- Email: [email protected]
Feed intake, feed utilization and feeding-related gene expression response to dietary phytic acid for juvenile grass carp (Ctenopharyngodon idellus)
Aquaculture 424–425 (2014) 201–206
Contents lists available at ScienceDirect
Aquaculture journal homepage: www.elsevier.com/locate/aqua-online
Feed intake, feed utilization and feeding-related gene expression response to dietary phytic acid for juvenile grass carp (Ctenopharyngodon idellus) Liwei Liu 1, Xu-Fang Liang ⁎, Jie Li, Xiaochen Yuan, Yi Zhou, Yan He College of Fisheries, Key Lab of Freshwater Animal Breeding, Ministry of Agriculture, Huazhong Agricultural University, Freshwater Aquaculture Collaborative Innovation Center of Hubei Province, Wuhan, Hubei 430070, China
a r t i c l e
i n f o
Article history: Received 13 April 2013 Received in revised form 18 August 2013 Accepted 30 December 2013 Available online 11 January 2014 Keywords: Ctenopharyngodon idellus Feed intake Feeding-related gene expression Feed utilization Growth Phytic acid
a b s t r a c t The negative effect of dietary phytic acid (PA) in feed intake is a common feature of response to stress in fish, but the regulation mechanism of feed intake is poorly understood. Our study was therefore conducted to estimate the effects of dietary PA on feed intake, feed utilization and feeding-related gene expression in juvenile grass carp. The levels of dietary PA supplementation were 0 (control), 5 (low) and 40 (high) g kg−1 diet, respectively. Triplicate groups (nine 300-L tanks) of grass carp (mean weight, 22.37 ± 0.16 g) were fed twice daily (08:00 and 16:00 h) to satiation for 8 weeks. Supplemental PA decreased the weight gain, feed intake, feed utilization and digestive enzyme activities of grass carp. Dietary PA supplementation decreased the apparent digestibilities of phosphorus, calcium and crude protein. The gene expression levels of cocaine- and amphetamine-regulated transcript (CART) and cholecystokinin (CCK) in the brain were enhanced with the increase of dietary PA supplementation. However, the neuropeptide Y (NPY) and ghrelin mRNA expression levels were reduced in fish fed with low PA, but increased significantly (P b 0.05) in fish fed with high PA compared to the control. No significant differences were observed in the gene expressions of NPY receptors Y8a and Y8b among all the groups. The results of this study indicated that the decrease of feed utilization and the increase of CART and CCK gene expressions in the brain might be the main factors for the decrease of feed intake in grass carp caused by dietary PA supplementation. Crown Copyright © 2014 Published by Elsevier B.V. All rights reserved.
1. Introduction Phytic acid (PA), also known as myoinositol hexaphosphate, is the main storage form of phosphorus in many plant seeds. However, phosphorus in the form of phytate is a poor source of nutrient for monogastric animals. Besides, PA can strongly chelate with cations and adversely affect the absorption and digestion of minerals in fish (Papatryphon et al., 1999). Moreover, PA can also integrate with protein, amino acids, starch and lipids in feedstuff. This integration is responsible for reduced digestibility of nutrients and leads to depressed growth of fish (Spinelli et al., 1983). The presence of PA/phytate in the aquafeed negatively affects the feed intake, growth and feed utilization. Spinelli et al. (1983) observed decreased growth rates in rainbow trout fed a diet containing 5 g kg−1 synthetic PA. Addition of 0.5% or 1% phytate in purified diets for the agastric common carp (Cyprinus carpio) caused a significant reduction in growth and feed efficiency (Hossain and Jauncey, 1993). High dietary ⁎ Corresponding author. Tel.: +86 27 8728 8255; fax: +86 27 8728 2114. E-mail addresses: [email protected] (L. Liu), [email protected] (X.-F. Liang). 1 Postal address: College of Fisheries, Key Lab of Freshwater Animal Breeding, Ministry of Agriculture, Huazhong Agricultural University; Freshwater Aquaculture Collaborative Innovation Center of Hubei Province, Wuhan, Hubei 430070, China.
PA (synthetic, 25.8 g kg−1) dramatically depressed the rate of growth in Chinook salmon (Richardson et al., 1985). Channel catfish fed a diet containing 2.2% phytate had significantly reduced weight gain and feed efficiency compared to fish fed a diet containing 1.1% phytate (Satoh et al., 1989). However, studies with reference of PA in grass carp are limited. Grass carp is an important and increasingly popular aquaculture species in China. The main feed of the fish is plant protein which contained many anti-nutrition factors. Therefore, it is important to study the effect of dietary anti-nutritional factor (such as PA) on grass carp. Changes in feeding behavior and appetite are often associated with changes in gene expression and/or protein concentration levels of appetite-regulating hormones or their receptors in fish (Aldegunde and Mancebo, 2006; Kamijo et al., 2011; Volkoff et al., 2010). Thus, changes in mRNA/protein level of a given hormone following feeding likely reflect its physiological role in feeding regulation (Lopez-Patino et al., 1999; Valassi et al., 2008). In fish, appetite is regulated by central and peripheral appetite-stimulating (orexigenic) or appetite-inhibiting (anorexigenic) factors. Neuropeptide Y (NPY) is the most important stimulant of food intake and body weight gain in vertebrates, including mammals and fish (Valassi et al., 2008; Volkoff et al., 2009). Whereas cholecystokinin (CCK), which is produced by the brain, is mostly synthesized in the gut and acts as a peripheral satiety factor (Volkoff
0044-8486/$ – see front matter. Crown Copyright © 2014 Published by Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.aquaculture.2013.12.044
202
L. Liu et al. / Aquaculture 424–425 (2014) 201–206
et al., 2005). Cocaine- and amphetamine-regulated transcript (CART) is an example of a central anorexigenic factor (Volkoff et al., 2005). Ghrelin gene expression in the brain, gut and serum provides further support to the orexigenic actions of ghrelin (both central and peripheral injections) in goldfish (Unniappan et al., 2004). So far, the research on feeding-related gene expression in freshwater species was focused on clone or injection, but less attention was given to the dietary nutrient factor. Furthermore, anti-nutrient factor such as PA which influenced feeding-related gene expression was not clearly understood in freshwater species including the grass carp. Besides, other aspects such as nutrient digestibility and digestive enzyme activity response to supplemented PA in the diet of grass carp were also unclear in limited research. The aim of this study was therefore to investigate the effects of dietary graded levels of PA on juvenile grass carp. Growth, feed intake, feed utilization, digestive enzyme activity and feeding-related gene expression are the main responses. 2. Material and methods 2.1. Diet preparation The composition and chemical analysis of the three experimental diets are shown in Table 1. The levels of dietary PA were 0, 5 and 40 g kg−1 (named as P0, P5 and P40), respectively. The PA (Powder, 99%) used in this study was produced by TongXiang Xinyang Food Additives CO., LTD (Zhejiang, China) and complied with the BP 2003 Standard. The ingredients were from the mainland of China and purchased from Shentianyu and Fulong Dietary Company (Wuhan, China). The ingredients were mixed and the diets were pelleted (2 mm diameter) by a laboratory pellet machine within 30 min. Finally, the pellets were air-dried and stored at −20 °C until used. 2.2. Fish, experimental conditions and assessment food intake About 400 grass carp were obtained from the Fish Center of Xiantao, Hubei, China. Prior to the experiment, the fish were distributed into 2 tanks (1000-L) provided with flow-through water for 15 days. These were randomly selected and distributed into 9 tanks (300-L) where the fish were acclimated for 2 weeks. Fish were fed to apparent satiation with the respective control diet twice a day at 08:00 and 16:00 (Beijing time) during the acclimation period. After 2-week acclimation, fish were starved for 24 h to measure the body length and weight at the beginning of the experiment. The stocking density was 20 fish (mean Table 1 Ingredients and compositions of diets with different levels of phytic acid. Item
P0
P5
P40
Ingredients (g/kg diet) Phytic acid Cellulose Othersa
0 148.5 851.5
5.0 143.5 851.5
40.0 108.5 851.5
Compositions (%) Crude protein Crude lipid Ash Moisture Total phosphorus Calcium
32.0 4.16 7.68 9.46 0.99 1.03
31.9 4.69 7.75 9.54 1.04 1.00
32. 8 4.71 7.81 9.80 1.04 1.02
a Others: Fish meal, 180 g/kg; Casein, 240 g/kg; Corn starch, 330 g/kg; Fish oil, 15 g/kg; Soybean oil, 15 g/kg; Vitamin premix (vitamin premix (per kg of diet): vitamin A, 2000 IU; vitamin B1 (thiamin), 5 mg; vitamin B2 (riboflavin), 5 mg; vitamin B6, 5 mg; vitamin B12, 0.025 mg; vitamin D3, 1200 IU; vitamin E 21 mg; vitamin K3 2.5 mg; folic acid, 1.3 mg; biotin, 0.05 mg; pantothenic acid calcium, 20 mg; inositol, 60 mg; ascorbic acid (35%), 110 mg; and niacinamide, 25 mg), 10 g/kg; Mineral premix (mineral premix (per kg of diet): MnSO4, 10 mg; MgSO4, 10 mg; KCl, 95 mg; NaCl, 165 mg; ZnSO4, 20 mg; KI, 1 mg; CuSO4, 12.5 mg; FeSO4, 105 mg; Na2SeO3, 0.1 mg; and Co, 1.5 mg), 20 g/kg; Ca(H2PO4)2, 20 g/kg; Chromic oxide, 5 g/kg; Choline chloride (50%), 6 g/kg; Ethoxyquin (30%), 0.5 g/kg; Carboxymethyl cellulose, 10 g/kg.
weight, 22.37 ± 0.16 g) per tank and each diet was fed to three randomly assigned tanks. The filtered flow-through tap water (pre-aerated) was kept at a flow-rate of 3 L min−1. The dissolved oxygen (DO) value was 7.33–7.94 mg L−1, the temperature ranged from 24 to 28 °C, the ammonia content was about 0.22 ± 0.02 mg L−1 and pH ranged from 7.06 to 7.52 during the experimental period. During whole feeding trial, the fish were fed to apparent satiation twice per day at 08:00 and 16:00 (Beijing time). Food residues were collected by siphon 2 h later, dessicated at 100 °C for 1 h and weighed. Food intake was calculated as the difference between the initial dry food weight and the adjusted uneaten dry food weight. 2.3. Sample collection and analyses At the end of the 8-week feeding trial, approximately 24 h after the last feeding, all the fish were anesthetized with 75 mg MS-222 L− 1 water (Liu et al., 2012). These fish were counted and weighed to determine survival ratio (SR), weight gain (WG) and specific growth rate (SGR). After obtaining the final weight of all fish, three fish from each tank were randomly selected and dried at 60 °C for subsequent determination of the whole body crude protein. Proximate analysis of crude protein was done following standard methods (AOAC, 1995). Crude protein (N × 6.25) of the samples was determined by the Kjeldahl method after an acid digestion using a Kjeltec system (Kjeltec 2300 Analyzer, Foss Tecator, Sweden). After that, protein efficiency ratio (PER) and protein retention efficiency (PR) were calculated. Proximate mineral contents in the diets and feces were determined by flame atomic absorption spectrophotometers (model AA — 6300C, Shimadzu, Kyoto Japan) following digestion in nitric acid after combustion of the sample in a muffle furnace (AOAC, 1995). The intestines were dissected and weighed, and then homogenized on ice. The homogenate was centrifuged at 5000 ×g for 15 min at 4 °C and the upper lipid layer was discarded. The supernatant was divided into small portions and kept at − 20 °C for later determination of the enzyme activities. The protein contents of the intestinal extracts were determined using the BCA method (Wuhan More Biotechnology Co., Ltd). Duplicate analyses were conducted for each sample. Amylase activity, protease activity and lipase activity were measured using assay kits (Nanjing Jiancheng Bioengineering Institute, China) according to the manufacturer's instructions. One unit of amylase activity was defined as the amount of enzyme that hydrolyzes 10.0 mg starch per 30 min. Protease activity was expressed as the equivalent enzyme activity that was required to generate an optical density (OD) change of 0.003. One unit of lipase activity was defined as enzyme required for the hydrolysis of 1 mmol of substrate per minute. Enzyme activities were expressed as specific activity (U protein−1). Apparent digestibility coefficient (ADC) was measured during the growth experiment by adding 0.5% chromic oxide (Cr2O3) to the diets as an inert marker (Liu et al., 2013a). Fish were fed the diets containing chromic oxide at the beginning of the trial, and then fecal samples were collected by Guelph-type settlement collectors from 7 days later. After feeding, the unconsumed feed and the residues were collected manually each day, while the feces were collected by hand-stripping of each tank about 2 h later. The feces were frozen at −20 °C and freeze dried until analyzed for phosphorus (P), calcium (Ca) and crude protein (CP) as well as chromic oxide. 2.4. RNA extraction Brains of three fish in each groups were immediately frozen in liquid nitrogen and stored at −80 °C for RNA isolation and subsequent analysis. Total RNA was extracted by SV Total RNA Isolation System kit (Promega, USA) as described by the manufacturer, and then its purity and quantity were measured using protein and nucleic acid analyzer and agarose gel electrophoresis. Then 1 μg of RNA was reverse
L. Liu et al. / Aquaculture 424–425 (2014) 201–206
transcribed to cDNA by PrimeScript® RT Master Mix (TaKaRa BIO, Tokyo, Japan) according to reagent's instructions. 2.5. Gene expression assay Real-time PCR was applied to evaluate the expression level of gene expression assay using gene-specific primers (Table 2). Betaactin gene, a housekeeping gene, was used as an endogenous reference to normalize the template amount. Real-time PCR assays were carried out in a quantitative thermal cycler (MyiQ™ 2 Two-Color Real-Time PCR Detection System, BIO-RAD, USA) with a 20 μL reaction volume containing 2 × SYBR® Premix Ex Taq™ (TaKaRa BIO, Tokyo, Japan) 10 μL, 10 mM each of forward and reverse primers 0.4 μL, 1 μL template and 8.2 μL sterile double-distilled water dH 2 O. The PCR parameters were 95 °C for 1 min followed by 40 cycles at 95 °C for 10 s, 57 °C for 30 s and a melt curve step (from 95 °C, gradually reducing 0.5 °C s − 1 to 57 °C, with acquisition data every 6 s). The amplification efficiencies of the control and target genes were approximately equal and ranged from 96.3 to 104.9%. Gene expression levels were quantified relative to the expression of β-actin using the optimized comparative Ct (2-ΔΔCt) value method (Livaka and Schmittgenb, 2001). All amplifications were performed in triplicate for each RNA sample.
203
Table 3 Growth, feed intake, protein efficiency ratio and protein retention efficiency of grass carp fed with different levels of phytic acid. Item
P0
IW (g) FW (g) WG (%) SGR (%/day) FI (g) PER PR (%) SR (%)
22.3 49.6 123 1.43 743 2.46 26.6 91.7
P5 ± ± ± ± ± ± ± ±
0.2 2.5c 12c 0.10c 28c 0.27c 2.6c 1.7
22.4 41.6 85.2 1.10 589 1.72 15.6 90.0
P40 ± ± ± ± ± ± ± ±
0.1 0.8b 3.3b 0.03b 12b 0.03b 1.1b 5.8
22.5 31.3 39.2 0.59 420 1.06 6.88 88.3
P-value ± ± ± ± ± ± ± ±
0.1 0.7a 3.9a 0.05a 18a 0.08a 0.63a 1.7
0.498 0.000 0.000 0.000 0.001 0.001 0.000 0.936
Values are means ± S.E. of three replicates and values within the same row with different letters are significantly different (P b 0.05). IW, initial weight; FW, final weight; WG (weight gain, %) = 100 × (FW − IW) / IW; SGR (specific growth ratio, %/day) = 100 × (lnFW − lnIW) / day; FI, feed intake; PER (protein efficiency ratio) = wet weight gain (g) / total protein fed (g); PR (protein retention efficiency, %) = 100 × [final body protein − initial body protein (g)] / total protein fed (g); SR (survival ratio, %) = 100 × (final fish number) / (initial fish number).
decreased weight gain (WG) (P = 0.000) and specific growth rate (SGR) (P = 0.000). Moreover, the growth and feed utilization were obviously inhibited when PA added up to 40 g kg−1 diet (Table 3). No significant difference was observed in survival ratio (SR) among all the treatments.
2.6. Calculations and statistical analyses The data were analyzed for WG, SGR, PER, PR and SR with the following formula: gainðWG; % Þ ¼ 100 ðfinal weight−initial weightÞ=initial weight; growth ratioðSGR; %=dÞ ¼ 100 ðln final weight–ln initial weightÞ=days; efficiency ratioðPERÞ ¼ wet weight gainðgÞ=total protein fedðgÞ; retention efficiencyðPR; % Þ ¼ 100 ½final body protein–initial body proteinðgÞ= total protein fedðgÞ; Survival ratioðSR; % Þ ¼ 100 ðfinal fish numberÞ=ðinitial fish numberÞ:
Weight Specific Protein Protein
3.2. Feed utilization of grass carp Dietary PA supplementation significantly reduced the apparent digestibilities of phosphorus (P) (P = 0.000), calcium (Ca) (P = 0.000) and crude protein (CP) (P = 0.000) (Table 4). Besides, supplemental phytic acid (PA) significantly decreased protein efficiency ratio (PER) (P = 0.001) and protein retention efficiency (PR) (P = 0.000). 3.3. Digestive enzyme activities in grass carp
The statistical analyses were performed with the statistical software package SPSS 19.0 (SPSS, Chicago, IL, USA). Data were expressed as means ± S.E. of three replicates. The data were subjected to one-way ANOVA and if differences were found, the means were ranked using Duncan's multiple comparisons test. Differences were considered significant at P b 0.05. 3. Results
Dietary PA supplementation decreased the intestinal digestive enzyme activities in grass carp (Table 5). The activities of intestinal protease, lipase and amylase were significantly inhibited in fish fed with P40 compared to the control. However, no significant difference was observed between fish fed with P5 and P0 (control). 3.4. Feeding-related gene expression in grass carp
3.1. Feed intake and growth performance of grass carp Dietary phytic acid (PA) supplementation significantly decreased feed intake (FI) (P = 0.001) which was obviously inhibited when fish were fed with P40 (shown in Table 3). Moreover, the FI was also affected by PA supplementation level. Supplemental PA significantly Table 2 Primer sequences for the quantitative real-time PCR. Accession no.
Gene
Primer
Sequence 5′–3′
M25013
β-actin
JQ951928
NPY
ESTs
Y8a
ESTs
Y8b
JF912411
CCK
ESTs
CART
JQ068139
Ghrelin
β-actin-F β-actin-R NPY-F NPY-R Y8a-F Y8a-R Y8b-F Y8b-R CCK-F CCK-R CART-F CART-R Ghrelin-F Ghrelin-R
GGCTGTGCTGTCCCTGTATG GGTAGTCAGTCAGGTCACGGC CTTCCTCTTGTTCGCCTGCT CCTTTTGCCATACCTCTGCC AATGTGTGCCCTCCCTCTGT CGATGAGGATGTTGGTGACG GATTTTTGACTGGAACCACGAG CGGCATCTGGAAAGCAGTG GGAACACACACGCCACACC GGAGAGGAACTTCTGCGGTATG AGTTTTACCCAAAGGACCCG TGACCCTTTTCTGATGGCG GCAGCACAGGACCGTATTTC TGCTCAGAAACCACAGGGTC
Supplemental PA affected several feeding-related gene expressions in the brain. The cocaine- and amphetamine-regulated transcript (CART) expression in the brain was increased with the increase of dietary PA, and significantly (P b 0.05) increased in fish fed with high dietary PA (Fig. 1A). The cholecystokinin (CCK) expression in the brain was significantly increased with the increased level of dietary PA (P b 0.05) (Fig. 1B). The ghrelin mRNA expression was very low, and its level was reduced in fish fed with P5 but increased significantly in fish fed with P40 (Fig. 2A). Neuropeptide Y (NPY) expression was also decreased in
Table 4 Apparent digestibilities of phosphorus (P), calcium (Ca) and crude protein (CP) in grass carp fed with different levels of phytic acid. Item
P0
P5
P40
P-value
P (%) Ca (%) CP (%)
58.4 ± 1.3c 90.8 ± 0.2c 93.2 ± 0.3c
46.5 ± 1.2b 88.6 ± 0.9b 89.7 ± 0.6b
29.1 ± 2.7a 84.3 ± 0.6a 88.2 ± 0.5a
0.000 0.000 0.000
Values are means ± S.E. of three replicates and values within the same row with different letters are significantly different (P b 0.05).
204
L. Liu et al. / Aquaculture 424–425 (2014) 201–206
Table 5 Digestive enzyme activities in grass carp fed with different levels of phytic acid. Item
P0
P5
P40
P-value
Protease (U/ug protein) Lipase (U/g protein) Amylase (U/mg protein)
18.0 ± 0.9b 19.2 ± 0.5b 52.7 ± 3.0b
16.6 ± 0.7ab 16.9 ± 0.7b 47.6 ± 1.9ab
15.5 ± 0.3a 12.4 ± 1.3a 43.6 ± 1.7a
0.093 0.005 0.077
Values are means ± S.E. of three replicates and values within the same row with different letters are significantly different (P b 0.05).
fish fed with P5 and an increased trend was observed in fish fed with P40 (Fig. 2B). The Y8a and Y8b mRNA levels had the same trend with NPY. Although the NPY mRNA level was significantly increased in fish fed with high PA-supplemented diet, the mRNA levels of Y8a and Y8b were not significantly different among all the groups (Fig. 2C and D). 4. Discussion Supplemental phytic acid (PA) significantly decreased weight gain and special growth ratio in this study. The effect of PA on growth primarily depends on the amount of dietary phytate (Hossain and Jauncey, 1993; Usmani and Jafri, 2002). Inclusion of 0.5% or 1% PA in purified diets for the agastric common carp (C. carpio) caused a significant reduction in growth and feed efficiency (Hossain and Jauncey, 1993). In the study of Usmani and Jafri (2002), specific growth rate of rohu (Labeo rohita) and mrigal (Cirrhinus mrigala) was significantly decreased when phytate was included N1% of total diet. In our study, growth was inhibited when dietary PA was given at a concentration of 40 g kg − 1 diet. In a previous study, channel catfish fed a diet containing 2.2% phytate had significantly reduced weight gain and feed efficiency compared to fish fed a diet containing 1.1% phytate (Satoh et al., 1989). In the study of Laining et al. (2010), weight gain of fish fed with diets containing more than 13.5 g phytate was significantly lower than those of the control group. Dietary PA supplementation decreased feed intake, especially when fish fed with high PA. Feed intake and growth responded negatively to the dose of dietary inclusion of PA (Denstadli et al., 2006), and the tolerance level of PA for growth and feed intake in their study was between 4.7 and 10.0 g kg − 1 . In the study of Laining et al. (2010), weight gain and feed intake of fish fed diets containing 13.5 and 20.6 g phytate were significantly lower than those of the control group (no phytate supplementation). These researches were in accordance with our study that the decrease of feed intake and growth is affected by dietary PA level and depressed deeply in high dietary PA supplementation level.
Supplemental PA decreased protein efficiency ratio and protein retention efficiency in the present study. The main reason was that dietary PA supplementation significantly decreased the apparent digestibility of crude protein in our study. Phytates form sparingly digestible phytate–protein complexes, thus reducing the availability of dietary protein (Richardson et al., 1985). Protein digestibility has been shown to decrease with the inclusion of 5 g sodium phyate kg − 1 in diets for rainbow trout (Spinelli et al., 1983) and 8 g PA kg − 1 for Atlantic salmon (Sajjadi and Carter, 2004). Richardson et al. (1985) also reported that 26 g PA kg− 1 reduced the protein efficiency ratio in Chinook salmon. Besides, dietary PA supplementation also significantly decreased the apparent digestibilities of phosphorus and calcium in our study. The possible reason is that a PA molecule has a substantial ability to chelate divalent cations including P and Ca to form mineral–PA complexes, which are indigestible or partially digestible for fish because of lack of phytase (Ellestad et al., 2002; Liu et al., 2013b). Another main factor concerning the decrease of protein utilization was the decrease of intestinal protease activity because of PA supplementation (significantly in high PA group) in our study. Proteases that hydrolyzed the protein were important in the digestion process, and allowed the ingested proteins to be broken down into simple molecules, which could be absorbed and used in metabolic pathways (Guillaume and Choubert, 2001). PA supplementation reduced the protease activity through sparingly digestible phytate–protein complexes, which could not be absorbed by fish, and thus leads to the reduction of protein utilization. Besides, the activities of intestinal lipase and amylase were inhibited in fish fed with high PA-supplemented diet compared with the control. Therefore, utilization of lipid and amylum might be decreased in fish fed with PA-supplemented diets. However, little related research was concerned about the effect of dietary PA supplementation on intestinal digestive enzyme activity. In fish, appetite is regulated by central and peripheral appetitestimulating (orexigenic) or appetite-inhibiting (anorexigenic) factors. The CART is a central anorexigenic factor and CCK is a peripheral anorexigenic factor (Volkoff et al., 2005). In the present study, the expression levels of CART and CCK were elevated in the brain with the increasing of dietary PA. Dietary PA supplementation caused an increase in the expression of CART and CCK in the brain, and thus reduced appetite and decreased feed intake of grass carp in this study. In goldfish, both central and peripheral injections of sulfated CCK suppress food intake (Volkoff et al., 2003). Administration of CART inhibits NPYstimulated food intake in goldfish, suggesting an inhibitory action of CART on NPY systems (Volkoff and Peter, 2000). Conformably, in our study, the CART was increased in fish fed with 5 g kg−1 PA while the NPY was decreased. Previously little attention has been given to study
Fig. 1. The relative mRNA level changes of cocaine- and amphetamine-regulated transcript (CART) (A) and ecystokinin (CCK) (B) in the brain of grass carp fed with different levels of phytic acid. Columns represent the means. Bars represent the S.E. Treatments that do not share a common letter are significantly different from each other as determined by one-way ANOVA (P b 0.05). Values are means ± S.E. (n = 9).
L. Liu et al. / Aquaculture 424–425 (2014) 201–206
205
Fig. 2. The relative mRNA level changes of ghrelin (A), neuropeptide Y (NPY) (B), Y8a (C) and Y8b (D) in the brain of grass carp fed with different levels of phytic acid. Columns represent the means. Bars represent the S.E. Treatments that do not share a common letter are significantly different from each other as determined by one-way ANOVA (P b 0.05). Values are means ± S.E. (n = 9).
the effects of PA addition on feeding-related gene expression. On the basis of our results it might be concluded that the increased CART and CCK expression might be the main reason for decreased feed intake. The NPY is the central appetite-stimulating (orexigenic) factor (Volkoff et al., 2005). In our previous study, we cloned the NPY gene in grass carp. The full-length cDNA sequence of gc-NPY was 797 bp, and an ORF of 96 amino acids, including the 28-residue signal peptide and 36-residue mature peptide. Our results indicated that NPY acted as an orexigenic factor in the grass carp (Zhou et al., 2013). In the present study, the NPY expression level was decreased in fish fed with low PA and an increased trend was observed in fish fed with high PA. In fish fed with low PA-supplemented diet, the dietary PA resulted in decreased appetite and feed intake, and thus the NPY expression was decreased. However, in the high dietary PA group, the appetite of fish was deeply decreased and the feed intake was also deeply reduced. In this situation, the stomach was empty which led to the increase of NPY expression as a regulated trend. This phenomenon was consistent with the study of Volkoff et al. (2005), fasting increased the brain mRNA expression of NPY. The ghrelin mRNA expression was very low, and its level was reduced in fish fed with low PA but increased significantly in fish fed with high PA. The ghrelin is another central appetitestimulating (orexigenic) factor in the regulation of feed intake. Similarly, the stomach of fish was also empty when they were fed with high PA diet and fasting increased the brain mRNA expression of ghrelin (Volkoff et al., 2005). No significant differences were observed in the expression of NPY receptors Y8a and Y8b among all the groups despite the NPY mRNA level was significantly increased in fish fed with high dietary PA. The possible reason was that the expressions of Y8a and Y8b were very low in the brain because they might not be the key receptors for NPY in the regulation process. Another possible explanation might be that the feeding trial was not long enough and the changes in mRNA level of these two receptors were not obvious. In our previous study, the results indicated that Y8b may be involved in the feeding regulation of grass carp (Zhou et al., 2013). So far, little study was conducted to evaluate the function of Y8a and Y8b in feed intake regulation of fish. Thus,
the mechanism of the two receptors regulating the feed intake by PA supplementation was unknown according to the present data. 5. Conclusion Dietary phytic acid (PA) decreased the feed intake and feed utilization, while it was also responsible for an increase in the expression of CART and CCK in the brain. All these changes led to a poor growth in fish fed with PA-supplemented diet. Based on this study it might be concluded that supplemental PA reduced the appetite of grass carp despite the fact that NPY and ghrelin expressions in the brain were increased in high dietary PA. Further studies are needed to investigate the signal pathway of feeding in grass carp to explain the changes of feeding behavior. Acknowledgment This work was financially supported by the National Basic Research Program of China (2009CB118702), the National Natural Science Foundation of China (31172420, 31072219), the Special Fund for AgroScientific Research in the Public Interest of China (201003020), the Fundamental Research Funds for the Central Universities (2010PY010, 2011PY030) and Huazhong Agricultural University Scientific & Technological Self-innovation Foundation (2012YB09). References Aldegunde, M., Mancebo, M., 2006. Effects of neuropeptide Y on food intake and brain biogenic amines in the rainbow trout (Oncorhynchus mykiss). Peptides 27, 719–727. AOAC (Association of Official Analytical Chemists), 1995. Official Methods of Analysis of Official Analytical Chemists International, 16th ed. AOAC, Arlington, VA. Denstadli, V., Skrede, A., Krogdahl, Å., Sahlstrøm, S., Storebakken, T., 2006. Feed intake, growth, feed conversion, digestibility, enzyme activities and intestinal structure in Atlantic salmon (Salmo salar L.) fed graded levels of phytic acid. Aquaculture 256, 365–376. Ellestad, L.E., Angel, R., Soares Jr., J.H., 2002. Intestinal phytase I: detection of preliminary characterization of activity in the intestinal brush border membrane of hybrid striped bass Morone saxatilis × M. chrysops. Fish Physiol. Biochem. 26, 249–258.
206
L. Liu et al. / Aquaculture 424–425 (2014) 201–206
Guillaume, J., Choubert, G., 2001. Digestive physiology and nutrient digestibility in fishes. In: Guillaume, J., Kaushik, S., Bergot, P., Métailler, R. (Eds.), Nutrition and Feeding of Fish and Crustaceans. Springer Praxis Publishing, Chichester UK, pp. 27–58. Hossain, M.A., Jauncey, K., 1993. The effects of varying dietary phytic acid, calcium and magnesium levels on the nutrition of common carp, Cyprinus carpio. In: INRA (Ed.), Fish Nutrition in Practice, IVth International Symposium on Fish Nutrition and Feeding, Biarritz, France, pp. 705–715. Kamijo, M., Kojima, K., Maruyama, K., Konno, N., Motohashi, E., Ikegami, T., Uchiyama, M., Shioda, S., Ando, H., Matsuda, K., 2011. Neuropeptide Y in tiger puffer (Takifugu rubripes): distribution, cloning, characterization, and mRNA expression responses to prandial condition. Zool. Sci. 28, 882–890. Laining, A., Traifalgar, R.F., Thu, M., Komilus, C.F., Kader, M.A., Koshio, S., Ishikawa, M., Yokoyama, S., 2010. Influence of dietary phytic acid on growth, feed intake, and nutrient utilization in juvenile Japanese flounder, Paralichthys olivaceus. J. World Aquacult. Soc. 41, 746–755. Liu, L.W., Su, J.M., Luo, Y.L., 2012. Effect of partial replacement of dietary monocalcium phosphate with neutral phytase on growth performance and phosphorus digestibility in gibel carp, Carassius auratus gibelio (Bloch). Aquac. Res. 43, 1404–1413. Liu, L.W., Su, J.M., Zhang, T., Liang, X.-F., Luo, Y.L., 2013a. Apparent digestibility of nutrients in grass carp (Ctenopharyngodon idellus) diet supplemented with graded levels of neutral phytase using pretreatment and spraying methods. Aquac. Nutr. 19, 91–99. Liu, L.W., Zhou, Y., Wu, J.J., Zhang, W., Abbas, K., Luo, Y.L., 2013b. Supplemental graded levels of neutral phytase using pretreatment and spraying methods in the diet of grass carp, Ctenopharyngodon idellus. Aquac. Res.. http://dx.doi.org/10.1111/are.12145. Livaka, K.J., Schmittgenb, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2−ΔΔCT method. Methods 25, 402–408. Lopez-Patino, M.A., Guijarro, A.I., Isorna, E., Delgado, M.J., Alonso-Bedate, M., Pedro, N.D., 1999. Neuropeptide Y has a stimulatory action on feeding behavior in goldfish (Carassius auratus). Eur. J. Pharmacol. 377, 147–153. Papatryphon, E., Howell, R.A., Soares, J.H., 1999. Growth and mineral absorption by striped bass Morone saxatilis fed a plant feedstuff based diet supplemented with phytase. J. World Aquacult. Soc. 30, 161–173. Richardson, N.L., Higgs, D.A., Beames, R.M., McBride, J.R., 1985. Influence of dietary calcium, phosphorus, zinc and sodium phytate level on cataract incidence, growth and histopathology in juvenile chinook salmon (Oncorhynchus tshawytscha). J. Nutr. 115, 553–567.
Sajjadi, Carter, 2004. Effect of phytic acid and phytase on feed intake, growth, digestibility and trypsin activity in Atlantic salmon (Salmo salar, L.). Aquac. Nutr. 10, 135–142. Satoh, S., Poe, W.E., Wilson, R.P., 1989. Effect of supplemental phytate and/or tricalcium phosphate on weight gain, feed efficiency and zinc content in vertebrae of channel catfish. Aquaculture 80, 155–161. Spinelli, J., Houle, C.R., Wekell, J.C., 1983. The effects of phytates on the growth of rainbow trout (Salmo gairdneri) fed purified diets containing varying quantities of calcium and magnesium. Aquaculture 30, 71–83. Unniappan, S., Canosa, L.F., Peter, R.E., 2004. Orexigenic actions of ghrelin in goldfish: feeding-induced changes in brain and gut mRNA expression and serum levels, and responses to central and peripheral injections. Neuroendocrinology 79, 100–108. Usmani, N., Jafri, A.K., 2002. Influence of dietary phytic acid on the growth, conversion efficiency, and carcass composition of Mrigal Cirrhinus mrigala (Hamilton) fry. J. World Aquacult. Soc. 33, 199–204. Valassi, E., Scacchi, M., Cavagnini, F., 2008. Neuroendocrine control of food intake. Nutr. Metab. Cardiovasc. Dis. 18, 158–168. Volkoff, H., Peter, R.E., 2000. Effects of CART peptides on food consumption, feeding and associated behaviors in the goldfish, Carassius auratus: actions on neuropeptide Yand orexin A-induced feeding. Brain Res. 887, 125–133. Volkoff, H., Eykelbosh, A.J., Peter, R.E., 2003. Role of leptin in the control of feeding of goldfish Carassius auratus: interactions with cholecystokinin, neuropeptide Y and orexin A, and modulation by fasting. Brain Res. 972, 90–109. Volkoff, H., Canosa, L.F., Unniappan, S., Cerdá-Reverter, J.M., Bernier, N.J., Kelly, S.P., Peter, R.E., 2005. Neuropeptides and the control of food intake in fish. Gen. Comp. Endocrinol. 142, 3–19. Volkoff, H., Unniappan, S., Kelly, S.P., 2009. The endocrine regulation of food intake. In: Bernier, N., Kraak, G.V.D., Farrell, A., Brauner, C. (Eds.), Fish Physiology, vol. 28. Academic Press, Burlington, pp. 421–465. Volkoff, H., Hoskins, L.J., Tuziak, S.M., 2010. Influence of intrinsic signals and environmental cues on the endocrine control of feeding in fish: potential application in aquaculture. Gen. Comp. Endocrinol. 167, 352–359. Zhou, Y., Liang, X.-F., Yuan, X.C., Li, J., He, Y., Fang, L., Guo, X.Z., Liu, L.W., Li, B., Shen, D., 2013. Neuropeptide Y stimulates food intake and regulates metabolism in grass carp, Ctenopharyngodon idellus. Aquaculture 380–383, 52–61.
Contents lists available at ScienceDirect
Aquaculture journal homepage: www.elsevier.com/locate/aqua-online
Feed intake, feed utilization and feeding-related gene expression response to dietary phytic acid for juvenile grass carp (Ctenopharyngodon idellus) Liwei Liu 1, Xu-Fang Liang ⁎, Jie Li, Xiaochen Yuan, Yi Zhou, Yan He College of Fisheries, Key Lab of Freshwater Animal Breeding, Ministry of Agriculture, Huazhong Agricultural University, Freshwater Aquaculture Collaborative Innovation Center of Hubei Province, Wuhan, Hubei 430070, China
a r t i c l e
i n f o
Article history: Received 13 April 2013 Received in revised form 18 August 2013 Accepted 30 December 2013 Available online 11 January 2014 Keywords: Ctenopharyngodon idellus Feed intake Feeding-related gene expression Feed utilization Growth Phytic acid
a b s t r a c t The negative effect of dietary phytic acid (PA) in feed intake is a common feature of response to stress in fish, but the regulation mechanism of feed intake is poorly understood. Our study was therefore conducted to estimate the effects of dietary PA on feed intake, feed utilization and feeding-related gene expression in juvenile grass carp. The levels of dietary PA supplementation were 0 (control), 5 (low) and 40 (high) g kg−1 diet, respectively. Triplicate groups (nine 300-L tanks) of grass carp (mean weight, 22.37 ± 0.16 g) were fed twice daily (08:00 and 16:00 h) to satiation for 8 weeks. Supplemental PA decreased the weight gain, feed intake, feed utilization and digestive enzyme activities of grass carp. Dietary PA supplementation decreased the apparent digestibilities of phosphorus, calcium and crude protein. The gene expression levels of cocaine- and amphetamine-regulated transcript (CART) and cholecystokinin (CCK) in the brain were enhanced with the increase of dietary PA supplementation. However, the neuropeptide Y (NPY) and ghrelin mRNA expression levels were reduced in fish fed with low PA, but increased significantly (P b 0.05) in fish fed with high PA compared to the control. No significant differences were observed in the gene expressions of NPY receptors Y8a and Y8b among all the groups. The results of this study indicated that the decrease of feed utilization and the increase of CART and CCK gene expressions in the brain might be the main factors for the decrease of feed intake in grass carp caused by dietary PA supplementation. Crown Copyright © 2014 Published by Elsevier B.V. All rights reserved.
1. Introduction Phytic acid (PA), also known as myoinositol hexaphosphate, is the main storage form of phosphorus in many plant seeds. However, phosphorus in the form of phytate is a poor source of nutrient for monogastric animals. Besides, PA can strongly chelate with cations and adversely affect the absorption and digestion of minerals in fish (Papatryphon et al., 1999). Moreover, PA can also integrate with protein, amino acids, starch and lipids in feedstuff. This integration is responsible for reduced digestibility of nutrients and leads to depressed growth of fish (Spinelli et al., 1983). The presence of PA/phytate in the aquafeed negatively affects the feed intake, growth and feed utilization. Spinelli et al. (1983) observed decreased growth rates in rainbow trout fed a diet containing 5 g kg−1 synthetic PA. Addition of 0.5% or 1% phytate in purified diets for the agastric common carp (Cyprinus carpio) caused a significant reduction in growth and feed efficiency (Hossain and Jauncey, 1993). High dietary ⁎ Corresponding author. Tel.: +86 27 8728 8255; fax: +86 27 8728 2114. E-mail addresses: [email protected] (L. Liu), [email protected] (X.-F. Liang). 1 Postal address: College of Fisheries, Key Lab of Freshwater Animal Breeding, Ministry of Agriculture, Huazhong Agricultural University; Freshwater Aquaculture Collaborative Innovation Center of Hubei Province, Wuhan, Hubei 430070, China.
PA (synthetic, 25.8 g kg−1) dramatically depressed the rate of growth in Chinook salmon (Richardson et al., 1985). Channel catfish fed a diet containing 2.2% phytate had significantly reduced weight gain and feed efficiency compared to fish fed a diet containing 1.1% phytate (Satoh et al., 1989). However, studies with reference of PA in grass carp are limited. Grass carp is an important and increasingly popular aquaculture species in China. The main feed of the fish is plant protein which contained many anti-nutrition factors. Therefore, it is important to study the effect of dietary anti-nutritional factor (such as PA) on grass carp. Changes in feeding behavior and appetite are often associated with changes in gene expression and/or protein concentration levels of appetite-regulating hormones or their receptors in fish (Aldegunde and Mancebo, 2006; Kamijo et al., 2011; Volkoff et al., 2010). Thus, changes in mRNA/protein level of a given hormone following feeding likely reflect its physiological role in feeding regulation (Lopez-Patino et al., 1999; Valassi et al., 2008). In fish, appetite is regulated by central and peripheral appetite-stimulating (orexigenic) or appetite-inhibiting (anorexigenic) factors. Neuropeptide Y (NPY) is the most important stimulant of food intake and body weight gain in vertebrates, including mammals and fish (Valassi et al., 2008; Volkoff et al., 2009). Whereas cholecystokinin (CCK), which is produced by the brain, is mostly synthesized in the gut and acts as a peripheral satiety factor (Volkoff
0044-8486/$ – see front matter. Crown Copyright © 2014 Published by Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.aquaculture.2013.12.044
202
L. Liu et al. / Aquaculture 424–425 (2014) 201–206
et al., 2005). Cocaine- and amphetamine-regulated transcript (CART) is an example of a central anorexigenic factor (Volkoff et al., 2005). Ghrelin gene expression in the brain, gut and serum provides further support to the orexigenic actions of ghrelin (both central and peripheral injections) in goldfish (Unniappan et al., 2004). So far, the research on feeding-related gene expression in freshwater species was focused on clone or injection, but less attention was given to the dietary nutrient factor. Furthermore, anti-nutrient factor such as PA which influenced feeding-related gene expression was not clearly understood in freshwater species including the grass carp. Besides, other aspects such as nutrient digestibility and digestive enzyme activity response to supplemented PA in the diet of grass carp were also unclear in limited research. The aim of this study was therefore to investigate the effects of dietary graded levels of PA on juvenile grass carp. Growth, feed intake, feed utilization, digestive enzyme activity and feeding-related gene expression are the main responses. 2. Material and methods 2.1. Diet preparation The composition and chemical analysis of the three experimental diets are shown in Table 1. The levels of dietary PA were 0, 5 and 40 g kg−1 (named as P0, P5 and P40), respectively. The PA (Powder, 99%) used in this study was produced by TongXiang Xinyang Food Additives CO., LTD (Zhejiang, China) and complied with the BP 2003 Standard. The ingredients were from the mainland of China and purchased from Shentianyu and Fulong Dietary Company (Wuhan, China). The ingredients were mixed and the diets were pelleted (2 mm diameter) by a laboratory pellet machine within 30 min. Finally, the pellets were air-dried and stored at −20 °C until used. 2.2. Fish, experimental conditions and assessment food intake About 400 grass carp were obtained from the Fish Center of Xiantao, Hubei, China. Prior to the experiment, the fish were distributed into 2 tanks (1000-L) provided with flow-through water for 15 days. These were randomly selected and distributed into 9 tanks (300-L) where the fish were acclimated for 2 weeks. Fish were fed to apparent satiation with the respective control diet twice a day at 08:00 and 16:00 (Beijing time) during the acclimation period. After 2-week acclimation, fish were starved for 24 h to measure the body length and weight at the beginning of the experiment. The stocking density was 20 fish (mean Table 1 Ingredients and compositions of diets with different levels of phytic acid. Item
P0
P5
P40
Ingredients (g/kg diet) Phytic acid Cellulose Othersa
0 148.5 851.5
5.0 143.5 851.5
40.0 108.5 851.5
Compositions (%) Crude protein Crude lipid Ash Moisture Total phosphorus Calcium
32.0 4.16 7.68 9.46 0.99 1.03
31.9 4.69 7.75 9.54 1.04 1.00
32. 8 4.71 7.81 9.80 1.04 1.02
a Others: Fish meal, 180 g/kg; Casein, 240 g/kg; Corn starch, 330 g/kg; Fish oil, 15 g/kg; Soybean oil, 15 g/kg; Vitamin premix (vitamin premix (per kg of diet): vitamin A, 2000 IU; vitamin B1 (thiamin), 5 mg; vitamin B2 (riboflavin), 5 mg; vitamin B6, 5 mg; vitamin B12, 0.025 mg; vitamin D3, 1200 IU; vitamin E 21 mg; vitamin K3 2.5 mg; folic acid, 1.3 mg; biotin, 0.05 mg; pantothenic acid calcium, 20 mg; inositol, 60 mg; ascorbic acid (35%), 110 mg; and niacinamide, 25 mg), 10 g/kg; Mineral premix (mineral premix (per kg of diet): MnSO4, 10 mg; MgSO4, 10 mg; KCl, 95 mg; NaCl, 165 mg; ZnSO4, 20 mg; KI, 1 mg; CuSO4, 12.5 mg; FeSO4, 105 mg; Na2SeO3, 0.1 mg; and Co, 1.5 mg), 20 g/kg; Ca(H2PO4)2, 20 g/kg; Chromic oxide, 5 g/kg; Choline chloride (50%), 6 g/kg; Ethoxyquin (30%), 0.5 g/kg; Carboxymethyl cellulose, 10 g/kg.
weight, 22.37 ± 0.16 g) per tank and each diet was fed to three randomly assigned tanks. The filtered flow-through tap water (pre-aerated) was kept at a flow-rate of 3 L min−1. The dissolved oxygen (DO) value was 7.33–7.94 mg L−1, the temperature ranged from 24 to 28 °C, the ammonia content was about 0.22 ± 0.02 mg L−1 and pH ranged from 7.06 to 7.52 during the experimental period. During whole feeding trial, the fish were fed to apparent satiation twice per day at 08:00 and 16:00 (Beijing time). Food residues were collected by siphon 2 h later, dessicated at 100 °C for 1 h and weighed. Food intake was calculated as the difference between the initial dry food weight and the adjusted uneaten dry food weight. 2.3. Sample collection and analyses At the end of the 8-week feeding trial, approximately 24 h after the last feeding, all the fish were anesthetized with 75 mg MS-222 L− 1 water (Liu et al., 2012). These fish were counted and weighed to determine survival ratio (SR), weight gain (WG) and specific growth rate (SGR). After obtaining the final weight of all fish, three fish from each tank were randomly selected and dried at 60 °C for subsequent determination of the whole body crude protein. Proximate analysis of crude protein was done following standard methods (AOAC, 1995). Crude protein (N × 6.25) of the samples was determined by the Kjeldahl method after an acid digestion using a Kjeltec system (Kjeltec 2300 Analyzer, Foss Tecator, Sweden). After that, protein efficiency ratio (PER) and protein retention efficiency (PR) were calculated. Proximate mineral contents in the diets and feces were determined by flame atomic absorption spectrophotometers (model AA — 6300C, Shimadzu, Kyoto Japan) following digestion in nitric acid after combustion of the sample in a muffle furnace (AOAC, 1995). The intestines were dissected and weighed, and then homogenized on ice. The homogenate was centrifuged at 5000 ×g for 15 min at 4 °C and the upper lipid layer was discarded. The supernatant was divided into small portions and kept at − 20 °C for later determination of the enzyme activities. The protein contents of the intestinal extracts were determined using the BCA method (Wuhan More Biotechnology Co., Ltd). Duplicate analyses were conducted for each sample. Amylase activity, protease activity and lipase activity were measured using assay kits (Nanjing Jiancheng Bioengineering Institute, China) according to the manufacturer's instructions. One unit of amylase activity was defined as the amount of enzyme that hydrolyzes 10.0 mg starch per 30 min. Protease activity was expressed as the equivalent enzyme activity that was required to generate an optical density (OD) change of 0.003. One unit of lipase activity was defined as enzyme required for the hydrolysis of 1 mmol of substrate per minute. Enzyme activities were expressed as specific activity (U protein−1). Apparent digestibility coefficient (ADC) was measured during the growth experiment by adding 0.5% chromic oxide (Cr2O3) to the diets as an inert marker (Liu et al., 2013a). Fish were fed the diets containing chromic oxide at the beginning of the trial, and then fecal samples were collected by Guelph-type settlement collectors from 7 days later. After feeding, the unconsumed feed and the residues were collected manually each day, while the feces were collected by hand-stripping of each tank about 2 h later. The feces were frozen at −20 °C and freeze dried until analyzed for phosphorus (P), calcium (Ca) and crude protein (CP) as well as chromic oxide. 2.4. RNA extraction Brains of three fish in each groups were immediately frozen in liquid nitrogen and stored at −80 °C for RNA isolation and subsequent analysis. Total RNA was extracted by SV Total RNA Isolation System kit (Promega, USA) as described by the manufacturer, and then its purity and quantity were measured using protein and nucleic acid analyzer and agarose gel electrophoresis. Then 1 μg of RNA was reverse
L. Liu et al. / Aquaculture 424–425 (2014) 201–206
transcribed to cDNA by PrimeScript® RT Master Mix (TaKaRa BIO, Tokyo, Japan) according to reagent's instructions. 2.5. Gene expression assay Real-time PCR was applied to evaluate the expression level of gene expression assay using gene-specific primers (Table 2). Betaactin gene, a housekeeping gene, was used as an endogenous reference to normalize the template amount. Real-time PCR assays were carried out in a quantitative thermal cycler (MyiQ™ 2 Two-Color Real-Time PCR Detection System, BIO-RAD, USA) with a 20 μL reaction volume containing 2 × SYBR® Premix Ex Taq™ (TaKaRa BIO, Tokyo, Japan) 10 μL, 10 mM each of forward and reverse primers 0.4 μL, 1 μL template and 8.2 μL sterile double-distilled water dH 2 O. The PCR parameters were 95 °C for 1 min followed by 40 cycles at 95 °C for 10 s, 57 °C for 30 s and a melt curve step (from 95 °C, gradually reducing 0.5 °C s − 1 to 57 °C, with acquisition data every 6 s). The amplification efficiencies of the control and target genes were approximately equal and ranged from 96.3 to 104.9%. Gene expression levels were quantified relative to the expression of β-actin using the optimized comparative Ct (2-ΔΔCt) value method (Livaka and Schmittgenb, 2001). All amplifications were performed in triplicate for each RNA sample.
203
Table 3 Growth, feed intake, protein efficiency ratio and protein retention efficiency of grass carp fed with different levels of phytic acid. Item
P0
IW (g) FW (g) WG (%) SGR (%/day) FI (g) PER PR (%) SR (%)
22.3 49.6 123 1.43 743 2.46 26.6 91.7
P5 ± ± ± ± ± ± ± ±
0.2 2.5c 12c 0.10c 28c 0.27c 2.6c 1.7
22.4 41.6 85.2 1.10 589 1.72 15.6 90.0
P40 ± ± ± ± ± ± ± ±
0.1 0.8b 3.3b 0.03b 12b 0.03b 1.1b 5.8
22.5 31.3 39.2 0.59 420 1.06 6.88 88.3
P-value ± ± ± ± ± ± ± ±
0.1 0.7a 3.9a 0.05a 18a 0.08a 0.63a 1.7
0.498 0.000 0.000 0.000 0.001 0.001 0.000 0.936
Values are means ± S.E. of three replicates and values within the same row with different letters are significantly different (P b 0.05). IW, initial weight; FW, final weight; WG (weight gain, %) = 100 × (FW − IW) / IW; SGR (specific growth ratio, %/day) = 100 × (lnFW − lnIW) / day; FI, feed intake; PER (protein efficiency ratio) = wet weight gain (g) / total protein fed (g); PR (protein retention efficiency, %) = 100 × [final body protein − initial body protein (g)] / total protein fed (g); SR (survival ratio, %) = 100 × (final fish number) / (initial fish number).
decreased weight gain (WG) (P = 0.000) and specific growth rate (SGR) (P = 0.000). Moreover, the growth and feed utilization were obviously inhibited when PA added up to 40 g kg−1 diet (Table 3). No significant difference was observed in survival ratio (SR) among all the treatments.
2.6. Calculations and statistical analyses The data were analyzed for WG, SGR, PER, PR and SR with the following formula: gainðWG; % Þ ¼ 100 ðfinal weight−initial weightÞ=initial weight; growth ratioðSGR; %=dÞ ¼ 100 ðln final weight–ln initial weightÞ=days; efficiency ratioðPERÞ ¼ wet weight gainðgÞ=total protein fedðgÞ; retention efficiencyðPR; % Þ ¼ 100 ½final body protein–initial body proteinðgÞ= total protein fedðgÞ; Survival ratioðSR; % Þ ¼ 100 ðfinal fish numberÞ=ðinitial fish numberÞ:
Weight Specific Protein Protein
3.2. Feed utilization of grass carp Dietary PA supplementation significantly reduced the apparent digestibilities of phosphorus (P) (P = 0.000), calcium (Ca) (P = 0.000) and crude protein (CP) (P = 0.000) (Table 4). Besides, supplemental phytic acid (PA) significantly decreased protein efficiency ratio (PER) (P = 0.001) and protein retention efficiency (PR) (P = 0.000). 3.3. Digestive enzyme activities in grass carp
The statistical analyses were performed with the statistical software package SPSS 19.0 (SPSS, Chicago, IL, USA). Data were expressed as means ± S.E. of three replicates. The data were subjected to one-way ANOVA and if differences were found, the means were ranked using Duncan's multiple comparisons test. Differences were considered significant at P b 0.05. 3. Results
Dietary PA supplementation decreased the intestinal digestive enzyme activities in grass carp (Table 5). The activities of intestinal protease, lipase and amylase were significantly inhibited in fish fed with P40 compared to the control. However, no significant difference was observed between fish fed with P5 and P0 (control). 3.4. Feeding-related gene expression in grass carp
3.1. Feed intake and growth performance of grass carp Dietary phytic acid (PA) supplementation significantly decreased feed intake (FI) (P = 0.001) which was obviously inhibited when fish were fed with P40 (shown in Table 3). Moreover, the FI was also affected by PA supplementation level. Supplemental PA significantly Table 2 Primer sequences for the quantitative real-time PCR. Accession no.
Gene
Primer
Sequence 5′–3′
M25013
β-actin
JQ951928
NPY
ESTs
Y8a
ESTs
Y8b
JF912411
CCK
ESTs
CART
JQ068139
Ghrelin
β-actin-F β-actin-R NPY-F NPY-R Y8a-F Y8a-R Y8b-F Y8b-R CCK-F CCK-R CART-F CART-R Ghrelin-F Ghrelin-R
GGCTGTGCTGTCCCTGTATG GGTAGTCAGTCAGGTCACGGC CTTCCTCTTGTTCGCCTGCT CCTTTTGCCATACCTCTGCC AATGTGTGCCCTCCCTCTGT CGATGAGGATGTTGGTGACG GATTTTTGACTGGAACCACGAG CGGCATCTGGAAAGCAGTG GGAACACACACGCCACACC GGAGAGGAACTTCTGCGGTATG AGTTTTACCCAAAGGACCCG TGACCCTTTTCTGATGGCG GCAGCACAGGACCGTATTTC TGCTCAGAAACCACAGGGTC
Supplemental PA affected several feeding-related gene expressions in the brain. The cocaine- and amphetamine-regulated transcript (CART) expression in the brain was increased with the increase of dietary PA, and significantly (P b 0.05) increased in fish fed with high dietary PA (Fig. 1A). The cholecystokinin (CCK) expression in the brain was significantly increased with the increased level of dietary PA (P b 0.05) (Fig. 1B). The ghrelin mRNA expression was very low, and its level was reduced in fish fed with P5 but increased significantly in fish fed with P40 (Fig. 2A). Neuropeptide Y (NPY) expression was also decreased in
Table 4 Apparent digestibilities of phosphorus (P), calcium (Ca) and crude protein (CP) in grass carp fed with different levels of phytic acid. Item
P0
P5
P40
P-value
P (%) Ca (%) CP (%)
58.4 ± 1.3c 90.8 ± 0.2c 93.2 ± 0.3c
46.5 ± 1.2b 88.6 ± 0.9b 89.7 ± 0.6b
29.1 ± 2.7a 84.3 ± 0.6a 88.2 ± 0.5a
0.000 0.000 0.000
Values are means ± S.E. of three replicates and values within the same row with different letters are significantly different (P b 0.05).
204
L. Liu et al. / Aquaculture 424–425 (2014) 201–206
Table 5 Digestive enzyme activities in grass carp fed with different levels of phytic acid. Item
P0
P5
P40
P-value
Protease (U/ug protein) Lipase (U/g protein) Amylase (U/mg protein)
18.0 ± 0.9b 19.2 ± 0.5b 52.7 ± 3.0b
16.6 ± 0.7ab 16.9 ± 0.7b 47.6 ± 1.9ab
15.5 ± 0.3a 12.4 ± 1.3a 43.6 ± 1.7a
0.093 0.005 0.077
Values are means ± S.E. of three replicates and values within the same row with different letters are significantly different (P b 0.05).
fish fed with P5 and an increased trend was observed in fish fed with P40 (Fig. 2B). The Y8a and Y8b mRNA levels had the same trend with NPY. Although the NPY mRNA level was significantly increased in fish fed with high PA-supplemented diet, the mRNA levels of Y8a and Y8b were not significantly different among all the groups (Fig. 2C and D). 4. Discussion Supplemental phytic acid (PA) significantly decreased weight gain and special growth ratio in this study. The effect of PA on growth primarily depends on the amount of dietary phytate (Hossain and Jauncey, 1993; Usmani and Jafri, 2002). Inclusion of 0.5% or 1% PA in purified diets for the agastric common carp (C. carpio) caused a significant reduction in growth and feed efficiency (Hossain and Jauncey, 1993). In the study of Usmani and Jafri (2002), specific growth rate of rohu (Labeo rohita) and mrigal (Cirrhinus mrigala) was significantly decreased when phytate was included N1% of total diet. In our study, growth was inhibited when dietary PA was given at a concentration of 40 g kg − 1 diet. In a previous study, channel catfish fed a diet containing 2.2% phytate had significantly reduced weight gain and feed efficiency compared to fish fed a diet containing 1.1% phytate (Satoh et al., 1989). In the study of Laining et al. (2010), weight gain of fish fed with diets containing more than 13.5 g phytate was significantly lower than those of the control group. Dietary PA supplementation decreased feed intake, especially when fish fed with high PA. Feed intake and growth responded negatively to the dose of dietary inclusion of PA (Denstadli et al., 2006), and the tolerance level of PA for growth and feed intake in their study was between 4.7 and 10.0 g kg − 1 . In the study of Laining et al. (2010), weight gain and feed intake of fish fed diets containing 13.5 and 20.6 g phytate were significantly lower than those of the control group (no phytate supplementation). These researches were in accordance with our study that the decrease of feed intake and growth is affected by dietary PA level and depressed deeply in high dietary PA supplementation level.
Supplemental PA decreased protein efficiency ratio and protein retention efficiency in the present study. The main reason was that dietary PA supplementation significantly decreased the apparent digestibility of crude protein in our study. Phytates form sparingly digestible phytate–protein complexes, thus reducing the availability of dietary protein (Richardson et al., 1985). Protein digestibility has been shown to decrease with the inclusion of 5 g sodium phyate kg − 1 in diets for rainbow trout (Spinelli et al., 1983) and 8 g PA kg − 1 for Atlantic salmon (Sajjadi and Carter, 2004). Richardson et al. (1985) also reported that 26 g PA kg− 1 reduced the protein efficiency ratio in Chinook salmon. Besides, dietary PA supplementation also significantly decreased the apparent digestibilities of phosphorus and calcium in our study. The possible reason is that a PA molecule has a substantial ability to chelate divalent cations including P and Ca to form mineral–PA complexes, which are indigestible or partially digestible for fish because of lack of phytase (Ellestad et al., 2002; Liu et al., 2013b). Another main factor concerning the decrease of protein utilization was the decrease of intestinal protease activity because of PA supplementation (significantly in high PA group) in our study. Proteases that hydrolyzed the protein were important in the digestion process, and allowed the ingested proteins to be broken down into simple molecules, which could be absorbed and used in metabolic pathways (Guillaume and Choubert, 2001). PA supplementation reduced the protease activity through sparingly digestible phytate–protein complexes, which could not be absorbed by fish, and thus leads to the reduction of protein utilization. Besides, the activities of intestinal lipase and amylase were inhibited in fish fed with high PA-supplemented diet compared with the control. Therefore, utilization of lipid and amylum might be decreased in fish fed with PA-supplemented diets. However, little related research was concerned about the effect of dietary PA supplementation on intestinal digestive enzyme activity. In fish, appetite is regulated by central and peripheral appetitestimulating (orexigenic) or appetite-inhibiting (anorexigenic) factors. The CART is a central anorexigenic factor and CCK is a peripheral anorexigenic factor (Volkoff et al., 2005). In the present study, the expression levels of CART and CCK were elevated in the brain with the increasing of dietary PA. Dietary PA supplementation caused an increase in the expression of CART and CCK in the brain, and thus reduced appetite and decreased feed intake of grass carp in this study. In goldfish, both central and peripheral injections of sulfated CCK suppress food intake (Volkoff et al., 2003). Administration of CART inhibits NPYstimulated food intake in goldfish, suggesting an inhibitory action of CART on NPY systems (Volkoff and Peter, 2000). Conformably, in our study, the CART was increased in fish fed with 5 g kg−1 PA while the NPY was decreased. Previously little attention has been given to study
Fig. 1. The relative mRNA level changes of cocaine- and amphetamine-regulated transcript (CART) (A) and ecystokinin (CCK) (B) in the brain of grass carp fed with different levels of phytic acid. Columns represent the means. Bars represent the S.E. Treatments that do not share a common letter are significantly different from each other as determined by one-way ANOVA (P b 0.05). Values are means ± S.E. (n = 9).
L. Liu et al. / Aquaculture 424–425 (2014) 201–206
205
Fig. 2. The relative mRNA level changes of ghrelin (A), neuropeptide Y (NPY) (B), Y8a (C) and Y8b (D) in the brain of grass carp fed with different levels of phytic acid. Columns represent the means. Bars represent the S.E. Treatments that do not share a common letter are significantly different from each other as determined by one-way ANOVA (P b 0.05). Values are means ± S.E. (n = 9).
the effects of PA addition on feeding-related gene expression. On the basis of our results it might be concluded that the increased CART and CCK expression might be the main reason for decreased feed intake. The NPY is the central appetite-stimulating (orexigenic) factor (Volkoff et al., 2005). In our previous study, we cloned the NPY gene in grass carp. The full-length cDNA sequence of gc-NPY was 797 bp, and an ORF of 96 amino acids, including the 28-residue signal peptide and 36-residue mature peptide. Our results indicated that NPY acted as an orexigenic factor in the grass carp (Zhou et al., 2013). In the present study, the NPY expression level was decreased in fish fed with low PA and an increased trend was observed in fish fed with high PA. In fish fed with low PA-supplemented diet, the dietary PA resulted in decreased appetite and feed intake, and thus the NPY expression was decreased. However, in the high dietary PA group, the appetite of fish was deeply decreased and the feed intake was also deeply reduced. In this situation, the stomach was empty which led to the increase of NPY expression as a regulated trend. This phenomenon was consistent with the study of Volkoff et al. (2005), fasting increased the brain mRNA expression of NPY. The ghrelin mRNA expression was very low, and its level was reduced in fish fed with low PA but increased significantly in fish fed with high PA. The ghrelin is another central appetitestimulating (orexigenic) factor in the regulation of feed intake. Similarly, the stomach of fish was also empty when they were fed with high PA diet and fasting increased the brain mRNA expression of ghrelin (Volkoff et al., 2005). No significant differences were observed in the expression of NPY receptors Y8a and Y8b among all the groups despite the NPY mRNA level was significantly increased in fish fed with high dietary PA. The possible reason was that the expressions of Y8a and Y8b were very low in the brain because they might not be the key receptors for NPY in the regulation process. Another possible explanation might be that the feeding trial was not long enough and the changes in mRNA level of these two receptors were not obvious. In our previous study, the results indicated that Y8b may be involved in the feeding regulation of grass carp (Zhou et al., 2013). So far, little study was conducted to evaluate the function of Y8a and Y8b in feed intake regulation of fish. Thus,
the mechanism of the two receptors regulating the feed intake by PA supplementation was unknown according to the present data. 5. Conclusion Dietary phytic acid (PA) decreased the feed intake and feed utilization, while it was also responsible for an increase in the expression of CART and CCK in the brain. All these changes led to a poor growth in fish fed with PA-supplemented diet. Based on this study it might be concluded that supplemental PA reduced the appetite of grass carp despite the fact that NPY and ghrelin expressions in the brain were increased in high dietary PA. Further studies are needed to investigate the signal pathway of feeding in grass carp to explain the changes of feeding behavior. Acknowledgment This work was financially supported by the National Basic Research Program of China (2009CB118702), the National Natural Science Foundation of China (31172420, 31072219), the Special Fund for AgroScientific Research in the Public Interest of China (201003020), the Fundamental Research Funds for the Central Universities (2010PY010, 2011PY030) and Huazhong Agricultural University Scientific & Technological Self-innovation Foundation (2012YB09). References Aldegunde, M., Mancebo, M., 2006. Effects of neuropeptide Y on food intake and brain biogenic amines in the rainbow trout (Oncorhynchus mykiss). Peptides 27, 719–727. AOAC (Association of Official Analytical Chemists), 1995. Official Methods of Analysis of Official Analytical Chemists International, 16th ed. AOAC, Arlington, VA. Denstadli, V., Skrede, A., Krogdahl, Å., Sahlstrøm, S., Storebakken, T., 2006. Feed intake, growth, feed conversion, digestibility, enzyme activities and intestinal structure in Atlantic salmon (Salmo salar L.) fed graded levels of phytic acid. Aquaculture 256, 365–376. Ellestad, L.E., Angel, R., Soares Jr., J.H., 2002. Intestinal phytase I: detection of preliminary characterization of activity in the intestinal brush border membrane of hybrid striped bass Morone saxatilis × M. chrysops. Fish Physiol. Biochem. 26, 249–258.
206
L. Liu et al. / Aquaculture 424–425 (2014) 201–206
Guillaume, J., Choubert, G., 2001. Digestive physiology and nutrient digestibility in fishes. In: Guillaume, J., Kaushik, S., Bergot, P., Métailler, R. (Eds.), Nutrition and Feeding of Fish and Crustaceans. Springer Praxis Publishing, Chichester UK, pp. 27–58. Hossain, M.A., Jauncey, K., 1993. The effects of varying dietary phytic acid, calcium and magnesium levels on the nutrition of common carp, Cyprinus carpio. In: INRA (Ed.), Fish Nutrition in Practice, IVth International Symposium on Fish Nutrition and Feeding, Biarritz, France, pp. 705–715. Kamijo, M., Kojima, K., Maruyama, K., Konno, N., Motohashi, E., Ikegami, T., Uchiyama, M., Shioda, S., Ando, H., Matsuda, K., 2011. Neuropeptide Y in tiger puffer (Takifugu rubripes): distribution, cloning, characterization, and mRNA expression responses to prandial condition. Zool. Sci. 28, 882–890. Laining, A., Traifalgar, R.F., Thu, M., Komilus, C.F., Kader, M.A., Koshio, S., Ishikawa, M., Yokoyama, S., 2010. Influence of dietary phytic acid on growth, feed intake, and nutrient utilization in juvenile Japanese flounder, Paralichthys olivaceus. J. World Aquacult. Soc. 41, 746–755. Liu, L.W., Su, J.M., Luo, Y.L., 2012. Effect of partial replacement of dietary monocalcium phosphate with neutral phytase on growth performance and phosphorus digestibility in gibel carp, Carassius auratus gibelio (Bloch). Aquac. Res. 43, 1404–1413. Liu, L.W., Su, J.M., Zhang, T., Liang, X.-F., Luo, Y.L., 2013a. Apparent digestibility of nutrients in grass carp (Ctenopharyngodon idellus) diet supplemented with graded levels of neutral phytase using pretreatment and spraying methods. Aquac. Nutr. 19, 91–99. Liu, L.W., Zhou, Y., Wu, J.J., Zhang, W., Abbas, K., Luo, Y.L., 2013b. Supplemental graded levels of neutral phytase using pretreatment and spraying methods in the diet of grass carp, Ctenopharyngodon idellus. Aquac. Res.. http://dx.doi.org/10.1111/are.12145. Livaka, K.J., Schmittgenb, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2−ΔΔCT method. Methods 25, 402–408. Lopez-Patino, M.A., Guijarro, A.I., Isorna, E., Delgado, M.J., Alonso-Bedate, M., Pedro, N.D., 1999. Neuropeptide Y has a stimulatory action on feeding behavior in goldfish (Carassius auratus). Eur. J. Pharmacol. 377, 147–153. Papatryphon, E., Howell, R.A., Soares, J.H., 1999. Growth and mineral absorption by striped bass Morone saxatilis fed a plant feedstuff based diet supplemented with phytase. J. World Aquacult. Soc. 30, 161–173. Richardson, N.L., Higgs, D.A., Beames, R.M., McBride, J.R., 1985. Influence of dietary calcium, phosphorus, zinc and sodium phytate level on cataract incidence, growth and histopathology in juvenile chinook salmon (Oncorhynchus tshawytscha). J. Nutr. 115, 553–567.
Sajjadi, Carter, 2004. Effect of phytic acid and phytase on feed intake, growth, digestibility and trypsin activity in Atlantic salmon (Salmo salar, L.). Aquac. Nutr. 10, 135–142. Satoh, S., Poe, W.E., Wilson, R.P., 1989. Effect of supplemental phytate and/or tricalcium phosphate on weight gain, feed efficiency and zinc content in vertebrae of channel catfish. Aquaculture 80, 155–161. Spinelli, J., Houle, C.R., Wekell, J.C., 1983. The effects of phytates on the growth of rainbow trout (Salmo gairdneri) fed purified diets containing varying quantities of calcium and magnesium. Aquaculture 30, 71–83. Unniappan, S., Canosa, L.F., Peter, R.E., 2004. Orexigenic actions of ghrelin in goldfish: feeding-induced changes in brain and gut mRNA expression and serum levels, and responses to central and peripheral injections. Neuroendocrinology 79, 100–108. Usmani, N., Jafri, A.K., 2002. Influence of dietary phytic acid on the growth, conversion efficiency, and carcass composition of Mrigal Cirrhinus mrigala (Hamilton) fry. J. World Aquacult. Soc. 33, 199–204. Valassi, E., Scacchi, M., Cavagnini, F., 2008. Neuroendocrine control of food intake. Nutr. Metab. Cardiovasc. Dis. 18, 158–168. Volkoff, H., Peter, R.E., 2000. Effects of CART peptides on food consumption, feeding and associated behaviors in the goldfish, Carassius auratus: actions on neuropeptide Yand orexin A-induced feeding. Brain Res. 887, 125–133. Volkoff, H., Eykelbosh, A.J., Peter, R.E., 2003. Role of leptin in the control of feeding of goldfish Carassius auratus: interactions with cholecystokinin, neuropeptide Y and orexin A, and modulation by fasting. Brain Res. 972, 90–109. Volkoff, H., Canosa, L.F., Unniappan, S., Cerdá-Reverter, J.M., Bernier, N.J., Kelly, S.P., Peter, R.E., 2005. Neuropeptides and the control of food intake in fish. Gen. Comp. Endocrinol. 142, 3–19. Volkoff, H., Unniappan, S., Kelly, S.P., 2009. The endocrine regulation of food intake. In: Bernier, N., Kraak, G.V.D., Farrell, A., Brauner, C. (Eds.), Fish Physiology, vol. 28. Academic Press, Burlington, pp. 421–465. Volkoff, H., Hoskins, L.J., Tuziak, S.M., 2010. Influence of intrinsic signals and environmental cues on the endocrine control of feeding in fish: potential application in aquaculture. Gen. Comp. Endocrinol. 167, 352–359. Zhou, Y., Liang, X.-F., Yuan, X.C., Li, J., He, Y., Fang, L., Guo, X.Z., Liu, L.W., Li, B., Shen, D., 2013. Neuropeptide Y stimulates food intake and regulates metabolism in grass carp, Ctenopharyngodon idellus. Aquaculture 380–383, 52–61.