- Email: [email protected]
Cloning and Characterization of a Putative Human d -2-Hydroxyacid Dehydrogenase in Chromosome 9q
Biochemical and Biophysical Research Communications 268, 298 –301 (2000) doi:10.1006/bbrc.2000.2122, available online at http://www.idealibrary.com on
Cloning and Characterization of a Putative Human D-2-Hydroxyacid Dehydrogenase in Chromosome 9q Taosheng Huang,* Wenxue Yang,† Alexander C. Pereira,‡ William J. Craigen,§ and Vivian E. Shih† ,1 *Division of Genetics and Metabolism, Children’s Hospital, Harvard Medical School, Boston, Massachusetts; †Amino Acid Disorder Laboratory, Neurology and Pediatrics Services, Massachusetts General Hospital, Harvard Medical School, Boston Massachusetts; ‡Laboratorio de Genetica e Cardiologia Molecular Instituto do Coracao, HC-FMUSP, Sao Paulo, Brazil; and §Departments of Molecular and Human Genetics and Pediatrics, Baylor College of Medicine, Houston, Texas
Received November 19, 1999
There is little information on D-isomer-specific dehydrogenases in humans. Identification of D-2-hydroxyglutaric aciduria, an inherited metabolic disorder associated with severe neurological dysfunction, highlights the role of D-isomers in human metabolism. The possibility of a defect in D-2-hydroxyglutarate dehydrogenation prompted us to employ E. coli D-2-hydroxyacid dehydrogenase cDNA to search the human expressed sequence tags database. Two human EST homologues were retrieved and sequenced. Analysis showed the two clones were identical with 1258 nucleotides encoding 248 amino acids of the putative human D-2-hydroxyacid dehydrogenase. It was highly homologous to bacterial D-2hydroxyacid dehydrogenases (46%), D-phosphoglycerate dehydrogenase (38%), and formate dehydrogenase (36%) at the amino acid level. The gene is expressed ubiquitously in tissue, most abundantly in liver, and was mapped to chromosome 9q between markers WI-3028 and WI-93330. To our knowledge this is the first cloning and characterization of the cDNA for a human D-isomer specific NADⴙ-dependent 2-hydroxyacid dehydrogenase. © 2000 Academic Press
There is very little information on D-isomer-specific dehydrogenases in humans, although both L- and Dspecific forms of 2-hydroxyacid dehydrogenase with different substrates have been documented in lower organisms. D-2-Hydroxyglutaric acid is present in minute amounts in normal urine and is increased in type II glutaric acidemia. (1). The source and further metabolism of this D-isomer of 2-hydroxyglutarate in humans is unknown. Identification of D-2-hydroxyglutaric aciduria as an inherited metabolic disorder associated with 1 To whom correspondence should be addressed at Amino Acid Disorder Laboratory, Massachusetts General Hospital, 149 Thirteenth Street, Boston, MA 02129.
0006-291X/00 $35.00 Copyright © 2000 by Academic Press All rights of reproduction in any form reserved.
severe neurological dysfunction highlights the role of D-isomers in human metabolism (2, 3). The metabolic defect in D-2-hydroxyglutaric aciduria, however, remains elusive. The possibility of a defect in D-2hydroxyglutarate dehydrogenation in this meatabolic disorder prompted us to employ E. coli D-2-hydroxyacid dehydrogenase (D-2-HADH) cDNA (4) (GenBank accession number: 3916009) to search the database of expressed sequence tags in humans. MATERIALS AND METHODS A number of human EST clones in the database (dbEST) (5) with significant homology to E. coli D-2-HADH were identified. Two cDNA clones, GenBank Accession No. AA199911 derived from human neuroepithelium and T72836 derived from human liver, were obtained from the Genetics Research Institute. These were constructed in the bluescript vector and carried in an E. coli host cell. Clones were selected on ampicillin-agar plates. A single colony was grown in ampicillin-LB overnight at 37°C. Plasmid DNA was purified using a plasmid Mini Kit (100) column (QIAGEN, Valencia, CA) and sequenced. The sequencing was carried out with T3 and T7 primers. The subsequent primers for sequencing reactions were designed based on the previous sequences. These two cDNA clones were sequenced to completion by an ABI autosequencer. The open reading frame was analyzed by DNAStar computer program (DNAStar, Inc., Madison, WI). The amino acid sequences forming a favorable open reading frame were used to blast the protein database. The homologue analysis was also carried out using DNAStar. The tissue expression pattern of this human homologue D-2-HADH was examined by Northern blot analysis using Human Multiple Tissue Northern Blot (Clonetech). The filter was hybridized to [␣- 32P]dCTPlabeled probe. Hybridization was performed overnight at 65°C in hybridization buffer (6). The filter was washed twice with 2⫻ SSC, 0.1% SDS for 30 min at room temperature, then washed with 0.1⫻ SSC, 0.1% SDS for an additional 30 min at 65°C. The filter was exposed to X-ray film overnight and an image was obtained in a Kodak film developer. To map the chromosome location of the human D-2-hydroxyacid dehydrogenase gene, we developed a sequence tagged site (STS) from the cDNA sequence (sense 5⬘-CAAGCTGTAGCCAAACAGTAGAGA3⬘, antisense: 5⬘-GGCGCAAATGTGTCCAACACCAAT-3⬘), which corresponds to a unique 179 bp fragment. This STS was used to map the gene on the GeneBridge 4 panel consisting of 93 hybrid DNAs
298
Vol. 268, No. 2, 2000
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 1. Partial cDNA sequences and deduced amino acid sequence of human HADH. The open reading frame starts at nucleotide 300 to 1046 nucleotide. (GenBank Accession No. AF113251).
(Research Genetics, Huntsville, AL). The panel was scored using the Radiation Hybrid server at the Whitehead Institute (www-genome. wi.mit.edu/cgibin/ contig/rhmapper.pl). Total RNA was isolated from fibroblasts using the Total Arrest RNA Kit (Geno Technology Inc.) according to the manufacturer’s instructions. Isolated RNA was resuspended in TE buffer and stored at ⫺80°C. RT-PCR and cDNA amplification were performed in a single tube. A total of 1–2 g RNA was added to a 50 L total reaction volume containing 10 mM Tris-HCl, 1.2 mM MgSO 4, 50 mM KCl, 1 L RT/Taq polymerase mix (Gibco Cat. No. 10928-018), 200 mM dNTP, and 0.2 mM sense and antisense primers corresponding to HADH cDNA (F1-1, GATGAGACCGGTGCGACTCATGAA; R3, CACAAACTCTGCCTGGAATTCCGC; F4, CTGTGTTCATCAACATCAGCAGGG; R1-1, GGCGCAAATGTGTCCAACACCAAT) permit-
FIG. 2. Northern blot analysis of tissue expression pattern of human HADH. Human Multiple Tissue Northern Blot purchased from Clonetech was hybridized to [␣- 32P]dCTP-labeled clone AA199911. The filter was washed, exposed to X-ray film overnight and the image was developed in a Kodak film developer. Molecular weight is labeled on the left. The different tissues are labeled on the top. Each lane contains 2 g RNA from the tissues.
ted amplification of the coding sequence. PCR reaction consisted of 50°C for 30 min and 94°C for 2 min followed by 35 cycles of 94°C for 1 min, 68°C for 1 min; 72°C for 3 min. The PCR products were approximately 450 bp and 600 bp, with primers F4/R1-1 and F1-1/ R3, respectively.
RESULTS AND DISCUSSION The DNA sequences revealed that the two EST clones AA199911 and T72836 are identical, with 1258
FIG. 3. The chromosomal location of human dehydrogenase gene.
299
D-2-hydroxyacid
Vol. 268, No. 2, 2000
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 4. Amino acid sequence alignment. The dot indicates amino acids identical to majority. HADH, D-isomer-specific hydroxyacid dehydrogenase; LDHD, D-lactate dehydrogenase; PGDH, D-3-phosphoglycerate dehydrogenase; FDH, formate dehydrogenase, DHGY, NADH dependent glycerate dehydrogenase; CTB2; C-terminal binding protein 2.
nucleotides encoding 248 amino acids of the putative human D-2-hydroxyacid dehydrogenase (Fig. 1). The initial codon for the open reading frame was preceded by a 5⬘ untranslated sequence of 299 nucleotides. The termination codon was followed by a 3⬘ untranslated sequence of 212 nucleotides and a poly(A) tail. The tissue expression studies showed that poly(A) RNA from human heart, brain, placenta, lung, liver, skeletal muscle, kidney, pancreas, and colon was detected with radiolabeled AA199911 cDNA (Fig. 2). A 1.3 kb transcript was detected in all tissues examined, suggesting that AA199911 is full-length and is expressed ubiquitously with the highest level of expression in liver. We mapped this gene to chromosome 9q between marker WI-3028 and WI-93330 (LOD score ⬎15.0) (Fig. 3). On the assumption that this cDNA we identified is the putative gene of a human D-2-hydroxyacid dehydrogenase, we sequenced the full length cDNA synthe-
sized from total RNA of two patients with D-2-hydroxyglutaric aciduria. Neither patient had any mutation in the coding sequence. In microorganisms, a family of NAD ⫹-dependent D-isomer specific-2-hydroxyacid dehydrogenases was identified by Grant in 1989 (7). These now include the dehydrogenases of D-lactate, D-2-hydroxy-4-methylvalerate, D-2-hydroxyisocaproate dehydrogenase, and D-3-phosphoglycerate (8). These D-2-hydroxyacid dehydrogenase have wide substrate specificity and several D-2-hydroxyacids can serve as substrate. Comparison of the deduced amino acid sequence of the putative cDNA we cloned with that of the cDNAs encoding the microbial enzymes in the D-2-hydroxyacid dehydrogenase family showed that our clone is highly homologous. A protein database blast revealed that the putative human D-2-hydroxyacid dehydrogenase was highly homologous to bacterial (E. coli) D-2-hydroxyacid dehydrogenase (46%), D-phosphoglycerate dehydrogenase
300
Vol. 268, No. 2, 2000
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
(38%) and formate dehydrogenase (36%) at the amino acid level (Fig. 4). It contains the consensus sequences of other D-2-hydroxyacid dehydrogenases (8). The sequence identity includes the following catalytically important residues: Arg235, His296, Asp200, Asn232, Cys225. Amino acids are numbered according to D-lactate dehydrogenase (8). These residues have been conserved in five dedydrogenases studied by Taguchi and Ohta (8). Our clone also has the consensus sequence of GXGXXG (X ⫽ any amino acid), which is the NAD ⫹ binding domain in close proximity to amino acids 152–157 in the D-2-hydroxyacid dehydrogenase (9). Comparison of the amino acid sequences of this putative human D-isomer-specific HADH demonstrated no similarity between with any L-isomer-specific dehydrogenase. However, it shares 46% with E. coli HADH, further suggesting that the L- and D-isomer-specific hydroxyacid dehydrogenases evolved from different ancestral molecules and function in different metabolic pathways (10). We believe that our data provides strong evidence that the cDNA we cloned belongs to the D-2-hydroxyacid dehydrogenase family. To our knowledge this is the first cloning and characterization of the cDNA for a human D-isomer specific NAD ⫹-dependent 2-hydroxyacid dehydrogenase. ACKNOWLEDGMENTS This work was supported in part by USPHS Grant NS05096. TH is partially supported by NIH/NIGMS grant T32GM07748. We are very
grateful to Roseann Mandell for preparing the manuscript. The GenBank Accession No. for HADH cDNA is AF113251. Note added in proof. A report on the gene encoding hydroxypyruvate reductase with D-isomer specific activity has just been published (11).
REFERENCES 1. Watanabe, H., Yamaguchi, S., Saiki, K., Shimizu, N., Fukao, T., Kondo, N., and Orii, T. (1995) Clin. Chim. Acta 238, 115–124. 2. Gibson, K. M., Craigen, W., Herman, G. E., and Jakobs, C. (1993) J. Inherit. Metab. Dis. 16, 497–500. 3. Craigen, W. J., Jakobs, C., Sekul, E. A., Levy, M. L., Gibson, K. M., Butler, I. J., and Herman, G. E. (1994) Pediatr. Neurol. 10(1), 49 –53. 4. Sofia, H. J., Burland, V., Daniels, D. L., Plunkett, G., and Blattner, F. R. (1994) Nucleic Acids Res. 22(13), 2576 –2586. 5. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., and Lipman, D. J. (1990) J. Mol. Biol. 215, 403– 410. 6. Sambrook, J., Fristh, E. F., and Maniatis, T. (1989) Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press. 7. Grant, G. A. (1989) Biochem. Biophys. Res. Commun. 165, 1371– 1374. 8. Taguchi, H., and Ohta, T. (1991) J. Biol. Chem. 266, 12588 – 12594. 9. Bernard, N., Johnsen, K., Gelpi, J. L., Alvarez, J. A., and Ferain, T., et al. (1997) Eur. J. Biochem. 244, 213–219. 10. Kochhar, S., Hunziker, P. E., Leong-Morgenthaler, P., and Hottinger, H. (1992) Biochem. Biophys. Res. Commun. 184, 60 – 66. 11. Cramer, S. D., Ferree, P. M., Lin, K., Milliner, D. S., and Holmes, R. P. (1999) Hum. Mol. Genet. 8, 2063–2069.
301
Cloning and Characterization of a Putative Human D-2-Hydroxyacid Dehydrogenase in Chromosome 9q Taosheng Huang,* Wenxue Yang,† Alexander C. Pereira,‡ William J. Craigen,§ and Vivian E. Shih† ,1 *Division of Genetics and Metabolism, Children’s Hospital, Harvard Medical School, Boston, Massachusetts; †Amino Acid Disorder Laboratory, Neurology and Pediatrics Services, Massachusetts General Hospital, Harvard Medical School, Boston Massachusetts; ‡Laboratorio de Genetica e Cardiologia Molecular Instituto do Coracao, HC-FMUSP, Sao Paulo, Brazil; and §Departments of Molecular and Human Genetics and Pediatrics, Baylor College of Medicine, Houston, Texas
Received November 19, 1999
There is little information on D-isomer-specific dehydrogenases in humans. Identification of D-2-hydroxyglutaric aciduria, an inherited metabolic disorder associated with severe neurological dysfunction, highlights the role of D-isomers in human metabolism. The possibility of a defect in D-2-hydroxyglutarate dehydrogenation prompted us to employ E. coli D-2-hydroxyacid dehydrogenase cDNA to search the human expressed sequence tags database. Two human EST homologues were retrieved and sequenced. Analysis showed the two clones were identical with 1258 nucleotides encoding 248 amino acids of the putative human D-2-hydroxyacid dehydrogenase. It was highly homologous to bacterial D-2hydroxyacid dehydrogenases (46%), D-phosphoglycerate dehydrogenase (38%), and formate dehydrogenase (36%) at the amino acid level. The gene is expressed ubiquitously in tissue, most abundantly in liver, and was mapped to chromosome 9q between markers WI-3028 and WI-93330. To our knowledge this is the first cloning and characterization of the cDNA for a human D-isomer specific NADⴙ-dependent 2-hydroxyacid dehydrogenase. © 2000 Academic Press
There is very little information on D-isomer-specific dehydrogenases in humans, although both L- and Dspecific forms of 2-hydroxyacid dehydrogenase with different substrates have been documented in lower organisms. D-2-Hydroxyglutaric acid is present in minute amounts in normal urine and is increased in type II glutaric acidemia. (1). The source and further metabolism of this D-isomer of 2-hydroxyglutarate in humans is unknown. Identification of D-2-hydroxyglutaric aciduria as an inherited metabolic disorder associated with 1 To whom correspondence should be addressed at Amino Acid Disorder Laboratory, Massachusetts General Hospital, 149 Thirteenth Street, Boston, MA 02129.
0006-291X/00 $35.00 Copyright © 2000 by Academic Press All rights of reproduction in any form reserved.
severe neurological dysfunction highlights the role of D-isomers in human metabolism (2, 3). The metabolic defect in D-2-hydroxyglutaric aciduria, however, remains elusive. The possibility of a defect in D-2hydroxyglutarate dehydrogenation in this meatabolic disorder prompted us to employ E. coli D-2-hydroxyacid dehydrogenase (D-2-HADH) cDNA (4) (GenBank accession number: 3916009) to search the database of expressed sequence tags in humans. MATERIALS AND METHODS A number of human EST clones in the database (dbEST) (5) with significant homology to E. coli D-2-HADH were identified. Two cDNA clones, GenBank Accession No. AA199911 derived from human neuroepithelium and T72836 derived from human liver, were obtained from the Genetics Research Institute. These were constructed in the bluescript vector and carried in an E. coli host cell. Clones were selected on ampicillin-agar plates. A single colony was grown in ampicillin-LB overnight at 37°C. Plasmid DNA was purified using a plasmid Mini Kit (100) column (QIAGEN, Valencia, CA) and sequenced. The sequencing was carried out with T3 and T7 primers. The subsequent primers for sequencing reactions were designed based on the previous sequences. These two cDNA clones were sequenced to completion by an ABI autosequencer. The open reading frame was analyzed by DNAStar computer program (DNAStar, Inc., Madison, WI). The amino acid sequences forming a favorable open reading frame were used to blast the protein database. The homologue analysis was also carried out using DNAStar. The tissue expression pattern of this human homologue D-2-HADH was examined by Northern blot analysis using Human Multiple Tissue Northern Blot (Clonetech). The filter was hybridized to [␣- 32P]dCTPlabeled probe. Hybridization was performed overnight at 65°C in hybridization buffer (6). The filter was washed twice with 2⫻ SSC, 0.1% SDS for 30 min at room temperature, then washed with 0.1⫻ SSC, 0.1% SDS for an additional 30 min at 65°C. The filter was exposed to X-ray film overnight and an image was obtained in a Kodak film developer. To map the chromosome location of the human D-2-hydroxyacid dehydrogenase gene, we developed a sequence tagged site (STS) from the cDNA sequence (sense 5⬘-CAAGCTGTAGCCAAACAGTAGAGA3⬘, antisense: 5⬘-GGCGCAAATGTGTCCAACACCAAT-3⬘), which corresponds to a unique 179 bp fragment. This STS was used to map the gene on the GeneBridge 4 panel consisting of 93 hybrid DNAs
298
Vol. 268, No. 2, 2000
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 1. Partial cDNA sequences and deduced amino acid sequence of human HADH. The open reading frame starts at nucleotide 300 to 1046 nucleotide. (GenBank Accession No. AF113251).
(Research Genetics, Huntsville, AL). The panel was scored using the Radiation Hybrid server at the Whitehead Institute (www-genome. wi.mit.edu/cgibin/ contig/rhmapper.pl). Total RNA was isolated from fibroblasts using the Total Arrest RNA Kit (Geno Technology Inc.) according to the manufacturer’s instructions. Isolated RNA was resuspended in TE buffer and stored at ⫺80°C. RT-PCR and cDNA amplification were performed in a single tube. A total of 1–2 g RNA was added to a 50 L total reaction volume containing 10 mM Tris-HCl, 1.2 mM MgSO 4, 50 mM KCl, 1 L RT/Taq polymerase mix (Gibco Cat. No. 10928-018), 200 mM dNTP, and 0.2 mM sense and antisense primers corresponding to HADH cDNA (F1-1, GATGAGACCGGTGCGACTCATGAA; R3, CACAAACTCTGCCTGGAATTCCGC; F4, CTGTGTTCATCAACATCAGCAGGG; R1-1, GGCGCAAATGTGTCCAACACCAAT) permit-
FIG. 2. Northern blot analysis of tissue expression pattern of human HADH. Human Multiple Tissue Northern Blot purchased from Clonetech was hybridized to [␣- 32P]dCTP-labeled clone AA199911. The filter was washed, exposed to X-ray film overnight and the image was developed in a Kodak film developer. Molecular weight is labeled on the left. The different tissues are labeled on the top. Each lane contains 2 g RNA from the tissues.
ted amplification of the coding sequence. PCR reaction consisted of 50°C for 30 min and 94°C for 2 min followed by 35 cycles of 94°C for 1 min, 68°C for 1 min; 72°C for 3 min. The PCR products were approximately 450 bp and 600 bp, with primers F4/R1-1 and F1-1/ R3, respectively.
RESULTS AND DISCUSSION The DNA sequences revealed that the two EST clones AA199911 and T72836 are identical, with 1258
FIG. 3. The chromosomal location of human dehydrogenase gene.
299
D-2-hydroxyacid
Vol. 268, No. 2, 2000
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 4. Amino acid sequence alignment. The dot indicates amino acids identical to majority. HADH, D-isomer-specific hydroxyacid dehydrogenase; LDHD, D-lactate dehydrogenase; PGDH, D-3-phosphoglycerate dehydrogenase; FDH, formate dehydrogenase, DHGY, NADH dependent glycerate dehydrogenase; CTB2; C-terminal binding protein 2.
nucleotides encoding 248 amino acids of the putative human D-2-hydroxyacid dehydrogenase (Fig. 1). The initial codon for the open reading frame was preceded by a 5⬘ untranslated sequence of 299 nucleotides. The termination codon was followed by a 3⬘ untranslated sequence of 212 nucleotides and a poly(A) tail. The tissue expression studies showed that poly(A) RNA from human heart, brain, placenta, lung, liver, skeletal muscle, kidney, pancreas, and colon was detected with radiolabeled AA199911 cDNA (Fig. 2). A 1.3 kb transcript was detected in all tissues examined, suggesting that AA199911 is full-length and is expressed ubiquitously with the highest level of expression in liver. We mapped this gene to chromosome 9q between marker WI-3028 and WI-93330 (LOD score ⬎15.0) (Fig. 3). On the assumption that this cDNA we identified is the putative gene of a human D-2-hydroxyacid dehydrogenase, we sequenced the full length cDNA synthe-
sized from total RNA of two patients with D-2-hydroxyglutaric aciduria. Neither patient had any mutation in the coding sequence. In microorganisms, a family of NAD ⫹-dependent D-isomer specific-2-hydroxyacid dehydrogenases was identified by Grant in 1989 (7). These now include the dehydrogenases of D-lactate, D-2-hydroxy-4-methylvalerate, D-2-hydroxyisocaproate dehydrogenase, and D-3-phosphoglycerate (8). These D-2-hydroxyacid dehydrogenase have wide substrate specificity and several D-2-hydroxyacids can serve as substrate. Comparison of the deduced amino acid sequence of the putative cDNA we cloned with that of the cDNAs encoding the microbial enzymes in the D-2-hydroxyacid dehydrogenase family showed that our clone is highly homologous. A protein database blast revealed that the putative human D-2-hydroxyacid dehydrogenase was highly homologous to bacterial (E. coli) D-2-hydroxyacid dehydrogenase (46%), D-phosphoglycerate dehydrogenase
300
Vol. 268, No. 2, 2000
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
(38%) and formate dehydrogenase (36%) at the amino acid level (Fig. 4). It contains the consensus sequences of other D-2-hydroxyacid dehydrogenases (8). The sequence identity includes the following catalytically important residues: Arg235, His296, Asp200, Asn232, Cys225. Amino acids are numbered according to D-lactate dehydrogenase (8). These residues have been conserved in five dedydrogenases studied by Taguchi and Ohta (8). Our clone also has the consensus sequence of GXGXXG (X ⫽ any amino acid), which is the NAD ⫹ binding domain in close proximity to amino acids 152–157 in the D-2-hydroxyacid dehydrogenase (9). Comparison of the amino acid sequences of this putative human D-isomer-specific HADH demonstrated no similarity between with any L-isomer-specific dehydrogenase. However, it shares 46% with E. coli HADH, further suggesting that the L- and D-isomer-specific hydroxyacid dehydrogenases evolved from different ancestral molecules and function in different metabolic pathways (10). We believe that our data provides strong evidence that the cDNA we cloned belongs to the D-2-hydroxyacid dehydrogenase family. To our knowledge this is the first cloning and characterization of the cDNA for a human D-isomer specific NAD ⫹-dependent 2-hydroxyacid dehydrogenase. ACKNOWLEDGMENTS This work was supported in part by USPHS Grant NS05096. TH is partially supported by NIH/NIGMS grant T32GM07748. We are very
grateful to Roseann Mandell for preparing the manuscript. The GenBank Accession No. for HADH cDNA is AF113251. Note added in proof. A report on the gene encoding hydroxypyruvate reductase with D-isomer specific activity has just been published (11).
REFERENCES 1. Watanabe, H., Yamaguchi, S., Saiki, K., Shimizu, N., Fukao, T., Kondo, N., and Orii, T. (1995) Clin. Chim. Acta 238, 115–124. 2. Gibson, K. M., Craigen, W., Herman, G. E., and Jakobs, C. (1993) J. Inherit. Metab. Dis. 16, 497–500. 3. Craigen, W. J., Jakobs, C., Sekul, E. A., Levy, M. L., Gibson, K. M., Butler, I. J., and Herman, G. E. (1994) Pediatr. Neurol. 10(1), 49 –53. 4. Sofia, H. J., Burland, V., Daniels, D. L., Plunkett, G., and Blattner, F. R. (1994) Nucleic Acids Res. 22(13), 2576 –2586. 5. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., and Lipman, D. J. (1990) J. Mol. Biol. 215, 403– 410. 6. Sambrook, J., Fristh, E. F., and Maniatis, T. (1989) Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press. 7. Grant, G. A. (1989) Biochem. Biophys. Res. Commun. 165, 1371– 1374. 8. Taguchi, H., and Ohta, T. (1991) J. Biol. Chem. 266, 12588 – 12594. 9. Bernard, N., Johnsen, K., Gelpi, J. L., Alvarez, J. A., and Ferain, T., et al. (1997) Eur. J. Biochem. 244, 213–219. 10. Kochhar, S., Hunziker, P. E., Leong-Morgenthaler, P., and Hottinger, H. (1992) Biochem. Biophys. Res. Commun. 184, 60 – 66. 11. Cramer, S. D., Ferree, P. M., Lin, K., Milliner, D. S., and Holmes, R. P. (1999) Hum. Mol. Genet. 8, 2063–2069.
301