- Email: [email protected]
Comparative study of the effects of aluminum adjuvants and Freund's incomplete adjuvant on the immune response to an Edwardsiella tarda major antigen
Vaccine 28 (2010) 1832–1837
Contents lists available at ScienceDirect
Vaccine journal homepage: www.elsevier.com/locate/vaccine
Comparative study of the effects of aluminum adjuvants and Freund’s incomplete adjuvant on the immune response to an Edwardsiella tarda major antigen Xu-dong Jiao a,b , Shuang Cheng a,b , Yong-hua Hu a , Li Sun a,∗ a b
Institute of Oceanology, Chinese Academy of Sciences, 7 Nanhai Road, Qingdao 266071, PR China Graduate University of the Chinese Academy of Sciences, Beijing, PR China
a r t i c l e
i n f o
Article history: Received 2 November 2009 Received in revised form 29 November 2009 Accepted 30 November 2009 Available online 22 December 2009 Keywords: Adjuvant Aluminum hydroxide Aluminum phosphate Edwardsiella tarda Freund’s adjuvant Immune gene
a b s t r a c t Edwardsiella tarda is a severe aquaculture pathogen that can infect many different fish species cultured worldwide. Et49 is a major E. tarda antigen with weak immunoprotective potential. In this study, using Et49 as an example vaccine, the adjuvanticity of Freund’s incomplete adjuvant (FIA), aluminum hydroxide, and aluminum phosphate adjuvant were evaluated in a Japanese flounder model. The results showed that the presence of FIA, aluminum hydroxide, and aluminum phosphate adjuvant increased the relative percent of survival of Et49-vaccinated fish by 47%, 19%, and 35%, respectively. Fish vaccinated with FIA-adjuvanted Et49 exhibited longer persistence of vaccine at the injection site and more severe intraabdominal lesions than fish vaccinated with aluminum-adjuvanted Et49. Both aluminum adjuvants and, to a lesser degree, FIA augmented the production of specific serum antibodies, which reached the highest levels at 6 and 7 weeks post-vaccination. Passive immunization of Japanese flounder with sera from fish vaccinated with aluminum- and FIA-adjuvanted Et49 induced no protection against lethal E. tarda challenge. Examination of the transcription profile of immune-related genes showed that vaccination with aluminum-adjuvanted Et49 significantly enhanced the expression of the genes that are associated mainly with humoral immunity, whereas vaccination with FIA-adjuvanted Et49 induced the expression of a much broader spectrum of genes that are likely to be involved in humoral and innate cellular immunity. These results provide new insights to the action mechanisms of FIA and aluminum adjuvants in Japanese flounder and may be useful for the selection of adjuvant for vaccine formulations intended for Japanese flounder. © 2009 Elsevier Ltd. All rights reserved.
1. Introduction Adjuvants are immune enhancers that are often used in vaccination to augment the immune response of a vaccine, thereby enhancing the protective immunity against the targeted disease. Among the adjuvants that have been studied in association with fish vaccines are oil-based adjuvants and aluminum-based adjuvants [1–12]. Freund’s adjuvant is a classical oil adjuvant, which, with the aid of an emulsifying agent, forms a water-in-oil emulsion with the antigen. The complete form of Freund’s adjuvant (FCA) contains killed, dried mycobacteria, usually Mycobacterium tuberculosis, which is absent in the incomplete form of Freund’s adjuvant (FIA). Freund’s adjuvant is one of the most potent adjuvants and is effective in eliciting strong immune response at both humoral and cellular levels that in general have not been surpassed by any other adjuvant [13,14]. However, the use of Freund’s adjuvant, especially FCA, is often accompanied with various adverse effects, such as the
∗ Corresponding author. Tel.: +86 532 82898829; fax: +86 532 82898829. E-mail address: [email protected] (L. Sun). 0264-410X/$ – see front matter © 2009 Elsevier Ltd. All rights reserved. doi:10.1016/j.vaccine.2009.11.083
development of granuloma, necrosis, and tissue impairment, which cause considerable stress to the animal under vaccination. For this reason, Freund’s adjuvant has been prohibited in human clinical vaccine. The adjuvant property of aluminum salts was first discovered in 1926 by Glenny et al. [15], who found that diphtheria toxoid was more immunogenic when precipitated by potassium alum. Since then, aluminum compounds, mainly aluminum phosphate and aluminum hydroxide, have been used extensively in human and veterinary vaccines. Vaccines are usually compounded with aluminum salts in two forms, one is aluminum-precipitated vaccine, which is produced by mixing aluminum compounds with the antigen to form a precipitate, and the other is aluminumadsorbed vaccines, which are produced by adding the antigen to pre-formed aluminum phosphate or aluminum hydroxide gel [16,17]. Aluminum-based adjuvants are generally less reactive than oil emulsion adjuvants but do possess certain immunostimulatory properties, although, unlike Freund’s adjuvant, aluminum adjuvants are known to induce Th2 response only and cannot promote cytotoxic T cell-mediated immunity [18–20]. However, aluminum adjuvants have the advantage of being safe, which has been proven
X.-d. Jiao et al. / Vaccine 28 (2010) 1832–1837
1833
by a history of more than 70 years of human application with only rare cases of serious side effect [21]. Edwardsiella tarda is a Gram-negative bacterium and a severe aquaculture pathogen that can infect many different species of marine and freshwater fish [22–24]. Although several highly effective vaccine candidates have been reported [25–27], E. tarda vaccine development is still in the beginning, and to date only one vaccine, a bacterin, has been licensed for aquaculture application [28]. A previous study by Verjan et al. [29] has identified a number of E. tarda major antigens as potential candidate vaccines, and at least two of these antigens were later found to be moderately immunoprotective [30]. Since, to our knowledge, no comparative study of the adjuvanticity of aluminum compounds and Freund’s adjuvant in a Japanese flounder model has been reported, we aimed in this study to examine the immunopotentiating effects of these adjuvants on an E. tarda vaccine in Japanese flounder. For this purpose, we analyzed the immunoprotective potential of one of the antigens, Et49, reported by Verjan et al. under different adjuvant conditions. We found that FIA was immunologically more potent than aluminum-based adjuvants and that, as far as the effect on the protective efficacy of Et49 was concerned, aluminum phosphate adjuvant exhibited stronger adjuvanticity than aluminum hydroxide.
2.6. Vaccine formulation
2. Materials and methods
2.7. Vaccination
2.1. Bacterial strain and growth conditions
Japanese flounder were divided randomly into eight groups (28 fish/group), which were injected intraperitoneally (i.p.) with 100 l of Et49, Et49–AH, Et49–AP, Et49–FIA, aluminum hydroxide (AH), aluminum phosphate adjuvant (AP), FIA, and PBS, respectively. At 5 weeks post-vaccination, the fish were challenged with E. tarda TX1 that had been cultured in LB medium to mid-logarithmic phase and resuspended in PBS. Mortality was monitored over a period of 20 days after the challenge, and dying fish were randomly selected for the examination of bacterial recovery from the liver, kidney, and spleen as described above. The relative percent of survival (RPS) was calculated according to the following formula: RPS = {1 – (% mortality in vaccinated fish/% mortality in control fish)} × 100 [35]. All vaccinations were replicated, and the accumulated mortality and RPS values given in the report represent the mean results.
E. tarda TX1 is a pathogenic isolate from diseased Japanese flounder [31]; it was cultured in Luria–Bertani broth (LB) medium [32] at 28 ◦ C. 2.2. Purification of recombinant protein Recombinant Et49 was purified as described previously [30]. 2.3. Fish Healthy Japanese flounder (Paralichthys olivaceus, ∼10 g) were purchased from a local fish farm and acclimatized in the laboratory for 2 weeks before experimental manipulation. Fish were maintained at 22 ◦ C in aerated seawater and fed daily with commercial dry pellets. Before experiments, fish were randomly sampled for the examination of bacterial recovery from blood, liver, kidney, and spleen. Fish were considered as healthy only when no bacteria could be detected from any of the examined tissues and blood. Fish were anaesthetized with tricaine methanesulfonate (Sigma, USA) prior to experiments involving injection, blood collection, or sacrifice.
Et49 adjuvanted with aluminum hydroxide (Et49–AH) was prepared as follows: 5% NaOH and 5% Al2 (SO4 )3 were prepared and sterilized by passing through 0.45 m filters. The solutions were incubated at 60 ◦ C for 30 min. Two volumes of 5% NaOH and five volumes of 5% Al2 (SO4 )3 were mixed with stirring, followed by centrifugation at 10, 000 × g for 5 min. After washing twice with sterile PBS, the mixture was resuspended in PBS to 0.2 mg/ml. Purified recombinant Et49, which was suspended in PBS to 500 g/ml, was mixed with the aluminum gel at equal volume. Et49 adjuvanted with aluminum phosphate adjuvant (Et49–AP) was prepared based on the method of Burrell et al. [33,34] as follows: 0.12 M AlCl3 , 0.12 M NaH2 PO4 , and 0.5 M NaOH, all filtersterilized as described above, were mixed in equal volumes with stirring. The pH of the mixture was adjusted to pH 7.5–8.0. The mixture was centrifuged, washed, and resuspended in PBS to 0.2 mg/ml as described above. Et49 (as described above) was mixed with the aluminum gel at equal volume. Et49 adjuvanted with FIA (Et49–FIA) was prepared by mixing Et49 and Freund’s incomplete adjuvant (Sangon, PR China) at equal volume until a stable emulsion (a homogeneous white mixture) was formed.
2.8. Histopathological analysis Histopathology was performed according to the method of Pirarat et al. [36]. Briefly, spleen and kidney of the fish were removed and fixed in 10% buffered formalin. The fixed tissues were processed, and the sections were stained with haematoxylin and eosin. After staining, the sections were observed with a Nikon E800 microscope (Japan). The severity of intra-abdominal lesions was determined as described by Midtlyng et al. [6].
2.4. Bacterial recovery from fish tissues and blood
2.9. Enzyme-linked immunosorbent assay (ELISA)
Bacterial recovery from fish blood and tissues was performed as described previously [31]. Briefly, fish were sacrificed with an overdose of tricaine methanesulfonate, and blood/tissues were taken under aseptic conditions. The tissues were homogenized in phosphate-buffered saline (PBS). The homogenates and blood were plated on LB agar plates, and the plates were incubated at 28 ◦ C for 48 h.
Sera were collected from vaccinated fish (five at each time point) at various times post-vaccination. Sera were diluted 20-fold in PBST (0.1% Tween-20 in PBS) containing 2% bovine serum albumin. ELISA was performed as described previously [37]. Briefly, 96-well ELISA plates were coated with purified recombinant Et49, and diluted sera were added in triplicate to the wells of the plates. After incubation at 37 ◦ C for 2 h and washing with PBST, rat anti-Japanese flounder IgM antibodies, which were prepared as described previously [37], were added to the plates. The plates were incubated and washed as described above. Horse-radish peroxidase-conjugated goat anti-rat IgG (Bios, Beijing, PR China) was added to the plates. Color development was performed with
2.5. Chemicals Unless otherwise stated, all chemicals used in this study were purchased from Sangon (Shanghai, PR China).
1834
X.-d. Jiao et al. / Vaccine 28 (2010) 1832–1837
the DAB Kit (Bios, Beijing, PR China). The plates were read at 450 nm with a Precision microplate reader (Molecular Devices, Canada). 2.10. Passive immunization Passive immunization assay was performed according to the method of Pasnik et al. [38]. Briefly, sera were collected from fish vaccinated with Et49–AP and Et49–FIA at 6 and 7 weeks post-vaccination. As a control, sera were also collected from fish vaccinated with PBS. Three groups (10 fish per group) of Japanese flounder (∼3 g) were administered i.p. with 100 l of control serum, serum from Et49–AP- or Et49–FIA-vaccinated fish. At 72 h postimmunization, the fish were challenged with TX1 and monitored for mortality as described above. Dying fish were examined for bacterial recovery as described above. 2.11. Quantitative real time reverse transcriptase-PCR (qRT-PCR) analysis of the expression of immune-related genes Japanese flounder were vaccinated as described above. Spleen was taken from the fish (five in each case) at 24 h post-challenge. Total RNA extraction and cDNA synthesis were carried out as described previously [39]. qRT-PCR was performed in an ABI 7300 Real-time Detection System (Applied Biosystems, USA) by using the SYBR ExScript qRT-PCR Kit (Takara, Dalian, PR China) as described previously [39]. Each assay was performed in triplicate with -actin RNA as control. The primers used to amplify the immune-related genes are listed in Table 1. All data are given in terms of relative mRNA, expressed as means plus or minus standard errors of the means (SE). 2.12. Statistical analysis All statistical analyses were performed by using SPSS 15.0 software (SPSS Inc., USA). Differences in antibody titers and transcription levels of the immune-related genes were analyzed with Student’s t-test; differences in mortality were determined with chi-square test. In all cases, the significance level was defined as P < 0.05. 3. Results 3.1. Histopathological analysis of the vaccinated fish For fish vaccinated with Et49–AH, Et49–AP, AH, and AP, but not for fish vaccinated with Et49–FIA or FIA, clear droplet-like structures were observed in the pyloric caecum at 24 h post-
Table 1 Primers used in this study. Primers
Sequences (5 → 3 )
Target gene
ActF ActR IgMF IgMR IgDF IgDR MHCIF MHCIR MHCIIF MHCIIR C3F C3R IL1F IL1R IL6F IL6R IFNF IFNR IFN␥F IFN␥R TNF␣F TNF␣R CD8F CD8R CD40F CD40R MxF MxR NKEFF NKEFR
AGCCTTCATTCCTTGGAATGG TAGCACGGTGTTGGCGTAC CCCTCCAGAGGTTTTCGTTT CAAACCCTATTGAAAGCAATGG TGGGGACAAGGGACAAAGG GCGAGGCAGCCAAGAGTG AGACCACAGGCTGTTATCACCA TCTTCCCATGCTCCACGAA ACAGGGACGGAACTTATCAACG TCATCGGACTGGAGGGAGG AGTTCCACAGCAACCCACA CCACTCACCTCTTCACCAAA CTGTCGTTCTGGGCATCAAA AACAGAAATCGCACCATCTCACT CTCCGCAATGGGAAGGTG GATGGATGGGTGGAATAA CCCTGTTTGAGGAGGATTCC TGTTCTTCATGTGGCTGTGACT AGTGGTCTGTCTGTCCCTGTGT GAGGTTCTGGATGGTTTTGTTC CGTCCTGGCGTTTTCTTG CCTCAGTGTGTTGTGGGGTT ATTAGTTGTGAAAGAGGGGGC TGAGGAATCAATGTATGGGGA TGGCAGTTTGGCTGTAGTTG TCCTCCCTTTGGTCCTCG AAGAGAGAGGAGAACGAGGAGG GCAACAGGTGGTAGCGAATAAT GCTGCTGAACAGTTTAGGAAAA CGTCAATGATGAACAGACCCC
-actin IgM IgD MHC I␣ MHC II␣ C3 IL-1 IL-6 IFN IFN-␥ TNF-␣ CD8␣ CD40 Mx NKEF
vaccination (Fig. 1 and data not shown). For fish vaccinated with Et49–AH, Et49–AP, AH, and AP, vaccines, in the form of whitish fluids, were observed disbursed in the peritoneal cavity during the 1st week post-vaccination but were undetectable by 4 weeks postvaccination. For fish vaccinated with Et49–FIA and FIA, vaccine mixtures appeared as a whitish lump at the injection site in the 1st week post-vaccination, which became disbursed among the visceral organs after 4 weeks post-vaccination (Fig. 2). Et49–FIA and FIA persisted in the dispersed form until at least 2 months postvaccination. In contrast, no vaccine was visible in fish vaccinated with unadjuvanted Et49. Histopathological and gross morphology examination at 3 and 8 weeks post-vaccination showed that intraabdominal lesions, especially at the later time, were more severe in fish vaccinated with Et49–FIA and FIA than in fish vaccinated with aluminum-adjuvanted Et49 or with aluminum compounds alone. However, no granuloma-like structure was observed in the spleen and kidney of any of the vaccinated fish.
Fig. 1. Histological examination of the pyloric caecum of Japanese flounder vaccinated with different Et49 formulations. Japanese flounder were vaccinated with PBS (A), Et49–AH (B), and Et49–AP (C). Pyloric caeca were taken and examined at 24 h post-vaccination. Arrows indicate droplet-like structures.
X.-d. Jiao et al. / Vaccine 28 (2010) 1832–1837
Fig. 2. Persistence of FIA-adjuvanted vaccine at the injection site. Japanese flounder were vaccinated with Et49–FIA (A) or PBS (B). At 8 weeks post-vaccination, the fish were sacrificed, and the peritoneal cavity was examined for vaccine presence. The arrow indicates vaccine mixture.
3.2. Immunoprotective efficacy of different Et49 formulations Upon challenging with the pathogenic E. tarda strain TX1, fish vaccinated with Et49, Et49–AH, Et49–AP, Et49–FIA, AH, AP, FIA, and PBS exhibited accumulated mortalities of 63%, 45%, 29%, 18%, 100%, 93%, 96%, and 95%, respectively. Hence, the immunoprotective efficacies, in terms of RPS, of Et49, Et49–AH, Et49–AP, and Et49–FIA were, respectively, 34%, 53%, 69%, and 81% compared to PBS. TX1 was the only type of bacterial strain recovered from the spleen, kidney, and liver of moribund fish. 3.3. Induction of specific serum antibodies in vaccinated fish Specific antibodies were detected in fish vaccinated with Et49 in different forms (Fig. 3). In general, adjuvanted Et49 stimulated the production of significantly higher levels of antibody than unadjuvanted Et49, and aluminum-adjuvanted Et49 induced higher levels of antibody production than Et49–FIA. The highest antibody titers were observed at 4 weeks post-vaccination in Et49-vaccinated fish and at 6 and 7 weeks post-vaccination in fish vaccinated with adjuvanted Et49. 3.4. Effect of passive immunization Passive immunization analyses showed that, upon exposure to E. tarda challenge, fish received sera from Et49–AP- and Et49–FIAvaccinated fish exhibited accumulated mortalities (90% and 100%, respectively) comparable to that exhibited by the control fish (90%), although mortality of the passively immunized groups began 2–3
1835
Fig. 4. qRT-PCR analysis of the expression of immune-related genes in fish vaccinated with different Et49 formulations. Japanese founder were vaccinated with Et49, Et49–AH, Et49–AP, Et49–FIA, and PBS. Total RNA was extracted from the spleen at 24 h post-challenge and used for qRT-PCR. For each gene, the mRNA level of the PBS-vaccinated fish was set as 1. Data are means for five assays and presented as the means ± SE. *P < 0.05; **P < 0.001.
days later than that of the control group. TX1 was the only type of bacterial strain isolated from the tissues of dead fish. 3.5. Expression of immune-related genes To investigate at genetic level the immunological mechanisms underlying the differences observed with different Et49 formulations, we compared the effects of different Et49 vaccinations on the transcription of immune-related genes. For this purpose, qRTPCR was carried out to examine the expression of genes encoding immunoglobulin M (IgM) and D (IgD), major histocompatibility complex (MHC) class I␣ and class II␣, complement C3, interleukin 1 (IL-1), interleukin 6 (IL-6), type I interferon (IFN), IFN-␥, tumor necrosis factor-alpha (TNF-␣), CD8␣, CD40, interferon-induced Mx protein (Mx), and natural killer cell enhancing factor (NKEF). The results showed that vaccination with Et49–FIA significantly stimulated the induction of all the examined genes except those that encode IgD, IFN, and IL-1; the induction profile induced by Et49–AH and Et49–AP vaccination was similar, which showed significantly enhanced expression of the genes coding for IgM, IgD, C3, MHC II␣, IL-6, and, to lesser extents, NKEF and Mx (Fig. 4). In contrast, vaccination with Et49 alone caused significant induction of only IgM, MHC I␣, MHC II␣, and Mx. 4. Discussion
Fig. 3. Serum antibody response of fish vaccinated with different Et49 formulations. Japanese founder were vaccinated with purified recombinant Et49, Et49–AH, Et49–AP, Et49–FIA, or PBS. Sera were collected at 5–8 weeks post-vaccination. Serum antibodies against Et49 were determined by ELISA. *P < 0.05; **P < 0.001.
Our previous study has shown that Et49, when co-administered with a bacterial adjuvant, produced a RPS that is less than 50% in Japanese flounder [30]. This result suggests that Et49 is weakly immunogenic and thus may be used for the study of adjuvant effect. In this study, using purified recombinant Et49 as an example of E. tarda subunit vaccine, we compared the immunological effect of Freund’s incomplete adjuvant with those of aluminum compounds. Our results showed that, as far as the effect on the immunoprotection efficacy of Et49 is concerned, FIA is the most potent adjuvant. Many studies on fish vaccines formulated with oil-based adjuvants have indicated a persistence of antigen at the injection site, which is an important depot mechanism that enables the antigen to be released in a slow and sustained fashion, whereby increasing the exposure time of the antigen to the immune system. Similarly, in this study, we found that Et49 incorporated into FIA persisted among the visceral organs for at least 2 months, which
1836
X.-d. Jiao et al. / Vaccine 28 (2010) 1832–1837
may in part account for the strong immunopotentiating activity of FIA. Unlike oil emulsions such as FIA-adjuvanted vaccines, antigens compounded with aluminum adjuvants are absorbed to the aluminum salts through electrostatic interactions and thus are easily dissociated from the adjuvant and diffuse away from the injection site [40]. Therefore, the depot effect is likely to be short in aluminum-adjuvanted vaccines. In fact, several studies have demonstrated that antigens were rapidly released from aluminum adjuvants following vaccination [41–43]. In our study, vaccine mixtures of Et49–AH and Et49–AP were observed at the peritoneal cavity during the 1st week post-vaccination but were undetectable by 4 weeks post-vaccination. It is possible that, given the mechanism of interaction between antigen and aluminum adjuvants, some Et49 may have escaped from the aluminum gels even during the 1st week post-vaccination. In any case, it is evident that aluminum-adjuvanted Et49 was less persistent than FIA-Et49, which is in line with the result that aluminum-adjuvanted formulations were less effective in augmenting the protective immunity induced by Et49. For many fish species, antibody-mediated humoral immunity plays an essential role in the defense against bacterial infections. As a result, passive immunization has been shown to induce significant protection in fish against pathogens such as Vibrio anguillarum, Aeromonas hydrophila, Flavobacterium psychrophilum, Streptococcus agalactiae, and Streptococcus iniae [44–48]. In our study, fish vaccinated with FIA- and aluminum-adjuvanted Et49 produced specific antibodies that are significantly higher in titers than those produced by fish vaccinated with unadjuvanted Et49, suggesting that both FIA and the aluminum adjuvants enhanced humoral antibody response. However, passive immunization of naïve fish with sera from fish vaccinated with adjuvanted Et49 failed to elicit protection against E. tarda challenge. These results indicate that humoral immune response alone may not be enough to induce effective protective immunity, which is likely due to the fact that E. tarda is known to be an intracellular pathogen that can survive within phagocytic cells [49] and thus is able to evade, to a certain extent, the humoral arm of immune defense. Freund’s adjuvant is known to have a strong promoting effect on the induction of both humoral and cellular immunity. The mycobacterial component in FCA is particularly effective at inducing Th1 response via its ability to activate the pathways mediated by tolllike receptors. Unlike Freund’s adjuvant, aluminum salts appear to stimulate only Th2 type of immune response in mouse model and have no effect on Th1 type of immune reaction [18–20]. Other known action mechanisms of aluminum adjuvants include recruitment of antigen presenting cells, promoting the maturation of dendritic cells, and facilitating the activation of T cells [50–52]. In our study, we found that aluminum hydroxide and aluminum phosphate adjuvant augmented the expression of the same set of genes, most of which function in humoral immunity. However, although the expression of CD8␣, one of the markers of cellular response, was not significantly increased by aluminum adjuvants, the expression of NKEF and Mx was moderately induced. Since both Mx and NKEF are important mediators of immune defense against virus and other forms of intracellular pathogens [53,54], it is possible that the enhanced expression of NKEF and Mx may contribute to the immunoprotection induced by aluminum-adjuvanted Et49 against E. tarda, which, as mentioned earlier, is an intracellular pathogen. In contrast to vaccination with aluminum-adjuvanted Et49, vaccination with FIA-adjuvanted Et49 enhanced the expression of a wide range of genes that are likely to participate in humoral immunity and innate cellular immunity mediated by activated natural killer cells and phagocytes. The most drastic difference between the expression profiles induced by FIA-adjuvanted Et49 and aluminum-adjuvanted Et49 was observed in the expression
of the genes encoding MHC I␣, CD8␣, Mx, IFN-␥, TNF-␣, and IL6, which are associated with cellular, antiviral, and inflammatory responses. In addition, CD40, which is involved in the activation of antigen presenting cells, was also induced significantly by FIA but not by aluminum compounds. These results suggest that, for Japanese flounder, FIA is a more potent immunostimulator than aluminum compounds. In conclusion, our study demonstrate that, as far as the effect on protection efficacy is concerned, FIA is a more effective adjuvant than aluminum compounds, probably due to its ability to induce a much broader range of immune response. Aluminum-based adjuvants are inferior to FIA in adjuvanticity and promote relatively a narrow range of immune reactions, yet they have the advantage of being safer, more cost-efficient, and easier to prepare. Therefore, FIA and aluminum adjuvants may be applied to different vaccination situations that require different adjuvant properties. Acknowledgements This work was supported by the National Basic Research Program of China grant 2006CB101807 and the Ministry of Science and Technology grant 2008AA092501. References [1] Berg A, Rodseth OM, Hansen T. Fish size at vaccination influence the development of side-effects in Atlantic salmon (Salmo salar L.). Aquaculture 2007;265:9–15. [2] Bowden TJ, Lester K, MacLachlan P, Bricknell IR. Preliminary study into the short term effects of adjuvants on Atlantic halibut (Hippoglossus hippoglossus L.). Bull Eur Ass Fish Pathol 2000;20:148–52. [3] Bravo S, Midtlyng PJ. The use of fish vaccines in the Chilean salmon industry 1999–2003. Aquaculture 2007;270:36–42. [4] Midtlyng PJ, Lillehaug A. Growth of Atlantic salmon Salmo salar after intraperitoneal administration of vaccines containing adjuvants. Dis Aquat Organ 1998;32:91–7. [5] Midtlyng PJ, Reitan LJ, Lillehaug A, Ramstad A. Protection, immune responses and side effects in Atlantic salmon (Salmo salar L.) vaccinated against furunculosis by different procedures. Fish Shellfish Immunol 1996;6:599–613. [6] Midtlyng PJ, Reitan LJ, Speilberg L. Experimental studies on the efficacy and side-effects of intraperitoneal vaccination of Atlantic salmon (Salmo salar L.) against furunculosis. Fish Shellfish Immunol 1996;6:335–50. [7] Mutoloki S, Alexandersen S, Evensen O. Sequential study of antigen persistence and concomitant inflammatory reactions relative to side-effects and growth of Atlantic salmon (Salmo salar L.) following intraperitoneal injection with oiladjuvanted vaccines. Fish Shellfish Immunol 2004;16:633–44. [8] Mutoloki S, Alexandersen S, Gravningen K, Evensen O. Time-course study of injection site inflammatory reactions following intraperitoneal injection of Atlantic cod (Gadus morhua L.) with oil-adjuvanted vaccines. Fish Shellfish Immunol 2008;24:386–93. [9] Olivier G, Evelyn TPT, Lallier R. Immunogenicity of vaccines from a virulent and an avirulent strain of Aeromonas salmonicida. J Fish Dis 1985;8:43–55. [10] Poppe TT, Breck O. Pathology of Atlantic salmon Salmo salar intraperitoneally immunized with oil-adjuvanted vaccine. A case report. Dis Aquat Organ 1997;29:219–26. [11] Mulvey B, Landolt ML, Busch RA. Effects of potassium sulphate (alum) used in Aeromonas salmonicida bacterin on Atlantic salmon, Salmo salar L. J Fish Dis 1995;18:495–506. [12] Horne MT, Roberts, Tatner M. The effects of the use of potassium alum adjuvant in vaccines against vibriosis in rainbow trout, Salmo gairdneri Richardson. J Fish Dis 1984;7:91–9. [13] Lindblad EB. Freund’s adjuvants. In: O’Hagan DT, editor. Methods in molecular medicine: Vaccine adjuvants—preparation methods and research protocols. Totowa, NJ: Humana Press; 2000. p. 49–63. [14] Stills Jr HF. Adjuvants and antibody production: dispelling the myths associated with Freund’s complete and other adjuvants. ILAR J 2005;46:280–93. [15] Glenny AT, Pope CG, Waddington H, Wallace U. Immunological notes. XXIII. The antigenic value of toxoid precipitated by potassium alum. J Pathol Bacteriol 1926;29:31–40. [16] Gupta RK. Aluminum compounds as vaccine adjuvants. Adv Drug Deliv Rev 1998;32:155–72. [17] Hem SL, White JL. Structure and properties of aluminum-containing adjuvants. Pharm Biotechnol 1995;6:249–76. [18] Bomford R. The comparative selectivity of adjuvants for humoral and cellmediated immunity. Clin Exp Immunol 1980;39:435–41. [19] Bomford R, Stapleton M, Winsor S, McKnight A, Andronova T. The control of the antibody isotype response to recombinant human immunodeficiency virus gp120 antigen by adjuvants. AIDS Res Hum Retroviruses 1992;8:1765–71.
X.-d. Jiao et al. / Vaccine 28 (2010) 1832–1837 [20] Comoy EE, Capron A, Thyphronitis G. In vivo induction of types 1 and 2 immune responses against protein antigens. Int Immunol 1997;9:523–31. [21] Gupta RK, Rost BE, Relyveld E, Siber GR. Adjuvant properties of aluminum and calcium compounds. In: Powell MF, Newman MJ, editors. Vaccine design: The subunit and adjuvant approach. New York: Plenum Press; 1995. p. 229–48. [22] Castro N, Toranzo A, Barja J, Nunez S, Magarinos B. Characterization of Edwardsiella tarda strains isolated from turbot, Psetta maxima (L.). J Fish Dis 2006;29:541–7. [23] Kubota SS, Kaige N, Miyazaki T, Miyashita T. Histopathological studies on edwardsiellosis of tilapia, 1: natural infection. Bull Fac Fish Mie Univ 1981;9:155–6. [24] Meyer FP, Bullock GL. Edwardsiella tarda, a new pathogen of channel catfish (Ictalurus punctatus). Appl Microbiol 1973;25:155–6. ˜ ˜ [25] Castro N, Toranzo AE, Núnez S, Magarinos B. Development of an effective Edwardsiella tarda vaccine for cultured turbot (Scophthalmus maximus). Fish Shellfish Immunol 2008;25:208–12. [26] Kwon SR, Nam YK, Kim SK, Kim KH. Protection of tilapia (Oreochromis mosambicus) from edwardsiellosis by vaccination with Edwardsiella tarda ghosts. Fish Shellfish Immunol 2006;20:621–6. [27] Lee DJ, Kwon SR, Zenke K, Lee EH, Nam YK, Kim SK, et al. Generation of safety enhanced Edwardsiella tarda ghost vaccine. Dis Aquat Organ 2008;81:249–54. [28] Park SI. Disease control in Korean aquaculture. Fish Pathol 2009;44:19–23. [29] Verjan N, Hirono I, Aoki T. Genetic loci of major antigenic protein genes of Edwardsiella tarda. Appl Environ Microbiol 2005;71:5654–8. [30] Hou J, Zhang W, Sun L. Immunoprotective analysis of two Edwardsiella tarda antigens. J Gen Appl Microbiol 2009;55:57–61. [31] Zhang M, Sun K, Sun L. Regulation of autoinducer 2 production and luxS expression in a pathogenic Edwardsiella tarda strain. Microbiology 2008;154:2060–9. [32] Sambrook J, Fritsch E, Maniatis T. Molecular cloning: A laboratory manual. New York: Cold Spring Harbor Laboratory Press; 1989 p. 67–71. [33] Burrell LS, Johnston CT, Schulze D, Klein J, White JL, Hem SL. Aluminium phosphate adjuvants prepared by precipitation at constant pH. Part I: composition and structure. Vaccine 2000;19:275–81. [34] Burrell LS, Johnston CT, Schulze D, Klein J, White JL, Hem SL. Aluminium phosphate adjuvants prepared by precipitation at constant pH. Part II: physicochemical properties. Vaccine 2000;19:282–7. [35] Amend DF. Potency testing of fish vaccines. In: International Symposium on fish biologics: Serodiagnostics and vaccines. Dev Biol Stand 1981;49:447–54. [36] Pirarat N, Kobayashi T, Katagiri T, Maita M, Endo M. Protective effects and mechanisms of a probiotic bacterium Lactobacillus rhamnosus against experimental Edwardsiella tarda infection in tilapia (Oreochromis niloticus). Vet Immunol Immunopathol 2006;113:339–47. [37] Jiao X, Zhang M, Hu Y, Sun L. Construction and evaluation of DNA vaccines encoding Edwardsiella tarda antigens. Vaccine 2009;27:5195–202. [38] Pasnik DJ, Evans JJ, Klesius PH. Passive immunization of Nile tilapia (Oreochromis niloticus) provides significant protection against Streptococcus agalactiae. Fish Shellfish Immunol 2006;21:365–71.
1837
[39] Zhang W, Sun S, Cheng S, Sun L. Characterization of DegQVh , a serine protease and a protective immunogen from a pathogenic Vibrio harveyi strain. Appl Environ Microbiol 2008;74:6254–62. [40] Gupta RK, Rost BE. Aluminum compounds as vaccine adjuvants. In: O’Hagan DT, editor. Methods in Molecular Medicine. Vaccine Adjuvants—Preparation Methods and Research Protocols, vol. 42. Totowa, NJ: Humana Press; 2000, pp.65–89. [41] Heimlich JM, Regnier FE, White JL, Hem SL. The in vitro displacement of adsorbed model antigens from aluminum-containing adjuvants by interstitial proteins. Vaccine 1999;17:2873–81. [42] Seeber SJ, White JL, Hem SL. Solubilization of aluminum-containing adjuvants by constituents of interstitial fluid. J Parenter Sci Technol 1991;45:156–9. [43] Weissburg RP, Berman PW, Cleland JL, Eastman D, Farina F, Frie S, et al. Characterization of the MN gp120 HIV-1 vaccine: antigen binding to alum. Pharm Res 1995;12:1439–46. [44] Akhlaghi M. Passive immunisation of fish against vibriosis, comparison of intraperitoneal, oral and immersion routes. Aquaculture 1999;180:191–205. [45] Arasteh N, Aminirissehei AH, Yousif AN, Albright LJ, Durance TD. Passive immunization of rainbow trout (Oncorhynchus mykiss) with chicken egg yolk immunoglobulins (IgY). Aquaculture 2004;231:23–36. [46] LaFrentz BR, LaPatra SE, Jones GR, Cain KD. Passive immunization of rainbow trout, Oncorhynchus mykiss (Walbaum), against Flavobacterium psychrophilum, the causative agent of bacterial coldwater disease and rainbow trout fry syndrome. J Fish Dis 2003;26:371–84. [47] Lapatra SE, Plant KP, Alcorn S, Ostland V, Winton J. An experimental vaccine against Aeromonas hydrophila can induce protection in rainbow trout, Oncorhynchus mykiss (Walbaum). J Fish Dis, doi:10.1111/j.1365-2761.2009.01098. [48] Shelby RA, Klesius PH, Shoemaker CA, Evans JJ. Passive immunization of tilapia, Oreochromis niloticus (L.), with anti-Streptococcus iniae whole sera. J Fish Dis 2002;25:1–6. [49] Rao PSS, Lim TM, Leung KY. Opsonized virulent Edwardsiella tarda strains are able to adhere to and survive and replicate within fish phagocytes but fail to stimulate reactive oxygen intermediates. Infect Immun 2001;69:5689–97. [50] Hem SL, Hogenesch H. Relationship between physical and chemical properties of aluminum-containing adjuvants and immunopotentiation. Expert Rev Vaccines 2007;6:685–98. [51] HogenEsch H. Mechanisms of stimulation of the immune response by aluminum adjuvants. Vaccine 2002;20:S34–9. [52] Lindblad E. Aluminum compounds for use in vaccines. Immunol Cell Biol 2004;82:497–805. [53] Geiben-Lynn R, Kursar M, Brown NV, Addo MM, Shau H, Lieberman J, et al. HIV-1 antiviral activity of recombinant natural killer cell enhancing factors, NKEF-A and NKEF-B, members of the peroxiredoxin family. J Biol Chem 2003;278:1569–74. [54] Haller O, Stertz S, Kochs G. The Mx GTPase family of interferon-induced antiviral proteins. Microbes Infect 2007;9:1636–43.
Contents lists available at ScienceDirect
Vaccine journal homepage: www.elsevier.com/locate/vaccine
Comparative study of the effects of aluminum adjuvants and Freund’s incomplete adjuvant on the immune response to an Edwardsiella tarda major antigen Xu-dong Jiao a,b , Shuang Cheng a,b , Yong-hua Hu a , Li Sun a,∗ a b
Institute of Oceanology, Chinese Academy of Sciences, 7 Nanhai Road, Qingdao 266071, PR China Graduate University of the Chinese Academy of Sciences, Beijing, PR China
a r t i c l e
i n f o
Article history: Received 2 November 2009 Received in revised form 29 November 2009 Accepted 30 November 2009 Available online 22 December 2009 Keywords: Adjuvant Aluminum hydroxide Aluminum phosphate Edwardsiella tarda Freund’s adjuvant Immune gene
a b s t r a c t Edwardsiella tarda is a severe aquaculture pathogen that can infect many different fish species cultured worldwide. Et49 is a major E. tarda antigen with weak immunoprotective potential. In this study, using Et49 as an example vaccine, the adjuvanticity of Freund’s incomplete adjuvant (FIA), aluminum hydroxide, and aluminum phosphate adjuvant were evaluated in a Japanese flounder model. The results showed that the presence of FIA, aluminum hydroxide, and aluminum phosphate adjuvant increased the relative percent of survival of Et49-vaccinated fish by 47%, 19%, and 35%, respectively. Fish vaccinated with FIA-adjuvanted Et49 exhibited longer persistence of vaccine at the injection site and more severe intraabdominal lesions than fish vaccinated with aluminum-adjuvanted Et49. Both aluminum adjuvants and, to a lesser degree, FIA augmented the production of specific serum antibodies, which reached the highest levels at 6 and 7 weeks post-vaccination. Passive immunization of Japanese flounder with sera from fish vaccinated with aluminum- and FIA-adjuvanted Et49 induced no protection against lethal E. tarda challenge. Examination of the transcription profile of immune-related genes showed that vaccination with aluminum-adjuvanted Et49 significantly enhanced the expression of the genes that are associated mainly with humoral immunity, whereas vaccination with FIA-adjuvanted Et49 induced the expression of a much broader spectrum of genes that are likely to be involved in humoral and innate cellular immunity. These results provide new insights to the action mechanisms of FIA and aluminum adjuvants in Japanese flounder and may be useful for the selection of adjuvant for vaccine formulations intended for Japanese flounder. © 2009 Elsevier Ltd. All rights reserved.
1. Introduction Adjuvants are immune enhancers that are often used in vaccination to augment the immune response of a vaccine, thereby enhancing the protective immunity against the targeted disease. Among the adjuvants that have been studied in association with fish vaccines are oil-based adjuvants and aluminum-based adjuvants [1–12]. Freund’s adjuvant is a classical oil adjuvant, which, with the aid of an emulsifying agent, forms a water-in-oil emulsion with the antigen. The complete form of Freund’s adjuvant (FCA) contains killed, dried mycobacteria, usually Mycobacterium tuberculosis, which is absent in the incomplete form of Freund’s adjuvant (FIA). Freund’s adjuvant is one of the most potent adjuvants and is effective in eliciting strong immune response at both humoral and cellular levels that in general have not been surpassed by any other adjuvant [13,14]. However, the use of Freund’s adjuvant, especially FCA, is often accompanied with various adverse effects, such as the
∗ Corresponding author. Tel.: +86 532 82898829; fax: +86 532 82898829. E-mail address: [email protected] (L. Sun). 0264-410X/$ – see front matter © 2009 Elsevier Ltd. All rights reserved. doi:10.1016/j.vaccine.2009.11.083
development of granuloma, necrosis, and tissue impairment, which cause considerable stress to the animal under vaccination. For this reason, Freund’s adjuvant has been prohibited in human clinical vaccine. The adjuvant property of aluminum salts was first discovered in 1926 by Glenny et al. [15], who found that diphtheria toxoid was more immunogenic when precipitated by potassium alum. Since then, aluminum compounds, mainly aluminum phosphate and aluminum hydroxide, have been used extensively in human and veterinary vaccines. Vaccines are usually compounded with aluminum salts in two forms, one is aluminum-precipitated vaccine, which is produced by mixing aluminum compounds with the antigen to form a precipitate, and the other is aluminumadsorbed vaccines, which are produced by adding the antigen to pre-formed aluminum phosphate or aluminum hydroxide gel [16,17]. Aluminum-based adjuvants are generally less reactive than oil emulsion adjuvants but do possess certain immunostimulatory properties, although, unlike Freund’s adjuvant, aluminum adjuvants are known to induce Th2 response only and cannot promote cytotoxic T cell-mediated immunity [18–20]. However, aluminum adjuvants have the advantage of being safe, which has been proven
X.-d. Jiao et al. / Vaccine 28 (2010) 1832–1837
1833
by a history of more than 70 years of human application with only rare cases of serious side effect [21]. Edwardsiella tarda is a Gram-negative bacterium and a severe aquaculture pathogen that can infect many different species of marine and freshwater fish [22–24]. Although several highly effective vaccine candidates have been reported [25–27], E. tarda vaccine development is still in the beginning, and to date only one vaccine, a bacterin, has been licensed for aquaculture application [28]. A previous study by Verjan et al. [29] has identified a number of E. tarda major antigens as potential candidate vaccines, and at least two of these antigens were later found to be moderately immunoprotective [30]. Since, to our knowledge, no comparative study of the adjuvanticity of aluminum compounds and Freund’s adjuvant in a Japanese flounder model has been reported, we aimed in this study to examine the immunopotentiating effects of these adjuvants on an E. tarda vaccine in Japanese flounder. For this purpose, we analyzed the immunoprotective potential of one of the antigens, Et49, reported by Verjan et al. under different adjuvant conditions. We found that FIA was immunologically more potent than aluminum-based adjuvants and that, as far as the effect on the protective efficacy of Et49 was concerned, aluminum phosphate adjuvant exhibited stronger adjuvanticity than aluminum hydroxide.
2.6. Vaccine formulation
2. Materials and methods
2.7. Vaccination
2.1. Bacterial strain and growth conditions
Japanese flounder were divided randomly into eight groups (28 fish/group), which were injected intraperitoneally (i.p.) with 100 l of Et49, Et49–AH, Et49–AP, Et49–FIA, aluminum hydroxide (AH), aluminum phosphate adjuvant (AP), FIA, and PBS, respectively. At 5 weeks post-vaccination, the fish were challenged with E. tarda TX1 that had been cultured in LB medium to mid-logarithmic phase and resuspended in PBS. Mortality was monitored over a period of 20 days after the challenge, and dying fish were randomly selected for the examination of bacterial recovery from the liver, kidney, and spleen as described above. The relative percent of survival (RPS) was calculated according to the following formula: RPS = {1 – (% mortality in vaccinated fish/% mortality in control fish)} × 100 [35]. All vaccinations were replicated, and the accumulated mortality and RPS values given in the report represent the mean results.
E. tarda TX1 is a pathogenic isolate from diseased Japanese flounder [31]; it was cultured in Luria–Bertani broth (LB) medium [32] at 28 ◦ C. 2.2. Purification of recombinant protein Recombinant Et49 was purified as described previously [30]. 2.3. Fish Healthy Japanese flounder (Paralichthys olivaceus, ∼10 g) were purchased from a local fish farm and acclimatized in the laboratory for 2 weeks before experimental manipulation. Fish were maintained at 22 ◦ C in aerated seawater and fed daily with commercial dry pellets. Before experiments, fish were randomly sampled for the examination of bacterial recovery from blood, liver, kidney, and spleen. Fish were considered as healthy only when no bacteria could be detected from any of the examined tissues and blood. Fish were anaesthetized with tricaine methanesulfonate (Sigma, USA) prior to experiments involving injection, blood collection, or sacrifice.
Et49 adjuvanted with aluminum hydroxide (Et49–AH) was prepared as follows: 5% NaOH and 5% Al2 (SO4 )3 were prepared and sterilized by passing through 0.45 m filters. The solutions were incubated at 60 ◦ C for 30 min. Two volumes of 5% NaOH and five volumes of 5% Al2 (SO4 )3 were mixed with stirring, followed by centrifugation at 10, 000 × g for 5 min. After washing twice with sterile PBS, the mixture was resuspended in PBS to 0.2 mg/ml. Purified recombinant Et49, which was suspended in PBS to 500 g/ml, was mixed with the aluminum gel at equal volume. Et49 adjuvanted with aluminum phosphate adjuvant (Et49–AP) was prepared based on the method of Burrell et al. [33,34] as follows: 0.12 M AlCl3 , 0.12 M NaH2 PO4 , and 0.5 M NaOH, all filtersterilized as described above, were mixed in equal volumes with stirring. The pH of the mixture was adjusted to pH 7.5–8.0. The mixture was centrifuged, washed, and resuspended in PBS to 0.2 mg/ml as described above. Et49 (as described above) was mixed with the aluminum gel at equal volume. Et49 adjuvanted with FIA (Et49–FIA) was prepared by mixing Et49 and Freund’s incomplete adjuvant (Sangon, PR China) at equal volume until a stable emulsion (a homogeneous white mixture) was formed.
2.8. Histopathological analysis Histopathology was performed according to the method of Pirarat et al. [36]. Briefly, spleen and kidney of the fish were removed and fixed in 10% buffered formalin. The fixed tissues were processed, and the sections were stained with haematoxylin and eosin. After staining, the sections were observed with a Nikon E800 microscope (Japan). The severity of intra-abdominal lesions was determined as described by Midtlyng et al. [6].
2.4. Bacterial recovery from fish tissues and blood
2.9. Enzyme-linked immunosorbent assay (ELISA)
Bacterial recovery from fish blood and tissues was performed as described previously [31]. Briefly, fish were sacrificed with an overdose of tricaine methanesulfonate, and blood/tissues were taken under aseptic conditions. The tissues were homogenized in phosphate-buffered saline (PBS). The homogenates and blood were plated on LB agar plates, and the plates were incubated at 28 ◦ C for 48 h.
Sera were collected from vaccinated fish (five at each time point) at various times post-vaccination. Sera were diluted 20-fold in PBST (0.1% Tween-20 in PBS) containing 2% bovine serum albumin. ELISA was performed as described previously [37]. Briefly, 96-well ELISA plates were coated with purified recombinant Et49, and diluted sera were added in triplicate to the wells of the plates. After incubation at 37 ◦ C for 2 h and washing with PBST, rat anti-Japanese flounder IgM antibodies, which were prepared as described previously [37], were added to the plates. The plates were incubated and washed as described above. Horse-radish peroxidase-conjugated goat anti-rat IgG (Bios, Beijing, PR China) was added to the plates. Color development was performed with
2.5. Chemicals Unless otherwise stated, all chemicals used in this study were purchased from Sangon (Shanghai, PR China).
1834
X.-d. Jiao et al. / Vaccine 28 (2010) 1832–1837
the DAB Kit (Bios, Beijing, PR China). The plates were read at 450 nm with a Precision microplate reader (Molecular Devices, Canada). 2.10. Passive immunization Passive immunization assay was performed according to the method of Pasnik et al. [38]. Briefly, sera were collected from fish vaccinated with Et49–AP and Et49–FIA at 6 and 7 weeks post-vaccination. As a control, sera were also collected from fish vaccinated with PBS. Three groups (10 fish per group) of Japanese flounder (∼3 g) were administered i.p. with 100 l of control serum, serum from Et49–AP- or Et49–FIA-vaccinated fish. At 72 h postimmunization, the fish were challenged with TX1 and monitored for mortality as described above. Dying fish were examined for bacterial recovery as described above. 2.11. Quantitative real time reverse transcriptase-PCR (qRT-PCR) analysis of the expression of immune-related genes Japanese flounder were vaccinated as described above. Spleen was taken from the fish (five in each case) at 24 h post-challenge. Total RNA extraction and cDNA synthesis were carried out as described previously [39]. qRT-PCR was performed in an ABI 7300 Real-time Detection System (Applied Biosystems, USA) by using the SYBR ExScript qRT-PCR Kit (Takara, Dalian, PR China) as described previously [39]. Each assay was performed in triplicate with -actin RNA as control. The primers used to amplify the immune-related genes are listed in Table 1. All data are given in terms of relative mRNA, expressed as means plus or minus standard errors of the means (SE). 2.12. Statistical analysis All statistical analyses were performed by using SPSS 15.0 software (SPSS Inc., USA). Differences in antibody titers and transcription levels of the immune-related genes were analyzed with Student’s t-test; differences in mortality were determined with chi-square test. In all cases, the significance level was defined as P < 0.05. 3. Results 3.1. Histopathological analysis of the vaccinated fish For fish vaccinated with Et49–AH, Et49–AP, AH, and AP, but not for fish vaccinated with Et49–FIA or FIA, clear droplet-like structures were observed in the pyloric caecum at 24 h post-
Table 1 Primers used in this study. Primers
Sequences (5 → 3 )
Target gene
ActF ActR IgMF IgMR IgDF IgDR MHCIF MHCIR MHCIIF MHCIIR C3F C3R IL1F IL1R IL6F IL6R IFNF IFNR IFN␥F IFN␥R TNF␣F TNF␣R CD8F CD8R CD40F CD40R MxF MxR NKEFF NKEFR
AGCCTTCATTCCTTGGAATGG TAGCACGGTGTTGGCGTAC CCCTCCAGAGGTTTTCGTTT CAAACCCTATTGAAAGCAATGG TGGGGACAAGGGACAAAGG GCGAGGCAGCCAAGAGTG AGACCACAGGCTGTTATCACCA TCTTCCCATGCTCCACGAA ACAGGGACGGAACTTATCAACG TCATCGGACTGGAGGGAGG AGTTCCACAGCAACCCACA CCACTCACCTCTTCACCAAA CTGTCGTTCTGGGCATCAAA AACAGAAATCGCACCATCTCACT CTCCGCAATGGGAAGGTG GATGGATGGGTGGAATAA CCCTGTTTGAGGAGGATTCC TGTTCTTCATGTGGCTGTGACT AGTGGTCTGTCTGTCCCTGTGT GAGGTTCTGGATGGTTTTGTTC CGTCCTGGCGTTTTCTTG CCTCAGTGTGTTGTGGGGTT ATTAGTTGTGAAAGAGGGGGC TGAGGAATCAATGTATGGGGA TGGCAGTTTGGCTGTAGTTG TCCTCCCTTTGGTCCTCG AAGAGAGAGGAGAACGAGGAGG GCAACAGGTGGTAGCGAATAAT GCTGCTGAACAGTTTAGGAAAA CGTCAATGATGAACAGACCCC
-actin IgM IgD MHC I␣ MHC II␣ C3 IL-1 IL-6 IFN IFN-␥ TNF-␣ CD8␣ CD40 Mx NKEF
vaccination (Fig. 1 and data not shown). For fish vaccinated with Et49–AH, Et49–AP, AH, and AP, vaccines, in the form of whitish fluids, were observed disbursed in the peritoneal cavity during the 1st week post-vaccination but were undetectable by 4 weeks postvaccination. For fish vaccinated with Et49–FIA and FIA, vaccine mixtures appeared as a whitish lump at the injection site in the 1st week post-vaccination, which became disbursed among the visceral organs after 4 weeks post-vaccination (Fig. 2). Et49–FIA and FIA persisted in the dispersed form until at least 2 months postvaccination. In contrast, no vaccine was visible in fish vaccinated with unadjuvanted Et49. Histopathological and gross morphology examination at 3 and 8 weeks post-vaccination showed that intraabdominal lesions, especially at the later time, were more severe in fish vaccinated with Et49–FIA and FIA than in fish vaccinated with aluminum-adjuvanted Et49 or with aluminum compounds alone. However, no granuloma-like structure was observed in the spleen and kidney of any of the vaccinated fish.
Fig. 1. Histological examination of the pyloric caecum of Japanese flounder vaccinated with different Et49 formulations. Japanese flounder were vaccinated with PBS (A), Et49–AH (B), and Et49–AP (C). Pyloric caeca were taken and examined at 24 h post-vaccination. Arrows indicate droplet-like structures.
X.-d. Jiao et al. / Vaccine 28 (2010) 1832–1837
Fig. 2. Persistence of FIA-adjuvanted vaccine at the injection site. Japanese flounder were vaccinated with Et49–FIA (A) or PBS (B). At 8 weeks post-vaccination, the fish were sacrificed, and the peritoneal cavity was examined for vaccine presence. The arrow indicates vaccine mixture.
3.2. Immunoprotective efficacy of different Et49 formulations Upon challenging with the pathogenic E. tarda strain TX1, fish vaccinated with Et49, Et49–AH, Et49–AP, Et49–FIA, AH, AP, FIA, and PBS exhibited accumulated mortalities of 63%, 45%, 29%, 18%, 100%, 93%, 96%, and 95%, respectively. Hence, the immunoprotective efficacies, in terms of RPS, of Et49, Et49–AH, Et49–AP, and Et49–FIA were, respectively, 34%, 53%, 69%, and 81% compared to PBS. TX1 was the only type of bacterial strain recovered from the spleen, kidney, and liver of moribund fish. 3.3. Induction of specific serum antibodies in vaccinated fish Specific antibodies were detected in fish vaccinated with Et49 in different forms (Fig. 3). In general, adjuvanted Et49 stimulated the production of significantly higher levels of antibody than unadjuvanted Et49, and aluminum-adjuvanted Et49 induced higher levels of antibody production than Et49–FIA. The highest antibody titers were observed at 4 weeks post-vaccination in Et49-vaccinated fish and at 6 and 7 weeks post-vaccination in fish vaccinated with adjuvanted Et49. 3.4. Effect of passive immunization Passive immunization analyses showed that, upon exposure to E. tarda challenge, fish received sera from Et49–AP- and Et49–FIAvaccinated fish exhibited accumulated mortalities (90% and 100%, respectively) comparable to that exhibited by the control fish (90%), although mortality of the passively immunized groups began 2–3
1835
Fig. 4. qRT-PCR analysis of the expression of immune-related genes in fish vaccinated with different Et49 formulations. Japanese founder were vaccinated with Et49, Et49–AH, Et49–AP, Et49–FIA, and PBS. Total RNA was extracted from the spleen at 24 h post-challenge and used for qRT-PCR. For each gene, the mRNA level of the PBS-vaccinated fish was set as 1. Data are means for five assays and presented as the means ± SE. *P < 0.05; **P < 0.001.
days later than that of the control group. TX1 was the only type of bacterial strain isolated from the tissues of dead fish. 3.5. Expression of immune-related genes To investigate at genetic level the immunological mechanisms underlying the differences observed with different Et49 formulations, we compared the effects of different Et49 vaccinations on the transcription of immune-related genes. For this purpose, qRTPCR was carried out to examine the expression of genes encoding immunoglobulin M (IgM) and D (IgD), major histocompatibility complex (MHC) class I␣ and class II␣, complement C3, interleukin 1 (IL-1), interleukin 6 (IL-6), type I interferon (IFN), IFN-␥, tumor necrosis factor-alpha (TNF-␣), CD8␣, CD40, interferon-induced Mx protein (Mx), and natural killer cell enhancing factor (NKEF). The results showed that vaccination with Et49–FIA significantly stimulated the induction of all the examined genes except those that encode IgD, IFN, and IL-1; the induction profile induced by Et49–AH and Et49–AP vaccination was similar, which showed significantly enhanced expression of the genes coding for IgM, IgD, C3, MHC II␣, IL-6, and, to lesser extents, NKEF and Mx (Fig. 4). In contrast, vaccination with Et49 alone caused significant induction of only IgM, MHC I␣, MHC II␣, and Mx. 4. Discussion
Fig. 3. Serum antibody response of fish vaccinated with different Et49 formulations. Japanese founder were vaccinated with purified recombinant Et49, Et49–AH, Et49–AP, Et49–FIA, or PBS. Sera were collected at 5–8 weeks post-vaccination. Serum antibodies against Et49 were determined by ELISA. *P < 0.05; **P < 0.001.
Our previous study has shown that Et49, when co-administered with a bacterial adjuvant, produced a RPS that is less than 50% in Japanese flounder [30]. This result suggests that Et49 is weakly immunogenic and thus may be used for the study of adjuvant effect. In this study, using purified recombinant Et49 as an example of E. tarda subunit vaccine, we compared the immunological effect of Freund’s incomplete adjuvant with those of aluminum compounds. Our results showed that, as far as the effect on the immunoprotection efficacy of Et49 is concerned, FIA is the most potent adjuvant. Many studies on fish vaccines formulated with oil-based adjuvants have indicated a persistence of antigen at the injection site, which is an important depot mechanism that enables the antigen to be released in a slow and sustained fashion, whereby increasing the exposure time of the antigen to the immune system. Similarly, in this study, we found that Et49 incorporated into FIA persisted among the visceral organs for at least 2 months, which
1836
X.-d. Jiao et al. / Vaccine 28 (2010) 1832–1837
may in part account for the strong immunopotentiating activity of FIA. Unlike oil emulsions such as FIA-adjuvanted vaccines, antigens compounded with aluminum adjuvants are absorbed to the aluminum salts through electrostatic interactions and thus are easily dissociated from the adjuvant and diffuse away from the injection site [40]. Therefore, the depot effect is likely to be short in aluminum-adjuvanted vaccines. In fact, several studies have demonstrated that antigens were rapidly released from aluminum adjuvants following vaccination [41–43]. In our study, vaccine mixtures of Et49–AH and Et49–AP were observed at the peritoneal cavity during the 1st week post-vaccination but were undetectable by 4 weeks post-vaccination. It is possible that, given the mechanism of interaction between antigen and aluminum adjuvants, some Et49 may have escaped from the aluminum gels even during the 1st week post-vaccination. In any case, it is evident that aluminum-adjuvanted Et49 was less persistent than FIA-Et49, which is in line with the result that aluminum-adjuvanted formulations were less effective in augmenting the protective immunity induced by Et49. For many fish species, antibody-mediated humoral immunity plays an essential role in the defense against bacterial infections. As a result, passive immunization has been shown to induce significant protection in fish against pathogens such as Vibrio anguillarum, Aeromonas hydrophila, Flavobacterium psychrophilum, Streptococcus agalactiae, and Streptococcus iniae [44–48]. In our study, fish vaccinated with FIA- and aluminum-adjuvanted Et49 produced specific antibodies that are significantly higher in titers than those produced by fish vaccinated with unadjuvanted Et49, suggesting that both FIA and the aluminum adjuvants enhanced humoral antibody response. However, passive immunization of naïve fish with sera from fish vaccinated with adjuvanted Et49 failed to elicit protection against E. tarda challenge. These results indicate that humoral immune response alone may not be enough to induce effective protective immunity, which is likely due to the fact that E. tarda is known to be an intracellular pathogen that can survive within phagocytic cells [49] and thus is able to evade, to a certain extent, the humoral arm of immune defense. Freund’s adjuvant is known to have a strong promoting effect on the induction of both humoral and cellular immunity. The mycobacterial component in FCA is particularly effective at inducing Th1 response via its ability to activate the pathways mediated by tolllike receptors. Unlike Freund’s adjuvant, aluminum salts appear to stimulate only Th2 type of immune response in mouse model and have no effect on Th1 type of immune reaction [18–20]. Other known action mechanisms of aluminum adjuvants include recruitment of antigen presenting cells, promoting the maturation of dendritic cells, and facilitating the activation of T cells [50–52]. In our study, we found that aluminum hydroxide and aluminum phosphate adjuvant augmented the expression of the same set of genes, most of which function in humoral immunity. However, although the expression of CD8␣, one of the markers of cellular response, was not significantly increased by aluminum adjuvants, the expression of NKEF and Mx was moderately induced. Since both Mx and NKEF are important mediators of immune defense against virus and other forms of intracellular pathogens [53,54], it is possible that the enhanced expression of NKEF and Mx may contribute to the immunoprotection induced by aluminum-adjuvanted Et49 against E. tarda, which, as mentioned earlier, is an intracellular pathogen. In contrast to vaccination with aluminum-adjuvanted Et49, vaccination with FIA-adjuvanted Et49 enhanced the expression of a wide range of genes that are likely to participate in humoral immunity and innate cellular immunity mediated by activated natural killer cells and phagocytes. The most drastic difference between the expression profiles induced by FIA-adjuvanted Et49 and aluminum-adjuvanted Et49 was observed in the expression
of the genes encoding MHC I␣, CD8␣, Mx, IFN-␥, TNF-␣, and IL6, which are associated with cellular, antiviral, and inflammatory responses. In addition, CD40, which is involved in the activation of antigen presenting cells, was also induced significantly by FIA but not by aluminum compounds. These results suggest that, for Japanese flounder, FIA is a more potent immunostimulator than aluminum compounds. In conclusion, our study demonstrate that, as far as the effect on protection efficacy is concerned, FIA is a more effective adjuvant than aluminum compounds, probably due to its ability to induce a much broader range of immune response. Aluminum-based adjuvants are inferior to FIA in adjuvanticity and promote relatively a narrow range of immune reactions, yet they have the advantage of being safer, more cost-efficient, and easier to prepare. Therefore, FIA and aluminum adjuvants may be applied to different vaccination situations that require different adjuvant properties. Acknowledgements This work was supported by the National Basic Research Program of China grant 2006CB101807 and the Ministry of Science and Technology grant 2008AA092501. References [1] Berg A, Rodseth OM, Hansen T. Fish size at vaccination influence the development of side-effects in Atlantic salmon (Salmo salar L.). Aquaculture 2007;265:9–15. [2] Bowden TJ, Lester K, MacLachlan P, Bricknell IR. Preliminary study into the short term effects of adjuvants on Atlantic halibut (Hippoglossus hippoglossus L.). Bull Eur Ass Fish Pathol 2000;20:148–52. [3] Bravo S, Midtlyng PJ. The use of fish vaccines in the Chilean salmon industry 1999–2003. Aquaculture 2007;270:36–42. [4] Midtlyng PJ, Lillehaug A. Growth of Atlantic salmon Salmo salar after intraperitoneal administration of vaccines containing adjuvants. Dis Aquat Organ 1998;32:91–7. [5] Midtlyng PJ, Reitan LJ, Lillehaug A, Ramstad A. Protection, immune responses and side effects in Atlantic salmon (Salmo salar L.) vaccinated against furunculosis by different procedures. Fish Shellfish Immunol 1996;6:599–613. [6] Midtlyng PJ, Reitan LJ, Speilberg L. Experimental studies on the efficacy and side-effects of intraperitoneal vaccination of Atlantic salmon (Salmo salar L.) against furunculosis. Fish Shellfish Immunol 1996;6:335–50. [7] Mutoloki S, Alexandersen S, Evensen O. Sequential study of antigen persistence and concomitant inflammatory reactions relative to side-effects and growth of Atlantic salmon (Salmo salar L.) following intraperitoneal injection with oiladjuvanted vaccines. Fish Shellfish Immunol 2004;16:633–44. [8] Mutoloki S, Alexandersen S, Gravningen K, Evensen O. Time-course study of injection site inflammatory reactions following intraperitoneal injection of Atlantic cod (Gadus morhua L.) with oil-adjuvanted vaccines. Fish Shellfish Immunol 2008;24:386–93. [9] Olivier G, Evelyn TPT, Lallier R. Immunogenicity of vaccines from a virulent and an avirulent strain of Aeromonas salmonicida. J Fish Dis 1985;8:43–55. [10] Poppe TT, Breck O. Pathology of Atlantic salmon Salmo salar intraperitoneally immunized with oil-adjuvanted vaccine. A case report. Dis Aquat Organ 1997;29:219–26. [11] Mulvey B, Landolt ML, Busch RA. Effects of potassium sulphate (alum) used in Aeromonas salmonicida bacterin on Atlantic salmon, Salmo salar L. J Fish Dis 1995;18:495–506. [12] Horne MT, Roberts, Tatner M. The effects of the use of potassium alum adjuvant in vaccines against vibriosis in rainbow trout, Salmo gairdneri Richardson. J Fish Dis 1984;7:91–9. [13] Lindblad EB. Freund’s adjuvants. In: O’Hagan DT, editor. Methods in molecular medicine: Vaccine adjuvants—preparation methods and research protocols. Totowa, NJ: Humana Press; 2000. p. 49–63. [14] Stills Jr HF. Adjuvants and antibody production: dispelling the myths associated with Freund’s complete and other adjuvants. ILAR J 2005;46:280–93. [15] Glenny AT, Pope CG, Waddington H, Wallace U. Immunological notes. XXIII. The antigenic value of toxoid precipitated by potassium alum. J Pathol Bacteriol 1926;29:31–40. [16] Gupta RK. Aluminum compounds as vaccine adjuvants. Adv Drug Deliv Rev 1998;32:155–72. [17] Hem SL, White JL. Structure and properties of aluminum-containing adjuvants. Pharm Biotechnol 1995;6:249–76. [18] Bomford R. The comparative selectivity of adjuvants for humoral and cellmediated immunity. Clin Exp Immunol 1980;39:435–41. [19] Bomford R, Stapleton M, Winsor S, McKnight A, Andronova T. The control of the antibody isotype response to recombinant human immunodeficiency virus gp120 antigen by adjuvants. AIDS Res Hum Retroviruses 1992;8:1765–71.
X.-d. Jiao et al. / Vaccine 28 (2010) 1832–1837 [20] Comoy EE, Capron A, Thyphronitis G. In vivo induction of types 1 and 2 immune responses against protein antigens. Int Immunol 1997;9:523–31. [21] Gupta RK, Rost BE, Relyveld E, Siber GR. Adjuvant properties of aluminum and calcium compounds. In: Powell MF, Newman MJ, editors. Vaccine design: The subunit and adjuvant approach. New York: Plenum Press; 1995. p. 229–48. [22] Castro N, Toranzo A, Barja J, Nunez S, Magarinos B. Characterization of Edwardsiella tarda strains isolated from turbot, Psetta maxima (L.). J Fish Dis 2006;29:541–7. [23] Kubota SS, Kaige N, Miyazaki T, Miyashita T. Histopathological studies on edwardsiellosis of tilapia, 1: natural infection. Bull Fac Fish Mie Univ 1981;9:155–6. [24] Meyer FP, Bullock GL. Edwardsiella tarda, a new pathogen of channel catfish (Ictalurus punctatus). Appl Microbiol 1973;25:155–6. ˜ ˜ [25] Castro N, Toranzo AE, Núnez S, Magarinos B. Development of an effective Edwardsiella tarda vaccine for cultured turbot (Scophthalmus maximus). Fish Shellfish Immunol 2008;25:208–12. [26] Kwon SR, Nam YK, Kim SK, Kim KH. Protection of tilapia (Oreochromis mosambicus) from edwardsiellosis by vaccination with Edwardsiella tarda ghosts. Fish Shellfish Immunol 2006;20:621–6. [27] Lee DJ, Kwon SR, Zenke K, Lee EH, Nam YK, Kim SK, et al. Generation of safety enhanced Edwardsiella tarda ghost vaccine. Dis Aquat Organ 2008;81:249–54. [28] Park SI. Disease control in Korean aquaculture. Fish Pathol 2009;44:19–23. [29] Verjan N, Hirono I, Aoki T. Genetic loci of major antigenic protein genes of Edwardsiella tarda. Appl Environ Microbiol 2005;71:5654–8. [30] Hou J, Zhang W, Sun L. Immunoprotective analysis of two Edwardsiella tarda antigens. J Gen Appl Microbiol 2009;55:57–61. [31] Zhang M, Sun K, Sun L. Regulation of autoinducer 2 production and luxS expression in a pathogenic Edwardsiella tarda strain. Microbiology 2008;154:2060–9. [32] Sambrook J, Fritsch E, Maniatis T. Molecular cloning: A laboratory manual. New York: Cold Spring Harbor Laboratory Press; 1989 p. 67–71. [33] Burrell LS, Johnston CT, Schulze D, Klein J, White JL, Hem SL. Aluminium phosphate adjuvants prepared by precipitation at constant pH. Part I: composition and structure. Vaccine 2000;19:275–81. [34] Burrell LS, Johnston CT, Schulze D, Klein J, White JL, Hem SL. Aluminium phosphate adjuvants prepared by precipitation at constant pH. Part II: physicochemical properties. Vaccine 2000;19:282–7. [35] Amend DF. Potency testing of fish vaccines. In: International Symposium on fish biologics: Serodiagnostics and vaccines. Dev Biol Stand 1981;49:447–54. [36] Pirarat N, Kobayashi T, Katagiri T, Maita M, Endo M. Protective effects and mechanisms of a probiotic bacterium Lactobacillus rhamnosus against experimental Edwardsiella tarda infection in tilapia (Oreochromis niloticus). Vet Immunol Immunopathol 2006;113:339–47. [37] Jiao X, Zhang M, Hu Y, Sun L. Construction and evaluation of DNA vaccines encoding Edwardsiella tarda antigens. Vaccine 2009;27:5195–202. [38] Pasnik DJ, Evans JJ, Klesius PH. Passive immunization of Nile tilapia (Oreochromis niloticus) provides significant protection against Streptococcus agalactiae. Fish Shellfish Immunol 2006;21:365–71.
1837
[39] Zhang W, Sun S, Cheng S, Sun L. Characterization of DegQVh , a serine protease and a protective immunogen from a pathogenic Vibrio harveyi strain. Appl Environ Microbiol 2008;74:6254–62. [40] Gupta RK, Rost BE. Aluminum compounds as vaccine adjuvants. In: O’Hagan DT, editor. Methods in Molecular Medicine. Vaccine Adjuvants—Preparation Methods and Research Protocols, vol. 42. Totowa, NJ: Humana Press; 2000, pp.65–89. [41] Heimlich JM, Regnier FE, White JL, Hem SL. The in vitro displacement of adsorbed model antigens from aluminum-containing adjuvants by interstitial proteins. Vaccine 1999;17:2873–81. [42] Seeber SJ, White JL, Hem SL. Solubilization of aluminum-containing adjuvants by constituents of interstitial fluid. J Parenter Sci Technol 1991;45:156–9. [43] Weissburg RP, Berman PW, Cleland JL, Eastman D, Farina F, Frie S, et al. Characterization of the MN gp120 HIV-1 vaccine: antigen binding to alum. Pharm Res 1995;12:1439–46. [44] Akhlaghi M. Passive immunisation of fish against vibriosis, comparison of intraperitoneal, oral and immersion routes. Aquaculture 1999;180:191–205. [45] Arasteh N, Aminirissehei AH, Yousif AN, Albright LJ, Durance TD. Passive immunization of rainbow trout (Oncorhynchus mykiss) with chicken egg yolk immunoglobulins (IgY). Aquaculture 2004;231:23–36. [46] LaFrentz BR, LaPatra SE, Jones GR, Cain KD. Passive immunization of rainbow trout, Oncorhynchus mykiss (Walbaum), against Flavobacterium psychrophilum, the causative agent of bacterial coldwater disease and rainbow trout fry syndrome. J Fish Dis 2003;26:371–84. [47] Lapatra SE, Plant KP, Alcorn S, Ostland V, Winton J. An experimental vaccine against Aeromonas hydrophila can induce protection in rainbow trout, Oncorhynchus mykiss (Walbaum). J Fish Dis, doi:10.1111/j.1365-2761.2009.01098. [48] Shelby RA, Klesius PH, Shoemaker CA, Evans JJ. Passive immunization of tilapia, Oreochromis niloticus (L.), with anti-Streptococcus iniae whole sera. J Fish Dis 2002;25:1–6. [49] Rao PSS, Lim TM, Leung KY. Opsonized virulent Edwardsiella tarda strains are able to adhere to and survive and replicate within fish phagocytes but fail to stimulate reactive oxygen intermediates. Infect Immun 2001;69:5689–97. [50] Hem SL, Hogenesch H. Relationship between physical and chemical properties of aluminum-containing adjuvants and immunopotentiation. Expert Rev Vaccines 2007;6:685–98. [51] HogenEsch H. Mechanisms of stimulation of the immune response by aluminum adjuvants. Vaccine 2002;20:S34–9. [52] Lindblad E. Aluminum compounds for use in vaccines. Immunol Cell Biol 2004;82:497–805. [53] Geiben-Lynn R, Kursar M, Brown NV, Addo MM, Shau H, Lieberman J, et al. HIV-1 antiviral activity of recombinant natural killer cell enhancing factors, NKEF-A and NKEF-B, members of the peroxiredoxin family. J Biol Chem 2003;278:1569–74. [54] Haller O, Stertz S, Kochs G. The Mx GTPase family of interferon-induced antiviral proteins. Microbes Infect 2007;9:1636–43.