- Email: [email protected]
Agrobacterium tumefaciens-mediated transformation as an efficient tool for insertional mutagenesis of Kabatiella zeae
Journal of Microbiological Methods 149 (2018) 96–100
Contents lists available at ScienceDirect
Journal of Microbiological Methods journal homepage: www.elsevier.com/locate/jmicmeth
Agrobacterium tumefaciens-mediated transformation as an efficient tool for insertional mutagenesis of Kabatiella zeae Jiaying Suna, Ruidi Xua, Shuqin Xiaoa, Yuanyuan Lua, Qifeng Zhangb, Chunsheng Xuea, a b
T
⁎
College of Plant Protection, Shenyang Agricultural University, Shenyang, Liaoning Province 110866, China Heihe Branch of Heilongjiang Academy of Agricultural Sciences,Heihe,Heilongjiang Province 164300,China
A R T I C LE I N FO
A B S T R A C T
Keywords: Agrobacterium tumefaciens-mediated transformation (ATMT) Kabatiella zeae Green fluorescence protein (GFP)
Agrobacterium tumefaciens-mediated transformation (ATMT) has been widely used in filamentous fungi. In this study, an efficient Agrobacterium tumefaciens-mediated transformation approach was developed for the plant pathogenic fungus, Kabatiella zeae, the causative pathogen of eyespot in maize. Five parameters were selected to optimize efficiencies of transformation. A. tumefaciens concentration, conidia concentration of K. zeae and mixing ratio of A. tumefaciens and K. zeae were found to exert a significant influence on all parameters. Transformants emitted green fluorescence under fluorescence microscopy. The presence of mitotically stable hygromycin resistance gene (hph) integration in the genome was confirmed by PCR. Up to 148 transformants per 107 conidia could be obtained under optimal conditions. In this way, ATMT approach is an efficient tool for insertional mutagenesis of K. zeae.
1. Introduction Eyespot, a disease affecting corn (Zea mays L.), is caused by Kabatiella zeae (Narita et Hiratsuka). It is responsible for one of the global foliar diseases in maize. The disease was first found in Japan in 1959 (Naeita and Hiratsuka, 1959) and it has been subsequently found in the most corn planting areas worldwide (Arny et al., 1971; Reifschneider and Arny, 1979a; Qi et al., 1966; Shurtleff, 1980; Santos et al., 2007; Sun et al., 2016). In China, corn eyespot was first found in 1964 in Jilin Province (Qi et al., 1966). In 1998, total loss of grain yield caused by K. zeae, had been observed in seed farms in Liaoning province of China (Xu et al., 2000), and this disease has spread widely to corn planting regions in the northeast, north, and northwest, resulting in yield losses of 5–10%. Corn eyespot has recently drawn attention from researchers because it has rebounded in some corn-growing areas in recent years (Wang et al., 2014; Zhang, 2014; Sun et al., 2016). The genus Kabatiella is a member of the order Tuberculariales, class Hyphomycetes. In 1973, Dingley indicated that the genus Kabatiella is a synonym of Aureobasidium, and proposed that Aureobasidium zeae is the causative pathogen of corn eyespot, named using fungal taxonomy rules (Dingley, 1973). In 2011, Seifert et al. reported that Kabatiella should be considered an independent genus distinct from Aureobasidium, according to the research results on morphology and molecular biology, so that the fungus associated with corn eyespot should be restored to Kabatiella zeae Naeita and Hiratsuka (Seifert et al., 2011).
⁎
Corresponding author. E-mail address: [email protected] (C. Xue).
https://doi.org/10.1016/j.mimet.2018.05.004 Received 8 January 2018; Received in revised form 2 May 2018; Accepted 2 May 2018 Available online 03 May 2018 0167-7012/ © 2018 Elsevier B.V. All rights reserved.
Agrobacterium tumefaciens-mediated transformation as a manipulation protocol has been widely used for filamentous fungi for insertional mutagenesis (Michielse et al., 2005). Compared with other transformation techniques, the ATMT system has three key advantages: it allows flexibility with respect to choice of protoplasts, mycelium, or conidia as starting materials for transformation, the T-DNA can be randomly inserted into the host genome as a single copy, and T-DNAtagged mutated genes, and flanking sequences can be identified easily using Tail-PCR, Inverse-PCR, and plasmid rescue (Covert et al., 2001; Sugui et al., 2005; Morioka et al., 2006; Mullins et al., 2001; Chen et al., 2009; Sun et al., 2009). In recent years, ATMT has been successfully used in many plant pathogenic fungi, such as Fusarium oxysporum, Magnaporthe grisea, Verticillium dachliae, Colletotrichum trifolii, Curvularia lunata, and Cercospora zeae-maydis (Vijn and Govers, 2003; Mullins et al., 2001; Combier et al., 2003; Takahara et al., 2004; Zhang, 2014; Lu et al., 2016). In this way, the ATMT system is an efficient tool for insertional mutagenesis of filamentous fungi. However, there have been no previous reports of ATMT in K. zeae. In this study, we reported the establishment and optimization of an ATMT system for K. zeae. Transformation efficiency was optimized for A. tumefaciens concentration, conidia concentration, conidia germination time, and co-cultivation time. The improved ATMT protocol allowed us to rapidly acquire large numbers of T-DNA insertional mutants with altered morphological and cultural characters and virulence. This work provides opportunities for further investigation of the
Journal of Microbiological Methods 149 (2018) 96–100
J. Sun et al.
2.4. Mitotic stability of transformation
pathogenesis-related genes of K. zeae.
The mitotic stability of the K. zeae transformants was determined through the stability of hygromycin B resistance. The transformants were cultured on PDA plate without hygromycin B for 7 d at 25 °C. Mycelial plugs from the edge of the cultures were transferred to fresh PDA plates for another 7 days. We repeated this procedure 5 times, and the hyphal growth from each transformant was transferred to PDA containing hygromycin B (200 μg/mL).
2. Materials and methods 2.1. Strains and plasmids K. zeae wild-type strain CLNKZ-1 was used as a recipient in this study (Sun et al., 2015). CLNKZ-1 strain was isolated from leaves with typical symptom in Liaoning Province, China, and grown on potato dextrose agar (PDA) (200 g of potato, 20 g of dextrose, 20 g of agar per liter) at 25 °C and stored at −80 °C until use. A. tumefaciens strains AGL-1, carrying the binary vector pPZP100HG (Lu et al., 2016), were grown on lysogenic broth (LB) medium (10 g of tryptone, 5 g of yeast extract, 10 g of NaCl per liter) at 28 °C. Vector pPZP100HG, carrying hygromycin B resistance gene (hygromycin phosphotransferase gene, hph) and green fluorescent protein gene (GFP) under the control of the Aspergillus nidulans trpC promoter, served as a fungal transformant selection marker. All strains were obtained from the molecular and physiological plant pathology laboratory at Shenyang Agricultural University.
2.5. Observation and analysis of the transformants To obtain genomic DNA, five randomly selected putative transformants and the wild-type strain of K. zeae were grown in 150-mL potatodextrose (PD) containing hygromycin (200 μg/mL) or not for 7 days at 150 rpm. Mycelia were harvested and washed three times with sterile water, then dried in a freeze dryer. DNA from each of the transformants' genome and wild-type strain was prepared as described previously (Xue et al., 2013). PCR confirmed the insertion of T-DNA into the transformants' genomes, specific primers for hph gene, HPH-F1 and HPH-R1 (HPH-F1, 5′-CGACAGCGTCTCCGACCTGA-3′, HPH-R1 5′-GGATGCCTC CGCTCGAAGTA-3′) were used. TAIL-PCR was performed to clone the T-DNA flanking sequences. TAIL-PCR procedure was based on a previously published protocol (Liu and Chen, 2007). Pre-amplication reaction (20 μL) contained 2.0 μL PCR buffer, 200 μM dNTPs, 1.0 μM of LAD-1, 1.0 μM AC1, 0.5 U Taq and 3 μL DNA. Each 25 μL primary reaction contained 2.5 μL PCR buffer, 200 μM dNTPs, 0.3 μM AC1/RB-1a (AC1/RB-1b), 0.6 U Taq and 1 μL 40fold diluted pre-amplication product. Each secondary reaction (25 μL) contained 2.5 μL PCR buffer, 200 μM dNTPs, 0.3 μM AC1/RB-2a (AC1/ RB-2b), 0.5 U Taq and 1 μL 10-fold diluted primary reaction product. Primer sequences are listed in Table 1.
2.2. Sensitivity test to hygromycin B The strain CLNKZ-1 was inoculated on PDA and cultivated for 7 days. Mycelial plugs (d = 6 mm) were transplanted to PDA plates supplemented with different hygromycin B concentrations (0, 50, 100, 150, 200, 300, 400, and 500 μg/mL). After cultivation at 25 °C for 7 d, colony diameters were measured to evaluate the minimum inhibition. Three replicates were used during this assay.
2.3. A. tumefaciens-mediated fungal transformation A. tumefaciens strain AGL-1 containing pPZP100HG was grown at 28 °C for 2 days in LB medium supplemented with chloramphenicol (34 μg/mL) and ampicillin (100 μg/mL), on a shaker (150 rpm). A 1-mL sample of the culture was centrifuged at 6000 rpm for 3 min and diluted with IM medium (10.5 g of K2HPO4, 4.5 g of KH2PO4, 1.0 g of NH4SO4, 0.5 g of Na3citrate·2H2O, 0.2 g of MgSO4·7H2O, 1.0 mg of thiamine-HCl, 2.0 g of glucose, 40 mM 2-(4-morpholino) ethanesulfonic acid, and 0.5% glycerol per liter) to an optical density at 600 nm (OD600 = 0.15–0.2) with 200 μM acetosyringone (AS) in a final volume of 5 mL, then re-incubated at 28 °C with gentle sharking at 150 rpm. Each sample was then grown on OD600nm of 0.3, 0.45, 0.6, and 0.75. K. zeae was incubated on a PDA plate at 25 °C to sporulation. After culturing for 7 days, the mycelia were scraped from the surface of the medium and suspended in sterile water. The suspended spores were filtered through three layers of cheesecloth. The conidia concentration was determined using a hemocytometer and diluted to a final concentration of 10(Combier et al., 2003), 10(Dingley, 1973), or 107 conidia/mL. The conidia suspension was placed in sterile water for germination for 4 d at 25 °C in the dark. Cellophane papers (Dingguo Changsheng Biotechnology Co. Ltd., Beijing, China) were placed on IM plates containing 200 μM acetosyringone (AS), conidial suspension was mixed with the A. tumefaciens cells at proportions of 1:1, 2:1, 3:1, and 4:1. The mixtures were incubated for 0.5 h, 1 h, 2 h, and 4 h. Then 100 μL of each mixture was spread onto cellophane papers on each plate, and the plates were incubated at 25 °C, for 48 h in the dark. The cellophane papers were transferred to selective PDA medium containing hygromycin B (200 μg/ mL) and cefotaxime (300 μg/mL) to select candidate transformants and the plates were incubated for 7 d at 25 °C until conidial production. Transformation efficiency is defined as the average number of transformants for 1 × 10(Dingley, 1973)/mL conidia. Three replicates were used.
2.6. Data analyses All data were analyzed using SPSS software (22.0). Normal one-way analysis of variance was used, and differences between treatments in each experiment were evaluated using Duncan's multiple range test. The values were expressed as means ± SD. p < 0.05 was defined as statistically significant.
3. Results and analysis 3.1. Hygromycin B sensitivity of K. zeae Level of sensitivity to hygromycin B was tested by growing CLNKZ-1 strain on PDA plates supplemented with different concentrations of antibiotic. The results indicated that the growth of K. zeae was completely inhibited at a concentration of 200 μg/mL for 7 days at 25 °C. For this reason, we chose 200 μg/mL of hygromycin B as the optimal concentration for the selection of K. zeae transformants. Table 1 Primers used in TAIL-PCR.
97
Primers
Nucleotide sequence (5′ to 3′)
LAD1–1 LB-1a LB-2a LB-3a RB-1b RB-2b RB-3b AC1
ACGATGGACTCCAGAGCGGCCGCVNVNNNGGAA CTGGACCGATGGCTGTGTAGAG ACGATGGACTCCAGAGTCGGAATAGAGTAGATGCCGACCGGG GCCCGGTACCAGCTTTTGTTCAC GAGTCCCGCAATTATACATTTAATACGC ACGATGGACTCCAGAGTCCGCGCGCGGTGTCATCTATGTTACTAG GGATCCACTAGTTCTAGAGCGGCCGC ACGATGGACTCCAGAG
Journal of Microbiological Methods 149 (2018) 96–100
J. Sun et al.
Fig. 1. The transformation efficiency of strain CLNKZ-1 on different cell densities of A. tumefaciens AGL-1 (A), conidia concentration of K. zeae (B), mixing radio of A. tumefaciens and K. zeae (C), and induction time (D). These four factors exhibited obvious impacts on the K. zeae ATMT transformation efficiency. Bars denote standard error. Different letters in the same column in the same cultural condition indicate significant difference at p < .05 level by Duncan's new multiple rang test.
3.2. Optimization of conditions for ATMT of K. zeae
3.3. Mitotic stability of transformants
3.2.1. A. tumefaciens concentration To determine the optimal A. tumefaciens concentration for K. zeae transformation, A. tumefaciens cells in IM (OD = 0.3, 0.45, 0.6, and 0.75) were co-cultivated with conidia (106 conidia/mL). As shown in Fig. 1A, the highest transformation efficiency was observed with A. tumefaciens at a density of OD600 nm = 0.6, and with > 148 transformants obtained per 106 conidia.
Mitotic stability of transformants is an important feature of an effective mutagenesis system. After all selected mutants of K. zeae were cultured on PDA five more times, they could still grow on PDA containing hygromycin B (200 mg/mL), indicating that the hph gene was stably integrated into the transformants' genomes. Transformants emitted green fluorescence, but the hypha and conidia of the wild-type strain did not, indicating that the GFP gene was stably integrated into the transformants genome (Fig. 2).
3.2.2. Conidia concentration of K. zeae To determine the optimal conidia concentration for K. zeae transformation, conidia concentration was tested at three different levels (10(Combier et al., 2003), 10(Dingley, 1973), and 107 conidia/mL) cocultivated with A. tumefaciens cells (OD600 nm = 0.6). As shown in Fig. 1B, the highest transformation efficiency was observed at a K. zeae conidia concentration of 106 conidia/mL, and there were > 142 transformants per 106 conidia.
3.4. Observation of transformants The mutants obtained were an important starting material for further investigating biological characteristics, development, virulence factors and pathogenic mechanisms of K. zeae. In this study, four types of phenotypic mutants were observed and cultured on PDA medium. As shown in Fig. 3, T1 colonies grew faster than wild-type colonies. They were also white in color during the primary growth stage but eventually showed a colony margin of light green and light cream in the central area and produced hyaline conidia. T2 colonies formed black halos at their edges. T3 showed no significant difference compared to wild-type in phenotype. T4 grew slowly, produced less conidia, and colonies
3.2.3. Mixing ratio of A. tumefaciens and K. zeae The mixing ratio of A. tumefaciens and K. zeae during co-cultivation had a considerable effect on the efficiency of the transformation. K. zeae conidia suspension (106 conidia/mL) and A. tumefaciens cells (OD600 nm = 0.6) were blended at different ratios (1:1, 2:1, 3:1, and 4:1) and co-cultivated. As shown in Fig. 1C, the highest transformation efficiency was observed at a 3:1 ratio, and there were > 127 transformants per 106 conidia.
Fig. 2. Colony features of transformants and wild-type of K. zeae. All colonies were cultured on PDA plates at 25 °C for 7 d. T1 colonies grew faster and were white in color; T2 formed black halos at the edges of colonies. T3 showed normal colonies. T4 colonies grew slowly and were light cream in color without creases. T5 colonies also grew slowly, were light brown, leathery, and much more creased. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
3.2.4. Induction time We tested four different time periods to determine the optimal induction time for the ATMT of K. zeae: 0.5 h, 1 h, 2 h, and 4 h. As shown in Fig. 1D, the results showed the highest transformation efficiency at an induction time of 1 h, and > 98 transformants per 106 conidia. 98
Journal of Microbiological Methods 149 (2018) 96–100
J. Sun et al.
Fig. 3. Polymerase chain reaction (PCR) analysis of transformants of K. zeae. The hph gene (750 bp approximate) in five selected transformants of K. zeae were amplified by PCR, DNA from transformants (lanes 2–6), DNA from wildtype strain (WT) (lane 7), and negative control with H2O (lane 8).
Fig. 5. Observation of transformants and wild-type K. zeae by fluorescence microscope. (A) Transformants hypha in bright field; (B) Transformants conidiophore in bright field; (C) wild-type strain hypha in bright field; (D) wild-type strain conidiophore in bright field; (E) Transformants hypha in FITC; (F) Transformants conidiophore in FITC; (G) wild-type strain hypha in FITC; (H) wild-type strain conidiophore in FITC.
showed light cream appearance without creases. T5 also grew slowly, colony showed light brown, leathery and creased much more. 3.5. Molecular analysis of transformants
primers. 0.7 to 0.8-kb DNA fragments were obtained for different transformants (Fig. 5). These results indicated that T-DNA was randomly integrated into the fungal genome. T-DNA insertion flanking sequences of the 5 transformants were obtained (Table 2). Direct sequence analysis with BLAST in NCBI database showed that the TAILPCR products contained the sequence corresponding to the right and left border of the T-DNA and respective nucleotide sequences of FAD/ NAD(P)-binding domain-containing protein (XM_013575717.1) in Aureobasidium namibia, tryptophan synthase-like protein (KL584984.1) in Aureobasidium pullulans, TPR-like protein (KL584833.1) in Aureobasidium melanogenum, hypothetical protein (XM_013486146.1) in Aureobasidium subglaciale, and hypothetical protein (KL584838.1) in Aureobasidium melanogenum.
To investigate the integration mode of T-DNA in the genome of K. zeae, the hph gene was detected by PCR with the primers (HPH-F1/ HPH-R1) in all 5 randomly selected transformants. Amplification from each of those mutants yielded a specific 700-bp fragment, indicating that T-DNA had been integrated in the genome of K. zeae (Fig. 4). T1 to T5 were amplified with TAIL-PCR using different degenerate primers, namely, left border (LB)- and right border (RB)-specific
4. Discussion The virulence-related genes in plant pathogenic fungi play important roles in the mechanisms that regulate infection and destruction of host plants, such as host recognition, induction and activation signaling, maintenance of fungal cell wall integrity, formation of infection structures, absorption of nutrients, penetration of the cuticle and cell wall, and colonization within the host (Van de Wouw & Howlett, 2011). Research into the function and structure of virulence-related genes could facilitate understanding of the plant–parasite interaction and formulation of effective measures to control the plant disease. At present, research on K. zeae, the causative agent of corn eyespot, has mainly focused on etiology. Very little is known about the mechanisms underlying the pathogenicity of this fungus at the physiological or molecular levels. To fully understand virulence factors of this fungus, especially those responsible for toxin biosynthesis, the production of enzymes that degrade the cell wall, secondary metabolites synthesis pathways, the development of an efficient mutagenesis system that can create a wide range of transformants is of considerable significance. In recent years, the virulence-related genes of many phytopathogenic fungi have been identified by high-throughput approaches. T-
Fig. 4. TAIL-PCR analysis of transformants of K. zeae. Agarose gel analysis of TAIL-PCR products generated from 5 randomly selected transformants (T1–5). PCR amplification with the left border-specific primers (LB-3b) and right border specific primers (RB-3a). The products of the secondary round amplification of each transformant are shown from left to right. DL2000 DNA marker (M), TAIL-PCR amplification of genomic region flanking the left border of T-DNA insertion site (lanes 2, 3, 4, 5, and 6); TAIL-PCR amplification of genomic region flanking the right border of T-DNA insertion site (lanes 7, 8, 9, 10, and 11). 99
Journal of Microbiological Methods 149 (2018) 96–100
J. Sun et al.
Table 2 Analyses of the T-DNA flanking sequences in the K. zeae transformants.
T1 T2 T3 T4 T5
K. zeae
…
LB
T-DNA
RB
…
K. zeae
GGTAATCTATAAAAACAGAT GGGATCTGTTTAAAATCATG CCCAGAATCGGGTCGGGGTC TAGATAACTTCCGAGGGGGC GTGTCGGCAGACCTAATGGC
… … … … …
GCCCGGTACCAGCTTTTGTTCAC GCCCGGTACCAGCTTTTGTTCAC GCCCGGTACCAGCTTTTGTTCAC GCCCGGTACCAGCTTTTGTTCAC GCCCGGTACCAGCTTTTGTTCAC
– – – – –
GGATCCACTAGTTCTAGAGCGGCCGC GGATCCACTAGTTCTAGAGCGGCCGC GGATCCACTAGTTCTAGAGCGGCCGC GGATCCACTAGTTCTAGAGCGGCCGC GGATCCACTAGTTCTAGAGCGGCCGC
… … … … …
GGTAGAAATACAAGAAAACA CCCTCACACTTTGTTATGCT TGAAGCGATAATAAGTCTGC TGTTAGGGCATGCTCGACCC TTCTCACAGGGACGAGATGT
DNA tagging, a simple and efficient approach, was used to identify the pathogenicity genes in filamentous fungi. However some fungi are not amenable to gene disruption, but could be silenced by RNA interference (RNAi) (Miyamoto et al., 2008; Van de Wouw et al., 2009). As an approach to T-DNA tagging, ATMT has been successfully used in different fungal species for identification of pathogenicity genes, which usually had optimal co-cultivation conditions to obtain the maximum number of transformants (Mullins et al., 2001; Combier et al., 2003; Michielse et al., 2005). The optimal A. tumefaciens concentration for the ATMT of Colletotrichum graminicola was 0.25 (OD600nm) (Flowers et al., 2005) and the mixing ratio of A. tumefaciens and conidia during co-cultivation was 1:4 for the ATMT of Setosphaeria turcica (Xue et al., 2013). In this study, the optimal A. tumefaciens concentration was found to be 0.6 (OD600 nm) and the mixing ratio of conidia and A. tumefaciens during co-cultivation was 3:1 for the ATMT of K. zeae. To the best of our knowledge, this is the first report of the establishment of any successful and effective ATMT system for K. zeae. Using this protocol, we could rapidly produce a large number of T-DNA insertional mutants of K. zeae. The results confirmed that ATMT is an efficient means of producing insertional mutagenesis and subsequent identification of mutated genes in K. zeae.
Curr. Genet. 48, 380–388. Liu, Y.G., Chen, Y., 2007. High-efficiency thermal asymmetric interlaced PCR for amplification of unknown flanking sequences. BioTechniques 43 (5), 649. Lu, Y., Xiao, S., Wang, F., Sun, J., Zhao, L., Yan, L., et al., 2016. Agrobacterium tumefaciensmediated transformation as an efficient tool for insertional mutagenesis of Cercospora zeae-maydis. J. Microbiol. Methods 133, 8. Michielse, C.B., Hooykaas, P.J.J., van den Hondel, Cees A.M.J.J., Ram, A.F.J., 2005. Agrobacterium-mediated transformation as a tool for functional genomics in fungi. Curr. Genet. 48 (1), 1–17. Miyamoto, Y., Masunaka, A., Tsuge, T., Yamamoto, M., Ohtani, K., Fukumoto, T., et al., 2008. Functional analysis of a multicopy host-selective act-toxin biosynthesis gene in the tangerine pathotype of Alternaria alternata using RNA silencing. Mol. PlantMicrobe Interact. 21 (12), 1591–1599. Morioka, L.R.I., Furlaneto, M.C., Bogas, A.C., Pompermayer, P., Duarte, R.T.D., Vieira, M.L.C., et al., 2006. Efficient genetic transformation system for the ochratoxigenic fungus Aspergillus carbonarius. Curr. Microbiol. 52 (6), 469–472. Mullins, E.D., Chen, X., Romaine, P., Raina, R., Geiser, D.M., Kang, S., 2001. Agrobacterium-mediated transformation of Fusarium oxysporum: an efficient tool for insertional mutagenesis and gene transfer. Phytopathology 91 (2), 173–180. Naeita, T., Hiratsuka, Y., 1959. Studies on Kabatiella zeae n.sp. the causal fungus of a new leaf spot disease of corn. Japanese Journal of Phytopathology 24 (3), 147–153. Qi, P.K., Bai, J.K., Zhu, G.X., 1966. Cultivated Plant Fungal Diseases in Jilin Province. Science Press, Beijing, pp. 28–30. Reifschneider, F.J.B., Arny, D.C., 1979. Seed infection of maize (zea mays) by Kabatiella zeae. Plant Dis. Rep. 63 (5), 352–354. Santos, I.D., Silva, A.D., Malagi, G., 2007. Occurrence of maize eyespot caused by Kabatiella zeae in paraná and Santa Catarina state, Brazil. Fitopatol. Bras. 32 (4), 359. Shurtleff, M.C., 1980. Compendium of Corn Diseases. APS Press, pp. 21–22. Sugui, J.A., Chang, Y.C., Kwonchung, K.J., 2005. Agrobacterium tumefaciens-mediated transformation of Aspergillus fumigatus: an efficient tool for insertional mutagenesis and targeted gene disruption. Appl. Environ. Microbiol. 71 (4), 1798–1802. Sun, W.L., Liu, L.X., Hu, X.L., Tang, J., Peng, L., Jie, C., et al., 2009. Generation and identification of DNA sequence flanking t-dna integration site of Trichoderma atroviride mutants with high Dichlorvos-degrading capacity. Bioresour. Technol. 100 (23), 5941–5946. Sun, J.Y., Xiao, S.Q., Lu, Y.Y., Tu, G.P., Xue, C.S., Chen, J., 2015. Isolation,identification and biological characteristics of Aureobasidium zeae in Liaoning Province. Journal of Plant Protection 42 (6), 927–934. Sun, J.Y., Xiao, S.Q., Xu, J.N., Lu, K.X., Xue, C.S., Chen, J., 2016. Occurrence condition and chemical control of maize eyespot in Liaoning Province. J. Maize Sci. 24 (5), 147–151. Takahara, H., Tsuji, G., Kubo, Y., Yamamoto, M., Toyoda, K., Inagaki, Y., et al., 2004. Agrobacterium tumefaciens -mediated transformation as a tool for random mutagenesis of Colletotrichum trifolii. J. Gen. Plant Pathol. 70 (2), 93–96. Vijn, I., Govers, F., 2003. Agrobacterium tumefaciens, mediated transformation of the oomycete plant pathogen phytophthora infestans. Mol. Plant Pathol. 4 (6), 459–467. Wang, D., Dan, H., Li, G., Song, G., Lv, H., Shan, Q., et al., 2014. An efficient tool for random insertional mutagenesis: Agrobacterium tumefaciens -mediated transformation of the filamentous fungus Aspergillus terreus. J. Microbiol. Methods 98 (1), 114–118. Wouw, A.P.V.D., Pettolino, F.A., Howlett, B.J., Elliott, C.E., 2009. Mutations to lmIFRD affect cell wall integrity, development and pathogenicity of the ascomycete leptosphaeria maculans. Fungal Genet. Biol. 46 (9), 695–706. Xu, X.D., Dong, H.Y., Jiang, Y., Qiao, Y., Liu, Z.H., Sun, J.D., 2000. Preliminary studies on the northern anthracnose disease in maize. J. Shenyang Agric. Univ. 31 (5), 507–510. Xue, C., Wu, D., Condon, B.J., Bi, Q., Wang, W., Turgeon, B.G., 2013. Efficient gene knockout in the maize pathogen Setosphaeria turcica using Agrobacterium tumefaciensmediated transformation. Phytopathology 103 (6), 641–647. Zhang, Q.F., 2014. The corn northern anthracnose. Science and Technology of West China 13 (1), 49–50.
Acknowledgments This study was supported by the National Natural Science Foundation of China (grant number 31271992) and China Agriculture Research System (grant number CARS-02). We would like to thank LetPub (www.letpub.com) for providing linguistic assistance during the preparation of this manuscript. References Van de Wouw, A.P., Howlett, B.J., 2011. Fungal pathogenicity genes in the age of ‘omics’. Mol. Plant Pathol. 12 (5), 507–514. Arny, D.C., Smalley, E.B., Ullstrup, A.J., Worf, G.L., Ahrens, R.W., 1971. Eyespot of maize, a disease new to North America. Phytopathology 61 (1), 54–57. Chen, E.C., Su, Y.H., Kanagarajan, S., Agrawal, D.C., Tsay, H.S., 2009. Development of an activation tagging system for the basidiomycetous medicinal fungus Antrodia cinnamomea. Mycol. Res. 113 (3), 290–297. Combier, J.P., Melayah, D., Raffier, C., Gay, G., Marmeisse, R., 2003. Agrobacterium tumefaciens-mediated transformation as a tool for insertional mutagenesis in the symbiotic ectomycorrhizal fungus Hebeloma cylindrosporum. Appl. Microbiol. 220, 141–148. Covert, S.F., Kapoor, P., Lee, M.H., Briley, A., Nairn, C.J., 2001. Agrobacterium tumefaciens-mediated transformation of Fusarium circinatum. Mycol. Res. 105 (3), 259–264. Dingley, J., 1973. Eyespot disease of maize in New Zealand. N. Z. J. Agric. Res. 16 (3), 325–328. Flowers, J.L., Vaillancourt, L.J., 2005. Parameters affecting the efficiency of Agrobacterium tumefaciens-mediated transformation of colletotrichum graminicola.
100
Contents lists available at ScienceDirect
Journal of Microbiological Methods journal homepage: www.elsevier.com/locate/jmicmeth
Agrobacterium tumefaciens-mediated transformation as an efficient tool for insertional mutagenesis of Kabatiella zeae Jiaying Suna, Ruidi Xua, Shuqin Xiaoa, Yuanyuan Lua, Qifeng Zhangb, Chunsheng Xuea, a b
T
⁎
College of Plant Protection, Shenyang Agricultural University, Shenyang, Liaoning Province 110866, China Heihe Branch of Heilongjiang Academy of Agricultural Sciences,Heihe,Heilongjiang Province 164300,China
A R T I C LE I N FO
A B S T R A C T
Keywords: Agrobacterium tumefaciens-mediated transformation (ATMT) Kabatiella zeae Green fluorescence protein (GFP)
Agrobacterium tumefaciens-mediated transformation (ATMT) has been widely used in filamentous fungi. In this study, an efficient Agrobacterium tumefaciens-mediated transformation approach was developed for the plant pathogenic fungus, Kabatiella zeae, the causative pathogen of eyespot in maize. Five parameters were selected to optimize efficiencies of transformation. A. tumefaciens concentration, conidia concentration of K. zeae and mixing ratio of A. tumefaciens and K. zeae were found to exert a significant influence on all parameters. Transformants emitted green fluorescence under fluorescence microscopy. The presence of mitotically stable hygromycin resistance gene (hph) integration in the genome was confirmed by PCR. Up to 148 transformants per 107 conidia could be obtained under optimal conditions. In this way, ATMT approach is an efficient tool for insertional mutagenesis of K. zeae.
1. Introduction Eyespot, a disease affecting corn (Zea mays L.), is caused by Kabatiella zeae (Narita et Hiratsuka). It is responsible for one of the global foliar diseases in maize. The disease was first found in Japan in 1959 (Naeita and Hiratsuka, 1959) and it has been subsequently found in the most corn planting areas worldwide (Arny et al., 1971; Reifschneider and Arny, 1979a; Qi et al., 1966; Shurtleff, 1980; Santos et al., 2007; Sun et al., 2016). In China, corn eyespot was first found in 1964 in Jilin Province (Qi et al., 1966). In 1998, total loss of grain yield caused by K. zeae, had been observed in seed farms in Liaoning province of China (Xu et al., 2000), and this disease has spread widely to corn planting regions in the northeast, north, and northwest, resulting in yield losses of 5–10%. Corn eyespot has recently drawn attention from researchers because it has rebounded in some corn-growing areas in recent years (Wang et al., 2014; Zhang, 2014; Sun et al., 2016). The genus Kabatiella is a member of the order Tuberculariales, class Hyphomycetes. In 1973, Dingley indicated that the genus Kabatiella is a synonym of Aureobasidium, and proposed that Aureobasidium zeae is the causative pathogen of corn eyespot, named using fungal taxonomy rules (Dingley, 1973). In 2011, Seifert et al. reported that Kabatiella should be considered an independent genus distinct from Aureobasidium, according to the research results on morphology and molecular biology, so that the fungus associated with corn eyespot should be restored to Kabatiella zeae Naeita and Hiratsuka (Seifert et al., 2011).
⁎
Corresponding author. E-mail address: [email protected] (C. Xue).
https://doi.org/10.1016/j.mimet.2018.05.004 Received 8 January 2018; Received in revised form 2 May 2018; Accepted 2 May 2018 Available online 03 May 2018 0167-7012/ © 2018 Elsevier B.V. All rights reserved.
Agrobacterium tumefaciens-mediated transformation as a manipulation protocol has been widely used for filamentous fungi for insertional mutagenesis (Michielse et al., 2005). Compared with other transformation techniques, the ATMT system has three key advantages: it allows flexibility with respect to choice of protoplasts, mycelium, or conidia as starting materials for transformation, the T-DNA can be randomly inserted into the host genome as a single copy, and T-DNAtagged mutated genes, and flanking sequences can be identified easily using Tail-PCR, Inverse-PCR, and plasmid rescue (Covert et al., 2001; Sugui et al., 2005; Morioka et al., 2006; Mullins et al., 2001; Chen et al., 2009; Sun et al., 2009). In recent years, ATMT has been successfully used in many plant pathogenic fungi, such as Fusarium oxysporum, Magnaporthe grisea, Verticillium dachliae, Colletotrichum trifolii, Curvularia lunata, and Cercospora zeae-maydis (Vijn and Govers, 2003; Mullins et al., 2001; Combier et al., 2003; Takahara et al., 2004; Zhang, 2014; Lu et al., 2016). In this way, the ATMT system is an efficient tool for insertional mutagenesis of filamentous fungi. However, there have been no previous reports of ATMT in K. zeae. In this study, we reported the establishment and optimization of an ATMT system for K. zeae. Transformation efficiency was optimized for A. tumefaciens concentration, conidia concentration, conidia germination time, and co-cultivation time. The improved ATMT protocol allowed us to rapidly acquire large numbers of T-DNA insertional mutants with altered morphological and cultural characters and virulence. This work provides opportunities for further investigation of the
Journal of Microbiological Methods 149 (2018) 96–100
J. Sun et al.
2.4. Mitotic stability of transformation
pathogenesis-related genes of K. zeae.
The mitotic stability of the K. zeae transformants was determined through the stability of hygromycin B resistance. The transformants were cultured on PDA plate without hygromycin B for 7 d at 25 °C. Mycelial plugs from the edge of the cultures were transferred to fresh PDA plates for another 7 days. We repeated this procedure 5 times, and the hyphal growth from each transformant was transferred to PDA containing hygromycin B (200 μg/mL).
2. Materials and methods 2.1. Strains and plasmids K. zeae wild-type strain CLNKZ-1 was used as a recipient in this study (Sun et al., 2015). CLNKZ-1 strain was isolated from leaves with typical symptom in Liaoning Province, China, and grown on potato dextrose agar (PDA) (200 g of potato, 20 g of dextrose, 20 g of agar per liter) at 25 °C and stored at −80 °C until use. A. tumefaciens strains AGL-1, carrying the binary vector pPZP100HG (Lu et al., 2016), were grown on lysogenic broth (LB) medium (10 g of tryptone, 5 g of yeast extract, 10 g of NaCl per liter) at 28 °C. Vector pPZP100HG, carrying hygromycin B resistance gene (hygromycin phosphotransferase gene, hph) and green fluorescent protein gene (GFP) under the control of the Aspergillus nidulans trpC promoter, served as a fungal transformant selection marker. All strains were obtained from the molecular and physiological plant pathology laboratory at Shenyang Agricultural University.
2.5. Observation and analysis of the transformants To obtain genomic DNA, five randomly selected putative transformants and the wild-type strain of K. zeae were grown in 150-mL potatodextrose (PD) containing hygromycin (200 μg/mL) or not for 7 days at 150 rpm. Mycelia were harvested and washed three times with sterile water, then dried in a freeze dryer. DNA from each of the transformants' genome and wild-type strain was prepared as described previously (Xue et al., 2013). PCR confirmed the insertion of T-DNA into the transformants' genomes, specific primers for hph gene, HPH-F1 and HPH-R1 (HPH-F1, 5′-CGACAGCGTCTCCGACCTGA-3′, HPH-R1 5′-GGATGCCTC CGCTCGAAGTA-3′) were used. TAIL-PCR was performed to clone the T-DNA flanking sequences. TAIL-PCR procedure was based on a previously published protocol (Liu and Chen, 2007). Pre-amplication reaction (20 μL) contained 2.0 μL PCR buffer, 200 μM dNTPs, 1.0 μM of LAD-1, 1.0 μM AC1, 0.5 U Taq and 3 μL DNA. Each 25 μL primary reaction contained 2.5 μL PCR buffer, 200 μM dNTPs, 0.3 μM AC1/RB-1a (AC1/RB-1b), 0.6 U Taq and 1 μL 40fold diluted pre-amplication product. Each secondary reaction (25 μL) contained 2.5 μL PCR buffer, 200 μM dNTPs, 0.3 μM AC1/RB-2a (AC1/ RB-2b), 0.5 U Taq and 1 μL 10-fold diluted primary reaction product. Primer sequences are listed in Table 1.
2.2. Sensitivity test to hygromycin B The strain CLNKZ-1 was inoculated on PDA and cultivated for 7 days. Mycelial plugs (d = 6 mm) were transplanted to PDA plates supplemented with different hygromycin B concentrations (0, 50, 100, 150, 200, 300, 400, and 500 μg/mL). After cultivation at 25 °C for 7 d, colony diameters were measured to evaluate the minimum inhibition. Three replicates were used during this assay.
2.3. A. tumefaciens-mediated fungal transformation A. tumefaciens strain AGL-1 containing pPZP100HG was grown at 28 °C for 2 days in LB medium supplemented with chloramphenicol (34 μg/mL) and ampicillin (100 μg/mL), on a shaker (150 rpm). A 1-mL sample of the culture was centrifuged at 6000 rpm for 3 min and diluted with IM medium (10.5 g of K2HPO4, 4.5 g of KH2PO4, 1.0 g of NH4SO4, 0.5 g of Na3citrate·2H2O, 0.2 g of MgSO4·7H2O, 1.0 mg of thiamine-HCl, 2.0 g of glucose, 40 mM 2-(4-morpholino) ethanesulfonic acid, and 0.5% glycerol per liter) to an optical density at 600 nm (OD600 = 0.15–0.2) with 200 μM acetosyringone (AS) in a final volume of 5 mL, then re-incubated at 28 °C with gentle sharking at 150 rpm. Each sample was then grown on OD600nm of 0.3, 0.45, 0.6, and 0.75. K. zeae was incubated on a PDA plate at 25 °C to sporulation. After culturing for 7 days, the mycelia were scraped from the surface of the medium and suspended in sterile water. The suspended spores were filtered through three layers of cheesecloth. The conidia concentration was determined using a hemocytometer and diluted to a final concentration of 10(Combier et al., 2003), 10(Dingley, 1973), or 107 conidia/mL. The conidia suspension was placed in sterile water for germination for 4 d at 25 °C in the dark. Cellophane papers (Dingguo Changsheng Biotechnology Co. Ltd., Beijing, China) were placed on IM plates containing 200 μM acetosyringone (AS), conidial suspension was mixed with the A. tumefaciens cells at proportions of 1:1, 2:1, 3:1, and 4:1. The mixtures were incubated for 0.5 h, 1 h, 2 h, and 4 h. Then 100 μL of each mixture was spread onto cellophane papers on each plate, and the plates were incubated at 25 °C, for 48 h in the dark. The cellophane papers were transferred to selective PDA medium containing hygromycin B (200 μg/ mL) and cefotaxime (300 μg/mL) to select candidate transformants and the plates were incubated for 7 d at 25 °C until conidial production. Transformation efficiency is defined as the average number of transformants for 1 × 10(Dingley, 1973)/mL conidia. Three replicates were used.
2.6. Data analyses All data were analyzed using SPSS software (22.0). Normal one-way analysis of variance was used, and differences between treatments in each experiment were evaluated using Duncan's multiple range test. The values were expressed as means ± SD. p < 0.05 was defined as statistically significant.
3. Results and analysis 3.1. Hygromycin B sensitivity of K. zeae Level of sensitivity to hygromycin B was tested by growing CLNKZ-1 strain on PDA plates supplemented with different concentrations of antibiotic. The results indicated that the growth of K. zeae was completely inhibited at a concentration of 200 μg/mL for 7 days at 25 °C. For this reason, we chose 200 μg/mL of hygromycin B as the optimal concentration for the selection of K. zeae transformants. Table 1 Primers used in TAIL-PCR.
97
Primers
Nucleotide sequence (5′ to 3′)
LAD1–1 LB-1a LB-2a LB-3a RB-1b RB-2b RB-3b AC1
ACGATGGACTCCAGAGCGGCCGCVNVNNNGGAA CTGGACCGATGGCTGTGTAGAG ACGATGGACTCCAGAGTCGGAATAGAGTAGATGCCGACCGGG GCCCGGTACCAGCTTTTGTTCAC GAGTCCCGCAATTATACATTTAATACGC ACGATGGACTCCAGAGTCCGCGCGCGGTGTCATCTATGTTACTAG GGATCCACTAGTTCTAGAGCGGCCGC ACGATGGACTCCAGAG
Journal of Microbiological Methods 149 (2018) 96–100
J. Sun et al.
Fig. 1. The transformation efficiency of strain CLNKZ-1 on different cell densities of A. tumefaciens AGL-1 (A), conidia concentration of K. zeae (B), mixing radio of A. tumefaciens and K. zeae (C), and induction time (D). These four factors exhibited obvious impacts on the K. zeae ATMT transformation efficiency. Bars denote standard error. Different letters in the same column in the same cultural condition indicate significant difference at p < .05 level by Duncan's new multiple rang test.
3.2. Optimization of conditions for ATMT of K. zeae
3.3. Mitotic stability of transformants
3.2.1. A. tumefaciens concentration To determine the optimal A. tumefaciens concentration for K. zeae transformation, A. tumefaciens cells in IM (OD = 0.3, 0.45, 0.6, and 0.75) were co-cultivated with conidia (106 conidia/mL). As shown in Fig. 1A, the highest transformation efficiency was observed with A. tumefaciens at a density of OD600 nm = 0.6, and with > 148 transformants obtained per 106 conidia.
Mitotic stability of transformants is an important feature of an effective mutagenesis system. After all selected mutants of K. zeae were cultured on PDA five more times, they could still grow on PDA containing hygromycin B (200 mg/mL), indicating that the hph gene was stably integrated into the transformants' genomes. Transformants emitted green fluorescence, but the hypha and conidia of the wild-type strain did not, indicating that the GFP gene was stably integrated into the transformants genome (Fig. 2).
3.2.2. Conidia concentration of K. zeae To determine the optimal conidia concentration for K. zeae transformation, conidia concentration was tested at three different levels (10(Combier et al., 2003), 10(Dingley, 1973), and 107 conidia/mL) cocultivated with A. tumefaciens cells (OD600 nm = 0.6). As shown in Fig. 1B, the highest transformation efficiency was observed at a K. zeae conidia concentration of 106 conidia/mL, and there were > 142 transformants per 106 conidia.
3.4. Observation of transformants The mutants obtained were an important starting material for further investigating biological characteristics, development, virulence factors and pathogenic mechanisms of K. zeae. In this study, four types of phenotypic mutants were observed and cultured on PDA medium. As shown in Fig. 3, T1 colonies grew faster than wild-type colonies. They were also white in color during the primary growth stage but eventually showed a colony margin of light green and light cream in the central area and produced hyaline conidia. T2 colonies formed black halos at their edges. T3 showed no significant difference compared to wild-type in phenotype. T4 grew slowly, produced less conidia, and colonies
3.2.3. Mixing ratio of A. tumefaciens and K. zeae The mixing ratio of A. tumefaciens and K. zeae during co-cultivation had a considerable effect on the efficiency of the transformation. K. zeae conidia suspension (106 conidia/mL) and A. tumefaciens cells (OD600 nm = 0.6) were blended at different ratios (1:1, 2:1, 3:1, and 4:1) and co-cultivated. As shown in Fig. 1C, the highest transformation efficiency was observed at a 3:1 ratio, and there were > 127 transformants per 106 conidia.
Fig. 2. Colony features of transformants and wild-type of K. zeae. All colonies were cultured on PDA plates at 25 °C for 7 d. T1 colonies grew faster and were white in color; T2 formed black halos at the edges of colonies. T3 showed normal colonies. T4 colonies grew slowly and were light cream in color without creases. T5 colonies also grew slowly, were light brown, leathery, and much more creased. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
3.2.4. Induction time We tested four different time periods to determine the optimal induction time for the ATMT of K. zeae: 0.5 h, 1 h, 2 h, and 4 h. As shown in Fig. 1D, the results showed the highest transformation efficiency at an induction time of 1 h, and > 98 transformants per 106 conidia. 98
Journal of Microbiological Methods 149 (2018) 96–100
J. Sun et al.
Fig. 3. Polymerase chain reaction (PCR) analysis of transformants of K. zeae. The hph gene (750 bp approximate) in five selected transformants of K. zeae were amplified by PCR, DNA from transformants (lanes 2–6), DNA from wildtype strain (WT) (lane 7), and negative control with H2O (lane 8).
Fig. 5. Observation of transformants and wild-type K. zeae by fluorescence microscope. (A) Transformants hypha in bright field; (B) Transformants conidiophore in bright field; (C) wild-type strain hypha in bright field; (D) wild-type strain conidiophore in bright field; (E) Transformants hypha in FITC; (F) Transformants conidiophore in FITC; (G) wild-type strain hypha in FITC; (H) wild-type strain conidiophore in FITC.
showed light cream appearance without creases. T5 also grew slowly, colony showed light brown, leathery and creased much more. 3.5. Molecular analysis of transformants
primers. 0.7 to 0.8-kb DNA fragments were obtained for different transformants (Fig. 5). These results indicated that T-DNA was randomly integrated into the fungal genome. T-DNA insertion flanking sequences of the 5 transformants were obtained (Table 2). Direct sequence analysis with BLAST in NCBI database showed that the TAILPCR products contained the sequence corresponding to the right and left border of the T-DNA and respective nucleotide sequences of FAD/ NAD(P)-binding domain-containing protein (XM_013575717.1) in Aureobasidium namibia, tryptophan synthase-like protein (KL584984.1) in Aureobasidium pullulans, TPR-like protein (KL584833.1) in Aureobasidium melanogenum, hypothetical protein (XM_013486146.1) in Aureobasidium subglaciale, and hypothetical protein (KL584838.1) in Aureobasidium melanogenum.
To investigate the integration mode of T-DNA in the genome of K. zeae, the hph gene was detected by PCR with the primers (HPH-F1/ HPH-R1) in all 5 randomly selected transformants. Amplification from each of those mutants yielded a specific 700-bp fragment, indicating that T-DNA had been integrated in the genome of K. zeae (Fig. 4). T1 to T5 were amplified with TAIL-PCR using different degenerate primers, namely, left border (LB)- and right border (RB)-specific
4. Discussion The virulence-related genes in plant pathogenic fungi play important roles in the mechanisms that regulate infection and destruction of host plants, such as host recognition, induction and activation signaling, maintenance of fungal cell wall integrity, formation of infection structures, absorption of nutrients, penetration of the cuticle and cell wall, and colonization within the host (Van de Wouw & Howlett, 2011). Research into the function and structure of virulence-related genes could facilitate understanding of the plant–parasite interaction and formulation of effective measures to control the plant disease. At present, research on K. zeae, the causative agent of corn eyespot, has mainly focused on etiology. Very little is known about the mechanisms underlying the pathogenicity of this fungus at the physiological or molecular levels. To fully understand virulence factors of this fungus, especially those responsible for toxin biosynthesis, the production of enzymes that degrade the cell wall, secondary metabolites synthesis pathways, the development of an efficient mutagenesis system that can create a wide range of transformants is of considerable significance. In recent years, the virulence-related genes of many phytopathogenic fungi have been identified by high-throughput approaches. T-
Fig. 4. TAIL-PCR analysis of transformants of K. zeae. Agarose gel analysis of TAIL-PCR products generated from 5 randomly selected transformants (T1–5). PCR amplification with the left border-specific primers (LB-3b) and right border specific primers (RB-3a). The products of the secondary round amplification of each transformant are shown from left to right. DL2000 DNA marker (M), TAIL-PCR amplification of genomic region flanking the left border of T-DNA insertion site (lanes 2, 3, 4, 5, and 6); TAIL-PCR amplification of genomic region flanking the right border of T-DNA insertion site (lanes 7, 8, 9, 10, and 11). 99
Journal of Microbiological Methods 149 (2018) 96–100
J. Sun et al.
Table 2 Analyses of the T-DNA flanking sequences in the K. zeae transformants.
T1 T2 T3 T4 T5
K. zeae
…
LB
T-DNA
RB
…
K. zeae
GGTAATCTATAAAAACAGAT GGGATCTGTTTAAAATCATG CCCAGAATCGGGTCGGGGTC TAGATAACTTCCGAGGGGGC GTGTCGGCAGACCTAATGGC
… … … … …
GCCCGGTACCAGCTTTTGTTCAC GCCCGGTACCAGCTTTTGTTCAC GCCCGGTACCAGCTTTTGTTCAC GCCCGGTACCAGCTTTTGTTCAC GCCCGGTACCAGCTTTTGTTCAC
– – – – –
GGATCCACTAGTTCTAGAGCGGCCGC GGATCCACTAGTTCTAGAGCGGCCGC GGATCCACTAGTTCTAGAGCGGCCGC GGATCCACTAGTTCTAGAGCGGCCGC GGATCCACTAGTTCTAGAGCGGCCGC
… … … … …
GGTAGAAATACAAGAAAACA CCCTCACACTTTGTTATGCT TGAAGCGATAATAAGTCTGC TGTTAGGGCATGCTCGACCC TTCTCACAGGGACGAGATGT
DNA tagging, a simple and efficient approach, was used to identify the pathogenicity genes in filamentous fungi. However some fungi are not amenable to gene disruption, but could be silenced by RNA interference (RNAi) (Miyamoto et al., 2008; Van de Wouw et al., 2009). As an approach to T-DNA tagging, ATMT has been successfully used in different fungal species for identification of pathogenicity genes, which usually had optimal co-cultivation conditions to obtain the maximum number of transformants (Mullins et al., 2001; Combier et al., 2003; Michielse et al., 2005). The optimal A. tumefaciens concentration for the ATMT of Colletotrichum graminicola was 0.25 (OD600nm) (Flowers et al., 2005) and the mixing ratio of A. tumefaciens and conidia during co-cultivation was 1:4 for the ATMT of Setosphaeria turcica (Xue et al., 2013). In this study, the optimal A. tumefaciens concentration was found to be 0.6 (OD600 nm) and the mixing ratio of conidia and A. tumefaciens during co-cultivation was 3:1 for the ATMT of K. zeae. To the best of our knowledge, this is the first report of the establishment of any successful and effective ATMT system for K. zeae. Using this protocol, we could rapidly produce a large number of T-DNA insertional mutants of K. zeae. The results confirmed that ATMT is an efficient means of producing insertional mutagenesis and subsequent identification of mutated genes in K. zeae.
Curr. Genet. 48, 380–388. Liu, Y.G., Chen, Y., 2007. High-efficiency thermal asymmetric interlaced PCR for amplification of unknown flanking sequences. BioTechniques 43 (5), 649. Lu, Y., Xiao, S., Wang, F., Sun, J., Zhao, L., Yan, L., et al., 2016. Agrobacterium tumefaciensmediated transformation as an efficient tool for insertional mutagenesis of Cercospora zeae-maydis. J. Microbiol. Methods 133, 8. Michielse, C.B., Hooykaas, P.J.J., van den Hondel, Cees A.M.J.J., Ram, A.F.J., 2005. Agrobacterium-mediated transformation as a tool for functional genomics in fungi. Curr. Genet. 48 (1), 1–17. Miyamoto, Y., Masunaka, A., Tsuge, T., Yamamoto, M., Ohtani, K., Fukumoto, T., et al., 2008. Functional analysis of a multicopy host-selective act-toxin biosynthesis gene in the tangerine pathotype of Alternaria alternata using RNA silencing. Mol. PlantMicrobe Interact. 21 (12), 1591–1599. Morioka, L.R.I., Furlaneto, M.C., Bogas, A.C., Pompermayer, P., Duarte, R.T.D., Vieira, M.L.C., et al., 2006. Efficient genetic transformation system for the ochratoxigenic fungus Aspergillus carbonarius. Curr. Microbiol. 52 (6), 469–472. Mullins, E.D., Chen, X., Romaine, P., Raina, R., Geiser, D.M., Kang, S., 2001. Agrobacterium-mediated transformation of Fusarium oxysporum: an efficient tool for insertional mutagenesis and gene transfer. Phytopathology 91 (2), 173–180. Naeita, T., Hiratsuka, Y., 1959. Studies on Kabatiella zeae n.sp. the causal fungus of a new leaf spot disease of corn. Japanese Journal of Phytopathology 24 (3), 147–153. Qi, P.K., Bai, J.K., Zhu, G.X., 1966. Cultivated Plant Fungal Diseases in Jilin Province. Science Press, Beijing, pp. 28–30. Reifschneider, F.J.B., Arny, D.C., 1979. Seed infection of maize (zea mays) by Kabatiella zeae. Plant Dis. Rep. 63 (5), 352–354. Santos, I.D., Silva, A.D., Malagi, G., 2007. Occurrence of maize eyespot caused by Kabatiella zeae in paraná and Santa Catarina state, Brazil. Fitopatol. Bras. 32 (4), 359. Shurtleff, M.C., 1980. Compendium of Corn Diseases. APS Press, pp. 21–22. Sugui, J.A., Chang, Y.C., Kwonchung, K.J., 2005. Agrobacterium tumefaciens-mediated transformation of Aspergillus fumigatus: an efficient tool for insertional mutagenesis and targeted gene disruption. Appl. Environ. Microbiol. 71 (4), 1798–1802. Sun, W.L., Liu, L.X., Hu, X.L., Tang, J., Peng, L., Jie, C., et al., 2009. Generation and identification of DNA sequence flanking t-dna integration site of Trichoderma atroviride mutants with high Dichlorvos-degrading capacity. Bioresour. Technol. 100 (23), 5941–5946. Sun, J.Y., Xiao, S.Q., Lu, Y.Y., Tu, G.P., Xue, C.S., Chen, J., 2015. Isolation,identification and biological characteristics of Aureobasidium zeae in Liaoning Province. Journal of Plant Protection 42 (6), 927–934. Sun, J.Y., Xiao, S.Q., Xu, J.N., Lu, K.X., Xue, C.S., Chen, J., 2016. Occurrence condition and chemical control of maize eyespot in Liaoning Province. J. Maize Sci. 24 (5), 147–151. Takahara, H., Tsuji, G., Kubo, Y., Yamamoto, M., Toyoda, K., Inagaki, Y., et al., 2004. Agrobacterium tumefaciens -mediated transformation as a tool for random mutagenesis of Colletotrichum trifolii. J. Gen. Plant Pathol. 70 (2), 93–96. Vijn, I., Govers, F., 2003. Agrobacterium tumefaciens, mediated transformation of the oomycete plant pathogen phytophthora infestans. Mol. Plant Pathol. 4 (6), 459–467. Wang, D., Dan, H., Li, G., Song, G., Lv, H., Shan, Q., et al., 2014. An efficient tool for random insertional mutagenesis: Agrobacterium tumefaciens -mediated transformation of the filamentous fungus Aspergillus terreus. J. Microbiol. Methods 98 (1), 114–118. Wouw, A.P.V.D., Pettolino, F.A., Howlett, B.J., Elliott, C.E., 2009. Mutations to lmIFRD affect cell wall integrity, development and pathogenicity of the ascomycete leptosphaeria maculans. Fungal Genet. Biol. 46 (9), 695–706. Xu, X.D., Dong, H.Y., Jiang, Y., Qiao, Y., Liu, Z.H., Sun, J.D., 2000. Preliminary studies on the northern anthracnose disease in maize. J. Shenyang Agric. Univ. 31 (5), 507–510. Xue, C., Wu, D., Condon, B.J., Bi, Q., Wang, W., Turgeon, B.G., 2013. Efficient gene knockout in the maize pathogen Setosphaeria turcica using Agrobacterium tumefaciensmediated transformation. Phytopathology 103 (6), 641–647. Zhang, Q.F., 2014. The corn northern anthracnose. Science and Technology of West China 13 (1), 49–50.
Acknowledgments This study was supported by the National Natural Science Foundation of China (grant number 31271992) and China Agriculture Research System (grant number CARS-02). We would like to thank LetPub (www.letpub.com) for providing linguistic assistance during the preparation of this manuscript. References Van de Wouw, A.P., Howlett, B.J., 2011. Fungal pathogenicity genes in the age of ‘omics’. Mol. Plant Pathol. 12 (5), 507–514. Arny, D.C., Smalley, E.B., Ullstrup, A.J., Worf, G.L., Ahrens, R.W., 1971. Eyespot of maize, a disease new to North America. Phytopathology 61 (1), 54–57. Chen, E.C., Su, Y.H., Kanagarajan, S., Agrawal, D.C., Tsay, H.S., 2009. Development of an activation tagging system for the basidiomycetous medicinal fungus Antrodia cinnamomea. Mycol. Res. 113 (3), 290–297. Combier, J.P., Melayah, D., Raffier, C., Gay, G., Marmeisse, R., 2003. Agrobacterium tumefaciens-mediated transformation as a tool for insertional mutagenesis in the symbiotic ectomycorrhizal fungus Hebeloma cylindrosporum. Appl. Microbiol. 220, 141–148. Covert, S.F., Kapoor, P., Lee, M.H., Briley, A., Nairn, C.J., 2001. Agrobacterium tumefaciens-mediated transformation of Fusarium circinatum. Mycol. Res. 105 (3), 259–264. Dingley, J., 1973. Eyespot disease of maize in New Zealand. N. Z. J. Agric. Res. 16 (3), 325–328. Flowers, J.L., Vaillancourt, L.J., 2005. Parameters affecting the efficiency of Agrobacterium tumefaciens-mediated transformation of colletotrichum graminicola.
100