Agrobacterium tumefaciens-mediated transformation: An efficient tool for insertional mutagenesis and targeted gene disruption in Harpophora oryzae

Microbiological Research 182 (2016) 40–48

Contents lists available at ScienceDirect

Microbiological Research journal homepage: www.elsevier.com/locate/micres

Agrobacterium tumefaciens-mediated transformation: An efficient tool for insertional mutagenesis and targeted gene disruption in Harpophora oryzae Ning Liu a , Guo-Qing Chen b , Guo-Ao Ning a , Huan-Bin Shi a , Chu-Long Zhang a , Jian-Ping Lu c , Li-Juan Mao e , Xiao-Xiao Feng a , Xiao-Hong Liu a , Zhen-Zhu Su a,∗ , Fu-Cheng Lin a,d,∗ a

State Key Laboratory for Rice Biology, Institute of Biotechnology, Zhejiang University, Hangzhou, China State Key Laboratory of Rice Biology, China National Rice Research Institute, Hangzhou, China c College of Life Sciences, Zhejiang University, Hangzhou 310058, China d China Tobacco Gene Research Center, Zhengzhou Tobacco Institute of CNTC, Zhengzhou, China e Analysis Center of Agrobiology and Environmental Science, Zhejiang University, Hangzhou, China b

a r t i c l e

i n f o

Article history: Received 20 July 2015 Received in revised form 22 September 2015 Accepted 28 September 2015 Available online 9 October 2015 Keywords: Endophytic fungus Harpophora oryzae Agrobacterium tumefaciens-mediated transformation Insertional mutagenesis Gene deletion mutagenesis Sulfonylurea resistance

a b s t r a c t The endophytic filamentous fungus Harpophora oryzae is a beneficial endosymbiont isolated from the wild rice. H. oryzae could not only effectively improve growth rate and biomass yield of rice crops, but also induce systemic resistance against the rice blast fungus, Magnaporthe oryzae. In this study, Agrobacterium tumefaciens-mediated transformation (ATMT) was employed and optimized to modify the H. oryzae genes by either random DNA fragment integration or targeted gene replacement. Our results showed that co-cultivation of H. oryzae conidia with A. tumefaciens in the presence of acetosyringone for 48 h at 22 ◦ C could lead to a relatively highest frequency of transformation, and 200 ␮M acetosyringone (AS) pre-cultivation of A. tumefaciens is also suggested. ATMT-mediated knockout mutagenesis was accomplished with the gene-deletion cassettes using a yeast homologous recombination method with a yeast–Escherichia–Agrobacterium shuttle vector pKOHo. Using the ATMT-mediated knockout mutagenesis, we successfully deleted three genes of H. oryzae (HoATG5, HoATG7, and HoATG8), and then got the null mutants Hoatg5, Hoatg7, and Hoatg8. These results suggest that ATMT is an efficient tool for gene modification including randomly insertional mutagenesis and gene deletion mutagenesis in H. oryzae. © 2015 Elsevier GmbH. All rights reserved.

1. Introduction In nature, plants abundantly form beneficial associations with microorganisms that are important for plant survival and, as such, affect plant biodiversity and ecosystem functioning (Zamioudis and Pieterse, 2012). This often occurs in the rhizosphere and promotes plant growth or helps the plant overcome biotic or abiotic stress. Dark septate endophytes (DSEs) can form a symbiosis with approximately 80% of all the terrestrial plant species and have been shown as an important component of beneficial microorganisms (Mandyam and Jumpponen, 2015). Plants gain advantages such as

∗ Corresponding authors at: State Key Laboratory for Rice Biology, Institute of Biotechnology, Zhejiang University, Hangzhou, China. Fax: +86 571 88982183. E-mail addresses: [email protected] (Z.-Z. Su), [email protected] (F.-C. Lin). http://dx.doi.org/10.1016/j.micres.2015.09.008 0944-5013/© 2015 Elsevier GmbH. All rights reserved.

growth promoting and stress resistance from the relationship of symbiosis. A common theme in discussion of endophytes is that they could be latent or quiescent pathogens. Thus the study of DSEs has long attracted significant interests (Newsham, 2011). Root endophytes, occupying a great proportion of mycorrhizal fungi, live within plant root tissues without causing symptoms of disease (Collins et al., 2008; Green et al., 2008). The fungus Harpophora oryzae was the first described endophyte isolated from the domestic Chinese wild rice (Oryza granulata) roots, where H. oryzae can significantly stimulate rice growth and biomass accumulation (Yuan et al., 2010). Moreover, H. oryzae can not only protect rice roots away from the invasion of the rice blast fungus, Magnaporthe oryzae, but also induce systemic resistance against rice blast, which qualifies it an attractive candidate for biological control (Su et al., 2013). What is peculiarly interesting is the report that H. oryzae is a close relative of the pathogen M. oryzae (Xu et al., 2014). Fur-

N. Liu et al. / Microbiological Research 182 (2016) 40–48

41

Fig. 1. (A) Sketch map of the new vector pKOHo. The promoter of H3 histone gene from H. oryzae (HoPH3) was introduced to replace the H3 promoter of M. oryzae. (B) Building of the knockout vector. The 5 and 3 flanking fragments of the targeted gene are generated from the H. oryzae genomic DNA by primers Targer-upF/Target-upR and Target-downF/Target-downR. Primers Targer-upF and Target-downR have 5’tails homologous to the vector while Target-upR and Target-downF have 5 tails homologous to the resistant gene SUR. The two flanking fragments, SUR cassette and gapped pKOHo were transformed into yeast, and then the circular knockout vector was created by homologous recombination.

ther identification of the symbiosis-related genes will enable us to address the key question underlying the pathogenic/symbiotic divergences between these two closely related fungi. In addition, we could take advantage of the symbiosis by genetically modification of H. oryzae rather than rice itself for the purpose of a higher rice production. Though the genome of H. oryzae has been sequenced recently (Xu et al., 2014), function genes are largely little analyzed and remained to be elucidated further. Therefore, developing molecular genetic tools to explore the biological function of interested genes is of great significance. Insertional mutagenesis techniques and target gene deletion techniques are considered as the most direct and powerful tools to decipher gene functions. The Agrobacterium tumefaciens-mediated transformation (ATMT) system has been used as an effective tool for insertional mutagenesis and homologous replacement in many organisms (Frandsen, 2011). A. tumefaciens is a gram-negative, plant-pathogenic bacterium that causes crown gall in plants (Wang et al., 2014). In recent years, ATMT has been frequently used for genetic manipulation of the filamentous fungi (Michielse et al., 2005). A. tumefaciens can transfer part of its DNA (T-DNA), which is contained in the tumor-inducing (Ti) plasmid, to the host chromosome for expression. Ti plasmid vectors have been developed to introduce target DNA sequences into various filamentous fungi, including members of the Ascomycetes, Basidiomycetes, and Zygomycetes phyla, as efficiently as to plants (Michielse et al., 2005; Sun et al., 2009; Chen et al., 2009). It is reported that the ATMT system has several advantages. Firstly, the transformation frequency via ATMT was significantly higher in comparison to the frequency through the traditional methods, regardless of whether conidia or protoplasts were used for transformation. Secondly, the ATMT assay does not require special equipment (Duarte et al., 2007). Finally, most of the transformants obtained by ATMT contained a single, randomly integrated T-DNA copy. Therefore, the ATMT system offers an efficient tool for target gene replacement mutagenesis. In our research, the key factors affecting the transformation frequency were optimized. Subsequently, we explored the ATMT as a tool for random insertional mutagenesis as well as for gene disruption in H. oryzae. The high efficient transformation method we developed enables us to obtain a large number of transformants with high efficiency of target-gene replacement in H. oryzae. And

we successfully got three autophagy genes deletion mutants of H. oryzae (Hoatg5, Hoatg7, and Hoatg8) through this high efficient transformation method. 2. Materials and methods 2.1. Strains and cultures Endophytic H. oryzae strains, R5-6-1, were isolated from healthy wild rice roots (Yuan et al., 2010) and grown at 25 ◦ C in the dark on complete medium agar (CM). Germinating phialidic conidia were harvested from 4-days-old potato dextrose broth (PDB, with 5 g glucose/l) (Sivasithamparam, 1975). A. tumefaciens strain AGL-1 (Li et al., 2012) carrying the plasmid pKOHo was used as T-DNA donor for fungal transformation. A. tumefaciens strain AGL-1 was cultured at 28 ◦ C in Lysogenic Broth (LB) medium. Saccharomyces cerevisiae strain FY834, and Escherichia coli strain DH5␣ were used. 2.2. The sensitivity assays to antibiotic in oryzae Fungi plugs were cultured in DCM and CM plates at 28 ◦ C with incremental sulfonylurea and hygromycin concentrations: 100, 200, 300, 400, 500, 600 ␮g/ml and no antibiotic. The appearance and size of fungal colonies was observed after 7 days. 2.3. Plasmid construction pKO1B, a yeast–Escherichia–Agrobacterium shuttle vector (Lu et al., 2014), contains the eGFP gene which controlled by the promoter of histone H3 in M. oryzae to identify the insertional mutants. In this study, the promoter of histone H3 in M. oryzae was replaced by that in H. oryzae. This new plasmid was designed as pKOHo (Fig. 1A). Due to the ability to shuttle in three organisms, S. cerevisiae, E. coli and A. tumefaciens, three DNA fragments (5 and 3 flanking fragments of the targeted gene and a resistant gene fragment) could be merged into a gene-deletion cassette in one step by yeast recombination cloning. Then the vectors obtained were directly transformed into Agrobacterium, and ATMT method was used to transform fungal cells in H. oryzae.

42

N. Liu et al. / Microbiological Research 182 (2016) 40–48

Table 1 Oligonucleotide primers used in this study. Name

Sequence(5 -3 )

SUR-F SUR-R

GTGCCAACGCCACAGTGCC GTGAGAGCATGCAATTCCC

Target-upF/target-upR ATG5-upF ATG5-upR ATG7-upF ATG7-upR ATG8-upF ATG8-upR

GCTGTACAAGTAAGAGCTCGGTACCCGGGGATCTGGTTACTTGCCGCTTTG CCGGGAGATGTGGGGCACTGTGGCGTTGGCACATCGGACGATGATGGGTGA GCTGTACAAGTAAGAGCTCGGTACCCGGGGATCCTACGCTGATGAGCAGGAAGA CCGGGAGATGTGGGGCACTGTGGCGTTGGCACATTGGTGCGATGTTGGATTG GCTGTACAAGTAAGAGCTCGGTACCCGGGGATCTCCGTTTCCGAGGTTCTG CCGGGAGATGTGGGGCACTGTGGCGTTGGCACAGGTTGGGTTGTTGGTTTGAT

Target-downF/target-downR ATG5-downF ATG5-downR ATG7-downF ATG7-downR ATG8-downF ATG8-downR

TTGATTATTGCACGGGAATTGCATGCTCTCACATGCCCGAGCTAGTTTAGG TTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCAACCGACGATAAGGAGAAGAG TTGATTATTGCACGGGAATTGCATGCTCTCACAGGATTAGGAGCAAGCGGAAGG TTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCAGGGACAGACCCAGACCAGAAA TTGATTATTGCACGGGAATTGCATGCTCTCACAACTCGGACTTCAGCTTGTG TTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCAAACGGGCGGTTTATTCTA

Target-F/target-R ATG5-F ATG5-R ATG7-F ATG7-R ATG8-F ATG8-R

CGTTTAGCAGCTGGTTGTTG GGACTCCGTACCTTGATGAATAC ACGAACGAGGAGAGGACTAAA CACCGATGAATCCTTGACTTACA GGTGAGTAACTGTGATGAGA TGGACGAAGATGAAGATGG

Tubulin-F Tubulin-R

ACTACACTGAGGGTGCTGA CGAAGCCGACCATGAAGAA

Target-P1/target-P2 ATG5-P1 ATG5-P2 ATG7-P1 ATG7-P2 ATG8-P1 ATG8-P2

CCTTCTCGTCTGGAACTATTGG GCCAACAGTACGAAGCATTTC GTCGCGTCGTCGTACATC GCCAACAGTACGAAGCATTTC TATAGGCAAGGATAAGCAACGG TGGTTACGCTCCTCCTCAGAT

qSur-F qSur-R

CAAGGAGTGGAAGGAGAAGTG CCGGTTGTGATGTAGGTCATG

qTubulin-F qTubulin-R

TCTGCATTGATAACGAGGCTC GAAACCAGGTAGTTCAGGTCG

The knockout vector was constructed following the protocol of Lu et al. (2014). The 5 and 3 flanking fragments of the targeted genes were separately amplified from genomic DNA with primers Targer-upF/Target-upR and Target-downF/Target-downR (Table 1). Primers Target-upR and Target-downF have 5 tails homologous to the sulfonylurea receptor (SUR) gene, and those for Target-upF and Target-downR are homologous to the vector. The SUR cassette fragment was generated from pBS-SUR with primers SUR-F and SUR-R (Table 1). The two flanking fragments, SUR cassette and gapped pKOHo were transformed into yeast, and then the circular knockout vector was created by homologous recombination (Fig. 1B). The plasmids were extracted with TIANprep yeast plasmid DNA kit (Tiangen Biotech, China) and transformed into the E. coli strain DH5˛. Whether homologous recombinational happened or not was confirmed by bacterial culture PCR with primers Targer-upF and Target-downR (Table 1). The confirmed plasmid was then transformed into A. tumefaciens, and the correct A. tumefaciens was confirmed following the same method with that of DH5˛. The confirmed A. tumefaciens was used for ATMT, which applied for target-gene replacement finally. 2.4. Conditions for A. tumefaciens-mediated transformation A. tumefaciens strain AGL-1 using the freeze/thaw shock transformation method following the procedure described in the previous reports (Rho et al., 2001). H. oryzae strain R5-6-1 was grown on CM for 7 days in the dark. The conidia were harvested from 4-days-old potato dextrose broth and transformed with the

plasmids mediated by A. tumefaciens following a reported procedure by Rho et al. (2001). The cells of A. tumefaciens and the conidia of H. oryzae were co-cultured on nitrocellulose membrane placed on A. tumefaciens Induced Medium (AIM) in the dark at different temperatures (18–37 ◦ C) for 2 days. Then the nitrocellulose membrane was cut into strips and transferred onto the selection defined complex medium (DCM) containing 400 ␮g/ml sulfonylurea, 400 ␮g/ml cefotaxime and 60 ␮g/ml streptomycin. Individual sulfonylurea-resistant transformants were appeared after 5 days on average. 2.5. Identification of transformants 2.5.1. Extraction of genomic DNA Genomic DNA from H. oryzae was extracted following the CTAB protocol of Lu et al. (2014) with some modifications. A piece of mycelia (>9 mm2 ) along with little medium was collected in a 2ml round-bottom tube, which is added with 400 ␮l ddH2 O and 0.1 g porcelain beads. The tubes then were shook in a Fastprep24 homogenizer (MP, USA) at 4.0 m/s for 1 min, then were added with 400 ␮l 4× CATB buffer (4% CTAB, 100 mM Trisma base, 20 mM EDTA, 1.4 M NaCl) and incubated at 65 ◦ C for 30 min. The following step was referred to the normal CTAB protocol (Lu et al., 2014). 2.5.2. GFP fluorescence as a marker of random insertional mutagenesis GFP was activated when the T-DNA were ectopically integrated into fungal genomic DNA. The green fluorescence can be observed

N. Liu et al. / Microbiological Research 182 (2016) 40–48

43

Fig. 2. Sensitivity test to antibiotic in H. oryzae. (A) The mycelial growth of H. oryzae was analyzed on CM with various concentrations of hygromycin after 7 days incubation before observation. (B) The mycelial growth of H. oryzae was analyzed on DCM with various concentrations of sulfonylurea after 7 days incubation before observation.

Table 2 Efficiency of the transformation system. Gene

Total transformants

GFP-free transformants

Knocked-out mutants

KO/total (%)

KO/GFP-free (%)

Increased folds

HoATG5 HoATG7 HoATG8

91 74 83

34 25 37

20 13 24

22.0 17.6 28.9

58.8 52.0 64.9

2.7 3.0 2.2

using the fluorescence microscope (Nikon, Japan) in ectopically integrated mutants, but not in the null mutants. We selected a small piece of mycelium and then put them onto a glass slide which can hold at most six pieces. Whether the transformants harbored green fluorescence or not can be observed under a fluorescence microscope. 2.5.3. PCR analyses The first round PCR called double PCR which is used to detect the targeted gene and ˇ-tubulin gene were carried out to screen null mutants. Double PCR was performed using primers Target-F/Target-R limited in the targeted gene and primers Tubulin-F/Tubulin-R for the positive control ˇ-tubulin gene (Table 1). The PCR products were detected using 1.0% agarose gel electrophoresis. If the target gene was deleted, there was only one band for ˇ-tubulin, which performs as a positive control; otherwise, there were two bands including the target gene and the ˇ-tubulin gene in ectopic transformants and the wild-type strain (Fig. 5A).

Mutants showed one band by the first round PCR were further identified by the second round PCR. The method of primer designing is particularly worth mentioning. One was limited in the genomic DNA outside of the 5 to 3 flanking fragment of the target gene, and the other was limited in the SUR gene (Target-P1/TargetP2 in Table 1). One band of 1.6–1.9 kb on the electrophoretic gel appeared in null mutants, and no band appeared in the ectopic transformants and wild-type strain (Fig. 5A). 2.5.4. Quantitative PCR Quantitative PCR were used to identify copies of transformed gene deletion cassettes in null mutants, compared with the wildtype strain using ˇ-tubulin (one copy in the genome) as a control. The primers qSur-F/qSur-R and qTubulin-F/qTubulin-R (Table 1) were used. The concentration of DNA samples of null mutants was standardized to 25 ng/␮l by NANO drop (Thermo, USA). The SUR gene was inserted into the genomic DNA of the mutant in different copies. If the copy number of the SUR gene was 1.0 ± 0.2 time

44

N. Liu et al. / Microbiological Research 182 (2016) 40–48

Fig. 3. (A) A. tumefaciens cells were cultured in the A. tumefaciens Induced Medium (AIM) in the presence or absence of AS during the pre-cultivation period. Difference of the transformation frequency is showed by increasing the co-cultivation time. (B) Effect of mixture ratio between A. tumefaciens cells and H. oryzae conidia on transformation frequency. (C) Effect of the number of A. tumefaciens cells utilized for co-cultivation on transformation frequency. A. tumefaciens cells were cultured in AIM in the presence or absence of AS in the pre-cultivation. (D) Effect of temperature on transformation. As the temperature of co-cultivatiom verifies, the amount of transformants per 106 conidia shows different. Data presented as the average of 9 plates per treatment. Error bars indicate standard error.

the ˇ-tubulin gene in genomic DNA, the mutant was regarded as containing a single insertion of the SUR gene.

2.5.5. Southern blot Total DNA of H. oryzae transformants was extracted according to the CTAB method. The detailed protocol of Southern blot was performed following the specifications of DIG-High Prime DNA Labeling and Detection Starter Kit I (Roche, USA).

3. Results 3.1. Sulfonylurea as a selectable marker for oryzae To introduce exogenous DNA fragment into H. oryzae, hygromycin and sulfonylurea resistance genes were both tested as a selection marker. When no visible mycelial growth was observed, the concentration of hygromycin used (Fig. 2A) was higher than that of sulfonylurea (Fig. 2B). Thus sulfonylurea was used as the selectable marker to select for a successful genetic modification of H. oryzae, and the minimal inhibitory concentration was subsequently determined as the lowest concentration at which no visible mycelial growth was observed. Our analysis showed that DCM plates supplemented with 400 ␮g/ml sulfonylurea completely inhibited the growth of a H. oryzae-inoculum for up to 7 days (Fig. 2B). We thus used this antibiotic concentration for the selection of H. oryzae transformants generated from the ATMT.

3.2. Optimization of conditions for ATMT of oryzae 3.2.1. The addition of acetosyringone to tumefaciens in pre-culture and co-culture period Acetosyringone (AS) is a compound that induces the expression of virulence genes in A. tumefaciens, and plays an essential role in fungal transformation (Chen et al., 2000; de Groot et al., 1998; Mullins et al., 2001). The addition of AS, however, was reported to be optional for the pre-cultivation of A. tumefaciens. We made an attempt to find out whether the addition of AS is optional during the pre-cultivation in our trial. The number of formed transformants were more and more with AS during pre-cultivation as the co-cultivation time advanced (Fig. 3A). To obtain an optimal yield of tranformants, a series of co-cultivation time (24, 36, 48, and 60 h) was carried out in ATMT procedure before the selection of H. oryzae transformants from non-tranformants. As shown in Fig. 3A, there was a continuous increase of fungal transformants as incubation time increased from 24 h to 48 h, while none of tranformants could be selected at 60 h post-co-incubation due to mycelial overgrowing of the strains. Therefore, AS pre-incubation and a subsequent 48 h co-incubation time was selected for a better ATMT result.

3.2.2. The ratio of the bacterial and fungal mixtures The ratio of the bacterial and fungal mixtures during cocultivation was shown to have a significant impact on the transformation frequency (Michielse et al., 2008). The conidial germination rate of H. oryzae after 48 h in the water was determined as only approximately 40%, fewer than those of other studied fungi, so we increased the number of the conidia of H. oryzae. A. tumefaciens

N. Liu et al. / Microbiological Research 182 (2016) 40–48

45

Fig. 4. (A) Two types of transfomants after ATMT. The GFP cassette will be degraded in the putative gene deletion mutants because of the homologous recombination event. However, the GFP cassette still remains in the random insertional transformants. (B) A gene deletion mutant and a random insertional mutant of HoATG5 under a fluorescence microscope.

Fig. 5. Analysis of the PCR products. (A) Two rounds of PCR are applied to screen the transformants. The first round PCR is a double PCR which use the ␤-tubulin gene as a positive control. The null mutant will not produce two bands as the wide-type does. The second round PCR is to amplify a unique recombinational DNA fragment marked as a knockout event. The null mutant will produce a recombinational DNA band while wide-type would not. (B) PCR products of HoATG5 deletion mutant. (C) PCR products of HoATG7 deletion mutant. (D) PCR products of HoATG8 deletion mutant.

46

N. Liu et al. / Microbiological Research 182 (2016) 40–48

Fig. 6. Southern hybridization of the null mutants. The DNAs were individually hybridized with the probes.

cells in a series of cell densities (OD600 = 0.2–0.8) were co-cultivated with various concentrations of H. oryzae conidia (105 , 106 , 107 conidia/ml). As shown in Fig. 3B, the highest transformation efficiency was acquired when the cell density of A. tumefaciens (OD600 ) reached to 0.4 and the H. oryzae conidia were 1 × 106 conidia/ml. Under this condition, we harvested 29 transformants per plate. We tested the effects of the number of A. tumefaciens cells used for co-cultivation. Different volumes of the A. tumefaciens cells from the same culture, ranging from 50 to 200 ␮l, were centrifuged to collect cells. The cells were resuspended with 100 ␮l of AIM, and then co-cultivated with 100 ␮l of H. oryzae conidia (1 × 106 conidia/ml) for 48 h. The result is that the transformation frequency increased with the A. tumefaciens cell number increasing (Fig. 3C), and the number of transformants per plate reached the most of 17 when we used 200 ␮l of A. tumefaciens cells.

3.2.3. Co-cultivation temperature Analysis of co-cultivation temperature ranging from 18 ◦ C to 37 ◦ C showed that a peak of transformant formation was observed at 22 ◦ C. 67 transformants per plate were got when the cocultivation temperature reached 22 ◦ C, while the number declined dramatically when the temperature was either lower or higher than that optimum temperature point. There was even no transformants could be obtained as the temperature increased to 37 ◦ C (Fig. 3D). In conclusion, the optimization of ATMT conditions is showed clearly. 200 ␮l of A. tumefaciens cells (OD600 = 0.4) resuspended with

100 ␮l of AIM, then co-cultivated with 100 ␮l of H. oryzae conidia (1 × 106 conidia/ml) for 48 h under the temperature of 22 ◦ C, and all of these can make us receive the highest transformation efficiency.

3.3. Target-gene replacement of H. oryzae using ATMT 3.3.1. Construction of the vectors of target-gene replacement In order to analysis the function genes in H. oryzae, target-gene replacement was carried out using the ATMT methods above. We had constructed three vectors of autophagy related genes replacement by yeast recombinational cloning following the methods mentioned above. They were respectively pKOHo-ATG5, pKOHoATG7 and pKOHo-ATG8, which were used for ATMT in this study. Three null mutants of Hoatg5, Hoatg7 and Hoatg8 were successfully got through the optimized ATMT we got above.

3.3.2. GFP fluorescence as a marker for labeling random insertional mutants As the fluorescent cassette was lost after the homologous recombination event, gene knockout mutants could be distinguished from transformants with random insertion in the aid of fluorescence microscope (Fig. 4A). Take the case of gene HoATG5, gene deletion mutants do have not GFP fluorescence, but random insertional transformants do (Fig. 4B). Taking the functional analysis of three autophagy-related genes, HoATG5, HoATG7, and HoATG8,

N. Liu et al. / Microbiological Research 182 (2016) 40–48

47

Fig. 7. (A) Colony characteristics of the wild-type strain and mutants (Hoatg5, Hoatg7, Hoatg8) on CM plates for 7 days. Bar = 1 cm. (B) Colony diameters of the wild-type strain and mutants (Hoatg5, Hoatg7, Hoatg8) on CM plates for 7 days. Data presented as the average of 9 plates per treatment. Error bars indicate standard error.

GFP fluorescence-aided strategy dramatically improved the efficiency for screening of null mutants by 2–3 folds (Table 2). 3.3.3. PCR analysis of the null mutant. A number of transformants with fluorescence was eliminated using the fluorescence microscope. Candidate mutants without fluorescence were further tested if they were knockout mutants or not by two round PCR. The wild-type strain has products of 500 bp and 200–400 bp, which separately represent ˇ-tubulin gene and target gene in the first round PCR, however, the null mutant only has 500 bp for ˇ-tubulin gene. The null mutant showed the band of 1.6–1.9 kb in the second round PCR because of the unique recombinational DNA fragment generated by homologous recombination, while the wild-type strain has no band as shown (Fig. 5A). The candidate mutant of HoATG5 mutant only has 500 bp for ˇ-tubulin gene, but the wild-type strain has products of 500 bp and 275 bp. The candidate mutant of HoATG5 obtained the band of 1813 bp, while the wild-type has no band as shown in Fig. 5B. The same as the HoATG5 mutant, the candidate mutant of Hoatg7 showed the band of 500 bp, while the wild-type showed the bands of 500 bp and 273 bp. The candidate mutant of Hoatg7 showed the band of 1771 bp, while the wild-type has no band (Fig. 5C). In Fig. 5D, the candidate mutant of Hoatg8 and the wild-type stain separately both obtain products of 500 bp, but the candidate mutant of Hoatg8 has an extra product of 339 bp. The candidate mutant of Hoatg8 showed the band of 1662 bp, while the wild-type has no band (Fig. 5D). We successfully obtained three null mutants of Harpophora oryzae (HoATG5, HoATG7, and HoATG8). 3.3.4. Confirmation of a single-copy deletion of the target gene. The copy number of gene-deletion cassette could be determined by Real-time PCR by using SUR gene and ˇ-tubulin as the detection signal and the background control, respectively. The null mutants had one copy of the SUR cassette, while the null+ectopic transformants had at least two copies and the wild-type strain had none. Finally, the mutants containing a single copy of the gene deletion cassette were considered null mutants. Nearly all of above regular PCR-confirmed isolates were proven to be deletion mutant without ectopic insertion. Southern blot was also performed with random selected isolates to confirm gene knockout without random insertion. Only one band was detected in Hoatg5, Hoatg7, and Hoatg8, which size was

respective 4.0 kb, 5.9 kb, and 4.8 kb. Differences appeared in that of wild-type strain, which size was respective 1.8 kb, 2.5, 2.0 kb. All of this indicated that homologous recombination occurred at a single site (Fig. 6). 3.3.5. Genetic stability of transformants In general, an effective mutagenesis system also requires genetic stability of the transformants without mitotic segregation. In the previous reports, transformants have been observed to be stable inheritance of the recombinant DNA during continuous cultivation under non-selective condition (Leclerque et al., 2004; Zhong et al., 2007). To monitor the mitotic stability in H. oryzae transformants, five random selected mutants from each of Hoatg5, Hoatg7, and Hoatg8 were tested for their capacities in sulfonylurea-resistance after being cultured for five generations in the absence of sulfonylurea. All of these null mutants were able to grow on CM containing 400 ␮g/ml sulfonylurea, suggesting that SUR gene was constantly maintained in the genomes of all the null mutants. Besides, there were no significant differences in phenotype between the wild type and all used mutants along cultivation. 3.3.6. Phenotypes of the mutants The colony characteristics of three null mutants were tested on CM plates after inoculated 7 days (Fig. 7A). The diameters of wild-type/Hoatg5/Hoatg7/Hoatg8 colonies are 76.0 mm/79.0 mm/49.5 mm/62.6 mm respectively (Fig. 7B). The growth of the Hoatg7/Hoatg8 mutant were slower than the wild-type strain, however, the growth of the Hoatg5 mutant was faster than the wild-type strain. Compared with the dense aerial hypha of the wild-type strain on CM plates, the Hoatg7 and Hoatg8 mutants show sparse aerial hypha. All these data showed that the knockout mutants provide valuable materials for the future research on H. oryzae. 4. Discussions Fungal endophytes have attracted a great deal of attention because of their striking diversities in species and function. As a beneficial endosymbiont of wild rice, H. oryzae has also been shown to be of great value in agricultural management (Su et al., 2013). In the recent years, more and more efforts have directed toward

48

N. Liu et al. / Microbiological Research 182 (2016) 40–48

functional genomics research in fungi. Genome-wide construction of gene deletion mutant library provides a valuable resource for the broader understanding of fungal cell biology and biochemistry in the yeast S. cerevisiae and Schizosaccharomyces pombe (Tong et al., 2001; Kim et al., 2010), as well as the filamentous fungus Neurospora crassa (Colot et al., 2006). The availability of H. oryzae genome greatly promoted the progress of research into the fundamental mechanisms of mutualistic symbiosis, which would pave the way for H. oryzae in agricultural application. However, there was limited functional genomics research on endophytic fungi, let alone appropriate research methods used. Here, we first present an approach that utilizes A. tumefaciens-mediated transformation for genetic modification, including insertional mutagenesis and gene disruption, in an endophytic fungus H. oryzae. This study provides a comprehensive analysis of the conditions for ATMT in H. oryzae, which is unprecedented in any endophytic fungus. We found that using sulfonylurea is more proper than hygromycin as the selectable marker for H. oryzae. Transformation frequency was not only related to the stimulation of AS to A. tumefaciens during the co-cultivation with H. oryzae, but also did in the pre-culture period. Our results also presented a modified ratio between A. tumefaciens cell density and H. oryzae conidia, while the co-cultivation time and temperature were determined as 48 h and 22 ◦ C for achieving highest transformation efficiency. High-throughput screening of gene function has been merged as a hot topic in functional genomics research among fungi. With the purpose of deeper elucidation into the molecular mechanism of symbiosis between plants and endophytic fungi, we testified the applicability of the vector pKOHo for rapid and time-effective generation of targeted gene replacement in H. oryzae. The incorporation of GFP fluorescence was proved to be of great efficiency in the distinction of null mutants from the transformants with random insertion in H. oryzae. Besides, the combination of regular plus qPCR brought great convenience for the confirmation of homologous recombination, in consistent with the results in M. oryzae. The copy number of the gene-deletion cassette in mutant genomic DNA quantified by qPCR had been widely utilized in animals and plants (Ginzinger, 2002; Ingham et al., 2001), although Southern blot was still the priority in fungi. Our results favored the former methodology due to their similar accuracies, however, less time- and cost-consuming, which is especially important in massive, high-throughput work. A large amount of functional genes can be studied in parallel via this approach, which can aid the exploration of the relationship between fundamental pathways (e.g. autophagy) and mutualistic symbiosis. Three autophagy-related genes, HoATG5, HoATG7, and HoATG8, were selected and further disrupted, respectively, in due to their important roles in autophagy and different location on chromosomes. Taken together, this is the first demonstration that a general genetic approach of studying gene function is reported in H. oryzae. The method described in this study also provides the foundation for future genetic researches in other endophytic fungus. Acknowledgement This work was supported by the National High Technology Research and Development Program of China (863 Program, grant no. 2011AA10A205-03). References Chen, E.C., Su, Y.H., Kanagarajan, S., Agrawal, D.C., Tsay, H.S., 2009. Development of an activation tagging system for the basidiomycetous medicinal fungus Antrodia cinnamomea. Mycol. Res. 113, 290–297. Chen, X., Stone, M., Schlagnhaufer, C., Romaine, C.P., 2000. A fruiting body tissue method for efficient Agrobacterium-mediated transformation of Agaricus bisporus. Appl. Environ. Microbiol. 66, 4510–4513.

Collins, S.L., Sinsabaugh, R.L., Crenshaw, C., Green, L., Porras-Alfaro, A., Stursova, M., et al., 2008. Pulse dynamics and microbial processes in aridland ecosystems. J. Ecol. 96, 413–420. Colot, H.V., Park, G., Turner, G.E., Ringelberg, C., Crew, C.M., Litvinkova, L., et al., 2006. A high-throughput gene knockout procedure for Neurospora reveals functions for multiple transcription factors. Proc. Natl. Acad. Sci. U. S. A. 103, 10352–10357. de Groot, M.J.A., Bundock, P., Hooykaas, P.J.J., Beijersbergen, A.G.M., 1998. Agrobacterium tumefaciens-mediated transformation of filamentous fungi. Nat. Biotechnol. 16, 839–842. Duarte, R.T.D., Staats, C.C., Fungaro, M.H.P., Schrank, A., Vainsten, M.H., Furlaneto-Maia, L., et al., 2007. Development of a simple and rapid Agrobacterium tumefaciens-mediated transformation system for the entomopathogenic fungus Metarhizium anisopliae var. acridum. Lett. Appl. Microbiol. 44, 248–254. Frandsen, R.J.N., 2011. A guide to binary vectors and strategies for targeted genome modification in fungi using Agrobacterium tumefaciens-mediated transformation. J. Microbiol. Methods 87, 247–262. Ginzinger, D.G., 2002. Gene quantification using real-time quantitative PCR: an emerging technology hits the mainstream. Exp. Hematol. 30, 503–512. Green, L.E., Porras-Alfaro, A., Sinsabaugh, R.L., 2008. Translocation of nitrogen and carbon integrates biotic crust and grass production in desert grassland. J. Ecol. 96, 1076–1085. Ingham, D.J., Beer, S., Money, S., Hansen, G., 2001. Quantitative real-time PCR assay for determining transgene copy number in transformed plants. Biotechniques 31, 132–140. Kim, D.U., Hayles, J., Kim, D., Wood, V., Park, H.O., Won, M., et al., 2010. Analysis of a genome-wide set of gene deletions in the fission yeast Schizosaccharomyces pombe. Nat. Biotechnol. 28, 617–623. Leclerque, A., Wan, H., Abschutz, A., Chen, S., Mitina, G.V., Zimmermann, G., 2004. Agrobacterium-mediated insertional mutagenesis (AIM) of the entomopathogenic fungus Beauveria bassiana. Curr. Genet. 45, 111–119. Li, H.J., Lu, J.P., Liu, X.H., Zhang, L.L., Lin, F.C., 2012. Vectors building and usage for gene knockout, protein expression and fluorescent fusion protein in the rice blast fungus. J. Agric. Biotechnol. 20, 94–104. Lu, J.P., Cao, H.J., Zhang, L.L., Huang, P.Y., Lin, F.C., 2014. Systematic analysis of Zn2 Cys6 transcription factors required for development and pathogenicity by high-throughput gene knockout in the rice blast fungus. PLoS Pathog. 10 (10), e1004432. Mandyam, K.G., Jumpponen, A., 2015. Mutualism-parasitism paradigm synthesized from results of root-endophyte models. Front. Microbiol., 5. Michielse, C.B., Hooykaas, P.J., van den Hondel, C.A., Ram, A.F., 2005. Agrobacterium-mediated transformation as a tool for functional genomics in fungi. Curr. Genet. 48, 1–17. Michielse, C.B., Hooykaas, P.J., van den Hondel, C.A., Ram, A.F., 2008. Agrobacterium-mediated transformation of the filamentous fungus Aspergillus awamori. Nat. Protoc. 3, 1671–1678. Mullins, E.D., Chen, X., Romaine, P., Raina, R., Geiser, D.M., Kang, S., 2001. Agrobacterium-mediated transformation of Fusarium oxysporum: an efficient tool for insertional mutagenesis and gene transfer. Phytopathology 91, 173–180. Newsham, K.K., 2011. A meta-analysis of plant responses to dark septate root endophytes. New Phytol. 190, 783–793. Rho, H.S., Kang, S., Lee, Y.H., 2001. Agrobacterium tumefaciens-mediated transformation of the plant pathogenic fungus, Magnaporthe grisea. Mol. Cells 12, 407–411. Sivasithamparam, K., 1975. Phialophora and Phialophora-like fungi occurring in root region of wheat. Aust. J. Bot. 23, 193–212. Sun, W.L., Liu, L.X., Hu, X.L., Tang, J., Li, P., Chen, J., et al., 2009. Generation and identification of DNA sequence flanking T-DNA integration site of Trichoderma atroviride mutants with high dichlorvos-degrading capacity. Bioresour. Technol. 100, 5941–5946. Su, Z.Z., Mao, L.J., Li, N., Feng, X.X., Yuan, Z.L., Wang, L.W., et al., 2013. Evidence for biotrophic lifestyle and biocontrol potential of dark septate endophyte Harpophora oryzae to Rice Blast Disease. PLoS One 8, e61332. Tong, A.H.Y., Evangelista, M., Parsons, A.B., Xu, H., Bader, G.D., Page, N., et al., 2001. Systematic genetic analysis with ordered arrays of yeast deletion mutants. Science 294, 2364–2368. Wang, D.Y., He, D., Li, G.Q., Gao, S., Lv, H.Y., Shan, Q.S., et al., 2014. An efficient tool for random insertional mutagenesis: Agrobacterium tumefaciens-mediated transformation of the filamentous fungus Aspergillus terreus. J. Microbiol. Methods 98, 114–118. Xu, X.H., Su, Z.Z., Wang, C., Kubicek, C.P., Feng, X.X., Mao, L.J., et al., 2014. The rice endophyte Harpophora oryzae genome reveals evolution from a pathogen to a mutualistic endophyte. Sci. Rep. 4, 5783. Yuan, Z.L., Lin, F.C., Zhang, C.L., Kubicek, C.P., 2010. A new species of Harpophora (Magnaporthaceae) recovered from healthy wild rice (Oryza granulata) roots, representing a novel member of a beneficial dark septate endophyte. FEMS Microbiol. Lett. 307, 94–101. Zamioudis, C., Pieterse, C.M., 2012. Modulation of host immunity by beneficial microbes. Mol. Plant Microbe Interact. 25, 139–150. Zhong, Y.H., Wang, X.L., Wang, T.H., Jiang, Q., 2007. Agrobacterium-mediated transformation (AMT) of Trichoderma reesei as an efficient tool for random insertional mutagenesis. Appl. Microbiol. Biotechnol. 73, 1348–1354.