Characterization of the human PAP1 gene and its homologue possible involvement in mouse embryonic development

Colloids and Surfaces B: Biointerfaces 52 (2006) 22–30

Characterization of the human PAP1 gene and its homologue possible involvement in mouse embryonic development Kun-Xian Shu a,b , Li-Xiang Wu a,∗ , Yong-Fang Xie b , Jin-Feng Zhao a , Yi-Long Liang b , Biao Li b b

a Xiangya School of Medicine, Central South University, Changsha 410065, China College of Bioinformation, Chongqing University of Posts and Telecommunications, Chongqing 400065, China

Received 16 February 2006; received in revised form 1 May 2006; accepted 28 May 2006 Available online 3 June 2006

Abstract We have identified PAP1 gene, a novel member of the immunoglobulin superfamily (IGSF) from U251-pTet-p53 cell line, which carried a wild-type p53 transgene. The gene has been localised to chromosome 16p12-13. Alignment of the predicted protein sequence for Human, Pan troglodytes, Canis, Mus musculus and Gallus gallus revealed it was highly conserved. Its homologue, IGSF6, possible involves in mouse embryonic development. The presence of IGSF6 specific transcript was detected by Northern blot in the RNAs extracted from 11 to 14 day postconception. IGSF6 expression is different in mouse embryos of the different ages. In situ hybridization performed on mice embryos sections showed the differential presence of IGSF6 in developing lung and kidney. This structure and differential expression suggests a function involvement in embryonic development, perhaps involvement in cell proliferation. © 2006 Elsevier B.V. All rights reserved. Keywords: PAP1; Immunoglobulin superfamily 6 (IGSF6); Gene expression; Embryonic development

1. Introduction The function of the p53 protein has proven to be much more intricate than anticipated by most scientists. p53 is a key tumor suppressor that plays a critical role in coordinating the response of cells to a diverse range of stress conditions, e.g. oncogenic activation, hypoxia or DNA damage. p53 functions primarily as a transcription factor and can mediate its different downstream functions by activating or repressing a large number of target genes [1–5]. Positive and negative feedback mechanisms by downstream genes were also reported [6–8]. Several human p53 downstream genes have been identified. These include p21/WAF1, mdm2, bax, gadd45, PCNA, IGFBP3, etc. [6–10]. Although the number of identified p53 downstream genes keeps growing, it is conceivable that large fraction of p53 downstream genes have not been identified. It is very important to identify biologically important genes transcriptionally regulated by p53, which can help us to understand p53 gene regulatory network. ∗

Corresponding author. Tel.: +86 731 2355053. E-mail addresses: [email protected] (K.-X. Shu), [email protected], [email protected] (L.-X. Wu). 0927-7765/$ – see front matter © 2006 Elsevier B.V. All rights reserved. doi:10.1016/j.colsurfb.2006.05.021

For screening p53 downstream genes, we established a cell line U251-pTet-p53 carrying a wild-type p53 transgene that is inducible under the control of the tetracycline-response element (TRE). Induction of this transgene by doxycycline (Dox) arrests mRNAs isolated from this cell line, and looked for genes whose expression was activated or suppressed after induction of wildtype p53 [11,12]. By applying this approach, we have cloned a human cDNA, PAP1 (GenBank accession number: AF497245) for P53 Activated Protein 1 which encodes a novel member of the immunoglobulin-like superfamily. The localization of PAP1 to chromosome 16p12-13. In this locus, Bates reported the immunoglobulin superfamily 6 gene (IGSF6)/down-regulated by activation encodes a protein belonging to the CD8 family of receptors (DORA), which has been investigated as a positional and functional candidate for inflammatory bowel disease (IBD) susceptibility. A homologue has been described in rat, which exhibits a high degree of conservation with the human molecule [13–15]. In this report, we isolated a novel gene, PAP1, analyzed its structure, investigated its functions according to a rat homologue, IGSF6 gene. The mouse IGSF6 mRNA is specifically expressed in lung and kidney in the adult mouse. Moreover,

K.-X. Shu et al. / Colloids and Surfaces B: Biointerfaces 52 (2006) 22–30

23

Fig. 1. The nucleotide sequence of PAP1. The nucleotide sequence was shown with its corresponding translated protein sequence (predicted). This sequence has been deposited in the GenBank database with the accession number AF497245.

the expression of this novel gene was observed in lung and kidney primordium or developing lung and kidney in embryonic mouse tissues in vivo. Thus, a possible protein, which belongs to the CD8 family of receptors, encoded by the PAP1 gene may play an important role in mouse embryonic development.

ferent stages (11-day-postconception (dpc), 12, 13 and 14-dpc). Embryos were fixed in 4% (w/v) paraformaldehyde, embedded in paraffin and 5 ␮m sections were prepared [16].

2. Materials and methods

2.1.2. Genome data The Human genome data (Organism: Homo sapiens, NCBI Build Number: 35. Version:1. Release date: 26 August 2004) from NCBI (ftp://ftp.ncbi.nlm.nih.gov/genomes/H sapiens/).

2.1. Materials

2.2. Methods

2.1.1. Animals Kunming mice embryos were used for the experiments. For determination of the age of the embryos, the morning after vaginal plug formation was considered as day 0 of embryonic development. Females were sacrificed to collect embryos at dif-

2.2.1. Cell lines and cell culture The U251 human brain glioma cell line was maintained in RPMI1640 (Gibco) containing 10% fetal bovine serum (FBS). U251-pTet-p53 cells were maintained in complete culture medium containing RPMI1640, 10% FBS, G418

24

K.-X. Shu et al. / Colloids and Surfaces B: Biointerfaces 52 (2006) 22–30

Fig. 2. PAP1 belong to CD8 family of immunoglobulin-like receptors. Alignment of PAP1, DREV1, CD4, and TCRα,β,γ showed common conserved features.

(100 mg mL−1 ) and hygromycin (100 mg mL−1 ). All the cells cultured at 37 ◦ C and 5% CO2 ) [11,12]. To induce p53 expression, Dox was added to the medium every 2 days to a final concentration of 2 ␮g mL−1 (i.e., Dox+). To maintain U251pTet-p53 cells in a repressed state with respect to p53 expression, U251-p53 cells were first rinsed three times with PBS (without Ca2+ or Mg2+ ) and then switched to culture media lacking Dox (i.e., Dox−).

2.2.2. RNA isolation and differential display Total RNA from cells was isolated by using Trizol (Invitrogen). Samples were treated with RNase-free DNase, Extraction procedure [16–18] was performed according to the manufacturer’s instructions. Differential display has been previously described [12]. 2.2.3. Northern blot analysis The integrity of the RNA was tested through the presence of the ribosomal species in formaldehyde denaturing gels. Northern blot analysis using 30 mg of RNA in each lane was performed on 1% agarose/formaldehyde gels and transferred to membrane. Prehybridization, hybridization, and washings were performed according to the conditions suggested by the supplier. The membrane was exposed on X-ray film. PAP1 cDNA fragment was labeled using a random primer labeling kit (Gibco BRL). 2.2.4. Chromosomal localization Chromosomal localization was performed with the NCBI electronic PCR program (http://www.ncbi.nlm.nih.gov). PCR were using oligonucleotides, forward AAGAGGGTCTGTGTTCACAATTA, and reverse GAGTGTGACCTGCATTGGAGAGT.

Fig. 3. PAP1 gene is localised to human chromosome 16p12-13.

2.2.5. Alignment analysis Clustal W (1.82) software (http://www.ebi.ac.uk/clustalw) was used to analyze sequences. Comparisons against the GenBank databases were using the BLAST algorithm (http://www.ncbi.nlm.nih.gov/BLAST/). All noncommercial software used in studies was written in Perl 5.8.4.

K.-X. Shu et al. / Colloids and Surfaces B: Biointerfaces 52 (2006) 22–30

25

Fig. 4. Multiple sequence alignment. Partial alignments showing the most significant homology are detailed here. Human DREV sequence has been deposed in the GenBank database under the accession number NP 057109.2. Mouse IGSF sequence has been deposed in the GenBank database under the accession number NP 067529.2. Accession numbers for the aligned sequences are as follows: Pan troglodytes, XP 510871.1; Canis, XP 536936.2; Gallus gallus CAG31067.1.

2.2.6. TUNEL To detect apoptotic cells, the TUNEL method was performed using the “In Situ Cell Death Detection Kit-POD”(Roche Diagnostics GmbH). The sections were incubated with TdT and fluorescein dUTP without proteinase K pretreatment. After PBS rinsing, anti-fluorescein-peroxidase antibody was applied, and the reaction was visualized by 3,3 -diaminobenzidine (DAB) (Sigma). Sections were counterstained with hematoxylin. Negative control sections were incubated with distilled water in the absence of TdT [19]. Fig. 5. Northern blot analysis of total RNA (15 mg) isolated from whole uterus of nonpregnant mice at estrus (1) and 10-dpc (2), 11-dpc (3), 12-dpc (4), 13dpc (5), 14-dpc (6) mouse embryos. The top panel shows the IGSF6 signal was detected; the lower panel shows that detected by the ␤-actin probe on the same membrane.

2.2.7. Immunohistochemistry To examine proliferation, sections were incubated with antiPCNA monoclonal antibody, a marker of proliferating cells, followed by biotinylated rabbit anti-mouse polyclonal anti-

Table 1 The proliferative index (PI) and the apoptotic index (AI) in lung and kidney at different phases Phase

11-dpc

PI in lung PI in kidney AI in lung AI in kidney

0.1826 0.1450 0.1208 0.4721

12-dpc ± ± ± ±

0.0213 0.0123 0.0216 0.0213

0.3765 0.2314 0.1804 0.6514

13-dpc ± ± ± ±

0.0615 0.0141 0.0325 0.0121

Note: by χ2 -test, PI and AI of the groups have significant differences from each other (P < 0.01).

0.2367 0.5423 0.2328 0.1711

14-dpc ± ± ± ±

0.0268 0.0213 0.0198 0.0331

0.2961 0.4213 0.2713 0.2555

± ± ± ±

0.0043 0.0225 0.0294 0.0143

26

K.-X. Shu et al. / Colloids and Surfaces B: Biointerfaces 52 (2006) 22–30

Fig. 6. TUNEL staining. (A) Rare TUNEL positive cell in the 11-dpc embryonic lung. (B) In the 12-dpc embryonic lung, TUNEL positive cells are identified (arrowhead). (C) In the 13-dpc embryonic lung, many cells showed TUNEL positivity. (D) In the 14-dpc embryonic lung, more cells than in the 13-dpc showed TUNEL positivity. Magnification: 400×.

Fig. 7. Apoptotic index (AI) of embryonic cells. Asterisk (*) denotes significance of P < 0.01.

body. Sections were then incubated with streptavidin–biotin– peroxidase complex and visualized by 3-amino-9-ethylcarbazol substrate. Hematoxylin was used for counterstaining. Negative control sections were incubated with PBS in the absence of primary antibody [19].

2.2.8. Quantification of apoptotic index, quantification of proliferative index and statistical analysis The apoptotic index (AI) was determined by calculating the percentage of TUNEL positive cells per animal using the following method. Five sections were randomly chosen for each embryo. Approximately 1000 cell nuclei from each cell population were counted for each section at 400× magnification, and the number of apoptotic nuclei is expressed as percentage of the total. Quantification of the proliferative index (PI) was carried out as explained above instead that cell nuclei were stained with PCNA antibody. The data values were presented as mean value ± standard deviation (S.D.). The differences were considered to be statistically significant if P < 0.05 [19]. 2.2.9. In situ hybridization The specific cDNA sequence of the human PAP1 homologue in mouse, IGSF6 (GeneBank Accession No: NM021554)

Fig. 8. PCNA staining. (A) A few PCNA positive cells were seen in the 11-dpc embryonic lung (arrowheads). (B) In the 12-dpc embryonic lung, more cells are showed PCNA positivity (arrowheads). (C) Many PCNA positive were detected in the 13-dpc embryonic lung (arrowheads). (D) In the 14-dpc embryonic lung, more cells than in the 13-dpc showed PCNA positivity. Magnification: 400×.

K.-X. Shu et al. / Colloids and Surfaces B: Biointerfaces 52 (2006) 22–30

27

3. Results 3.1. PAP1 gene encodes a novel member of the immunoglobulin superfamily

Fig. 9. Proliferative index (PI) of embryonic cells. Asterisk (*) denotes significance of P < 0.01.

was cloned. Antisense DIG labeled riboprobe was synthesis using a DIG RNA labeling kit (Roche Diagnostics), and the concentrations were determined according to the manufacturer’s instructions. In order to show the specificity of the probe, unlabeled antisense riboprobe was also generated and applied together with the DIG labeled probe for competition as controls. Paraffin sections were deparaffinized in xylene, rehydrated through a graded series of ethanol from absolute ethanol to 30% ethanol and finally washed in PBS. The sections were then digested with proteinase K, rinsed in 0.1 M triethanolamine and acetylated in 0.25% acetic anhydride. Prehybridization was performed by incubating sections with 50% formamide with 4× SSC for 1 h at 50 ◦ C. Hybridization was performed overnight at 50 ◦ C in a humidified chamber with either DIG labeled antisense probe alone or 1:20 DIG labeled antisense to unlabeled antisense probe for competition. Hybridized sections were then washed with 1× SSC. Excess probe was removed by digestion with RNase A. Sections were finally washed sequentially with 1×, 0.5×, and 0.1× SSC at 50 ◦ C. Hybridized probes were detected with alkaline phosphatase conjugated anti-DIG antibody (Roche diagnostics) and visualized the positive purple signals by NBT/BCIP (Sigma). The sections were counterstained with methyl green, dehydrated in a graded ethanol series and mounted with Permount (Fisher Scientific) [16].

We compared the random primer PCR products of cDNA induced with no-induced in U251-pTet-p53 cells, a 480 bp of differential expressed cDNA [12]. RACE allowed us to extend the 5 and 3 sequence to a final 2779 bp, which we consider to be the correct start codon (Fig. 1). The encoded protein belong to CD8 family of immunoglobulin-like (Fig. 2). The NCBI electronic PCR program was used to localise the cDNA to chromosome 16p13-12, the closest marker is RH41956 (Fig. 3) and has the some region with DREV1. 3.2. The aligned sequences of the IGSF6 family On analysis with GenBank nt, PAP1 contig was found to be highly similar to DERV (GenBank accession number NM 016025.2). And its mouse homologue (GenBank accession number NM 021554.2) was also found. Interesting, a family of proteins related to PAP1 was detected in many species. We compared the proteins of human PAP1, human DERV, and the homologue of mouse (GenBank accession number NP 067529.2), Pan troglodytes (GenBank accession number XP 510871.1), Canis (GenBank accession number XP 536936.2), Gallus gallus (GenBank accession number CAG31067.1). The alignments showed the most significant homology (Fig. 4). This indicates long evolutionary conservation of this gene, and possibly a housekeeping function. 3.3. Expression of IGSF6 m RNA in developing lung and kidney 3.3.1. Northern blot analysis We studied the expression pattern the homologue of PAP1 during mouse embryonic development. Uteri of nonpregnant mice at estrus (NP) and 10, 11, 12, 13 and 14-dpc mouse embryos have been explanted. Total RNA was extracted from uterus as well as from 10, 11, 12, 13 and 14-dpc embryos. The presence

Fig. 10. TUNEL staining. (A): Rare TUNEL positive cell in the 11-dpc embryonic kidney. (B) In the 12-dpc embryonic kidney, TUNEL positive cells are identified (arrowhead). (C) In the 13-dpc embryonic kidney, many cells showed TUNEL positivity. (D) In the 14-dpc embryonic kidney, many cells showed TUNEL positivity, too, but it was less than 13-dpc. Magnification: 400×.

28

K.-X. Shu et al. / Colloids and Surfaces B: Biointerfaces 52 (2006) 22–30

Fig. 11. PCNA staining. (A) A few PCNA positive cells were seen in the 11-dpc embryonic kidney (arrowheads). (B) In the 12-dpc embryonic kidney, more cells are showed PCNA positivity (arrowheads). (C) Many PCNA positive were detected in the 13-dpc embryonic kidney (arrowheads). (D) In the 14-dpc embryonic kidney, more cells showed PCNA positivity but weaker than in the 13-dpc. Magnification: 400×.

of IGSF6 specific transcript was detected by Northern blot in the RNAs extracted from 11, 12, 13 and 14-dpc, as shown in Fig. 5 (top). IGSF6 expression is different in mouse embryos of the different ages. 3.3.2. Apoptosis and proliferation analysis of mouse embryonic development The embryo development is a process of cell proliferation, differentiation and apoptosis. It is very valuable to study the cell proliferation, differentiation and apoptosis of mice embryo for embryo development and cell cycle regulation. In this report, we explored the dynamic trends of the cell proliferation, apoptosis, and the expression of involved genes as IGSF6. In situ hybridization and TUNEL techniques were adopted to observe

the variation of the cell proliferation, apoptosis and the expression of IGSF6 in the development of mice lung and kidney. In the process of developing lung, apoptotic activity was seen to increase from 11- to 14-dpc. In 14-dpc, apoptotic activity was the greatest (Table 1 and Figs. 6 and 7). However, the proliferation index increased rapidly from 11- to 12-dpc, afterwards there was a decrease in 13-dpc, then higher proliferation was observed in 14-dpc (Table 1 and Figs. 8 and 9). In the process of developing kidney, apoptotic activity was similar to lung. But in 13-dpc, there was a rapidly decrease (Table 1 and Figs. 7 and 10). The proliferation index increased rapidly from 11- to 13-dpc, and the highest PI was observed in 13-dpc while the AI was the lowest. Afterwards there was a decrease (Table 1 and Figs. 9 and 11).

Fig. 12. Messenger RNA expression of IGSF6 during development of the mouse lung: (A) 11-dpc, (B) 12-dpc, (C) 13-dpc, and (D) 14-dpc mouse embryonic lung. (A) No positive signal was observed in the 11-dpc embryonic lung. (B) The small regions in epithelia showed a signal in the 12-dpc embryonic lung (arrowhead). (C) A strong signal was observed in the 13-dpc embryonic lung (arrowhead). (D) A signal was observed widely in the 14-dpc embryonic lung (arrowhead) (240×).

K.-X. Shu et al. / Colloids and Surfaces B: Biointerfaces 52 (2006) 22–30

29

Fig. 13. Messenger RNA expression of IGSF6 during development of the mouse kidney: (A) 11-dpc, (B) 12-dpc, (C) 13-dpc, and (D) 14-dpc mouse embryonic kidney. (A) No positive signal was observed in the 11-dpc embryonic kidney. (B) The small regions in epithelia showed a signal in the 12-dpc embryonic kidney (arrowhead). (C) A strong signal was observed in the 13-dpc embryonic kidney (arrowhead). (D) A signal was observed widely in the 14-dpc embryonic kidney, but it was weaker than 13-dpc and mainly showed in epithelia (arrowhead) (240×).

3.3.3. In situ hybridization analysis of IGSF6 in mouse embryonic development The lung from a 11-dpc embryo did not show any signal of IGSF6 by in situ hybridization (Fig. 12A). In the 12-dpc embryo, IGSF6 expression was observed specifically in epithelia of the developing lung (Fig. 12B). No significant signal for IGSF6 was detected in any other structure in the lung. In the 13-dpc embryonic lung, a strong signal was observed in the region of the developing lung (Fig. 12C). In the 14-dpc embryonic lung, a strong signal was observed, too, but it was more widely (Fig. 12D). The expression of IGSF6 in the kidney was similar to lung. The kidney from a 11-dpc embryo did not show any signal of IGSF6 by in situ hybridization (Fig. 13A). The small regions in epithelia showed a signal of IGSF6 in the 12-dpc embryonic kidney (Fig. 13B). In the 13-dpc embryonic lung, a strong signal was observed in the embryonic kidney (Fig. 13C). In the 14dpc embryonic kidney, a strong signal was observed widely, but it was weaker than 13-dpc and mainly showed in epithelia (Fig. 13D). 4. Discussion 4.1. PAP1 gene may be the same gene to IGSF6/DORA Bates et al. [13,14] characterized IGSF6 (DORA), a novel member of the immunoglobulin superfamily (IGSF) from human and rat expressed in dendritic and myeloid cells. The genes span 10 kbp (mouse) and 12 kbp (human), with six exons arranged in a manner similar to other members of IGSF, and has been localised to chromosome 16. They predicted that hDORA gene might encode DORA reverse strand protein 1 (DREV1). We characterized the PAP1 cDNA sequence, the NCBI electronic

PCR program was used to localise the cDNA to chromosome 16p13-12, the closest marker is RH41956 and has the some region with IGSF6. On analysis with GenBank nt, PAP1 contig was found to be highly similar to DREV1. Therefore, we think PAP1 gene may be the same gene to IGSF6/DORA. 4.2. PAP1/IGSF6/DORA gene possible involves in embryonic development The expression of the human DORA cDNA was studied in detail. Northern blot analysis revealed 1.0 and 2.5 kbp mRNAs in peripheral blood lymphocytes, spleen and lymph node, while low levels were observed in thymus, appendix, bone marrow and fetal liver. No signal was noted in non-immune system tissues. By RT-PCR analysis of hDORA revealed expression in cells committed to the myeloid lineage but not in CD34+ precursors or B cells and low expression in T cells. Expression was also observed in DC, purified ex vivo or generated in vitro from either monocytes or CD34+ progenitors. In situ hybridization performed on tonsil sections showed the presence of hDORA in cells within Germinal Centers. This suggests a function as a co-receptor, perhaps in an antigen uptake complex, or in homing or recirculation of DC [13]. The human and mouse IGSF6 gene has been investigated as a positional and functional candidate for inflammatory bowel disease (IBD) susceptibility [14,15]. In this study, we cloned the human PAP1 gene and investigated its homologue, IGSF6 gene expression in the developing mouse embryos (mainly developing lung and kidney). Expression of IGSF6 was first detected in the 12-dpc embryonic lung and. However, it was impossible to distinguish morphologically a particular cell type expressing mRNA at this stage. In the 13dpc embryonic lung and kidney, a strong signal was observed. A signal was observed widely in the 14-dpc embryonic lung, and

30

K.-X. Shu et al. / Colloids and Surfaces B: Biointerfaces 52 (2006) 22–30

a signal was observed widely in the 14-dpc embryonic kidney, too, but it was weaker than 13-dpc and mainly showed in epithelia (Figs. 12 and 13). In the meantime, the cell proliferation and apoptotic activity was detected (Figs. 6–11 and Table 1). Our in situ hybridization data indicate that mouse IGSF6 gene possible involves in embryonic development, perhaps involvement in cell proliferation.

[8]

[9]

[10]

Acknowledgements [11]

We thank Dr. Tan De-yong, who enabled us to establish the Tet-On Gene Expression System in our laboratory, and Dr. Shao Hong-Bo for the valuable comments and critical reading of the manuscript. This study has been supported by grants from National Natural Science Foundation of China (No. 30000084 and No. 39960030), Natural Science Foundation of Chongqing, China (CSTC 2005 BB1094), and Youth Scientific & Technological Foundation of Chongqing University of Posts and Telecomunications, China (No. A2005-22, No. A2004-23 and No. A2003-65).

[12]

[13]

[14]

[15]

References [1] K.H. Vousden, X. Lu, Live or let die: the cell’s response to p53, Nat. Rev. Cancer 2 (8) (2002) 594–604. [2] S. Sengupta, C.C. Harris, p53: Traffic cop at the crossroads of DNA repair and recombination, Nat. Rev. Mol. Cell. Biol. 6 (1) (2005) 44–55. [3] A.M. Bode, Z.G. Dong, Post-translational modification of p53 in tumorigenesis, Nat. Rev. Cancer 4 (10) (2004) 793–805. [4] G. Selivanova, p53: fighting cancer, Curr. Cancer Drug Targets 4 (5) (2004) 385–402. [5] B. Vogelstein, D. Lane, A.J. Levine, Surfing the p53 Network, Nature 408 (6810) (2000) 307–310. [6] Y. Nakamura, Isolation of p53-target genes and their functional analysis, Cancer Sci. 95 (1) (2004) 7–11. [7] J.C. Bourdon, K. Fernandes, F. Murray-Zmijewski, G. Liu, A. Diot, D.P. Xirodimas, M.K. Saville, D.P. Lane, p53 isoforms can regu-

[16]

[17]

[18]

[19]

late p53 transcriptional activity, Genes Dev. 19 (18) (2005) 2122– 2137. J.M. Stommel, G.M. Wahl, A new twist in the feedback loop: stressactivated MDM2 destabilization is required for p53 activation, Cell Cycle 4 (3) (2005) 411–417. L.Q. Wang, Q. Wu, P. Qiu, et al., Analyses of p53 target genes in the human genome by bioinformatics and microarray approaches, J. Biol. Chem. 276 (47) (2001) 43604–43610. R. Zhao, K. Gish, M. Murphy, et al., Analysis of p53-regulated gene expression patterns using oligonucleotide arrays, Genes Dev. 14 (8) (2000) 981–993. K.X. Shu, H.P. song, J.F. Zhao, et al., Establishment of regulable cell line for the inducible expression of p53 gene, Hunan Yi Ke Da Xue Xue Bao 27 (3) (2002) 293–294. K.X. Shu, B. Li, Y.L. Liang, et al., Effects of exogenous p53 transfection on the gene expression in the human brain glioma cell line U251, Colloids Surf. B: Biointerf. 47 (2) (2006) 126–131. E.E. Bates, M.C. Dieu, O. Ravel, et al., CD40L activation of dendritic cells down-regulates DORA, a novel member of the immunoglobulin superfamily, Mol. Immunol. 35 (9) (1998) 513–524. E.E. Bates, A. Kissenpfening, C. Peronne, et al., The mousse and human IGSF6(DORA) genes map to the inflammatory lowel disease 1 locus and are embedded in an intron of a gene of unknown function, Immunogenetics 52 (2000) 112–120. K. King, A. Moody, S.A. Fisher, et al., Genetic variation in the IGSF6 gene and lack of association with inflammatory bowel disease, Eur. J. Immunogenet. 30 (3) (2003) 187–190. F.Y. Siu, M.H. Sham, B.C. Chow, Secretin, a known gastrointestinal peptide, is widely expressed during mouse embryonic development, Gene Express. Patterns 5 (2005) 445–451. W.Q. Liu, B.C. Wang, C.R. Duan, B. Li, A method for isolating functional RNA from callus of Dendrobium candidum contented rich polysaccharides, Colloids Surf. B: Biointerf. 42 (3) (2005) 259– 262. B.C. Wang, J. Zhang, B. Li, D.H. Wang, C.R. Duan, Study of mRNA expression of Arabidopsis thaliana under stimulation using modified differential display RT-PCR with silver staining, Colloids Surf. B: Biointerf. 40 (1) (2005) 31–34. B. Marina, M.U. Miranda, S. Valter, et al., Cell death and cell proliferation in mouse submandibular gland during early post-irradiation phase, Acta Med. Okayama 59 (4) (2005) 153–159.