- Email: [email protected]
An efficient tool for random insertional mutagenesis: Agrobacterium tumefaciens-mediated transformation of the filamentous fungus Aspergillus terreus
MIMET-04306; No of Pages 5 Journal of Microbiological Methods xxx (2014) xxx–xxx
Contents lists available at ScienceDirect
Journal of Microbiological Methods journal homepage: www.elsevier.com/locate/jmicmeth
An efficient tool for random insertional mutagenesis: Agrobacterium tumefaciens-mediated transformation of the filamentous fungus Aspergillus terreus
Q1
O
F
1
Dongyang Wang, Dan He, Guangquan Li, Song Gao, Huiying Lv, Qiushi Shan, Li Wang ⁎
3 14 4 15 5 16 6 17 7 18
Article history: Received 15 November 2013 Received in revised form 13 January 2014 Accepted 13 January 2014 Available online xxxx
8 9 10 11 12 13
Keywords: Agrobacterium tumefaciens Filamentous fungus Aspergillus terreus T-DNA flanking sequences Transformation
a b s t r a c t
P
i n f o
Agrobacterium tumefaciens-mediated transformation (ATMT) has been widely used in various organisms. In the current study, we developed a simple and efficient system for genetic transformation of the filamentous fungus Aspergillus terreus using ATMT. The transformation protocol was optimized for certain parameters to rapidly generate a library of Transferred DNA (T-DNA) insertion mutants of A. terreus. The presence of mitotically stable hygromycin resistance gene (hph) integration in the genome was confirmed by PCR, and T-DNA flanking sequences were cloned by thermal asymmetric interlaced PCR. The successful construction of the mutant library demonstrated the utility of the ATMT approach for future forward and reverse genetic studies in this important fungus. © 2014 Published by Elsevier B.V.
D
a r t i c l e
T
E
2
R O
Department of Pathogenobiology, Jilin University Mycology Research Center, Key Laboratory of Pathobiology, Ministry of Education, College of Basic Medical Sciences, Jilin University, Changchun 130021, China
26 24 23
C E
1. Introduction
28 29
Aspergillus terreus is a common saprophytic, filamentous fungus that is widespread in the environment. A. terreus produces a spectrum of secondary metabolites, such as itaconic acid (Shimi and El Dein, 1962), butyrolactone (Nitta et al., 1983) and emodin (Fujii et al., 1982). Consequently, A. terreus has been used extensively in industry as a fermentation strain. Alberts et al. (1980) isolated lovastatin from cultures of A. terreus. Lovastatin is an active inhibitor of cholesterol synthesis with hypolipidemic effects, and has been widely used as an antilipemic agent. Additionally, A. terreus also causes opportunistic infection in immune-compromised individuals (Lass-Flörl et al., 2005). Baddley et al. (2003) found that the percentage of A. terreus isolates relative to those of other Aspergillus species was significantly increased in the clinical cases at their institution, and the A. terreus isolates were frequently resistant to antifungal drugs (Baddley et al., 2003). However, few studies have focused on mutation breeding, and metabolite and pathogenesis-related genes of A. terreus (Barrios-González et al., 2008; Varga et al., 2003; Tevz et al., 2010; Vinci et al., 1991; Gressler et al., 2011) because of the lack of efficient genetic methods to generate mutants in this organism. Agrobacterium tumefaciens is a gram negative plant pathogenic bacterium that causes crown gall in plants. A. tumefaciens is capable of
34 35 36 37 Q4 38 39 40 41 Q5 42 43 44 45 46 47 48
R
N C O
32 33
U
30 Q3 31
R
27
⁎ Corresponding author. Tel.: +86 431 85619486. E-mail address: [email protected] (L. Wang).
19 20 21 22
25
transferring a piece of its tumor-inducing (Ti) plasmid DNA into host cells, where it is integrated into the host chromosome and expressed. Ti plasmid vectors have been developed to introduce target DNA sequences into plants, mammalian cells and several species of fungi (Krysan et al., 1999; Kunik et al., 2001; Michielse et al., 2005). Insertional mutagenesis techniques are considered to be efficient tools to investigate fungal gene functions (Campoy et al., 2003; Rodríguez-Tovar et al., 2005). The A. tumefaciens-mediated transformation (ATMT) system has been used widely as an effective tool for insertional mutagenesis (De, Groot et al., 1998; Sugui et al., 2005; Zhang et al., 2011). Studies on Agrobacterium-mediated fungal transformation demonstrated that the ATMT system has several advantages. First, the T-DNA can be randomly inserted in the host genome, typically as a single copy, and is mitotic stable (Covert et al., 2001; Morioka et al., 2006). Second, Agrobacterium can transform intact cells, such as conidia, mycelium, or even fruiting bodies (Michielse et al., 2005), thereby eliminating the tedious process of protoplast preparation. Therefore, the ATMT system offers an efficient tool for random insertional mutagenesis. Here, we report the establishment of an ATMT system and an investigation into the important factors affecting the transformation frequency of A. terreus. The highly efficient transformation method enabled us to rapidly obtain a large number of T-DNA insertional mutants. The molecular analysis of the transformants showed that insertion site flanking sequences could be identified by thermal asymmetric interlaced PCR (TAIL-PCR).
0167-7012/$ – see front matter © 2014 Published by Elsevier B.V. http://dx.doi.org/10.1016/j.mimet.2014.01.007
Please cite this article as: Wang, D., et al., An efficient tool for random insertional mutagenesis: Agrobacterium tumefaciens-mediated transformation of the filamentous fungus Aspergillus terreus, J. Microbiol. Methods (2014), http://dx.doi.org/10.1016/j.mimet.2014.01.007
49 50 51 52 53 Q6 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74
2 t1:1 t1:1
D. Wang et al. / Journal of Microbiological Methods xxx (2014) xxx–xxx
Table 1 Primers used in this study. Primer name
Nucleotide sequence (5′ to 3′)
t1:1 t1:1 t1:1 t1:1 t1:1 t1:1 t1:1 t1:1 t1:1 t1:1 t1:1 t1:1
hph-r hph-f LB1 LB2 LB3 RB1 RB2 RB3 AD1 AD2 AD3 AD4
5′-CGACAGCGTCTCCGACCTGA-3′ 5′-CGCCCAAGCTGCATCATCGAA-3′ 5′-GGGTTCCTATAGGGTTTCGCTCATG-3′ 5′-CATGTGTTGAGCATATAAGAAACCCT-3′ 5′-GAATTAATTCGGCGTTAATTCAGT-3′ 5′-GGCACTGGCCGTCGTTTTACAAC-3′ 5′-AACGTCGTGACTGGGAAAACCCT-3′ 5′-CCCTTCCCAACAGTTGCGCA-3′ 5′-TGAGNAGTANCAGAGA-3′ 5′-AGTGNAGAANCAAAGG-3′ 5′-CATCGNCNGANACGAA-3′ 5′-CAAGCAAGCA-3′
t2:2
Co − AS
Co + AS
0* 15 ± 3
60 ± 12 315 ± 35
2. Materials and methods
76
2.1. Strains and plasmids
77 78
87
A. terreus was used as a recipient strain for transformation. The fungus was isolated from Jilin, Northeast China, and grown in Potato Dextrose Agar (PDA) at 25 °C and stored at −80 °C. A. tumefaciens strain AGL-1, harboring the binary vector pBHt1, was cultured at 28 °C in Lysogenic Broth (LB) medium. Vector pBHt1, carrying the bacterial hygromycin B phosphotransferase gene (hph) under the control of the Aspergillus nidulans trpC promoter, was used as a fungal selection marker (Mullins et al., 2001). Strain AGL-1 was kindly provided by Professor Zhonghua Wang (Fujian Agriculture and Forestry University). All strains were conserved at the Jilin University Mycology Research Center.
88
2.2. A. tumefaciens-mediated transformation
89
Before transformation, the minimum inhibitory concentration of hygromycin B for the wild-type strain of A. terreus was determined by transferring 100 μl 1 × 106 conidia/ml fungal cultures onto PDA plates supplemented with different concentrations of hygromycin B (0, 50, 100, 150, 200, 250 and 300 μg/ml).
90 91
C
E
98 99 100 101 102 103 Q7 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121
The stability of hygromycin B resistance was used to determine the mitotic stability of the A. terreus transformants (Figueiredo et al., 2010; Wang and Li, 2008). Twenty randomly selected transformants were cultured on PDA plates without hygromycin B for 7 d. Mycelia from the edge of the cultures were picked with a toothpick and grown on fresh PDA plates for another 7 d. After repeating this procedure five times, germinating mycelia from each transformant were transferred to PDA plates containing hygromycin B (200 μg/ml).
123
2.4. Molecular analysis of the transformants
131
Putative hygromycin B resistant transformants of A. terreus were cultured in potato dextrose broth (PDB) containing 200 μg/ml hygromycin B and 200 μM cefotaxime for 24 h at 25 °C with shaking (160 rpm). Mycelia were harvested by centrifugation at 12,000 rpm for 3 min, and their genomic DNA was extracted as previously described (Wang et al., 1998). PCR was performed using hygromycin phosphotransferase
132 133
U Q2
96 97
122
N
92 93
R
85 86
R
83 84
O
81 82
C
79 80
94 95
2.3. Mitotic stability of the transformants
T
75
D
Pre − AS Pre + AS
E
t2:2 t2:2
R O
Table 2 The effect of acetosyringone (AS) on the transformation efficiency of A. terreus. Pre: precultivation period; Co: co-cultivation period; +AS: the presence of AS; −AS: the absence of AS;* transformant numbers (average ± standard error).
P
t2:2 t2:2
O
F
t1:1
The transformation procedure was based on a previously described protocol (Michielse et al., 2008) with some modifications. Briefly, A. tumefaciens strain AGL-1 harboring pBHt1 was grown overnight in 10 ml of LB liquid medium supplemented with 20 μg/ml rifampicin and 100 μg/ml kanamycin at 28 °C, with shaking (200 rpm). A 1.5-ml sample of the culture was centrifuged at 2400 × g for 10 min and the pellets were resuspended at an optical density at 600 nm (OD600 nm) of 0.2–0.3 with induction medium (IM, described by Michielse et al., 2008) with 200 μM acetosyringone (AS) (IM + AS) or without AS (IM-AS) (Table 2). A. tumefaciens was then pre-cultured at 28 °C with gentle shaking at 160 rpm to an OD600 nm of 0.4, 0.6, 0.8 and 1.0 in IM(IM + AS) or (IM − AS). A. terreus was incubated on a PDA slide for 7 d at 25 °C to induce sporulation. The conidia were scraped off the fungal slide into 1 ml of saline and the cell concentration was determined using a hemocytometer. The conidia were then diluted to a final concentration of 105, 106 or 107 conidia/ml in saline. Sterile Hybond N+ Filters (0.45 μm pore, Amersham Pharmacia, USA) were placed on (IM + AS) or (IM − AS) plates, and the A tumefaciens cells were mixed with an equal volume of the conidial suspensions of A. terreus. A 100-μl sample of the mixture was pipetted onto the Hybond N+ Filters and the plates were incubated for varying lengths of time (24 h, 36 h, 48 h and 60 h) at different temperatures (22 °C, 25 °C and 28 °C) in the dark. The filters were then transferred to a selection medium (SM:PDA containing 200 μg/ml hygromycin B and 200 μM of cefotaxime) to select for A. terreus transformants while inhibiting the growth of A. tumefaciens. The plates were incubated for 3 d at 25 °C in the dark until colonies appeared.
Fig. 1. The effect of different temperatures on co-culture period on transformation frequency.
Please cite this article as: Wang, D., et al., An efficient tool for random insertional mutagenesis: Agrobacterium tumefaciens-mediated transformation of the filamentous fungus Aspergillus terreus, J. Microbiol. Methods (2014), http://dx.doi.org/10.1016/j.mimet.2014.01.007
124 125 126 127 128 129 130
134 135 136 137
3
F
D. Wang et al. / Journal of Microbiological Methods xxx (2014) xxx–xxx
149
3.1. The minimum inhibitory concentration of hygromycin B for A. terreus
150 151
154
The results suggested that the growth of A. terreus was completely inhibited on PDA medium containing ≥ 200 μg/ml hygromycin B. Therefore, 200 μg/ml of hygromycin B was considered the minimum inhibitory concentration of hygromycin B for the selection of A. terreus transformants in further experiments.
155
3.2. Optimization of conditions for ATMT of A. terreus
156 157 Q8
3.2.1. Co-cultivation time and temperature The co-cultivation time and temperature are critical factors in the transformation procedure. The optimal co-cultivation time and temperature vary according to different strains of Agrobacterium and hosts. To determine the optimal co-cultivation time and temperature for the ATMT of A. terreus, four different periods (24 h, 36 h, 48 h and 60 h) and three different temperatures (22 °C, 25 °C and 28 °C) were tested. Each temperature was tested for the four time periods (Fig. 1).
159 160 161 162 163
T
C
E
R
R
158
N C O
152 153
3.2.2. The addition of AS to A. tumefaciens pre-culture and co-culture periods The insertion of T-DNA into the host genome requires activation and high expression of the vir region genes on the Ti plasmid (Michielse et al., 2005). Transcription of the vir region genes was found to be silent when A. tumefaciens was grown in LB medium. The addition of AS or other phenolic compounds has been shown to induce the activation and high expression of vir region genes (Lai et al., 2006). While, AS was shown to be essential in the co-cultivation period for the transformation of most fungi, the addition of AS during the pre-culture of A. tumefaciens does not seem to be an absolute requirement. For example, experiments using Fusarium oxysporum and Magnaporthe grisea indicated that the omission of AS in the A. tumefaciens pre-culture led to a lower transformation frequency (Mullins et al., 2001; Rho et al., 2001). However, transformation of Hebeloma cylindrosporum showed no difference in frequency when AS was omitted from the pre-culture (Combier et al., 2003). The results show that when AS is absent from either the pre- or coculture period, a relatively low transformation efficiency resulted; when AS was absent from both pre- and co-culture periods, no transformants were obtained. It indicated that the addition of AS to the A. tumefaciens pre- and co-culture periods was essential for the transformation efficiency of A. terreus.
U
144 145
R O
3. Results and discussion
142 143
P
148
140 141
The results show that the transformation frequency of A. terreus using ATMT increased as the co-cultivation time increased. In addition, the transformation frequency was optimal at 25 °C compared to either 22 °C or 28 °C at each co-cultivation time. Therefore, for subsequent experiments we used a co-cultivation period of 48 h at 25 °C. The transformation efficiency reached more than 350 transformants per 106 conidia.
D
146 147
gene (hph) specific primers, hph-r and hph-f (Table 1), to detect the integration of T-DNA in the putative transformants (Dos et al., 2004). TAIL-PCR was performed to clone the T-DNA flanking sequences from A. terreus transformants. TAIL-PCR was performed as described previously (Zhang et al., 2011), primers' list in Table 1. Using these primer sets, T-DNA flanking sequences could be cloned and non-target products could be thermally controlled by one low-stringency PCR cycle, one high-stringency PCR cycle and one reduced-stringency PCR cycle (Mullins et al., 2001; Singer and Burke, 2003). Shenggong Co. Ltd. (Beijing, China) sequenced the reaction products.
E
138 139
O
Fig. 2. The effect of co-culture densities on transformation frequency. A1: A. terreus concentration 1 × 105 conidia/ml; A2: A. terreus concentration 1 × 106 conidia/ml; A3: A. terreus concentration 1 × 107 conidia/ml.
Fig. 3. The colony morphology of the wild-type and T-DNA insertional mutants of A. terreus. The wild-type host strain (WT) and mutant strains (Mut1 to Mut5) were inoculated onto PDA medium, and grown at 25 °C for 7 d. Images of the colonies are shown from the front view and the back view.
Please cite this article as: Wang, D., et al., An efficient tool for random insertional mutagenesis: Agrobacterium tumefaciens-mediated transformation of the filamentous fungus Aspergillus terreus, J. Microbiol. Methods (2014), http://dx.doi.org/10.1016/j.mimet.2014.01.007
164 165 166 167 168 169
170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192
D. Wang et al. / Journal of Microbiological Methods xxx (2014) xxx–xxx
F
4
201 202
3.3. Screening for phenotypic mutants
204 205
Mutants are valuable tools for both forward and reverse genetics. In our A. terreus transformation experiments, some phenotypic mutants of A. terreus were observed and cultured on PDA medium. As shown in Fig. 3, compared with the wild-type strain, Mut1 grew slowly and produced more pigment. Mut2 lost the capacity to produce pigment. Mut3 colony edges had more mycelia. Mut4 aerial hyphae grew vigorously and the colony surface was swollen. Mut5 colonies were folded. In addition to pigment production and other mutants showing changes in hyphae and conidial morphology, growth rate and conidial germination may also provide unique opportunities to study the biological characteristics of this organism. The A. terreus T-DNA insertional mutants obtained in our experiments may provide valuable research materials for future studies.
214 215 216
C
E
R
212 213
R
210 211
O
208 209
3.4. Mitotic stability of transformants
218 219
In other fungi, transformants have been reported to be relatively stable during growth under non-hygromycin B conditions (Leclerque et al., 2004; Zhong et al., 2007). This is an important feature of an effective mutagenesis system. After five subcultures in the absence of hygromycin B, all of our A. terreus transformants grew on PDA containing 200 μg/ml hygromycin B, suggesting that the hph gene was stably maintained in all the transformants (data not shown).
224 t3:3 t3:3
N
U
222 223
C
217
220 221
4. Conclusions
246
To the best of our knowledge, this is the first report documenting the development and optimization of an ATMT system for A. terreus. Using this protocol, we could rapidly obtain a large number of T-DNA insertional mutants, and the insertion site flanking sequences could be isolated by TAIL-PCR. The mutants displayed mitotic stability. Our results confirmed that ATMT is an efficient tool for insertional mutagenesis and subsequent identification of mutated genes in A. terreus.
247 248
Acknowledgment
254
Mut1 Mut2 Mut3 Mut4 Mut5
228 229 230 231 232 233 234 235 236 237 238 239 240 241 Q9 242 243 244 245
249 250 251 252 253
This research was supported by grants from the National Natural 255 Science Foundation of China (Project Nos. 81071334 and 81271802). 256 We thank the staff of Jilin University Mycology Research Center. 257
Table 3 Analysis of the T-DNA flanking sequences in the A. terreus transformants. Mut1 to Mut5 represent the five selected transformants; letters represent the T-DNA flanking sequences from the transformants and the nucleotides of the T-DNA borders from the LB (left border) and the RB (right border); hyphens represent the sequences between the LB and the RB; and ellipses represent the pBHt1 vector “backbone” sequences.
t3:3 t3:3 t3:3 t3:3 t3:3 t3:3
226 227
T
203
206 207
R O
199 200
To investigate the integration mode of T-DNA in the genome of A. terreus, 16 putative transformants were randomly selected for PCR analysis using the hph specific primers, hph-r and hph-f. In all of these mutants, an 800-bp specific fragment of the hph gene was amplified, indicating that T-DNA had been integrated into the chromosome of A. terreus (data not shown). One of the advantages of ATMT is that T-DNA tagged gene sequences can be generated. For example, several PCR-based methods, such as adapter ligation mediated PCR, inverse PCR and TAIL-PCR, have been described to isolate the T-DNA insertion site flanking sequences (Erster and Liscovitch, 2010; O'Malley et al., 2007; Singer and Burke, 2003). In our study, mutant (Mut1 to Mut5) T-DNA insertion site flanking sequences were amplified by TAIL-PCR (Fig. 4). Comparison of the pBHt1 plasmid backbone sequences and the TAIL-PCR data enabled us to obtain sequences from the A. terreus mutants, and localize the insertion sites in the A. terreus genome (Table 3). The phenotypes associated with these mutated genes will provide valuable material for further study. Our results indicated that T-DNA transfer and insertion could be performed in A. terreus and that T-DNA flanking sequences could be obtained by TAIL-PCR.
P
197 198
225
3.5. Molecular analysis of transformants
D
195 196
3.2.3. Ratio of A. tumefaciens and A. terreus The ratios of the bacterial and fungal mixtures during co-cultivation may have a considerable effect on the transformation efficiency (Michielse et al., 2008). In our study, A. tumefaciens cells in induction medium (IM) (OD600 nm = 0.4, 0.6, 0.8 and 1.0) were co-cultivated with various concentrations of A. terreus conidia (105, 106 and 107 conidia/ml). As shown in Fig. 2, the highest transformation frequency was observed with an A. tumefaciens density of OD600 nm = 0.8 and an A. terreus density of 1 × 106 conidia/ml represented the optimal balance to yield the highest transformation efficiency.
E
193 194
O
Fig. 4. Molecular analysis of Mut1 to Mut5 using TAIL-PCR. M: DNA molecular size marker. DL2000; Lanes 2–6: TAIL-PCR amplification of genomic region flanking the left border of T-DNA insertion site; Lanes 7–11: TAIL-PCR amplification of genomic region flanking the right border of T-DNA insertion site.
A. terreus
…
LB
T-DNA
RB
…
A. terreus
CTCACGTGACAGTGCGGCTT GGCTTAAGACGAGGACTCCG TCTAGGACCCTGTTACGTCG TCCGAGCACATGGAAATAGT CCGGCTCAACCAGGTTCCGC
… … … … …
TGGCAGGATATATTGTGGTGTAAACA TGGCAGGATATATTGTGGTGTAAACA TGGCAGGATATATTGTGGTGTAAACA TGGCAGGATATATTGTGGTGTAAACA TGGCAGGATATATTGTGGTGTAAACA
——————— ——————— ——————— ——————— ———————
GTAAACCTAAGAGAAAGAGCGTTTA GTAAACCTAAGAGAAAGAGCGTTTA GTAAACCTAAGAGAAAGAGCGTTTA GTAAACCTAAGAGAAAGAGCGTTTA GTAAACCTAAGAGAAAGAGCGTTTA
… … … … …
GGCCCACTAATCCGAAACTG CAGTCGCCCCATCCTGGCAA ATGTAGACGACTTCGGCCTC GAACCGGGAATGATGTAGCA GTCGGAAAGATAGTAGACTA
Please cite this article as: Wang, D., et al., An efficient tool for random insertional mutagenesis: Agrobacterium tumefaciens-mediated transformation of the filamentous fungus Aspergillus terreus, J. Microbiol. Methods (2014), http://dx.doi.org/10.1016/j.mimet.2014.01.007
D. Wang et al. / Journal of Microbiological Methods xxx (2014) xxx–xxx
F
O
R O
P
Alberts, A.W., Chen, J., Kuron, G., Hunt, V., Huff, J., Hoffman, C., et al., 1980. Mevinolin: a highly potent competitive inhibitor of hydroxymethyl-glutaryl-coenzyme A reductase and a cholesterol-lowering agent. Proc. Natl. Acad. Sci. U. S. A. 77, 3957–3961. Baddley, John W., Pappas, Peter G., Smith, Anita C., Moser, Stephen A., 2003. Epidemiology of Aspergillus terreus at a University Hospital. J. Clin. Microbiol. 41, 5525–5529. Barrios-González, J., Baños, J.G., Covarrubias, A.A., Garay-Arroyo, A., 2008. Lovastatin biosynthetic genes of Aspergillus terreus are expressed differentially in solid-state and in liquid submerged fermentation. Appl. Microbiol. Biotechnol. 79, 179–186. Campoy, S., Perez, F., Martin, J.F., Gutierrez, S., Liras, P., 2003. Stable transformants of the azaphilone pigment-producing Monascus purpureus obtained by protoplast transformation and Agrobacterium-mediated DNA transfer. Curr. Genet. 43, 447–452. Combier, J.P., Melayah, D., Raffier, C., Gay, G., Marmeisse, R., 2003. Agrobacterium tumefaciens-mediated transformation as a tool for insertional mutagenesis in the symbiotic ectomycorrhizal fungus Hebeloma cylindrosporum. FEMS Microbiol. Lett. 220, 141–148 (Mar 14). Covert, S.F., Kapoor, P., Lee, M., Briley, A., Nairn, C.J., 2001. Agrobacterium tumefaciensmediated transformation of Fusarium circinatum. Mycol. Res. 105, 259–264. De, G., M.J.A., Bundock, P., Hooykaas, P.J.J., Beijersbergen, A.G.M., 1998. Agrobacterium tumefaciens-mediated transformation of filamentous fungi. Nat. Biotechnol. 16, 839–842. Dos, R.M.C., Dos, R.M.C., Pelegrinelli Fungaro, M.H., Delgado Duarte, R.T., Furlaneto, L., Furlaneto, M.C., 2004. Agrobacterium tumefaciens-mediated genetic transformation of the entomopathogenic fungus Beauveria bassiana. J. Microbiol. Methods 58, 197–202. Erster, O., Liscovitch, M., 2010. A modified inverse PCR procedure for insertion, deletion, or replacement of a DNA fragment in a target sequence and its application in the ligand interaction scan method for generation of ligand-regulated proteins. Methods Mol. Biol. 634, 157–174. Figueiredo, J.G., Goulin, E.H., Tanaka, F., Stringari, D., Kava-Cordeiro, V., Galli-Terasawa, L.V., Staats, C.C., Schrank, A., Glienke, C., 2010. Agrobacterium tumefaciens-mediated transformation of Guignardia citricarpa. J. Microbiol. Methods 80, 143–147. Fujii, I., Ebizuka, Y., Sankawa, U., 1982. Partial purification and some properties of emodinO-methyl-transferase from (+)-geodin producing strain of Aspergillus terreus. Chem. Pharm. Bull. 30, 2283–2286. Gressler, M., Zaehle, C., Scherlach, K., Hertweck, C., Brock, M., 2011. Multifactorial induction of an orphan PKS-NRPS gene cluster in Aspergillus terreus. Chem. Biol. 18, 198–209 (25). Krysan, Patrick J., Young, Jeffery C., Sussman, Michael R., 1999. T-DNA insertional mutagenesis in Arabidopsis. Am. Soc. Plant Physiol. 11, 2283–2290. Kunik, T., Tz Wra, T., Kapulnik, Y., Gafni, Y., Dingwall, C., Citovsky, V., 2001. Genetic transformation of HeLa cells by Agrobacterium. Proc. Natl. Acad. Sci. U. S. A. 98, 1871–1876. Lai, E.M., Shih, H.W., Wen, S.R., Cheng, M.W., Hwang, H.H., Chiu, S.H., 2006. Proteomic analysis of Agrobacterium tumefaciens response to the Vir gene inducer acetosyringone. Proteomics 6, 4130–4136. Lass-Flörl, C., Griff, K., Mayr, A., Petzer, A., Gastl, G., Bonatti, H., Freund, M., Kropshofer, G., Dierich, M.P., Nachbaur, D., 2005. Epidemiology and outcome of infections due to Aspergillus terreus: 10-year single centre experience. Br. J. Haematol. 131, 201–207.
D
259 260 261 262 263 Q10 264 265 266 267 268 269 270 271 272 273 274 275 276 277 Q11 278 279 280 Q12 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 Q13 298 299 Q14 300 301 302 303 304 305 306 307
C
E
R
U
N C O
R
359
Leclerque, A., Wan, H., Abschutz, A., Chen, S., Mitina, G.V., Zimmermann, G., Schairer, H.U., 2004. Agrobacterium-mediated insertional mutagenesis (AIM) of the entomopathogenic fungus Beauveria bassiana. Curr. Genet. 45, 111–119. Michielse, C.B., Hooykaas, P.J., van den Hondel, C.A., Ram, A.F., 2005. Agrobacterium-mediated transformation as a tool for functional genomics in fungi. Curr. Genet. 48, 1–17. Michielse, C.B., Hooykaas, P.J., van den Hondel, C.A., Ram, A.F., 2008. Agrobacteriummediated transformation of the filamentous fungus Aspergillus awamori. Nat. Protoc. 3, 1671–1678. Morioka, L.R., Furlaneto, M.C., Bogas, A.C., Pompermayer, O.S., Duarte, R.T., Carneiro, M.L., Watanabe, M.A.E., Fungaro, M.H.P., 2006. Efficient genetic transformation system for the ochratoxigenic fungus Aspergillus carbonarius. Curr. Microbiol. 52, 469–472. Mullins, E.D., Chen, X., Romaine, P., Raina, R., Geiser, D.M., Kang, S., 2001. Agrobacteriummediated transformation of Fusarium oxysporum: an efficient tool for insertional mutagenesis and gene transfer. Phytopathology 91, 173–180. Nitta, K., Fujita, N., Yoshimura, T., Arai, K., Yama-moto, U., 1983. Metabolic products of Aspergillus terreus. IX. Biosynthesis of butyrolactone derivatives isolated from strain IFO 8835 and 4100. Chem. Pharm. Bull. 31, 1528–1533. O'Malley, R.C., Alonso, J.M., Kim, C.J., Leisse, T.J., Ecker, J.R., 2007. An adapter ligationmediated PCR method for high-throughput mapping of T-DNA inserts in the Arabidopsis genome. Nat. Protoc. 2, 2910–2917. Rho, H.S., Kang, S., Lee, Y.H., 2001. Agrobacterium tumefaciens-mediated transformation of the plant pathogenic fungus Magnaporthe grisea. Mol. Cells 12, 407–411. Rodríguez-Tovar, A.V., Ruiz-Medrano, R., Herrera-Martínez, A., Barrera-Figueroa, B.E., Hidalgo-Lara, M.E., Reyes-Márquez, B.E., Cabrera-Ponce, J.L., Valdéz, M., XoconostleCázares, B., 2005. Stable genetic transformation of the ectomycorrhizal fungus Pisolithus tinctorius. J. Microbiol. Methods 63, 45–54. Shimi, Ibrahim R., El Dein, Moustafa S. Nour, 1962. Biosynthesis of itaconic acid by Aspergillus terreus. Arch. Mikrobiol. 44, 181–188. Singer, T., Burke, E., 2003. High-throughput TAIL-PCR as a tool to identify DNA flanking insertions. Methods Mol. Biol. 236, 241–272. Sugui, Janyce A., Chang, Yun C., Kwon-Chung, K.J., 2005. Agrobacterium tumefaciensmediated transformation of Aspergillus fumigatus: an efficient tool for insertional mutagenesis and targeted gene disruption. Appl. Environ. Microbiol. 71 (4), 1798–1802. Tevz, G., Bencina, M., Legisa, M., 2010. Enhancing itaconic acid production by Aspergillus terreus. Appl. Microbiol. Biotechnol. 87, 1657–1664. Varga, J., Rigó, K., Kocsubé, S., Farkas, B., Pál, K., 2003. Diversity of polyketide synthase gene sequences in Aspergillus species. Res. Microbiol. 154, 593–600. Vinci, V.A., Hoerner, T.D., Coffman, A.D., Schimmel, T.G., Dabora, R.L., Kirpekar, A.C., Ruby, C.L., Stieber, R.W., 1991. Mutants of a lovastatin-hyperproducing Aspergillus terreus deficient in the production of sulochri. J. Ind. Microbiol. 8, 113–119. Wang, J., Li, H., 2008. Agrobacterium tumefaciens mediated genetic transformation of the phytopathogenic fungus Penicillium digitatum. J. Zhejiang Univ. Sci. 10, 823–828. Wang, L., Yokoyama, K., Miyaji, M., Nishimura, K., 1998. The identification and phylogenetic relationship of pathogenic species of Aspergillus based on the mitochondrial cytochrome b gene. Med. Mycol. 36, 153–164. Zhang, Y., Li, G., He, D., Yu, B., Yokoyama, K., Wang, L., 2011. Efficient insertional mutagenesis system for the dimorphic pathogenic fungus Sporothrix schenckii using Agrobacterium tumefaciens. J. Microbiol. Methods 84, 418–422. Zhong, Y.H., Wang, X.L., Wang, T.H., Jiang, Q., 2007. Agrobacterium-mediated transformation (AMT) of Trichoderma reesei as an efficient tool for random insertional mutagenesis. Appl. Microbiol. Biotechnol. 73, 1348–1354.
E
References
T
258
5
Please cite this article as: Wang, D., et al., An efficient tool for random insertional mutagenesis: Agrobacterium tumefaciens-mediated transformation of the filamentous fungus Aspergillus terreus, J. Microbiol. Methods (2014), http://dx.doi.org/10.1016/j.mimet.2014.01.007
308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 Q15 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358
Contents lists available at ScienceDirect
Journal of Microbiological Methods journal homepage: www.elsevier.com/locate/jmicmeth
An efficient tool for random insertional mutagenesis: Agrobacterium tumefaciens-mediated transformation of the filamentous fungus Aspergillus terreus
Q1
O
F
1
Dongyang Wang, Dan He, Guangquan Li, Song Gao, Huiying Lv, Qiushi Shan, Li Wang ⁎
3 14 4 15 5 16 6 17 7 18
Article history: Received 15 November 2013 Received in revised form 13 January 2014 Accepted 13 January 2014 Available online xxxx
8 9 10 11 12 13
Keywords: Agrobacterium tumefaciens Filamentous fungus Aspergillus terreus T-DNA flanking sequences Transformation
a b s t r a c t
P
i n f o
Agrobacterium tumefaciens-mediated transformation (ATMT) has been widely used in various organisms. In the current study, we developed a simple and efficient system for genetic transformation of the filamentous fungus Aspergillus terreus using ATMT. The transformation protocol was optimized for certain parameters to rapidly generate a library of Transferred DNA (T-DNA) insertion mutants of A. terreus. The presence of mitotically stable hygromycin resistance gene (hph) integration in the genome was confirmed by PCR, and T-DNA flanking sequences were cloned by thermal asymmetric interlaced PCR. The successful construction of the mutant library demonstrated the utility of the ATMT approach for future forward and reverse genetic studies in this important fungus. © 2014 Published by Elsevier B.V.
D
a r t i c l e
T
E
2
R O
Department of Pathogenobiology, Jilin University Mycology Research Center, Key Laboratory of Pathobiology, Ministry of Education, College of Basic Medical Sciences, Jilin University, Changchun 130021, China
26 24 23
C E
1. Introduction
28 29
Aspergillus terreus is a common saprophytic, filamentous fungus that is widespread in the environment. A. terreus produces a spectrum of secondary metabolites, such as itaconic acid (Shimi and El Dein, 1962), butyrolactone (Nitta et al., 1983) and emodin (Fujii et al., 1982). Consequently, A. terreus has been used extensively in industry as a fermentation strain. Alberts et al. (1980) isolated lovastatin from cultures of A. terreus. Lovastatin is an active inhibitor of cholesterol synthesis with hypolipidemic effects, and has been widely used as an antilipemic agent. Additionally, A. terreus also causes opportunistic infection in immune-compromised individuals (Lass-Flörl et al., 2005). Baddley et al. (2003) found that the percentage of A. terreus isolates relative to those of other Aspergillus species was significantly increased in the clinical cases at their institution, and the A. terreus isolates were frequently resistant to antifungal drugs (Baddley et al., 2003). However, few studies have focused on mutation breeding, and metabolite and pathogenesis-related genes of A. terreus (Barrios-González et al., 2008; Varga et al., 2003; Tevz et al., 2010; Vinci et al., 1991; Gressler et al., 2011) because of the lack of efficient genetic methods to generate mutants in this organism. Agrobacterium tumefaciens is a gram negative plant pathogenic bacterium that causes crown gall in plants. A. tumefaciens is capable of
34 35 36 37 Q4 38 39 40 41 Q5 42 43 44 45 46 47 48
R
N C O
32 33
U
30 Q3 31
R
27
⁎ Corresponding author. Tel.: +86 431 85619486. E-mail address: [email protected] (L. Wang).
19 20 21 22
25
transferring a piece of its tumor-inducing (Ti) plasmid DNA into host cells, where it is integrated into the host chromosome and expressed. Ti plasmid vectors have been developed to introduce target DNA sequences into plants, mammalian cells and several species of fungi (Krysan et al., 1999; Kunik et al., 2001; Michielse et al., 2005). Insertional mutagenesis techniques are considered to be efficient tools to investigate fungal gene functions (Campoy et al., 2003; Rodríguez-Tovar et al., 2005). The A. tumefaciens-mediated transformation (ATMT) system has been used widely as an effective tool for insertional mutagenesis (De, Groot et al., 1998; Sugui et al., 2005; Zhang et al., 2011). Studies on Agrobacterium-mediated fungal transformation demonstrated that the ATMT system has several advantages. First, the T-DNA can be randomly inserted in the host genome, typically as a single copy, and is mitotic stable (Covert et al., 2001; Morioka et al., 2006). Second, Agrobacterium can transform intact cells, such as conidia, mycelium, or even fruiting bodies (Michielse et al., 2005), thereby eliminating the tedious process of protoplast preparation. Therefore, the ATMT system offers an efficient tool for random insertional mutagenesis. Here, we report the establishment of an ATMT system and an investigation into the important factors affecting the transformation frequency of A. terreus. The highly efficient transformation method enabled us to rapidly obtain a large number of T-DNA insertional mutants. The molecular analysis of the transformants showed that insertion site flanking sequences could be identified by thermal asymmetric interlaced PCR (TAIL-PCR).
0167-7012/$ – see front matter © 2014 Published by Elsevier B.V. http://dx.doi.org/10.1016/j.mimet.2014.01.007
Please cite this article as: Wang, D., et al., An efficient tool for random insertional mutagenesis: Agrobacterium tumefaciens-mediated transformation of the filamentous fungus Aspergillus terreus, J. Microbiol. Methods (2014), http://dx.doi.org/10.1016/j.mimet.2014.01.007
49 50 51 52 53 Q6 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74
2 t1:1 t1:1
D. Wang et al. / Journal of Microbiological Methods xxx (2014) xxx–xxx
Table 1 Primers used in this study. Primer name
Nucleotide sequence (5′ to 3′)
t1:1 t1:1 t1:1 t1:1 t1:1 t1:1 t1:1 t1:1 t1:1 t1:1 t1:1 t1:1
hph-r hph-f LB1 LB2 LB3 RB1 RB2 RB3 AD1 AD2 AD3 AD4
5′-CGACAGCGTCTCCGACCTGA-3′ 5′-CGCCCAAGCTGCATCATCGAA-3′ 5′-GGGTTCCTATAGGGTTTCGCTCATG-3′ 5′-CATGTGTTGAGCATATAAGAAACCCT-3′ 5′-GAATTAATTCGGCGTTAATTCAGT-3′ 5′-GGCACTGGCCGTCGTTTTACAAC-3′ 5′-AACGTCGTGACTGGGAAAACCCT-3′ 5′-CCCTTCCCAACAGTTGCGCA-3′ 5′-TGAGNAGTANCAGAGA-3′ 5′-AGTGNAGAANCAAAGG-3′ 5′-CATCGNCNGANACGAA-3′ 5′-CAAGCAAGCA-3′
t2:2
Co − AS
Co + AS
0* 15 ± 3
60 ± 12 315 ± 35
2. Materials and methods
76
2.1. Strains and plasmids
77 78
87
A. terreus was used as a recipient strain for transformation. The fungus was isolated from Jilin, Northeast China, and grown in Potato Dextrose Agar (PDA) at 25 °C and stored at −80 °C. A. tumefaciens strain AGL-1, harboring the binary vector pBHt1, was cultured at 28 °C in Lysogenic Broth (LB) medium. Vector pBHt1, carrying the bacterial hygromycin B phosphotransferase gene (hph) under the control of the Aspergillus nidulans trpC promoter, was used as a fungal selection marker (Mullins et al., 2001). Strain AGL-1 was kindly provided by Professor Zhonghua Wang (Fujian Agriculture and Forestry University). All strains were conserved at the Jilin University Mycology Research Center.
88
2.2. A. tumefaciens-mediated transformation
89
Before transformation, the minimum inhibitory concentration of hygromycin B for the wild-type strain of A. terreus was determined by transferring 100 μl 1 × 106 conidia/ml fungal cultures onto PDA plates supplemented with different concentrations of hygromycin B (0, 50, 100, 150, 200, 250 and 300 μg/ml).
90 91
C
E
98 99 100 101 102 103 Q7 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121
The stability of hygromycin B resistance was used to determine the mitotic stability of the A. terreus transformants (Figueiredo et al., 2010; Wang and Li, 2008). Twenty randomly selected transformants were cultured on PDA plates without hygromycin B for 7 d. Mycelia from the edge of the cultures were picked with a toothpick and grown on fresh PDA plates for another 7 d. After repeating this procedure five times, germinating mycelia from each transformant were transferred to PDA plates containing hygromycin B (200 μg/ml).
123
2.4. Molecular analysis of the transformants
131
Putative hygromycin B resistant transformants of A. terreus were cultured in potato dextrose broth (PDB) containing 200 μg/ml hygromycin B and 200 μM cefotaxime for 24 h at 25 °C with shaking (160 rpm). Mycelia were harvested by centrifugation at 12,000 rpm for 3 min, and their genomic DNA was extracted as previously described (Wang et al., 1998). PCR was performed using hygromycin phosphotransferase
132 133
U Q2
96 97
122
N
92 93
R
85 86
R
83 84
O
81 82
C
79 80
94 95
2.3. Mitotic stability of the transformants
T
75
D
Pre − AS Pre + AS
E
t2:2 t2:2
R O
Table 2 The effect of acetosyringone (AS) on the transformation efficiency of A. terreus. Pre: precultivation period; Co: co-cultivation period; +AS: the presence of AS; −AS: the absence of AS;* transformant numbers (average ± standard error).
P
t2:2 t2:2
O
F
t1:1
The transformation procedure was based on a previously described protocol (Michielse et al., 2008) with some modifications. Briefly, A. tumefaciens strain AGL-1 harboring pBHt1 was grown overnight in 10 ml of LB liquid medium supplemented with 20 μg/ml rifampicin and 100 μg/ml kanamycin at 28 °C, with shaking (200 rpm). A 1.5-ml sample of the culture was centrifuged at 2400 × g for 10 min and the pellets were resuspended at an optical density at 600 nm (OD600 nm) of 0.2–0.3 with induction medium (IM, described by Michielse et al., 2008) with 200 μM acetosyringone (AS) (IM + AS) or without AS (IM-AS) (Table 2). A. tumefaciens was then pre-cultured at 28 °C with gentle shaking at 160 rpm to an OD600 nm of 0.4, 0.6, 0.8 and 1.0 in IM(IM + AS) or (IM − AS). A. terreus was incubated on a PDA slide for 7 d at 25 °C to induce sporulation. The conidia were scraped off the fungal slide into 1 ml of saline and the cell concentration was determined using a hemocytometer. The conidia were then diluted to a final concentration of 105, 106 or 107 conidia/ml in saline. Sterile Hybond N+ Filters (0.45 μm pore, Amersham Pharmacia, USA) were placed on (IM + AS) or (IM − AS) plates, and the A tumefaciens cells were mixed with an equal volume of the conidial suspensions of A. terreus. A 100-μl sample of the mixture was pipetted onto the Hybond N+ Filters and the plates were incubated for varying lengths of time (24 h, 36 h, 48 h and 60 h) at different temperatures (22 °C, 25 °C and 28 °C) in the dark. The filters were then transferred to a selection medium (SM:PDA containing 200 μg/ml hygromycin B and 200 μM of cefotaxime) to select for A. terreus transformants while inhibiting the growth of A. tumefaciens. The plates were incubated for 3 d at 25 °C in the dark until colonies appeared.
Fig. 1. The effect of different temperatures on co-culture period on transformation frequency.
Please cite this article as: Wang, D., et al., An efficient tool for random insertional mutagenesis: Agrobacterium tumefaciens-mediated transformation of the filamentous fungus Aspergillus terreus, J. Microbiol. Methods (2014), http://dx.doi.org/10.1016/j.mimet.2014.01.007
124 125 126 127 128 129 130
134 135 136 137
3
F
D. Wang et al. / Journal of Microbiological Methods xxx (2014) xxx–xxx
149
3.1. The minimum inhibitory concentration of hygromycin B for A. terreus
150 151
154
The results suggested that the growth of A. terreus was completely inhibited on PDA medium containing ≥ 200 μg/ml hygromycin B. Therefore, 200 μg/ml of hygromycin B was considered the minimum inhibitory concentration of hygromycin B for the selection of A. terreus transformants in further experiments.
155
3.2. Optimization of conditions for ATMT of A. terreus
156 157 Q8
3.2.1. Co-cultivation time and temperature The co-cultivation time and temperature are critical factors in the transformation procedure. The optimal co-cultivation time and temperature vary according to different strains of Agrobacterium and hosts. To determine the optimal co-cultivation time and temperature for the ATMT of A. terreus, four different periods (24 h, 36 h, 48 h and 60 h) and three different temperatures (22 °C, 25 °C and 28 °C) were tested. Each temperature was tested for the four time periods (Fig. 1).
159 160 161 162 163
T
C
E
R
R
158
N C O
152 153
3.2.2. The addition of AS to A. tumefaciens pre-culture and co-culture periods The insertion of T-DNA into the host genome requires activation and high expression of the vir region genes on the Ti plasmid (Michielse et al., 2005). Transcription of the vir region genes was found to be silent when A. tumefaciens was grown in LB medium. The addition of AS or other phenolic compounds has been shown to induce the activation and high expression of vir region genes (Lai et al., 2006). While, AS was shown to be essential in the co-cultivation period for the transformation of most fungi, the addition of AS during the pre-culture of A. tumefaciens does not seem to be an absolute requirement. For example, experiments using Fusarium oxysporum and Magnaporthe grisea indicated that the omission of AS in the A. tumefaciens pre-culture led to a lower transformation frequency (Mullins et al., 2001; Rho et al., 2001). However, transformation of Hebeloma cylindrosporum showed no difference in frequency when AS was omitted from the pre-culture (Combier et al., 2003). The results show that when AS is absent from either the pre- or coculture period, a relatively low transformation efficiency resulted; when AS was absent from both pre- and co-culture periods, no transformants were obtained. It indicated that the addition of AS to the A. tumefaciens pre- and co-culture periods was essential for the transformation efficiency of A. terreus.
U
144 145
R O
3. Results and discussion
142 143
P
148
140 141
The results show that the transformation frequency of A. terreus using ATMT increased as the co-cultivation time increased. In addition, the transformation frequency was optimal at 25 °C compared to either 22 °C or 28 °C at each co-cultivation time. Therefore, for subsequent experiments we used a co-cultivation period of 48 h at 25 °C. The transformation efficiency reached more than 350 transformants per 106 conidia.
D
146 147
gene (hph) specific primers, hph-r and hph-f (Table 1), to detect the integration of T-DNA in the putative transformants (Dos et al., 2004). TAIL-PCR was performed to clone the T-DNA flanking sequences from A. terreus transformants. TAIL-PCR was performed as described previously (Zhang et al., 2011), primers' list in Table 1. Using these primer sets, T-DNA flanking sequences could be cloned and non-target products could be thermally controlled by one low-stringency PCR cycle, one high-stringency PCR cycle and one reduced-stringency PCR cycle (Mullins et al., 2001; Singer and Burke, 2003). Shenggong Co. Ltd. (Beijing, China) sequenced the reaction products.
E
138 139
O
Fig. 2. The effect of co-culture densities on transformation frequency. A1: A. terreus concentration 1 × 105 conidia/ml; A2: A. terreus concentration 1 × 106 conidia/ml; A3: A. terreus concentration 1 × 107 conidia/ml.
Fig. 3. The colony morphology of the wild-type and T-DNA insertional mutants of A. terreus. The wild-type host strain (WT) and mutant strains (Mut1 to Mut5) were inoculated onto PDA medium, and grown at 25 °C for 7 d. Images of the colonies are shown from the front view and the back view.
Please cite this article as: Wang, D., et al., An efficient tool for random insertional mutagenesis: Agrobacterium tumefaciens-mediated transformation of the filamentous fungus Aspergillus terreus, J. Microbiol. Methods (2014), http://dx.doi.org/10.1016/j.mimet.2014.01.007
164 165 166 167 168 169
170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192
D. Wang et al. / Journal of Microbiological Methods xxx (2014) xxx–xxx
F
4
201 202
3.3. Screening for phenotypic mutants
204 205
Mutants are valuable tools for both forward and reverse genetics. In our A. terreus transformation experiments, some phenotypic mutants of A. terreus were observed and cultured on PDA medium. As shown in Fig. 3, compared with the wild-type strain, Mut1 grew slowly and produced more pigment. Mut2 lost the capacity to produce pigment. Mut3 colony edges had more mycelia. Mut4 aerial hyphae grew vigorously and the colony surface was swollen. Mut5 colonies were folded. In addition to pigment production and other mutants showing changes in hyphae and conidial morphology, growth rate and conidial germination may also provide unique opportunities to study the biological characteristics of this organism. The A. terreus T-DNA insertional mutants obtained in our experiments may provide valuable research materials for future studies.
214 215 216
C
E
R
212 213
R
210 211
O
208 209
3.4. Mitotic stability of transformants
218 219
In other fungi, transformants have been reported to be relatively stable during growth under non-hygromycin B conditions (Leclerque et al., 2004; Zhong et al., 2007). This is an important feature of an effective mutagenesis system. After five subcultures in the absence of hygromycin B, all of our A. terreus transformants grew on PDA containing 200 μg/ml hygromycin B, suggesting that the hph gene was stably maintained in all the transformants (data not shown).
224 t3:3 t3:3
N
U
222 223
C
217
220 221
4. Conclusions
246
To the best of our knowledge, this is the first report documenting the development and optimization of an ATMT system for A. terreus. Using this protocol, we could rapidly obtain a large number of T-DNA insertional mutants, and the insertion site flanking sequences could be isolated by TAIL-PCR. The mutants displayed mitotic stability. Our results confirmed that ATMT is an efficient tool for insertional mutagenesis and subsequent identification of mutated genes in A. terreus.
247 248
Acknowledgment
254
Mut1 Mut2 Mut3 Mut4 Mut5
228 229 230 231 232 233 234 235 236 237 238 239 240 241 Q9 242 243 244 245
249 250 251 252 253
This research was supported by grants from the National Natural 255 Science Foundation of China (Project Nos. 81071334 and 81271802). 256 We thank the staff of Jilin University Mycology Research Center. 257
Table 3 Analysis of the T-DNA flanking sequences in the A. terreus transformants. Mut1 to Mut5 represent the five selected transformants; letters represent the T-DNA flanking sequences from the transformants and the nucleotides of the T-DNA borders from the LB (left border) and the RB (right border); hyphens represent the sequences between the LB and the RB; and ellipses represent the pBHt1 vector “backbone” sequences.
t3:3 t3:3 t3:3 t3:3 t3:3 t3:3
226 227
T
203
206 207
R O
199 200
To investigate the integration mode of T-DNA in the genome of A. terreus, 16 putative transformants were randomly selected for PCR analysis using the hph specific primers, hph-r and hph-f. In all of these mutants, an 800-bp specific fragment of the hph gene was amplified, indicating that T-DNA had been integrated into the chromosome of A. terreus (data not shown). One of the advantages of ATMT is that T-DNA tagged gene sequences can be generated. For example, several PCR-based methods, such as adapter ligation mediated PCR, inverse PCR and TAIL-PCR, have been described to isolate the T-DNA insertion site flanking sequences (Erster and Liscovitch, 2010; O'Malley et al., 2007; Singer and Burke, 2003). In our study, mutant (Mut1 to Mut5) T-DNA insertion site flanking sequences were amplified by TAIL-PCR (Fig. 4). Comparison of the pBHt1 plasmid backbone sequences and the TAIL-PCR data enabled us to obtain sequences from the A. terreus mutants, and localize the insertion sites in the A. terreus genome (Table 3). The phenotypes associated with these mutated genes will provide valuable material for further study. Our results indicated that T-DNA transfer and insertion could be performed in A. terreus and that T-DNA flanking sequences could be obtained by TAIL-PCR.
P
197 198
225
3.5. Molecular analysis of transformants
D
195 196
3.2.3. Ratio of A. tumefaciens and A. terreus The ratios of the bacterial and fungal mixtures during co-cultivation may have a considerable effect on the transformation efficiency (Michielse et al., 2008). In our study, A. tumefaciens cells in induction medium (IM) (OD600 nm = 0.4, 0.6, 0.8 and 1.0) were co-cultivated with various concentrations of A. terreus conidia (105, 106 and 107 conidia/ml). As shown in Fig. 2, the highest transformation frequency was observed with an A. tumefaciens density of OD600 nm = 0.8 and an A. terreus density of 1 × 106 conidia/ml represented the optimal balance to yield the highest transformation efficiency.
E
193 194
O
Fig. 4. Molecular analysis of Mut1 to Mut5 using TAIL-PCR. M: DNA molecular size marker. DL2000; Lanes 2–6: TAIL-PCR amplification of genomic region flanking the left border of T-DNA insertion site; Lanes 7–11: TAIL-PCR amplification of genomic region flanking the right border of T-DNA insertion site.
A. terreus
…
LB
T-DNA
RB
…
A. terreus
CTCACGTGACAGTGCGGCTT GGCTTAAGACGAGGACTCCG TCTAGGACCCTGTTACGTCG TCCGAGCACATGGAAATAGT CCGGCTCAACCAGGTTCCGC
… … … … …
TGGCAGGATATATTGTGGTGTAAACA TGGCAGGATATATTGTGGTGTAAACA TGGCAGGATATATTGTGGTGTAAACA TGGCAGGATATATTGTGGTGTAAACA TGGCAGGATATATTGTGGTGTAAACA
——————— ——————— ——————— ——————— ———————
GTAAACCTAAGAGAAAGAGCGTTTA GTAAACCTAAGAGAAAGAGCGTTTA GTAAACCTAAGAGAAAGAGCGTTTA GTAAACCTAAGAGAAAGAGCGTTTA GTAAACCTAAGAGAAAGAGCGTTTA
… … … … …
GGCCCACTAATCCGAAACTG CAGTCGCCCCATCCTGGCAA ATGTAGACGACTTCGGCCTC GAACCGGGAATGATGTAGCA GTCGGAAAGATAGTAGACTA
Please cite this article as: Wang, D., et al., An efficient tool for random insertional mutagenesis: Agrobacterium tumefaciens-mediated transformation of the filamentous fungus Aspergillus terreus, J. Microbiol. Methods (2014), http://dx.doi.org/10.1016/j.mimet.2014.01.007
D. Wang et al. / Journal of Microbiological Methods xxx (2014) xxx–xxx
F
O
R O
P
Alberts, A.W., Chen, J., Kuron, G., Hunt, V., Huff, J., Hoffman, C., et al., 1980. Mevinolin: a highly potent competitive inhibitor of hydroxymethyl-glutaryl-coenzyme A reductase and a cholesterol-lowering agent. Proc. Natl. Acad. Sci. U. S. A. 77, 3957–3961. Baddley, John W., Pappas, Peter G., Smith, Anita C., Moser, Stephen A., 2003. Epidemiology of Aspergillus terreus at a University Hospital. J. Clin. Microbiol. 41, 5525–5529. Barrios-González, J., Baños, J.G., Covarrubias, A.A., Garay-Arroyo, A., 2008. Lovastatin biosynthetic genes of Aspergillus terreus are expressed differentially in solid-state and in liquid submerged fermentation. Appl. Microbiol. Biotechnol. 79, 179–186. Campoy, S., Perez, F., Martin, J.F., Gutierrez, S., Liras, P., 2003. Stable transformants of the azaphilone pigment-producing Monascus purpureus obtained by protoplast transformation and Agrobacterium-mediated DNA transfer. Curr. Genet. 43, 447–452. Combier, J.P., Melayah, D., Raffier, C., Gay, G., Marmeisse, R., 2003. Agrobacterium tumefaciens-mediated transformation as a tool for insertional mutagenesis in the symbiotic ectomycorrhizal fungus Hebeloma cylindrosporum. FEMS Microbiol. Lett. 220, 141–148 (Mar 14). Covert, S.F., Kapoor, P., Lee, M., Briley, A., Nairn, C.J., 2001. Agrobacterium tumefaciensmediated transformation of Fusarium circinatum. Mycol. Res. 105, 259–264. De, G., M.J.A., Bundock, P., Hooykaas, P.J.J., Beijersbergen, A.G.M., 1998. Agrobacterium tumefaciens-mediated transformation of filamentous fungi. Nat. Biotechnol. 16, 839–842. Dos, R.M.C., Dos, R.M.C., Pelegrinelli Fungaro, M.H., Delgado Duarte, R.T., Furlaneto, L., Furlaneto, M.C., 2004. Agrobacterium tumefaciens-mediated genetic transformation of the entomopathogenic fungus Beauveria bassiana. J. Microbiol. Methods 58, 197–202. Erster, O., Liscovitch, M., 2010. A modified inverse PCR procedure for insertion, deletion, or replacement of a DNA fragment in a target sequence and its application in the ligand interaction scan method for generation of ligand-regulated proteins. Methods Mol. Biol. 634, 157–174. Figueiredo, J.G., Goulin, E.H., Tanaka, F., Stringari, D., Kava-Cordeiro, V., Galli-Terasawa, L.V., Staats, C.C., Schrank, A., Glienke, C., 2010. Agrobacterium tumefaciens-mediated transformation of Guignardia citricarpa. J. Microbiol. Methods 80, 143–147. Fujii, I., Ebizuka, Y., Sankawa, U., 1982. Partial purification and some properties of emodinO-methyl-transferase from (+)-geodin producing strain of Aspergillus terreus. Chem. Pharm. Bull. 30, 2283–2286. Gressler, M., Zaehle, C., Scherlach, K., Hertweck, C., Brock, M., 2011. Multifactorial induction of an orphan PKS-NRPS gene cluster in Aspergillus terreus. Chem. Biol. 18, 198–209 (25). Krysan, Patrick J., Young, Jeffery C., Sussman, Michael R., 1999. T-DNA insertional mutagenesis in Arabidopsis. Am. Soc. Plant Physiol. 11, 2283–2290. Kunik, T., Tz Wra, T., Kapulnik, Y., Gafni, Y., Dingwall, C., Citovsky, V., 2001. Genetic transformation of HeLa cells by Agrobacterium. Proc. Natl. Acad. Sci. U. S. A. 98, 1871–1876. Lai, E.M., Shih, H.W., Wen, S.R., Cheng, M.W., Hwang, H.H., Chiu, S.H., 2006. Proteomic analysis of Agrobacterium tumefaciens response to the Vir gene inducer acetosyringone. Proteomics 6, 4130–4136. Lass-Flörl, C., Griff, K., Mayr, A., Petzer, A., Gastl, G., Bonatti, H., Freund, M., Kropshofer, G., Dierich, M.P., Nachbaur, D., 2005. Epidemiology and outcome of infections due to Aspergillus terreus: 10-year single centre experience. Br. J. Haematol. 131, 201–207.
D
259 260 261 262 263 Q10 264 265 266 267 268 269 270 271 272 273 274 275 276 277 Q11 278 279 280 Q12 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 Q13 298 299 Q14 300 301 302 303 304 305 306 307
C
E
R
U
N C O
R
359
Leclerque, A., Wan, H., Abschutz, A., Chen, S., Mitina, G.V., Zimmermann, G., Schairer, H.U., 2004. Agrobacterium-mediated insertional mutagenesis (AIM) of the entomopathogenic fungus Beauveria bassiana. Curr. Genet. 45, 111–119. Michielse, C.B., Hooykaas, P.J., van den Hondel, C.A., Ram, A.F., 2005. Agrobacterium-mediated transformation as a tool for functional genomics in fungi. Curr. Genet. 48, 1–17. Michielse, C.B., Hooykaas, P.J., van den Hondel, C.A., Ram, A.F., 2008. Agrobacteriummediated transformation of the filamentous fungus Aspergillus awamori. Nat. Protoc. 3, 1671–1678. Morioka, L.R., Furlaneto, M.C., Bogas, A.C., Pompermayer, O.S., Duarte, R.T., Carneiro, M.L., Watanabe, M.A.E., Fungaro, M.H.P., 2006. Efficient genetic transformation system for the ochratoxigenic fungus Aspergillus carbonarius. Curr. Microbiol. 52, 469–472. Mullins, E.D., Chen, X., Romaine, P., Raina, R., Geiser, D.M., Kang, S., 2001. Agrobacteriummediated transformation of Fusarium oxysporum: an efficient tool for insertional mutagenesis and gene transfer. Phytopathology 91, 173–180. Nitta, K., Fujita, N., Yoshimura, T., Arai, K., Yama-moto, U., 1983. Metabolic products of Aspergillus terreus. IX. Biosynthesis of butyrolactone derivatives isolated from strain IFO 8835 and 4100. Chem. Pharm. Bull. 31, 1528–1533. O'Malley, R.C., Alonso, J.M., Kim, C.J., Leisse, T.J., Ecker, J.R., 2007. An adapter ligationmediated PCR method for high-throughput mapping of T-DNA inserts in the Arabidopsis genome. Nat. Protoc. 2, 2910–2917. Rho, H.S., Kang, S., Lee, Y.H., 2001. Agrobacterium tumefaciens-mediated transformation of the plant pathogenic fungus Magnaporthe grisea. Mol. Cells 12, 407–411. Rodríguez-Tovar, A.V., Ruiz-Medrano, R., Herrera-Martínez, A., Barrera-Figueroa, B.E., Hidalgo-Lara, M.E., Reyes-Márquez, B.E., Cabrera-Ponce, J.L., Valdéz, M., XoconostleCázares, B., 2005. Stable genetic transformation of the ectomycorrhizal fungus Pisolithus tinctorius. J. Microbiol. Methods 63, 45–54. Shimi, Ibrahim R., El Dein, Moustafa S. Nour, 1962. Biosynthesis of itaconic acid by Aspergillus terreus. Arch. Mikrobiol. 44, 181–188. Singer, T., Burke, E., 2003. High-throughput TAIL-PCR as a tool to identify DNA flanking insertions. Methods Mol. Biol. 236, 241–272. Sugui, Janyce A., Chang, Yun C., Kwon-Chung, K.J., 2005. Agrobacterium tumefaciensmediated transformation of Aspergillus fumigatus: an efficient tool for insertional mutagenesis and targeted gene disruption. Appl. Environ. Microbiol. 71 (4), 1798–1802. Tevz, G., Bencina, M., Legisa, M., 2010. Enhancing itaconic acid production by Aspergillus terreus. Appl. Microbiol. Biotechnol. 87, 1657–1664. Varga, J., Rigó, K., Kocsubé, S., Farkas, B., Pál, K., 2003. Diversity of polyketide synthase gene sequences in Aspergillus species. Res. Microbiol. 154, 593–600. Vinci, V.A., Hoerner, T.D., Coffman, A.D., Schimmel, T.G., Dabora, R.L., Kirpekar, A.C., Ruby, C.L., Stieber, R.W., 1991. Mutants of a lovastatin-hyperproducing Aspergillus terreus deficient in the production of sulochri. J. Ind. Microbiol. 8, 113–119. Wang, J., Li, H., 2008. Agrobacterium tumefaciens mediated genetic transformation of the phytopathogenic fungus Penicillium digitatum. J. Zhejiang Univ. Sci. 10, 823–828. Wang, L., Yokoyama, K., Miyaji, M., Nishimura, K., 1998. The identification and phylogenetic relationship of pathogenic species of Aspergillus based on the mitochondrial cytochrome b gene. Med. Mycol. 36, 153–164. Zhang, Y., Li, G., He, D., Yu, B., Yokoyama, K., Wang, L., 2011. Efficient insertional mutagenesis system for the dimorphic pathogenic fungus Sporothrix schenckii using Agrobacterium tumefaciens. J. Microbiol. Methods 84, 418–422. Zhong, Y.H., Wang, X.L., Wang, T.H., Jiang, Q., 2007. Agrobacterium-mediated transformation (AMT) of Trichoderma reesei as an efficient tool for random insertional mutagenesis. Appl. Microbiol. Biotechnol. 73, 1348–1354.
E
References
T
258
5
Please cite this article as: Wang, D., et al., An efficient tool for random insertional mutagenesis: Agrobacterium tumefaciens-mediated transformation of the filamentous fungus Aspergillus terreus, J. Microbiol. Methods (2014), http://dx.doi.org/10.1016/j.mimet.2014.01.007
308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 Q15 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358