein source, corn starch as the carbohydrate source, fish oil and soybean oil as the lipid source, three diets were formulated to contain three crude lipid levels (9.3, 48.7 and 107.9 g kg−1 named as LL, ML and HL). The composition and chemical analysis of the three experimental diets are shown in Table 1. All the ingredients were from mainland of China and purchased from Shentianyu and Fulong Dietary Company (Wuhan, China). The diets were pelleted (2 mm diameter) by a laboratory pellet machine within 30 min after the ingredients were thoroughly mixed. Then the pellets were airdried and stored in a freezer at −20 °C until used. 2.2. Fish and experimental conditions Experimental grass carp were obtained from the Fish Center of Xiantao, Hubei, China. Prior to the experiment, the fish were distributed into 4 tanks (1000-L) provided with flow-through water for 15 days. Then they were selected and randomly distributed into 12 tanks (300L) where the fish were acclimated to the experimental conditions for 2 weeks. After the 2-week acclimation, fish were then starved for 24 h to measure the body length and weight at the beginning of the experiment. The stocking density was 25 fish (mean weight was about 12 g) per tank (300-L) and each diet was fed to triplicate randomly assigned tanks. During the experimental period, the temperature ranged from 22 to 26 °C, the ammonia content was about 0.27 ± 0.02 mg L−1 the pH ranged from 7.11 to 7.59. The aerated and filtered flow-through water was kept at a flow-rate of 3 L min− 1. The dissolved oxygen value was 7.26–7.86 mg L−1. During whole feeding trial, the fish were fed to apparent satiation twice daily at 08:00 and 16:00 for 8 weeks. Uneaten feed was collected after feeding by siphoning, then dried for about 12 h in a ventilated oven at 60 °C to determine feed intake.

Table 1 Compositions of experimental diets. Item

Casein Gelatin Fish oil Soybean oil DL-Met (99%) α-Starch Corn starch Cellulose Ca(H2PO4)2 Mineral mixb Vitamin mixa Choline chloride Ethoxyquin Total Compositions (g kg−1 diet) Crude protein Crude lipid Ash Moisture Gross energy (kJ g−1)

Experimental diets LL

ML

HL

190.0 70.2 0 0 1.6 100 326.5 100 20 20 10 6 0.5 1000

190.0 70.2 20 20 1.6 100 326.5 60 20 20 10 6 0.5 1000

190.0 70.2 50 50 1.6 100 326.5 0 20 20 10 6 0.5 1000

316.5 9.3 68.5 95.3 11.67

315.8 48.7 65.6 92.2 12.41

314.2 107.9 63.2 86.8 13.52

a Vitamin premix (per kg of diet): vitamin A, 2000 IU; vitamin B1 (thiamin), 5 mg; vitamin B2 (riboflavin), 5 mg; vitamin B6, 5 mg; vitamin B12, 0.025 mg; vitamin D3, 1200 IU; vitamin E 21 mg; vitamin K3 2.5 mg; folic acid, 1.3 mg; biotin, 0.05 mg; pantothenic acid calcium, 20 mg; inositol, 60 mg; ascorbic acid (35%), 110 mg; niacinamide, 25 mg. b Mineral premix (per kg of diet): MnSO4, 10 mg; MgSO4, 10 mg; KCl, 95 mg; NaCl, 165 mg; ZnSO4, 20 mg; KI, 1 mg; CuSO4, 12.5 mg; FeSO4, 105 mg; Na2SeO3, 0.1 mg; Co, 1.5 mg.

2.3. Sample collection and chemical analyses At the end of the 8-week feeding trial, approximately 2 h after the last feeding, all the fish were anesthetized with MS-222 (Argent Chemical Laboratories, Redmond, WA, USA) and then weighed and counted. In each cage, three fish were randomly captured for body chemical analysis, livers from another three fish were dissected and separated for tissue lipid contents detection; other six fish for molecular experiments were randomly captured and killed by immediate spinal destroying for measure and dissection. The small pieces of fish liver and brain samples for gene expression assay were immediately collected and frozen in liquid nitrogen and stored at −80 °C for RNA isolation and subsequent analysis. Blood was collected from the caudal vein of other three fish from each cage and centrifuged at 3500 g for 10 min, and then serum was separated and stored at −80 °C until used. Crude protein, crude lipid, moisture and ash of diets were determined by standard methods (A.O.A.C., 1995). Crude protein (N × 6.25) was determined following the Kjeldahl method after an acid digestion using a Kjeltec system (Kjeltec 2300 Analyzer, Foss Tecator, Sweden). Crude lipid was evaluated by the ether-extraction method using Soxtec System HT (Soxtec System HT6, Tecator, Sweden). Ash was measured using a muffle furnace at 550 °C for 12 h. Moisture was determined by oven drying at 105 °C for 6 h. Energy content of the diets was measured by bomb calorimetry using a Parr 6200 calorimeter equipped with a Parr 1108 Oxygen Bomb and a Parr 6510 water handling system (Parr Instrument Company, Moline, IL, USA). CHO, TG, HDL, LDL and glucose contents were determined using an automatic biochemical analyzer [Abbott Aeroset Analyzer (Abbott Laboratories, Abbott Park, IL, USA)] in the Zhongnan Hospital of Wuhan University (Wuhan, Hubei, China).

2.4. RNA isolation, reverse transcription and gene expression analysis The liver total RNA of grass carp consuming diets with varying lipid levels was extracted by SV Total RNA Isolation System kit (Promega, USA) following the manual, then its purity and quantity were measured

A. Li et al. / Aquaculture 457 (2016) 43–49

using protein and nucleic acid analyzer, and its integrity was checked by electrophoresis in 2% agarose gels. Then 1 μg of the RNA was reverse transcribed to cDNA using SuperScript™ II RT reverse transcriptase (Takara, Japan). Real-time PCR was applied to evaluate the expression level of gene expression assay using gene-specific primers as shown in Table 2. A set of six housekeeping genes (β-actin, rpl13a, tubα, b2m, gapdh and ef1α) were selected from the transcriptome assemblies (Vandesompele et al., 2002) in order to test their transcription stability for the treatment series. geNorm software was then used to compute the expression stability values (M) for each gene where a lower M value corresponds to more stable gene expression. Real-time PCR assays were carried out in a quantitative thermal cycler (MyiQ™ 2 Two-Color Real-Time PCR Detection System, BIO-RAD, USA) with a 20 μL reaction volume containing 2 × SYBR® Premix Ex Taq™ (TaKaRa BIO, Tokyo, Japan) 10 μL, 10 mM each of forward and reverse primers 0.4 μL, 1 μL template and 8.2 μL sterile double-distilled water. The PCR parameters were 95 °C for 1 min followed by 40 cycles at 95 °C for 10 s, 57 °C for 30 s and a melt curve step (from 95 °C, gradually reducing 0.5 °C s−1 to 57 °C, with acquisition data every 6 s). The amplification efficiencies of control and target genes were ranged from 96.3 to 104.9%. Gene expression levels were quantified relative to the expression of β-actin using the optimized comparative Ct (2− ΔΔCt) value method (Livak and Schmittgen, 2001). All amplifications were performed in triplicate for each RNA sample. Data from three replicate RT-PCR samples were analyzed using CFX Manager TM software (Version 1.0). The ΔCt (differences in the Ct value between target gene and β-actin) for each sample was subtracted from that of the calibrator, which was called ΔΔCt, gene expression levels were calculated using 2−ΔΔCt and the value represented an n-fold difference relative to the defined control. Modifications of gene expression are represented with respect to the calibrator, which is assumed to have the value of 1 A.U. (arbitrary unit). 2.5. Statistical analysis All data were presented as mean ± S.E.M. (standard error of the mean). The normality of data was assessed by using SPSS software

45

Table 3 Growth performance and feed utilization of grass carp fed diets containing three different lipid levels. Item1

IW (g) FW (g) WG (%) SGR (%) FI (g) PER SR (%)

Experimental diets LL

ML

HL

12.42 ± 0.02 16.01 ± 0.64a 28.96 ± 5.18a 0.45 ± 0.07a 444.22 ± 18.64a 0.46 ± 0.096a 85.33 ± 7.06

12.56 ± 0.09 21.23 ± 1.27b 68.92 ± 8.84b 0.93 ± 0.09b 538.14 ± 35.47b 1.12 ± 0.26b 88.00 ± 2.31

12.33 ± 0.03 17.35 ± 0.70ab 40.71 ± 5.90a 0.61 ± 0.07a 414.07 ± 18.90a 0.88 ± 0.15ab 89.33 ± 4.81

Values are mean ± S.E.M. (n = 20). Vertical bars not sharing the same letter are significantly different (P b 0.05).Values are means ± S.E.M. of three replicates and values within the same row with different letters are significantly different (P b 0.05). 1 IW, initial weight; weight gain (WG, %) = 100 × (FW − IW) / IW; specific growth ratio (SGR, %) = 100 × (lnFW − lnIW)/time (days); FI, feed intake; protein efficiency ratio (PER) = wet weight gain (g)/total protein fed (g); survival ratio (SR, %) = 100 × (final fish number)/(initial fish number).

with the Shapiro–Wilk test. All data were subjected to one-way analysis of variance (one-way ANOVA) using SPSS 17.0 software. Differences between the means were tested by Duncan's multiple range test after homogeneity of variances was checked. Statistical significance was determined at the 5% level.

3. Results 3.1. Growth performance and feed utilization After 8-week feeding trial, the growth performance and feed utilization of grass carp fed with different fats are shown in Table 3. No significant difference was observed in SR among all the experimental groups. The highest WG, SGR and FI of grass carp in the LL group or the HL group were lower than the ML group. There was no significant difference in PER between the HL group and the ML group.

Table 2 Primer sequences for Real-time PCR. Accession no.

Gene

Primers

Sequence 5′-3′

Amplicon size (bp)

E-values (%)

M25013

β-actin

100.3

npy

157

97.8

ESTs

cart

166

101.9

JF912411

cck

331

104.9

ESTs

g6pase

131

99.1

JQ898294

pepck

202

102.4

JQ782458

gp

257

96.3

JQ792167

gs

277

97.8

ADD52460

gk

210

103.1

JQ951928

pk

157

97.3

GU908475

acc

81

101.6

HM802556

fas

208

98.9

FJ231987

ppara

202

102.6

JF728839

cpt1

CGTGACATCAAGGAGAAG GAGTTGAAGGTGGTCTCAT CTTCCTCTTGTTCGCCTGCT CCTTTTGCCATACCTCTGCC GGACCCGAATCTGACAAACGA TTTGCCGATTCTTGACCCTTT GGAACACACACGCCACACC GGAGAGGAACTTCTGCGGTATG AAAGACAGCAGGTAGAAGAGG ACGGAAAACAAGAAGAGCAG ATCGTCACGGAGAACCAA CCTGAACACCAAACTTAGCA GGTCGCACGCTCCAGAACA TCAACCTGCCAGCCATCTTT CCTCCAGTAACAACTCACAACA CAGATAGATTGGTGGTTACGC GAAGAGCGAGGCTGGAAGG CAGAATGCCCTTATCCAAATCC GCCGAGAAAGTCTTCATCGCACAG CGTCCAGAACCGCATTAGCCAC TGGCTGCACTGCACTCTCACT GGTCCAGCTTCCCTGCGGTC GATGGGTCTACAGCCTGATGG GACACCCTGTGGACATTGAGC AGCAGAGAAGGACGTCAG TTCCTTCTCGGCATGCTG GCCACTGTAAAGGAGAACC GGATGCCTCATAAGTCAAG

299

JQ951928

β-act-F β-act-R npy-F npy-R cart-F cart-R cck-F cck-R g6pase-F g6pase-R pepck-F pepck-R gp-F gp-R gs-F gs-R gk-F gk-R pk-F pk-R acc-F acc-R fas-F fas-R ppara-F ppara-R cpt1-F cpt1-R

272

99.5

46

A. Li et al. / Aquaculture 457 (2016) 43–49

Table 4 Effects of different dietary lipids on tissue lipid content in grass carp. Item1

BCL(%) HCL(%)

Experimental diets LL

ML

HL

5.44 ± 0.25a 13.75 ± 0.29

6.95 ± 0.21b 14.64 ± 0.76

8.52 ± 0.40c 14.22 ± 0.36

Values are mean ± S.E.M. (n = 3). Vertical bars not sharing the same letter are significantly different (P b 0.05).Values are means ± S.E.M. of three replicates and values within the same row with different letters are significantly different (P b 0.05). 1 BCL, body crude lipid; HCL, hepatic crude lipid.

3.2. Body lipid content The body lipid contents of grass carp fed with different levels of fat are presented in Table 4. Total body lipid content was increased with the increasing dietary fat levels (P b 0.05). There was no significant difference in hepatic lipid content among the treatments. 3.3. Serum lipid fractions Serum total TG, TC, HDL, LDL and glucose concentrations are reported in Table 5. The serum TG content was significantly increased with increasing lipid intake (P b 0.05). The serum glucose level was significantly higher in grass carp fed with HL diet than fish fed with ML and LL diets. 3.4. Expressions of genes involved in appetite, carbohydrate, lipid metabolism By using geNorm software, β-actin was found to be the most stable reference gene in grass carp liver consuming diets with varying lipid levels (data not shown). The expressions of appetite genes in grass carp fed with different dietary fat levels are presented in Fig. 1. The expression of npy was significantly lower and the expression of cck was higher in LL group than those in ML group. The expression of npy was lower and the expressions of cart and cck were higher in HL group than those in ML group (P b 0.05). The expressions of hepatic genes involved in glucose metabolism in grass carp fed with different dietary fat levels are presented in Fig. 2. The expressions of genes (gk and pk) involved in glycolysis were significantly higher in LL group than those in ML group. The expressions of genes (g6pase and pepck) involved in gluconeogenesis were significantly higher in HL group than those in ML group. The expressions of hepatic genes involved in lipid metabolism in grass carp fed with different dietary fat levels are presented in Fig. 3. The expressions of genes (acc and fas) involved in lipid synthesis were significantly higher in LL group than those in ML group. Meanwhile, the lipolysis gene (cpt1) mRNA abundance was significantly reduced in LL group than ML group. The gene expressions of acc and fas were significantly lower in HL group than ML group. The gene expression of

Fig. 1. The relative expressions of appetite-regulating genes in brain of grass carp fed with different dietary fat levels. Values are mean ± S.E.M. (n = 6). Vertical bars not sharing the same letter are significantly different (P b 0.05).Values are means ± S.E.M. of three replicates and values within the same row with different letters are significantly different (P b 0.05).

pparα involved in β-oxidation of fatty acids was significantly higher in HL group than ML group. Leptin mRNA abundance was highest in HL group (P b 0.05) (Fig. 4). 4. Discussion To gain a better understanding of the systemic metabolic strategies to maintain lipid homeostasis in fish, we detected changes in growth performance, food intake, and expressions of anorexigenic and orexigenic neuropeptide genes and hepatic glucose and lipid metabolic genes of grass carp fed with low or high fat diets. Preliminary studies had evaluated the effects of graded dietary levels of fat on juvenile grass carp and the optimum dietary fat requirement for juvenile grass carp was 48.7 g kg−1 (unpublished data). Therefore, in the present study, we studied the adaptation strategies of grass carp to different dietary fat such as the low (9.3 g kg−1), optimum (48.7 g kg−1) and high (107.9 g kg−1) dietary fat. 4.1. The strategy of grass carp responding to low lipid intake Limited dietary fat is a nutritional stress for organisms (Soengas, 2014). In several fish species, limited dietary fat resulted in low growth and a series of symptoms related to essential fatty acid deficiency (Takeuchi et al., 1990; Watanabe, 1993). In the present study, the growth performance and feed utilization of grass carp fed with low fat diet were lower than those of fish fed with optimal fat diet. Du et al. (2005) also reported that the juvenile grass carp fed with diet containing 0% lipid showed poorer growth when compared with the optimal dietary fat content (4% lipid) after a 10-week trial. The weight loss, induced by low fat

Table 5 Effects of different dietary lipids on serum lipid fractions in grass carp. Item1

CHO (mmol/L) TG (mmol/L) HDL (mmol/L) LDL (mmol/L) Glucose (mmol/L)

Experimental diets LL

ML

HL

5.18 ± 0.55 2.99 ± 0.30a 1.08 ± 0.13 1.10 ± 0.16 5.10 ± 0.54a

6.52 ± 0.38 4.19 ± 0.07ab 1.44 ± 0.11 1.27 ± 0.17 6.02 ± 0.34a

6.86 ± 0.81 4.33 ± 0.51b 1.53 ± 0.27 1.35 ± 0.21 7.90 ± 0.36b

Values are mean ± S.E.M. (n = 3). Vertical bars not sharing the same letter are significantly different (P b 0.05).Values are means ± S.E.M. of three replicates and values within the same row with different letters are significantly different (P b 0.05). 1 TG, plasma total triglyceride; TC, cholesterol; HDL, high density lipoprotein; LDL, low density lipoprotein.

Fig. 2. The relative expressions of genes involved in carbohydrate metabolism in liver of grass carp fed with different dietary fat levels. Values are mean ± S.E.M. (n = 6). Vertical bars not sharing the same letter are significantly different (P b 0.05).Values are means ± S.E.M. of three replicates and values within the same row with different letters are significantly different (P b 0.05).

A. Li et al. / Aquaculture 457 (2016) 43–49

47

synthesized FAs were broken down through β-oxidation (lower cpt1 mRNA abundance). The adaptation strategies of grass carp in response to low lipid intake were to induce glycolysis (gk and pk) for supplying acetyl coenzyme A, increase lipid synthesis (acc and fas) and depress lipolysis (cpt1) to maintain lipid homeostasis. 4.2. The strategy of grass carp responding to high lipid intake

Fig. 3. The relative expressions of genes involved in lipid metabolism in liver of grass carp fed with different dietary fat levels. Values are mean ± S.E.M. (n = 6). Vertical bars not sharing the same letter are significantly different (P b 0.05).Values are means ± S.E.M. of three replicates and values within the same row with different letters are significantly different (P b 0.05).

intake, was positively correlated with whole body lipid content in juvenile grass carp. The positive correlation between body fat and dietary fat has been also demonstrated in other fish species such as rainbow trout (Lee and Putnam, 1973), channel catfish (Garling and Wilson, 1977), common carp (Takeuchi et al., 1979), red drum (Ellis and Reigh, 1991) and hybrid tilapia (Chou and Shiau, 1996). Compared to whole body lipid content, no significant difference of hepatic lipid content was observed between fish fed with LL and ML diet, suggesting that grass carp had the adaptive mechanisms to maintain lipid homeostasis in liver. To explore the mechanism of lipid metabolism of grass carp, we analyzed the expressions of several key hepatic genes involved in glucose metabolism (g6pase, pepck, gp, gs, gk and pk) and lipid metabolism (acc, fas, pparα, cpt1). The expressions of hepatic glucolytic genes (gk and pk) were significantly higher in LL group than those in ML group. In the case of lipid deficiency, higher glycolysis could be stimulated for more acetylCoA, which will be catalyzed by Acc for FA synthesis (He et al., 2015). Therefore, the higher mRNA expression of acc in the LL group than that in ML group indicated that glycolysis-sourced acetyl-CoA might be transformed to malonyl-CoA and FA. In addition, lower cpt1 expression in the LL group also indicated the increase malonyl-CoA (López et al., 2005, 2007). However, higher FA synthesis did not cause higher TG accumulation in the LL group. This might because the newly

Previous studies have been reported that dietary fat level could increase growth, improve feed and protein efficiency, and spare proteins (De Silva et al., 2001; Torstensen et al., 2001; Lee et al., 2002; Skalli et al., 2004). However, no protein sparing effect of lipid has been observed (McGoogan and Gatlin, 1999; Thoman et al., 1999). Fish have an optimum level of dietary fat, over which dietary fat will cause growth depression (Pei et al., 2004; Du et al., 2005; López et al., 2006; Chatzifotis et al., 2010). This result was also confirmed in this study in which the higher dietary fat level than the optimum one neither improved protein utilization nor triggered growth. Excessive dietary fat results in excessive fat deposition in visceral cavity, liver and muscle of fishes (Regost et al., 2001; Martino et al., 2002; Pei et al., 2004; Wang et al., 2005; Martins et al., 2007; Song et al., 2009). In the present study, whole body lipid content was observed to increase with increasing dietary fat levels. Consistently, serum triglyceride concentration increased with an increase of dietary fat, indicating an active endogenous lipid transport. The comparable hepatic lipid contents in HL and ML groups suggested that grass carp mobilized adaptive mechanisms to maintain lipid homeostasis in liver. The result of several important hepatic lipometabolic genes expression showed that acc and fas were significantly lower in HL group than those in ML group, whereas acc and fas, master regulators of lipogenesis, were higher in LL group, suggesting lipogenesis was decreased in liver when lipid intake was excessive. The previous studies also pointed out that acc and fas gene expressions and activities were reduced with increasing fat intake (Rollin et al., 2003; Ma et al., 2009; Wang et al., 2010; Leng et al., 2012). A possible reason was that elevated intake of exogenous fat in HL group reduced the endogenous synthesis to maintain the dynamic balance between direct absorption of exogenous feed and endogenous synthesis (Leng et al., 2012). Meanwhile, the pparα mRNA level was enhanced in grass carp fed with HL diet, similar to rainbow trout (Martinez-Rubio et al., 2013; Librán-Pérez et al., 2015) and Atlantic salmon (Kennedy et al., 2006), suggesting that high lipid intake induced mitochondrial FA oxidative processes. Enhanced expressions of g6pase and pepck, hepatic genes for gluconeogenesis, could contribute to hepatic glucose production, corresponding to the increase serum glucose level in fish fed with HL diet (Commerford et al., 2002; Panserat et al., 2002). Thus intrahepatic adaptations of grass carp in response to high lipid intake were to reduce lipid synthesis (fas and acc), induce mitochondrial FA oxidative (pparα) and simultaneously increase gluconeogenesis (g6pase and pepck) to deal with excessive lipid intake. 4.3. Effects of dietary fat on neuropeptides related to the control of food intake

Fig. 4. The relative gene expression of leptin in liver of grass carp fed with different dietary fat levels. Values are mean ± S.E.M. (n = 6). Vertical bars not sharing the same letter are significantly different (P b 0.05).Values are means ± S.E.M. of three replicates and values within the same row with different letters are significantly different (P b 0.05).

Since lipid is one of major nutrients in fish for supporting numerous physiological processes (Tocher et al., 2003; Polakof et al., 2010), it is not surprising that lipid levels of diet are related to food intake in fish. A reduced food intake has been observed in several fish fed with high fat diets (Rasmussen et al., 2000; Gélineau et al., 2001; Johansen et al., 2002, 2003; Figueiredo-Silva et al., 2012). The decreased food intake in HL group in our study was consistent with previous studies, suggesting that fish fed to satiation can adjust food intake to meet energy requirements (Ellis and Reigh, 1991; Ogata and Shearer, 2000; Lupatsch et al., 2001; Wang et al., 2005). The food intake control regulated by the dietary lipid level is likely mediated by central FA sensing (Soengas, 2014). The FA sensing systems in hypothalamus have been associated with the control of food

48

A. Li et al. / Aquaculture 457 (2016) 43–49

intake through regulating the expression of orexigenic and anorexigenic factors (López et al., 2005, 2007). The decreased npy and increased cart and pomc mRNA abundance were observed in brain of grass carp fed with HL diet, indicating an anorexigenic signal, which were in agreement with the reduced food intake. These results agreed with the previous study addressed by Figueiredo-Silva et al. (2012) in rainbow trout, in which the decreased npy mRNA levels and increased cart mRNA levels were observed in the hypothalamus of fish fed with a lipidenriched diet. The connection between FA sensing systems and anorexigenic and orexigenic factors is not well known (Soengas, 2014). Circulating nutrients either from food intake or hepatic production, such as glucose or lipids, can indirectly affect hypothalamic feeding-system by leptin levels through regulating hypothalamic neuropeptides expression (Wang et al., 1998; Obici and Rossetti, 2003; López et al., 2005). In the present study, the gene expression of leptin was significantly higher in HL group than that in LL and ML groups. This result suggested that the increased β-oxidative-induced FA or gluconeogenesis-induced serum glucose might induce the appetite suppression by high dietary lipid through modulation of leptin expression in grass carp. Acknowledgements This work was financially supported by the National Natural Science Foundation of China (31172420 and 31272641), the National Basic Research Program of China (2014CB138601) and the Key Projects in the National Science & Technology Pillar Program during the Twelfth Fiveyear Plan Period (2012BAD25B04). References Ando, S., Mori, Y., Nakamura, K., Sugawara, A., 1993. Characteristics of lipid accumulation types in five species of fish. Bull. Jpn. Soc. Sci. Fish. 59 (9), 1559–1664. A.O.A.C. (Association of Official Analytical Chemists), 1995. Official Methods of Analysis. Association of Official Analytical Chemists, Arlington, p. 1141. Blouet, C., Schwartz, G.J., 2010. Hypothalamic nutrient sensing in the control of energy homeostasis. Behav. Brain Res. 209 (1), 1–12. Boujard, T., Gélineau, A., Covès, D., Corraze, G., Dutto, G., Gasset, E., Kaushik, S., 2004. Regulation of feed intake, growth, nutrient and energy utilisation in European sea bass (Dicentrarchus labrax) fed high fat diets. Aquaculture 231 (1), 529–545. Buettner, R., Schölmerich, J., Bollheimer, L.C., 2007. High-fat diets: modeling the metabolic disorders of human obesity in rodents. Obesity 15 (4), 798–808. Chatzifotis, S., Panagiotidou, M., Papaioannou, N., Pavlidis, M., Nengas, I., Mylonas, C.C., 2010. Effect of dietary lipid levels on growth, feed utilization, body composition and serum metabolites of meagre (Argyrosomus regius) juveniles. Aquaculture 307 (1), 65–70. Cheng, H.L., Ji, N.J., Peng, Y.X., Shen, X., Xu, J.H., Dong, Z.G., Wu, C.C., 2011. Molecular characterization and tissue-specific expression of the acetyl-CoA carboxylase α gene from grass carp, Ctenopharyngodon idella. Gene 487 (1), 46–51. Chou, B.S., Shiau, S.Y., 1996. Optimal dietary lipid level for growth of juvenile hybrid tilapia, Oreochromis niloticus × Oreochromis aureus. Aquaculture 143 (2), 185–195. Commerford, S.R., Ferniza, J.B., Bizeau, M.E., Thresher, J.S., Willis, W.T., Pagliassotti, M.J., 2002. Diets enriched in sucrose or fat increase gluconeogenesis and G-6-Pase but not basal glucose production in rats. Am. J. Physiol. Endocrinol. Metab. 283 (3), 545–555. Conde-Sieira, M., Agulleiro, M.J., Aguilar, A.J., Míguez, J.M., Cerdá-Reverter, J.M., Soengas, J.L., 2010. Effect of different glycaemic conditions on gene expression of neuropeptides involved in control of food intake in rainbow trout; interaction with stress. J. Exp. Biol. 213 (22), 3858–3865. De Silva, S.S., Gunasekera, R.M., Gooley, G., Ingram, B.A., 2001. Growth of Australian shorfin eel (Anguilla australis) elvers given different dietary protein and lipid levels. Aquacult. Nutr. 7 (1), 53–57. Du, Z.Y., Liu, Y.J., Tian, L.X., Wang, J.T., Wang, Y., Liang, G.Y., 2005. Effect of dietary lipid level on growth, feed utilization and body composition by juvenile grass carp (Ctenopharyngodon idella). Aquacult. Nutr. 11, 139–146. Du, Z.Y., Clouet, P., Zheng, W.H., Degrace, P., Tian, L.X., Liu, Y.J., 2006. Biochemical hepatic alterations and body lipid composition in the herbivorous grass carp (Ctenopharyngodon idella) fed high-fat diets. Br. J. Nutr. 95 (05), 905–915. Ellis, S.C., Reigh, R.C., 1991. Effects of dietary lipid and carbohydrate levels on growth and body composition of juvenile red drum Sciclenops ocellutus. Aquaculture 97, 383–394. Figueiredo-Silva, A.C., Saravanan, S., Schrama, J.W., Kaushik, S., Geurden, I., 2012. Macronutrient-induced differences in food intake relate with hepatic oxidative metabolism and hypothalamic regulatory neuropeptides in rainbow trout (Oncorhynchus mykiss). Physiol. Behav. 106 (4), 499–505. Garling, D.L., Wilson, R.P., 1977. Effects of dietary carbohydrate-to-lipid ratio on growth and body composition of fingerling channel catfish. Prog. Fish Cult. 39 (1), 43–47.

Gélineau, A., Boujard, T., 2001. Oral administration of cholecystokinin receptor antagonists increase feed intake in rainbow trout. J. Fish Biol. 58, 716–724. Gélineau, A., Corraze, G., Boujard, T., Larroquet, L., Kaushik, S., 2001. Relation between dietary lipid level and voluntary feed intake, growth, nutrient gain, lipid deposition and hepatic lipogenesis in rainbow trout. Reprod. Nutr. Dev. 41 (6), 487–503. He, A.Y., Liu, C.Z., Chen, L.Q., Ning, L.J., Zhang, M.L., Li, E.C., Du, Z.Y., 2014. Identification, characterization and nutritional regulation of two isoforms of acyl-coenzyme A oxidase 1 gene in Nile tilapia (Oreochromis niloticus). Gene 545 (1), 30–35. He, A.Y., Ning, L.J., Chen, L.Q., Chen, Y.L., Xing, Q., Li, J.M., Qiao, F., Li, D.L., Zhang, M.L., Du, Z.Y., 2015. Systemic adaptation of lipid metabolism in response to low- and high-fat diet in Nile tilapia (Oreochromis niloticus). Physiol. Rep. 3 (8), e12485. Hillestad, M., Austreng, E., Johnsen, F., Asgard, T., 1998. Long-term effects of dietary fat level and feeding rate on growth, feed utilization and carcass quality of Atlantic salmon. Aquac. Nutr. 4, 89–98. Johansen, S.J.S., Ekli, M., Jobling, M., 2002. Is there lipostatic regulation of feed intake in Atlantic salmon Salmo salar L.? Aquac. Res. 33 (7), 515–524. Johansen, S.J.S., Sveier, H., Jobling, M., 2003. Lipostatic regulation of feed intake in Atlantic salmon Salmo salar L. defending adiposity at the expense of growth? Aquac. Res. 34 (4), 317–331. Kaneko, G., Yamada, T., Han, Y., Hirano, Y., Khieokhajonkhet, A., Shirakami, H., Nagasaka, R., Kondo, H., Hirono, I., Ushio, H., Watabe, S., 2013. Differences in lipid distribution and expression of peroxisome proliferator-activated receptor gamma and lipoprotein lipase genes in torafugu and red seabream. Gen. Comp. Endocrinol. 184, 51–60. Kennedy, S.R., Leaver, M.J., Campbell, P.J., Zheng, X., Dick, J.R., Tocher, D.R., 2006. Influence of dietary oil content and conjugated linoleic acid (CLA) on lipid metabolism enzyme activities and gene expression in tissues of Atlantic salmon (Salmo salar L.). Lipids 41 (5), 423–436. Kohsaka, A., Laposky, A.D., Ramsey, K.M., Estrada, C., Joshu, C., Kobayashi, Y., Turek, F.W., Bass, J., 2007. High-fat diet disrupts behavioral and molecular circadian rhythms in mice. Cell Metab. 6 (5), 414–421. Lee, D.J., Putnam, G.B., 1973. The response of rainbow trout to varying protein/energy ratios in a test diet. J. Nutr. 103, 916–922. Lee, S.M., Jeon, I.G., Lee, J.Y., 2002. Effects of digestible protein and lipid levels in practical diets on growth, protein utilization and body composition of juvenile rockfish (Sebastes schlegeli). Aquaculture 211 (1–4), 227–239. Leng, X.J., Wu, X.F., Tian, J., Li, X.Q., Guan, L., Weng, D.C., 2012. Molecular cloning of fatty acid synthase from grass carp (Ctenopharyngodon idella) and the regulation of its expression by dietary fat level. Aquacult. Nutr. 18 (5), 551–558. Levin, B.E., Routh, V.H., Kang, L., Sanders, N.M., Dunn-Meynell, A.A., 2004. Perspectives in diabetes-neuronal glucosensing what do we know after 50 years? Diabetes 53 (10), 2521–2528. Librán-Pérez, M., Polakof, S., Lopez-Patino, M.A., Miguez, J.M., Soengas, J.L., 2012. Evidence of a metabolic fatty acid-sensing system in the hypothalamus and Brockmann bodies of rainbow trout: implications in food intake regulation. Am. J. Physiol. Regul. Integr. Comp. Physiol. 302 (11), R1340–R1350. Librán-Pérez, M., Geurden, I., Dias, K., Corraze, G., Panserat, S., Soengas, J.L., 2015. Feeding rainbow trout with a lipid-enriched diet: effects on fatty acid sensing, regulation of food intake and cellular signaling pathways. J. Exp. Biol. 218 (16), 2610–2619. Lin, S., Thomas, T.C., Storlien, L.H., Huang, X.F., 2000. Development of high fat diet-induced obesity and leptin resistance in C57Bl/6 J mice. Int. J. Obes. Relat. Metab. Disord. 24 (5), 639–646. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2−ΔΔCt method. Methods 25 (4), 402–408. López, M., Tovar, S., Vazquez, M.J., Nogueiras, R., Senaris, R., Dieguez, C., 2005. Sensing the fat: fatty acid metabolism in the hypothalamus and the melanocortin system. Peptides 26 (10), 1753–1758. López, L.M., Torres, A.L., Durazo, E., Drawbridge, M., Bureau, D.P., 2006. Effects of lipid on growth and feed utilization of white seabass (Atractoscion nobilis) fingerlings. Aquaculture 253 (1–4), 557–563. López, M., Lelliott, C.J., Vidal-Puig, A., 2007. Hypothalamic fatty acid metabolism: a housekeeping pathway that regulates food intake. BioEssays 29 (3), 248–261. Lupatsch, I., Kissil, G.W., Sklan, D., Pfeffer, E., 2001. Effects of varying dietary protein and energy supply on growth, body composition and protein utilization in gilthead seabream (Sparus aurata L.). Aquac. Nutr. 7, 71–80. Ma, J.J., Shao, Q.J., Xu, Z.R., Zhou, F., Zhong, G.Y., Song, W.X., Owari, N.B., 2009. Effects of dietary n-3 HUFA on growth performance and lipid metabolism in juvenile black seabream, Sparus macrocephlus. J. Fish. China 33, 639–648. Martinez-Rubio, L., Wadsworth, S., Vecino, J.L.G., Bell, J.G., Tocher, D.R., 2013. Effect of dietary digestible energy content on expression of genes of lipid metabolism and LC-PUFA biosynthesis in liver of Atlantic salmon (Salmo salar L.). Aquaculture 384, 94–103. Martino, R.C., Cyrino, J.E.P., Portz, L., Trugo, L.C., 2002. Effect of dietary lipid level on nutritional performance of the surubim, Pseudoplatystoma coruscans. Aquaculture 209 (1–4), 209–218. Martins, D.A., Valente, L.M.P., Lall, S.P., 2007. Effects of dietary lipid level on growth and lipid utilization by juvenile Atlantic halibut (Hippoglossus hippoglossus L.). Aquaculture 263 (1–4), 150–158. McGoogan, B.B., Gatlin, D.M., 1999. Dietary manipulations affecting growth and nitrogenous waste production of red drum Sciaenops ocellatus: I. Effects of dietary protein and energy levels. Aquaculture 178, 333–348. Morash, A.J., Bureau, D.P., McClelland, G.B., 2009. Effects of dietary fatty acid composition on the regulation of carnitine palmitoyltransferase (CPT) I in rainbow trout (Oncorhynchus mykiss). Comp. Biochem. Physiol. B 152 (1), 85–93. Morton, G.J., Cummings, D.E., Baskin, D.G., Barsh, G.S., Schwartz, M.W., 2006. Central nervous system control of food intake and body weight. Nature 443 (7109), 289–295. Obici, S., Rossetti, L., 2003. Minireview: nutrient sensing and the regulation of insulin action and energy balance. Endocrinology 144 (12), 5172–5178.

A. Li et al. / Aquaculture 457 (2016) 43–49 Ogata, H.Y., Shearer, K.D., 2000. Influence of dietary fat and adiposity on feed intake of juvenile red sea bream Pagrus major. Aquaculture 189, 237–249. Panserat, S., Perrin, A., Kaushik, S., 2002. High dietary lipids induce liver glucose-6phosphatase expression in rainbow trout (Oncorhynchus mykiss). J. Nutr. 132 (2), 137–141. Pei, Z., Xie, S., Lei, W., Zhu, X., Yang, Y., 2004. Comparative study on the effect of dietary lipid level on growth and feed utilization for gibel carp (Carassius auratus gibelio) and Chinese longsnout catfish (Leiocassis longirostris Gunther). Aquacult. Nutr. 10 (4), 209–216. Polakof, S., Medale, F., Skiba-Cassy, S., Corraze, G., Panserat, S., 2010. Molecular regulation of lipid metabolism in liver and muscle of rainbow trout subjected to acute and chronic insulin treatments. Domest. Anim. Endocrinol. 39 (1), 26–33. Rasmussen, R.S., Ostenfeld, T.H., Ronsholdt, B., McLean, E., 2000. Manipulation of endproduct quality of rainbow trout with finishing diets. Aquacult. Nutr. 6, 17–23. Regost, C., Arzel, J., Cardinal, M., Robin, J., Laroche, M., Kaushik, S.J., 2001. Dietary lipid level, hepatic lipogenesis and flesh quality in turbot (Psetta maxima). Aquaculture 193, 291–309. Rollin, X., Medale, F., Gutieres, S., Blanc, D., Kaushik, S.J., 2003. Short- and long-term nutritional modulation of acetyl-CoA carboxylase activity in selected tissues of rainbow trout (Oncorhynchus mykiss). Br. J. Nutr. 89 (6), 803–810. Sargent, J., Bell, G., McEvoy, L., Tocher, D., Estevez, A., 1999. Recent developments in the essential fatty acid nutrition of fish. Aquaculture 177, 191–199. Skalli, A., Hidalgo, M.C., Abellan, E., Arizcun, M., Cardenete, G., 2004. Effects of the dietary protein/lipid ratio on growth and nutrient utilization in common dentex (Dentex dentex L.) at different growth stages. Aquaculture 235, 1–11. Soengas, J.L., 2014. Contribution of glucose- and fatty acid sensing systems to the regulation of food intake in fish. A review. Gen. Comp. Endocrinol. 205, 36–48. Song, L.P., An, L.G., Zhu, Y.A., Li, X., Wang, A.Y., 2009. Effects of dietary lipids on growth and feed utilization of Jade Perch, Scortum barcoo. J. World Aquacult. Soc. 40 (2), 266–273. Takeuchi, T., Watanabe, T., Ogino, C., 1979. Availability of carbohydrate and lipid as dietary energy sources for carp. Bull. Jpn. Soc. Sci. Fish. 45, 977–982.

49

Takeuchi, T., Toyota, M., Satoh, S., Watanabe, T., 1990. Requirement of juvenile red seabream Pagrus major for eicosapentaenoic and docosahexaenoic acids. Nippon Suisan Gakkaishi 56, 1263–1269. Thoman, E.S., Davis, D.A., Arnold, C.R., 1999. Evaluation of grow out diets with varying protein and energy levels for red drum (Sciaenops ocellatus). Aquaculture 176, 343–353. Tocher, D.R., Bell, J.G., McGhee, F., Dick, J.R., Fonseca-Madrigal, J., 2003. Effects of dietary lipid level and vegetable oil on fatty acid metabolism in Atlantic salmon (Salmo salar L.) over the whole production cycle. Fish Physiol. Biochem. 29 (3), 193–209. Torstensen, B.E., Lie, O., Hamre, K., 2001. A factorial experimental design for investigation of effects of dietary lipid content and pro- and antioxidants on lipid composition in Atlantic salmon (Salmo salar) tissues and lipoproteins. Aquacult. Nutr. 7, 265–276. Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy, N., De Paepe, A., Speleman, F., 2002. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 3 (RESEARCH0034). Wang, J., Liu, R., Hawkins, M., Barzilai, N., Rossetti, L., 1998. A nutrient-sensing pathway regulates leptin gene expression in muscle and fat. Nature 393 (6686), 684–688. Wang, J.T., Liu, Y.J., Tian, L.X., Mai, K.S., Du, Z.Y., Wang, Y., Yang, H.J., 2005. Effect of dietary lipid level on growth performance, lipid deposition, hepatic lipogenesis in juvenile cobia (Rachycentron canadum). Aquaculture 249, 439–447. Wang, A.M., Han, G.M., Wei, X.J., Liu, B., Lv, F., Feng, G.N., Qi, Z.T., Wang, T., Xu, P., Yang, Z.G., 2010. Molecular cloning of fatty acid synthase from gift tilapia Oreochromis niloticus: response of its expression to refeeding and different lipid levels in diet. J. Fish. China 34, 1113–1120. Watanabe, T., 1993. Importance of docosahexaenoic acid in marine larval fish. J. World Aquacult. Soc. 24, 152–161. Wilson, R.P., Halver, R.P., 1986. Protein and amino acid requirements of fishes. Annu. Rev. Nutr. 6, 225–244.