- Email: [email protected]
Cultured Skin Fibroblasts Isolated from Mice Devoid of the Prion Protein Gene Express Major Heat Shock Proteins in Response to Heat Stress
EXPERIMENTAL NEUROLOGY ARTICLE NO.
151, 105–115 (1998)
EN986796
Cultured Skin Fibroblasts Isolated from Mice Devoid of the Prion Protein Gene Express Major Heat Shock Proteins in Response to Heat Stress Jun-Ichi Satoh,*,1 Motohiro Yukitake,* Kazuhiro Kurohara,* Noriyuki Nishida,† Shigeru Katamine,† Tsutomu Miyamoto,† and Yasuo Kuroda* *Division of Neurology, Department of Internal Medicine, Saga Medical School, Saga 849, Japan; and †Department of Bacteriology, Nagasaki University School of Medicine, Nagasaki 852, Japan Received September 17, 1997; accepted January 28, 1998
INTRODUCTION Recent evidence has suggested that molecular chaperones participate in the conformational change between the normal cellular prion protein (PrPC ) and its scrapie isoform (PrPSc ). To study a role of PrPC in the regulation of expression of heat shock proteins (HSPs), a group of molecular chaperones, heat-induced expression of major HSPs (HSP105, HSP90a, HSP72, HSC70, HSP60, and HSP25) was investigated in cultured skin fibroblasts isolated from the mice homogeneous for a disrupted PrP gene (PrP2/2 mice) by Western blot analysis and immunocytochemistry. Two lines of fibroblasts were established and designated SFK derived from the PrP2/2 mice and SFH derived from the PrP1/1 mice, respectively. In both SFK and SFH cells, HSP105, HSP72, and HSP25 were expressed at low levels under unstressed conditions but they were induced markedly following exposure to heat stress (43°C/20 min) at 3–72 h postrecovery. In both cell types, HSC70 and HSP60 were expressed at high levels under unstressed conditions and their levels remained unchanged after heat shock treatment. HSP90a was undetectable in both cell types under any conditions examined. The pattern of expression, induction, and subcellular location of HSP105, HSP72, HSC70, HSP60, and HSP25 was not significantly different between SFK and SFH cells under unstressed and heat-stressed conditions. Furthermore, the levels of constitutive expression of HSP105, HSC70, HSP60, and HSP25 were similar between the brain tissues isolated from the PrP2/2 and PrP1/1 mice. These results indicate that HSP induction is not affected by either the existence or the absence of PrPC in the cells. r 1998 Academic Press Key Words: heat shock proteins; heat stress; prion protein-deficient mice.
1 To whom correspondence should be addressed at Division of Neurology, Department of Internal Medicine, Saga Medical School, 5-1-1 Nabeshima, Saga 849, Japan. Fax: 81-952-34-2017. E-mail: [email protected].
Heat shock proteins (HSPs) are produced by all prokaryotic and eukaryotic cells in response to heat stress and other noxious stimuli (25). HSPs serve as an indicator by which the extent of cellular stress is monitored (14, 30). It has been shown that an enhanced expression of HSPs can confer tolerance against stress in a variety of cell types, while their insufficient expression makes the cells vulnerable to stress, supporting the concept that HSPs play a protective role against irreversible cell damage (19, 24, 34, 41, 45). Some HSPs are expressed constitutively in unstressed cells in which they act as molecular chaperones that play pivotal roles not only in folding/unfolding, assembly/ disassembly, and translocation of cellular proteins but also in preventing inappropriate protein–protein interactions during maturation of the cellular protein structures (17, 18). HSPs are categorized into several groups based on their molecular weights, i.e., the HSP105, HSP90, HSP70, HSP60, and small (25–30 kDa) HSP families. Prion diseases are a group of transmissible neurodegenerative disorders characterized by intracerebral accumulation of an abnormal prion protein (PrPSc ) that causes pathological hallmarks of neuronal degeneration, spongiosis, deposition of amyloid plaques, and astrogliosis (37, 38, 40). The prion is an unconventional pathogen composed predominantly of the PrPSc protein that is identical in the amino acid sequence to the cellular isoform (PrPC ) (31). The gene coding for the PrPC protein is expressed constitutively in a wide variety of neural and nonneural cells and tissues, at the highest level in neurons in the central nervous system (2, 11, 42), although the biological functions of this protein remain unknown (37, 38, 40). The circadian activity rhythms are altered in the mice devoid of the PrP gene (PrP2/2 ) and the GABAA receptor-mediated fast inhibition is impaired in the hippocampus of these mice (13, 56). Recently, we (NN, SK, TM) have demonstrated that the PrP2/2 mice exhibit a progressive
105
0014-4886/98 $25.00 Copyright r 1998 by Academic Press All rights of reproduction in any form reserved.
106
SATOH ET AL.
ataxia after 70 weeks of age due to an extensive loss of Purkinje cells in the cerebellum, suggesting that the PrPC protein is essential for the survival of defined populations of neurons (44). The PrPSc protein differs biochemically from PrPC by its b-sheet-enriched structure, detergent insolubility, limited proteolysis by proteinase K, and the slower turnover rate (3). It has been proposed that the conversion of PrPC into PrPSc is mediated by a homotypic interaction between the endogeneous PrPC and the incoming or de novo-generated PrPSc via an as yet undefined posttranslational process that involves the unfolding of a-helices and their refolding into b-sheets (33). From this point of view, prion diseases can be considered as a disorder of protein conformation. Previous attempts to mix PrPSc with PrPC in vitro failed to produce nascent PrPSc, raising the possibility that certain auxiliary protein(s) acting as molecular chaperones might be involved in catalyzing the conformational change between PrPC and PrPSc (23, 29, 33, 54). Several lines of recent evidence suggested that a speciesspecific chaperone-like macromolecule denoted protein X can bind to the C-terminal region of PrPC during the formation of nascent PrPSc, offering an explanation for the species barrier observed in the transmission of human prions into mice (40, 55). Recently, HSPs have been proposed as one of molecular chaperones involving in the conformational conversion between PrPC and PrPSc. In Saccharomyces cerevisiae, HSP104 promotes disaggregation of heat-denatured proteins, facilitates acquisition of thermotolerance, and regulates the conformational transformation of the yeast prion-like factor (PSI 1 ) (12, 35, 36, 52). In addition to HSP104, GroEL, an Escherichia coli homologue of mammalian HSP60, stimulates the conformational transition of PrPC to its protease-resistant form in the presence of preexisting PrPSc in vitro (15). With respect to the mammalian nervous system, the expression of HSP70 mRNA is elevated during scrapie infection in mouse brain (22) where an enhanced expression of HSP72 is identified in astrocytes (16). The expression of HSP27, a human homologue of mouse HSP25, is found to be up-regulated in degenerating neurons in the cortex of Creutzfeldt-Jakob disease brains (21). A recent study demonstrated that the Cu/Zn superoxide dismutase (SOD) activity is reduced greatly in the brains of the PrP2/2 mice where neural cells are potentially more vulnerable to oxidative stress (6). A different study showed that neither HSP72 nor HSP25 is inducible in the scrapie-infected mouse neuroblastoma cells (53). This study indicates that the regulation of stress responses is altered by the propagation of PrPSc in the scrapie-infected cells, raising the possibility that the PrPSc protein might interfere with PrPC which could act as a sensor or a regulator for stress signal-transducing events in the cells and putting forth the hypothesis that
an aberrant induction of HSPs in the PrP-deficient cells might cause the degeneration of stress-susceptible neurons in the PrP2/2 mice. To evaluate this hypothesis in the present study using Western blot analysis and immunocytochemistry, the heat-induced and constitutive expression of major HSP including HSP105, HSP90a, HSP72, heat shock cognate protein HSC70, HSP60, and HSP25 was investigated in cultured skin fibroblasts as well as in the brain tissues isolated from the PrP2/2 mice. MATERIALS AND METHODS
Establishment of Skin Fibroblast Cell Lines Isolated from Mice Devoid of the Prion Protein Gene Primary cultures of fibroblasts were prepared from abdominal skin explants isolated from the mice homogeneous for a disrupted PrP gene (PrP2/2 mice) and the wild-type mice with the same genetic background (PrP1/1 mice) at ages of 35 to 50 weeks. The method for production of the PrP2/2 mice was described in detail elsewhere (43, 44). The cultures were incubated at 37°C in a 5% CO2/95% air incubator in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum, 100 U/ml penicillin, and 100 µg/ml streptomycin (feeding medium). Following maintenance of the cultures for more than 2 months, the cells with a capacity to proliferate without requirement of exogeneous growth factors were isolated. The established cell lines were designated SFK for the cells isolated from the PrP2/2 mice and SFH for those of the PrP1/1 mice, respectively. The cells were plated in 25-cm2 culture flasks at a density of 106 cells/ml for Western blot analysis or on poly-L-lysine-coated 9-mm round cover glasses at a density of 5 3 104 cells/coverslip for immunocytochemical studies. The expression of a battery of HSPs was also examined in the cerebral tissues isolated from the aged (70- to 80-week-old) PrP2/2 and PrP1/1 mice. Heat Stress Heat shock treatment was carried out according to the method described previously (46–48). Briefly, culture flasks and dishes were sealed and submerged in a water bath controlled at 43 6 0.4°C for 20 min (short period of stress) or at 42 6 0.4°C for 6 h (long period of stress). Immediately after this treatment, they were placed in a 5% CO2/95% air incubator at 37°C and the cells were allowed to recover for specified periods of time. Extraction of DNA and RNA The genomic DNA was isolated form the cells using the GenomicPrep cells and tissue DNA isolation kit (Pharmacia, Piscataway, NJ) according to the manufac-
107
PrP-DEFICIENT CELLS EXPRESS HSP
turer’s instructions. Total RNA was extracted from the cells using Trizol reagent (GIBCO-BRL, Gaithersburg, MD) by the acid guanidinium thiocyanate–phenol– chloroform method. The concentration and purity of isolated DNA and RNA were assessed by reading UV absorbance at 260 and 280 nm on a Beckman UV spectrophotometer. For reverse transcription–polymerase chain reaction (RT-PCR) analysis, 5 µg of RNA from each sample was subjected to DNase treatment and then processed for cDNA synthesis using oligo(dT) 12–18 primers and SuperScript II reverse transcriptase (GIBCO-BRL). PCR Analysis PCR analysis was performed according to the method described previously (49–51). In brief, 50 ng of genomic DNA or cDNA was amplified by PCR in a programmable thermal cycler (Takara, Tokyo, Japan) using specific sense and antisense primers for the mouse PrP gene (58CATTTTGGCAACGACTGGGAGGAC38 and 58GACTCCATCAAAGGGACCTGAAGC38; the size of the expected product is 551 bp) (26) or b-actin gene (58GAGCACAGCTTCTTTGCAGCTCCT38 and 58GGTCAGGATACCTCTCTTGCTCTG38; the size of the expected product is 255 bp) (57) as a reaction standard. PCR was carried out in 50 µl of reaction mixture containing Taq DNA polymerase buffer (20 mM Tris– HCl, pH 8.4, 50 mM KCl, 200 µM dNTP, 1.5 mM MgCl2, 0.5 µM each primer) and 1.25 U Taq DNA polymerase (GIBCO-BRL). The amplification program consisted of a denaturing step at 94°C for 1 min, an annealing step at 61°C for 40 s, and an extension step at 72.9°C for 50 s for 30 cycles. In RT-PCR analysis, total RNA was processed for PCR without inclusion of the step of reverse transcription to confirm the absence of contaminating genomic DNA. Western Blot Analysis Western blot analysis was performed according to the method described previously (46–48). To prepare total cellular protein extracts, the cells and tissues were homogenized in a lysis buffer composed of 50 mM Tris–HCl, pH 6.8, 2 mM EDTA, 2 mM phenylmethylsulfonyl fluoride, 5 µg/ml leupeptin, 20 µg/ml aprotinin, 10 µg/ml pepstatin A, 2% sodium dodecyl sulfate (SDS). Then, they were centrifuged at 12,000 rpm for 30 min at room temperature (RT). The supernatants were collected for separation on 6, 8, 10, or 12% SDS– polyacrylamide gel electrophoresis (SDS–PAGE). After gel electrophoresis, proteins transferred onto nitrocellulose membranes were immunolabeled at RT for 1 h with goat anti-mouse HSP105 antibody (1:2000), goat antimouse HSP90a antibody (1:2000), mouse anti-human HSP72 monoclonal antibody (1:4000), goat anti-mouse HSC70 antibody (1:2000), goat anti-mouse HSP60 anti-
body (1:2000), or goat anti-mouse HSP25 antibody (1:2000). They were then incubated at RT for 1 h with horseradish peroxidase (HRP)-conjugated anti-goat IgG (1:2000) for HSP105, HSP90a, HSC70, HSP60, or HSP25 or with HRP-conjugated anti-mouse IgG (1: 2000) for HSP72. All the primary and secondary antibodies described above except for the mouse anti-human HSP72 monoclonal antibody (Amersham International plc, Buckinghamshire, England) were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). The specific reaction was visualized on an autoradiographic film (Hyperfilm) using the enhanced chemiluminescence (ECL)–Western blot detection system (Amersham). The protein concentration was determined by the Bradford assay kit (Bio-Rad, Hercules, CA). Immunocytochemistry Immunocytochemical studies were performed according to the methods described previously (46–48). Briefly, the cells on coverglasses were fixed at 4°C for 15 min in 4% paraformaldehyde in 0.1 M phosphate buffer (pH 7.4), followed by a 30-min incubation in phosphatebuffered saline containing 0.5% Triton X-100. They were then incubated with the goat antibodies against HSP105, HSP90a, HSC70, HSP60, or HSP25 (1:20 each) or with the mouse anti-HSP72 monoclonal antibody (1:100) described above, followed by incubation with FITC-conjugated anti-goat IgG (1:40; Santa Cruz Biotechnology) or with FITC-conjugated anti-mouse IgG (1:40; Santa Cruz Biotechnology). They were washed and incubated with TRITC-labeled phalloidin (15 µg/ml; Sigma, St. Louis, MO) which reacts with F actin bundles (58). The incubation with primary and secondary antibodies described above was performed at RT for 30 min. After several washes, the coverglasses mounted on slides with glycerol–polyvinyl alcohol were examined under a Zeiss Universal Microscope equipped with phase contrast, fluorescein, and rhodamine optics. The intensity of immunolabeling was graded as (2) negative, (1) weakly positive, and (11) intensely positive. Photographs were taken on Kodak Tri-X Pan (ASA 400) films. RESULTS
Absence of the PrP Gene in Cultured Skin Fibroblasts Isolated from the PrP2/2 Mice At first, the absence of the PrP gene in cultured skin fibroblasts isolated from the PrP2/2 mice utilized in our study was confirmed by PCR analysis. The PrP gene was found to be undetectable at both genomic DNA and mRNA levels in SFK cells derived from the PrP2/2 mice, whereas its expression was detectable in SFH cells derived from the PrP1/1 mice (Fig. 1a, lanes 3 and 4;
108
SATOH ET AL.
FIG. 1. Absence of the PrP gene in cultured skin fibroblasts isolated from the PrP2/2 mice. Two cell lines termed SFK and SFH were established from primary cultures of skin fibroblasts derived from the PrP2/2 mice (SFK) or from the PrP1/1 mice (SFH). Fifty nanograms of (a) genomic DNA or (b) cDNA prepared from total RNA by reverse transcription was amplified by PCR using the primers specific for the b-actin gene (the expected size of the product is 255 bp) or the PrP gene (the expected size of the product is 551 bp). The amplified products were separated on a 1.5% agarose gel. (a) PCR analysis of the PrP gene at the genomic DNA level. Lanes 1 to 4, as follows: (lane 1) the b-actin gene in SFK; (lane 2) the b-actin gene in SFH; (lane 3) the PrP gene in SFK; and (lane 4) the PrP gene in SFH. (b) RT-PCR analysis of the PrP gene at the mRNA level. (Top) The PrP gene and (bottom) the b-actin gene. Lanes 1 to 4, as follows: (lane 1) RNA of SFK processed for PCR omitting the step of reverse transcription; (lane 2) RNA of SFK processed for PCR with inclusion of the step of reverse transcription; (lane 3) RNA of SFH processed for PCR omitting the step of reverse transcription; and (lane 4) RNA of SFH processed for PCR with inclusion of the step of reverse transcription. The DNA size marker (bp) is shown on the left.
Fig. 1b, top, lanes 2 and 4). In contrast, the b-actin gene was expressed in both SFK and SFH cells (Fig. 1a, lanes 1 and 2; Fig. 1b, bottom, lanes 2 and 4). In RT-PCR analysis, no products were amplified in total RNA isolated from each sample processed for PCR without reverse transcription, confirming that a contamination of genomic DNA was excluded (Fig. 1b, lanes 1 and 3). Heat-Inducible Expression of HSP105 in Cultured Skin Fibroblasts Isolated from the PrP2/2 and PrP1/1 Mice The cells were exposed to heat stress by incubation either at 43°C for 20 min or at 42°C for 6 h in a water bath, allowed to recover at 37°C for 0–72 h, and then processed for Western blot analysis and immunocytochemistry. Under unstressed conditions, very low levels of HSP105 expression were identified in both SFK and SFH cells by Western blot analysis (Fig. 2A, lane 1). The constitutive expression was below the detection limit by immunocytochemistry. After exposure to a 20
min heat shock at 43°C, the levels of HSP105 expression were elevated markedly in both cell types at 3–72 h postrecovery with its maximal expression at 8 h (Fig. 2A, lanes 2–5). At the peak of HSP105 expression, a weak and diffuse HSP105 immunoreactivity was identified in the cytoplasmic and nuclear regions of these cells (data not shown). HSP105 expression was not enhanced in these cells by exposure to the longer period of heat stress (42°C/6 h) (Fig. 2A, lane 6). The pattern of expression and induction of HSP105 following heat stress was not different between SFK and SFH cells. Nonexpression of HSP90a in Cultured Skin Fibroblasts Isolated from the PrP2/2 and PrP1/1 Mice HSP90a was undetectable by Western blot analysis and immunocytochemistry in both SFK and SFH cells under unstressed and heat-stressed conditions during the whole recovery time (Fig. 2B, lanes 1–5), while it was detectable at an appreciable level in unstressed
PrP-DEFICIENT CELLS EXPRESS HSP
109
HeLa cells (Fig. 2B, lane 7). HSP90a was not induced in SFK or SFH cells even after exposure to the longer period of heat stress (42°C/6 h) (Fig. 2B, lane 6). Heat-Inducible Expression of HSP72 in Cultured Skin Fibroblasts Isolated from the PrP2/2 and PrP1/1 Mice HSP72 was barely detectable in both SFK and SFH cells by Western blot analysis under unstressed conditions (Fig. 3A, lane 1) in which an extremely weak band of HSP72 became visible when the blots were overexposed on an autoradiographic film (data not shown). After exposure to heat stress (43°C/20 min), HSP72 was
FIG. 3. Western blot analysis of HSP72 and HSC70 in cultured skin fibroblasts isolated from the PrP2/2 and PrP1/1 mice. The cultured skin fibroblast cell lines termed SFK (PrP2/2) and SFH (PrP1/1) were either unstressed or heat-stressed at 43°C for 20 min followed by recovery at 37°C for 3–72 h or heat-stressed at 42°C for 6 h without recovery. Total cellular protein extracts were separated on a 12% SDS–PAGE gel, transferred onto a nitrocellulose membrane, and immunolabeled with specific antibodies. The left half is the blots of SFK, while the right half is those of SFH. (A) HSP72. (B) HSC70. Lanes 1–6, as follows: (lane 1) unstressed; (lane 2) 3 h, (lane 3) 8 h, (lane 4) 24 h, and (lane 5) 72 h postrecovery after exposure to heat stress (43°C/20 min); and (lane 6) immediately after exposure to heat stress (42°C/6 h). Each lane represents 10 µg of protein prior to transblotting. The molecular weight marker (kDa) is shown on the left. FIG. 2. Western blot analysis of HSP105 and HSP90a in cultured skin fibroblasts isolated from the PrP2/2 and PrP1/1 mice under unstressed and heat-stressed conditions. The cultured skin fibroblast cell lines termed SFK (PrP2/2 ) and SFH (PrP1/1 ) were either unstressed or heat-stressed at 43°C for 20 min followed by recovery at 37°C for 3–72 h or heat-stressed at 42°C for 6 h without recovery. Total cellular protein extracts were separated on a (A) 6% or (B) 10% SDS–PAGE gel, transferred onto a nitrocellulose membrane, and immunolabeled with specific antibodies. The left half is the blots of SFK, while the right half is those of SFH. (A) HSP105. (B) HSP90a. Lanes 1–6, as follows: (lane 1) unstressed; (lane 2) 3 h, (lane 3) 8 h, (lane 4) 24 h, and (lane 5) 72 h postrecovery after exposure to heat stress (43°C/20 min); and (lane 6) immediately after exposure to heat stress (42°C/6 h). Each lane (1–6) represents (A) 50 µg or (B) 20 µg of protein prior to transblotting, except for (B, lane 7) 4 µg of total cellular protein extracts of unstressed HeLa cells. The molecular weight marker (kDa) is shown on the left.
induced greatly in both cell types at 3–72 h postrecovery with its maximal expression at 3–24 h (Fig. 3A, lanes 2–5). During the whole recovery time, an intense HSP72 immunoreactivity was identified in their nuclear and cytoplasmic regions with some heterogeneous staining intensities in individual cells (Figs. 4a–4d). The dot-like structures in the nucleoplasm of these cells were found to be often devoid of HSP72 immunolabeling (Figs. 4a–4d). The HSP72 expression was also induced markedly in both cell types by exposure to the longer period of heat stress (42°C/6 h) (Fig. 3A, lane 6). The pattern of expression, induction, and subcellular
110
SATOH ET AL.
PrP-DEFICIENT CELLS EXPRESS HSP
111
location of HSP72 following heat stress was not different between SFK and SFH cells. Constitutive Expression of HSC70 in Cultured Skin Fibroblasts Isolated from the PrP2/2/ and PrP1/1 Mice Under unstressed conditions, HSC70 expression was detectable at high levels in both SFK and SFH cells by Western blot analysis (Fig. 3B, lane 1). The levels of HSC70 expression in both cell types remained unchanged following exposure to heat stress (43°C/20 min) during the whole recovery period (Fig. 3B, lanes 2–5). An intense HSC70 immunoreactivity forming dot-like accumulations was located in their nucleoplasmic regions (Figs. 4e–4h). The levels of HSC70 expression were unaltered again in these cells after exposure to the longer period of heat stress (42°C/6 h) (Fig. 3B, lane 6). The pattern of expression and subcellular location of HSC70 was not different between SFK and SFH cells under any conditions examined. Constitutive Expression of HSP60 in Cultured Skin Fibroblasts Isolated from the PrP2/2 and PrP1/1 Mice Under unstressed conditions, HSP60 expression was detectable at high levels in both SFK and SFH cells by Western blot analysis (Fig. 5A, lane 1). The levels of HSP60 expression in both cell types remained unchanged following exposure to heat stress (43°C/20 min) during the whole recovery period (Fig. 5A, lanes 2–5). An intense and fine-granular HSP60 immunoreactivity was identified in the cytoplasm but not in the nucleus of these cells under unstressed and heatstressed conditions (Figs. 6a–6d). The levels of HSP60 expression were unaltered again in these cells after exposure to the longer period of heat stress (42°C/6 h) (Fig. 5A, lane 6). The pattern of expression and subcellular location of HSP60 was not different between SFK and SFH cells under any conditions examined. Heat-Inducible Expression of HSP25 in Cultured Skin Fibroblasts Isolated from the PrP2/2 and PrP1/1 Mice Under unstressed conditions, low levels of HSP25 expression were detectable in both SFK and SFH cells by Western blot analysis (Fig. 5B, lane 1). After exposure to a 20-min heat shock at 43°C, the levels of HSP25 expression were elevated markedly in both cell
FIG. 5. Western blot analysis of HSP60 and HSP25 in cultured skin fibroblasts isolated from the PrP2/2 and PrP1/1 mice. The cultured skin fibroblast cell lines termed SFK (PrP2/2 ) and SFH (PrP1/1 ) were either unstressed or heat-stressed at 43°C for 20 min followed by recovery at 37°C for 3–72 h or heat-stressed at 42°C for 6 hr without recovery. Total cellular protein extracts were separated on a 12% SDS–PAGE gel, transferred onto a nitrocellulose membrane, and immunolabeled with specific antibodies. The left half is the blots of SFK, while the right half is those of SFH. (A) HSP60. (B) HSP25. Lanes 1–6, as follows: (lane 1) unstressed; (lane 2) 3 h, (lane 3) 8 h, (lane 4) 24 h, and (lane 5) 72 h postrecovery after exposure to heat stress (43°C/20 min); and (lane 6) immediately after exposure to heat stress (42°C/6 h). Each lane represents 10 µg of protein prior to transblotting. The molecular weight marker (kDa) is shown on the left.
types at 3–72 h postrecovery with its maximal expression at 8–24 h (Fig. 5B, lanes 2–5). An intense and diffuse HSP25 immunoreactivity was identified in the cytoplasm but not in the nucleus of these cells under unstressed and heat-stressed conditions (Figs. 6e–6h). HSP25 expression was also induced greatly in these cells by exposure to the longer period of heat stress
FIG. 4. Immunocytochemistry of HSP72 and HSC70 in cultured skin fibroblasts isolated from the PrP2/2 and PrP1/1 mice. The cultured skin fibroblast cell lines termed SKF (PrP2/2) and SFH (PrP1/1) were either unstressed or heat-stressed at 43°C for 20 min, allowed to recover at 37°C for 24 h, and then processed for double-labeling immunocytochemistry. (a, b) SFK at 24 h postrecovery after heat stress: (a) HSP72; (b) phalloidin. (c, d) SFH at 24 h postrecovery after heat stress: (c) HSP72; (d) phalloidin. (e,f ) unstressed SFK: (e) HSC70; (f ) phalloidin. (g, h) unstressed SFH: (g) HSC70; (h) phalloidin. Bar, 15 µm.
112
SATOH ET AL.
PrP-DEFICIENT CELLS EXPRESS HSP
113
(42°C/6 h) (Fig. 5B, lane 6). The pattern of expression, induction, and subcellular location of HSP25 following heat stress was not different between SFK and SFH cells. These results indicate that the pattern of constitutive and heat-inducible expression of major HSPs is similar between normal and PrP-deficient fibroblasts in culture. Constitutive Expression of Major HSPs in Brain Tissues Isolated from the PrP2/2 and PrP1/1 Mice Finally, the expression of major HSPs was studied by Western blot analysis in the brain tissues isolated form the aged PrP2/2 and PrP1/1 mice, the target organ in prion diseases. High levels of the constitutive expression of HSP105, HSC70, HSP60, and HSP25 were identified in the brain extracts derived from both mice without significant differences in the levels of their expression (Fig. 7, lanes 1–8). The constitutive expression of neither HSP90a nor HSP72 was detectable in the brain tissues of both mice when 20 µg of total protein of the extracts was analyzed (data not shown). These results indicate that the pattern of constitutive expression of major HSPs is similar between normal and PrP-deficient brain tissues. DISCUSSION
Using Western blot analysis and immunocytochemistry, the present study has demonstrated that the pattern of heat-inducible expression and subcellular location of HSP105, HSP72, HSC70, HSP60, and HSP25 is not significantly different between two distinct cultured skin fibroblasts isolated from the PrP2/2 and PrP1/1 mice. Furthermore, the pattern of constitutive expression of HSP105, HSC70, HSP60, and HSP25 is similar between the brain tissues isolated from the PrP2/2 and PrP1/1 mice. Our observations indicate that the constitutive and heat-inducible expression of major HSPs is not defective in the PrP-deficient cells. These results suggest that the PrPC protein may not serve as a sensor or a regulator for the heat shock response in the cells. The biological functions of PrPC remain unknown (37, 38, 40). A previous study revealed that the PrPC protein attached to the outer surface of cell membrane by a glycosyl phosphatidylinositol anchor is involved in activation of lymphocytes in response to mitogens (10). Recent studies have shown that the PrP2/2 mice exhibit
FIG. 7. Western blot analysis of major HSPs in brain tissues isolated from the PrP2/2 and PrP1/1 mice. Total protein extracts were prepared from the brain tissues of the cerebrum isolated from the PrP2/2 and PrP1/1 mice at ages of 70 to 80 weeks. They were separated on a 8% (for HSP105) or 12% (for HSC70, HSP60, and HSP25) SDS–PAGE gel, transferred onto a nitrocellulose membrane, and immunolabeled with specific antibodies. (A) HSP105. (B) HSC70. (C) HSP60. HSP25. Lanes 1, 3, 5, and 7 the brain tissues of the PrP2/2 mice; lanes 2, 4, 6, and 8, those of the PrP1/1 mice. Each lane represents 10 µg (lanes 3–6) or 20 µg (lanes 1, 2, 7, and 8) of protein prior to transblotting. The molecular weight marker (kDa) is shown on the left.
normal early development and maturation, suggesting that PrPC is a dispensable protein in the histogenesis (8, 27). On the other hand, the PrP2/2 mice are completely protected against scrapie infection and against prion-mediated neurotoxicity, indicating that the expression of PrPC is essential for induction of the prion diseases (4, 5, 9, 39, 43). It has been shown that the PrP2/2 mice display an altered pattern of circadian activity rhythms, an impaired GABAA receptor-mediated fast inhibition in the hippocampus and a progressive cerebellar ataxia due to loss of the Purkinje cells, although the molecular mechanisms accounting for these abnormalities remain to be further elucidated (13, 44, 56). Recently, it has been proven that PrPC exists as a membrane-associated cupper-binding protein in vivo (7). Interestingly, the activity of Cu/Zn SOD, a major antioxidant enzyme, is found to be decreased substantially in the brains of the PrP2/2 mice (6). Based on these findings, the hypothesis could be put forward that the inability to control the stress responses due to generation of excessive oxygen free radicals, a potent inducer of HSP synthesis might affect physiological functions in the PrP-deficient cells (20, 32). However, our observations that HSP induction by heat stress is
FIG. 6. Immunocytochemistry of HSP60 and HSP25 in cultured skin fibroblasts isolated from the PrP2/2 and PrP1/1 mice. The cultured skin fibroblast cell lines termed SFK (PrP2/2 ) and SFH (PrP1/1 ) were either unstressed or heat-stressed at 43°C for 20 min, allowed to recover at 37°C for 24 h, and then processed for double-labeling immunocytochemistry. (a,b) unstressed SFK: (a) HSP60; (b) phalloidin. (c,d) unstressed SFH: (c) HSP60; (d) phalloidin. (e,f ) SFK at 24 h postrecovery after heat stress: (e) HSP25; (f ) phalloidin. (g,h) SFH at 24 h postrecovery after heat stress: (g) HSP25; (h) phalloidin. Bar, 15 µm.
114
SATOH ET AL.
not affected by either the existence or the absence of PrPC in the cells disagree with this hypothesis. A number of previous studies showed that HSPs play a protective role against irreversible damage in the cells exposed to stressful insults, while the deficient HSP induction makes the cells highly vulnerable to stress (19, 24, 41, 45). Our results where no differences were observed in the induction of major HSPs between the PrP2/2 and PrP1/1 cell types argue against the possibility that a reduced level of HSP synthesis might be the direct cause for the progressive degeneration of Purkinje cells in the cerebellum of the PrP2/2 mice (44). In our study, the HSP90a protein was undetectable in both PrP2/2 and PrP1/1 fibroblasts under unstressed and heat-stressed conditions, while its expression was identified in unstressed HeLa cells. These observations are consistent with several studies which reported that a set of HSPs is not expressed in certain cell types (1, 28, 46). In conclusion, the pattern of constitutive and heatinducible expression and subcellular location of major HSPs is similar between the PrP2/2 and PrP1/1 cells and tissues.
8.
9.
10.
11.
12.
13.
14. 15.
ACKNOWLEDGMENTS This work was in part supported by grants to J.S. from Grant-inAid for Scientific Research on Priority Areas (Regulation of Cellular Functions by Molecular Chaperones 09276225) and Grant-in-Aid for Scientific Research (C2-08670715) from the Ministry of Education, Science, and Culture of Japan; the Japan Brain Foundation; the Naito Foundation; and the Narabayashi Trust for ALS Research.
16.
17. 18. 19.
REFERENCES 1.
2.
3.
4.
5.
6.
7.
Aujame, L., and C. Morgan. 1985. Nonexpression of a major heat shock gene in mouse plasmacytoma MPC-11. Mol. Cell. Biol. 5: 1780–1783. Bendheim, P. E., H. R. Brown, R. D. Rudelli, L. J. Scala, N. L. Goller, G. Y. Wen, R. J. Kascsak, N. R. Cashman, and D. C. Bolton. 1992. Nearly uniquitous tissue distribution of the scrapie agent precursor protein. Neurology 42: 149–156. Borchelt, D. R., M. Scott, A. Taraboulos, N. Stahl, and S. B. Prusiner. 1990. Scrapie and cellular prion proteins differ in their kinetics of synthesis and topology in cultured cells. J. Cell Biol. 110: 743–752. Brandner, S., S. Isenmann, A. Raeber, M. Fischer, A. Sailer, Y. Kobayashi, S. Marino, C. Weissmann, and A. Aguzzi. 1996. Normal host prion protein necessary for scrapie-induced neurotoxicity. Nature 379: 339–343. Brown, D. R., J. Herms, and H. A. Kretzschmar. 1994. Mouse cortical cells lacking cellular PrP survive in culture with a neurotoxic PrP fragment. NeuroReport 5: 2057–2060. Brown, D. R., W. J. Schulz-Schaeffer, B. Schmidt, and H. A. Kretzschmar. 1997. Prion protein-deficient cells show altered response to oxidative stress due to decreased SOD-1 activity. Exp. Neurol. 146: 104–112. Brown, D. R., K. Qin, J. W. Herms, A. Madlung, J. Manson, R. Strome, P. E. Fraser, T. Kruck, A. von Bohlen, W. SchulzSchaeffer, A. Giese, D. Westaway, and H. Kretzschmar. 1997.
20.
21.
22.
23.
24.
25.
The cellular prion protein binds copper in vivo. Nature 390: 684–687. Bu¨eler, H., M. Fischer, Y. Lang, H. Bluethmann, H.-P. Lipp, S. J. Dearmond, S. B. Prusiner, M. Aguet, and C. Weissmann. 1992. Normal development and behaviour of mice lacking the neuronal cell-surface PrP protein. Nature 356: 577–582. Bu¨eler, H., A. Aguzzi, A. Sailer, R.-A. Geriner, P. Autenried, M. Aguet, and C. Weissmann. 1993. Mice devoid of PrP are resistant to scrapie. Cell 73: 1339–1347. Cashman, N. R., R. Loertscher, J. Nalbantoglu, I. Shaw, R. J. Kascsak, D. C. Bolton, and P. E. Bendheim. 1990. Cellular isoform of the scrapie agent protein participates in lymphocyte activation. Cell 61: 185–192. Caughey, B., R. E. Race, and B. Chesebro. 1988. Detection of prion protein mRNA in normal and scrapie-infected tissues and cell lines. J. Gen. Virol. 69: 711–716. Chernoff, Y. O., S. L. Lindquist, B.-I. Ono, S. G. Inge-Vechtomov, and S. W. Libman. 1995. Role of the chaperone protein Hsp104 in propagation of the yeast prion-like factor [ psi 1]. Science 268: 880–884. Collinge, J., M. A. Whittington, K. C. L. Sidle, C. J. Smith, M. S. Palmer, A. R. Clarke, and J. G. R. Jefferys. 1994. Prion protein is necessary for normal synaptic function. Nature 370: 295–297. Craig, E. A., and C. A. Gross. 1991. Is hsp70 the cellular thermometer? Trends Biochem. Sci. 16: 135–140. DebBurman, S. K., Raymond, G. J., Caughey, B., and S. Lindquist. 1997. Chaperone-supervised conversion of prion protein to its protease-resistant form. Proc. Natl. Acad. Sci. USA 94: 13938–13943. Diedrich, J. F., R. I. Carp, and A. T. Haase. 1993. Increased expression of heat shock protein, transferrin, and b2-microglobulin in astrocytes during scrapie. Microb. Pathogen. 15: 1–6. Gething, M.-J., and J. Sambrook. 1992. Protein folding in the cell. Nature 355: 33–45. Hartl, F. U. 1996. Molecular chaperones in cellular protein folding. Nature 381: 571–580. Johnston, R. N., and B. L. Kucey. 1988. Competitive inhibition of hsp70 gene expression causes thermosensitivity. Science 242: 1551–1554. Kamii, H., H. Kinouchi, F. R. Sharp, J. Koistinaho, C. J. Epstein, and P. H. Chan. Prolonged expression of hsp70 mRNA following transient focal cerebral ischemia in transgenic mice overexpressing CuZn-superoxide dismutase. J. Cereb. Blood Flow. Metab. 14: 478–486. Kato, S., A. Hirano, T. Umahara, J. F. Llena, F. Herz, and E. Ohama. 1992. Ultrastructural and immunohistochemical studies on ballooned cortical neurons in Creutzfeldt-Jakob disease: Expression of aB-crystallin, ubiquitin and stress-response protein 27. Acta Neuropathol. 84: 443–448. Kenward, N., J. Hope, M. Landon, and R. J. Mayer. 1994. Expression of polyubiquitin and heat-shock protein 70 genes increases in the later stages of disease progression in scrapieinfected mouse brain. J. Neurochem. 62: 1870–1877. Kocisko, D. A., J. H. Come, S. A. Priola, B. Chesebro, G. J. Raymond, P. T. Lansbury, and B. Caughey. 1994. Cell-free formation of protease-resistant prion protein. Nature 370: 471– 474. Lavoie, J. N., G. Gingras-Breton, R. M. Tanguay, and J. Landry. 1993. Induction of Chinese hamster HSP27 gene expression in mouse cells confers resistance to heat shock. HSP27 stabilization of the microfilament organization. J. Biol. Chem. 268: 3420–3429. Lindquist, S., and E. A. Craig. 1988. The heat-shock proteins. Annu. Rev. Genet. 22: 631–677.
PrP-DEFICIENT CELLS EXPRESS HSP 26.
27.
28.
29. 30. 31.
32.
33.
34.
35.
36.
37. 38. 39.
40. 41.
42.
43.
Locht, C., B. Chesebro, R. Race, and J. M. Keith. 1986. Molecular cloning and complete sequence of prion protein cDNA from mouse brain infected with the scrapie agent. Proc. Natl. Acad. Sci. USA 83: 6372–6376. Manson, J. C., A. R. Clarke, M. L. Hooper, L. Aitchison, I. McConnell, and J. Hope. 1994. 129/Ola mice carrying a null mutation in PrP that abolishes mRNA production are developmentally normal. Mol. Neurobiol. 94: 121–127. Mathur, S. K., L. Sistonen, I. R. Brown, S. P. Murphy, K. D. Sarge, and R. I. Morimoto. 1994. Deficient induction of human hsp70 heat shock gene transcription in Y79 retinoblastoma cells despite activation of heat shock factor 1. Proc. Natl. Acad. Sci. USA 91: 8695–8699. Metel, R. 1996. Putting prions to the test. Science 273: 184–189. Nowak, T. S., Jr. 1993. Synthesis of heat shock/stress proteins during cellular injury. Ann. N.Y. Acad. Sci. 679: 142–156. Oesch, B., D. Westaway, M. Wa¨lchli, M. P. McKinley, S. B. H. Kent, R. Aebersold, R. A. Barry, P. Tempst, D. B. Teplow, L. E. Hood, S. B. Prusiner, and C. Weissmann. 1985. A cellular gene encodes scrapie PrP 27–30 protein. Cell 40: 735–746. Omar, R., and M. Pappolla. 1993. Oxygen free radicals as inducers of heat shock protein synthesis in cultured human neuroblastoma cells: Relevance to neurodegenerative disease. Eur. Arch. Psychiatry Clin. Neurosci. 242: 262–267. Pan, K.-M., M. Baldwin, J. Nguyen, M. Gasset, A. Serban, D. Groth, I. Mehlhorn, Z. Huang, R. J. Fletterick, F. E. Cohen, and S. B. Prusiner. 1993. Conversion of a-helices into b-sheets features in the formation of the scrapie prion proteins. Proc. Natl. Acad. Sci. USA 90: 10962–10966. Parsell, D. A., and S. Lindquist. 1993. The function of heatshock proteins in stress tolerance: Degradation and reactivation of damaged proteins. Annu. Rev. Genet. 27: 437–496. Parsell, D. A., A. S. Kowal, M. A. Singer, and S. Lindquist. 1994. Protein disaggregation mediated by heat-shock protein Hsp104. Nature 372: 475–478. Patino, M. M., J.-J. Liu, J. R. Glover, and S. Lindquist. 1996. Support for the prion hypothesis for inheritance of a phenotypic trait in yeast. Science 273: 622–626. Prusiner, S. B. 1991. Molecular biology of prion diseases. Science 252: 1515–1522. Prusiner, S. B. 1993. Genetic and infectious prion diseases. Arch. Neurol. 50: 1129–1153. Prusiner, S. B., D. Groth, A. Serban, R. Koehler, D. Foster, M. Torchia, D. Burton, S.-L. Yang, and S. J. DeArmond. 1993. Ablation of the prion protein (PrP) gene in mice prevents scrapie and facilitates production of anti-PrP antibodies. Proc. Natl. Acad. Sci. USA 90: 10608–10612. Prusiner, S. B. 1997. Prion diseases and the BSE crisis. Science 278: 245–251. Riabowol, K. T., L. A. Mizzen, and W. J. Welch. 1988. Heat shock is lethal to fibroblasts microinjected with antibodies against hsp70. Science 242: 433–436. Robakis, N. K., P. R. Sawh, G. C. Wolfe, R. Rubenstein, R. I. Carp, and M. A. Innis. 1986. Isolation of a cDNA clone encoding the leader peptide of prion protein and expression of the homologous gene in various tissues. Proc. Natl. Acad. Sci. USA 83: 6377–6381. Sakaguchi, S., S. Katamine, K. Shigematsu, A. Nakatani, R. Moriuchi, N. Nishida, K. Kurokawa, R. Nakaoke, H. Sato, K. Jishage, J. Kuno, T. Noda, and T. Miyamoto. 1995. Accumula-
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
55.
56.
57.
58.
115
tion of proteinase K-resistant prion protein (PrP) is restricted by the expression level of normal PrP in mice inoculated with a mouse-adapted strain of the Creutzfeldt-Jakob disease agent. J. Virol. 69: 7586–7592. Sakaguchi, S., S. Katamine, N. Nishida, R. Moriuchi, K. Shigematsu, T. Sugimoto, A. Nakatani, Y. Kataoka, T. Houtani, S. Shirabe, H. Okada, S. Hasegawa, T. Miyamoto, and T. Noda. 1996. Loss of cerebellar Purkinje cells in aged mice homozygous for a disrupted PrP gene. Nature 380: 528–531. Sanchez, Y., J. Taulien, K. A. Brokovich, and S. Lindquist. 1992. Hsp104 is required for tolerance to many forms of stress. EMBO J. 11: 2357–2364. Satoh, J.-I., T. Tabira, T. Yamamura, and S. U. Kim. 1994. HSP72 induction by heat stress is not universal in mammalian neural cell lines. J. Neurosci. Res. 37: 44–53. Satoh, J.-I., and S. U. Kim. 1994. HSP72 induction by heat stress in human neurons and glial cells in culture. Brain Res. 653: 243–250. Satoh, J.-I., and S. U. Kim. 1995. Differential expression of heat shock protein HSP27 in human neurons and glial cells in culture. J. Neurosci. Res. 41: 805–818. Satoh, J.-I., Y. B. Lee, and S. U. Kim. 1995. T-cell costimulatory molecules B7-1 (CD80) and B7-2 (CD86) are expressed in human microglia but not in astrocytes in culture. Brain Res. 704: 92–96. Satoh, J.-I., M. Yukitake, K. Kurohara, and Y. Kuroda. 1997. Retinoic acid-induced neuronal differentiation regulates expression of mRNAs for neurotrophins and neurotrophin receptors in a human embryonal carcinoma cell line NTera2. Neuropathology 17: 80–88. Satoh, J.-I., K. Kurohara, M. Yukitake, and Y. Kuroda. 1997. Interleukin-15, a T cell growth factor, is expressed in human neural cell lines and tissues. J. Neurol. Sci., in press. Schirmer, E. C., and S. Lindquist. 1997. Interactions of the chaperone HSP104 with yeast Sup35 and mammalian PrP. Proc. Natl. Acad. Sci. USA 94: 13932–13937. Tatzelt, J., J. Zuo, R. Voellmy, M. Scott, U. Hartl, S. B. Prusiner, and W. J. Welch. 1995. Scrapie prions selectively modify the stress response in neuroblastoma cells. Proc. Natl. Acad. Sci. USA 92: 2944–2948. Telling, G. C., M. Scott, K. K. Hsiao, D. Foster, S.-L. Yang, M. Torchia, K. C. Sidle, J. Collinge, S. J. DeArmond, and S. B. Prusiner. 1994. Transmission of Creutzfeldt-Jakob disease from humans to transgenic mice expressing chimeric human-mouse prion protein. Proc. Natl. Acad. Sci. USA 91: 9936–9940. Telling, G. C., M. Scott, J. Mastrianni, R. Gabizon, M. Torchia, F. E. Cohen, S. J. DeArmond, and S. B. Prusiner. 1995. Prion propagation in mice expressing human and chimeric PrP transgenes implicates the interaction of cellular PrP with another protein. Cell 83: 79–90. Tobler, I., S. E. Gaus, T. Deboer, P. Achermann, M. Fischer, T. Ru¨licke, M. Moser, B. Oesch, P. A. McBride, and J. C. Manson. 1996. Altered circadian activity rhythms and sleep in mice devoid of prion protein. Nature 380: 639–642. Tokunaga, K., H. Taniguchi, K. Yoda, M. Shimizu, and S. Sakiyama. 1986. Nucleotide sequence of a full-length cDNA for mouse cytoskeletal b-actin mRNA. Nucleic Acids Res. 14: 2829. Wulf, E., A. Deboben, F. A. Bautz, H. Faulstich, and T. Wieland. 1979. Fluorescent phallotoxin, a tool for the visualization of cellular actin. Proc. Natl. Acad. Sci. USA 76: 4498–4502.
151, 105–115 (1998)
EN986796
Cultured Skin Fibroblasts Isolated from Mice Devoid of the Prion Protein Gene Express Major Heat Shock Proteins in Response to Heat Stress Jun-Ichi Satoh,*,1 Motohiro Yukitake,* Kazuhiro Kurohara,* Noriyuki Nishida,† Shigeru Katamine,† Tsutomu Miyamoto,† and Yasuo Kuroda* *Division of Neurology, Department of Internal Medicine, Saga Medical School, Saga 849, Japan; and †Department of Bacteriology, Nagasaki University School of Medicine, Nagasaki 852, Japan Received September 17, 1997; accepted January 28, 1998
INTRODUCTION Recent evidence has suggested that molecular chaperones participate in the conformational change between the normal cellular prion protein (PrPC ) and its scrapie isoform (PrPSc ). To study a role of PrPC in the regulation of expression of heat shock proteins (HSPs), a group of molecular chaperones, heat-induced expression of major HSPs (HSP105, HSP90a, HSP72, HSC70, HSP60, and HSP25) was investigated in cultured skin fibroblasts isolated from the mice homogeneous for a disrupted PrP gene (PrP2/2 mice) by Western blot analysis and immunocytochemistry. Two lines of fibroblasts were established and designated SFK derived from the PrP2/2 mice and SFH derived from the PrP1/1 mice, respectively. In both SFK and SFH cells, HSP105, HSP72, and HSP25 were expressed at low levels under unstressed conditions but they were induced markedly following exposure to heat stress (43°C/20 min) at 3–72 h postrecovery. In both cell types, HSC70 and HSP60 were expressed at high levels under unstressed conditions and their levels remained unchanged after heat shock treatment. HSP90a was undetectable in both cell types under any conditions examined. The pattern of expression, induction, and subcellular location of HSP105, HSP72, HSC70, HSP60, and HSP25 was not significantly different between SFK and SFH cells under unstressed and heat-stressed conditions. Furthermore, the levels of constitutive expression of HSP105, HSC70, HSP60, and HSP25 were similar between the brain tissues isolated from the PrP2/2 and PrP1/1 mice. These results indicate that HSP induction is not affected by either the existence or the absence of PrPC in the cells. r 1998 Academic Press Key Words: heat shock proteins; heat stress; prion protein-deficient mice.
1 To whom correspondence should be addressed at Division of Neurology, Department of Internal Medicine, Saga Medical School, 5-1-1 Nabeshima, Saga 849, Japan. Fax: 81-952-34-2017. E-mail: [email protected].
Heat shock proteins (HSPs) are produced by all prokaryotic and eukaryotic cells in response to heat stress and other noxious stimuli (25). HSPs serve as an indicator by which the extent of cellular stress is monitored (14, 30). It has been shown that an enhanced expression of HSPs can confer tolerance against stress in a variety of cell types, while their insufficient expression makes the cells vulnerable to stress, supporting the concept that HSPs play a protective role against irreversible cell damage (19, 24, 34, 41, 45). Some HSPs are expressed constitutively in unstressed cells in which they act as molecular chaperones that play pivotal roles not only in folding/unfolding, assembly/ disassembly, and translocation of cellular proteins but also in preventing inappropriate protein–protein interactions during maturation of the cellular protein structures (17, 18). HSPs are categorized into several groups based on their molecular weights, i.e., the HSP105, HSP90, HSP70, HSP60, and small (25–30 kDa) HSP families. Prion diseases are a group of transmissible neurodegenerative disorders characterized by intracerebral accumulation of an abnormal prion protein (PrPSc ) that causes pathological hallmarks of neuronal degeneration, spongiosis, deposition of amyloid plaques, and astrogliosis (37, 38, 40). The prion is an unconventional pathogen composed predominantly of the PrPSc protein that is identical in the amino acid sequence to the cellular isoform (PrPC ) (31). The gene coding for the PrPC protein is expressed constitutively in a wide variety of neural and nonneural cells and tissues, at the highest level in neurons in the central nervous system (2, 11, 42), although the biological functions of this protein remain unknown (37, 38, 40). The circadian activity rhythms are altered in the mice devoid of the PrP gene (PrP2/2 ) and the GABAA receptor-mediated fast inhibition is impaired in the hippocampus of these mice (13, 56). Recently, we (NN, SK, TM) have demonstrated that the PrP2/2 mice exhibit a progressive
105
0014-4886/98 $25.00 Copyright r 1998 by Academic Press All rights of reproduction in any form reserved.
106
SATOH ET AL.
ataxia after 70 weeks of age due to an extensive loss of Purkinje cells in the cerebellum, suggesting that the PrPC protein is essential for the survival of defined populations of neurons (44). The PrPSc protein differs biochemically from PrPC by its b-sheet-enriched structure, detergent insolubility, limited proteolysis by proteinase K, and the slower turnover rate (3). It has been proposed that the conversion of PrPC into PrPSc is mediated by a homotypic interaction between the endogeneous PrPC and the incoming or de novo-generated PrPSc via an as yet undefined posttranslational process that involves the unfolding of a-helices and their refolding into b-sheets (33). From this point of view, prion diseases can be considered as a disorder of protein conformation. Previous attempts to mix PrPSc with PrPC in vitro failed to produce nascent PrPSc, raising the possibility that certain auxiliary protein(s) acting as molecular chaperones might be involved in catalyzing the conformational change between PrPC and PrPSc (23, 29, 33, 54). Several lines of recent evidence suggested that a speciesspecific chaperone-like macromolecule denoted protein X can bind to the C-terminal region of PrPC during the formation of nascent PrPSc, offering an explanation for the species barrier observed in the transmission of human prions into mice (40, 55). Recently, HSPs have been proposed as one of molecular chaperones involving in the conformational conversion between PrPC and PrPSc. In Saccharomyces cerevisiae, HSP104 promotes disaggregation of heat-denatured proteins, facilitates acquisition of thermotolerance, and regulates the conformational transformation of the yeast prion-like factor (PSI 1 ) (12, 35, 36, 52). In addition to HSP104, GroEL, an Escherichia coli homologue of mammalian HSP60, stimulates the conformational transition of PrPC to its protease-resistant form in the presence of preexisting PrPSc in vitro (15). With respect to the mammalian nervous system, the expression of HSP70 mRNA is elevated during scrapie infection in mouse brain (22) where an enhanced expression of HSP72 is identified in astrocytes (16). The expression of HSP27, a human homologue of mouse HSP25, is found to be up-regulated in degenerating neurons in the cortex of Creutzfeldt-Jakob disease brains (21). A recent study demonstrated that the Cu/Zn superoxide dismutase (SOD) activity is reduced greatly in the brains of the PrP2/2 mice where neural cells are potentially more vulnerable to oxidative stress (6). A different study showed that neither HSP72 nor HSP25 is inducible in the scrapie-infected mouse neuroblastoma cells (53). This study indicates that the regulation of stress responses is altered by the propagation of PrPSc in the scrapie-infected cells, raising the possibility that the PrPSc protein might interfere with PrPC which could act as a sensor or a regulator for stress signal-transducing events in the cells and putting forth the hypothesis that
an aberrant induction of HSPs in the PrP-deficient cells might cause the degeneration of stress-susceptible neurons in the PrP2/2 mice. To evaluate this hypothesis in the present study using Western blot analysis and immunocytochemistry, the heat-induced and constitutive expression of major HSP including HSP105, HSP90a, HSP72, heat shock cognate protein HSC70, HSP60, and HSP25 was investigated in cultured skin fibroblasts as well as in the brain tissues isolated from the PrP2/2 mice. MATERIALS AND METHODS
Establishment of Skin Fibroblast Cell Lines Isolated from Mice Devoid of the Prion Protein Gene Primary cultures of fibroblasts were prepared from abdominal skin explants isolated from the mice homogeneous for a disrupted PrP gene (PrP2/2 mice) and the wild-type mice with the same genetic background (PrP1/1 mice) at ages of 35 to 50 weeks. The method for production of the PrP2/2 mice was described in detail elsewhere (43, 44). The cultures were incubated at 37°C in a 5% CO2/95% air incubator in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum, 100 U/ml penicillin, and 100 µg/ml streptomycin (feeding medium). Following maintenance of the cultures for more than 2 months, the cells with a capacity to proliferate without requirement of exogeneous growth factors were isolated. The established cell lines were designated SFK for the cells isolated from the PrP2/2 mice and SFH for those of the PrP1/1 mice, respectively. The cells were plated in 25-cm2 culture flasks at a density of 106 cells/ml for Western blot analysis or on poly-L-lysine-coated 9-mm round cover glasses at a density of 5 3 104 cells/coverslip for immunocytochemical studies. The expression of a battery of HSPs was also examined in the cerebral tissues isolated from the aged (70- to 80-week-old) PrP2/2 and PrP1/1 mice. Heat Stress Heat shock treatment was carried out according to the method described previously (46–48). Briefly, culture flasks and dishes were sealed and submerged in a water bath controlled at 43 6 0.4°C for 20 min (short period of stress) or at 42 6 0.4°C for 6 h (long period of stress). Immediately after this treatment, they were placed in a 5% CO2/95% air incubator at 37°C and the cells were allowed to recover for specified periods of time. Extraction of DNA and RNA The genomic DNA was isolated form the cells using the GenomicPrep cells and tissue DNA isolation kit (Pharmacia, Piscataway, NJ) according to the manufac-
107
PrP-DEFICIENT CELLS EXPRESS HSP
turer’s instructions. Total RNA was extracted from the cells using Trizol reagent (GIBCO-BRL, Gaithersburg, MD) by the acid guanidinium thiocyanate–phenol– chloroform method. The concentration and purity of isolated DNA and RNA were assessed by reading UV absorbance at 260 and 280 nm on a Beckman UV spectrophotometer. For reverse transcription–polymerase chain reaction (RT-PCR) analysis, 5 µg of RNA from each sample was subjected to DNase treatment and then processed for cDNA synthesis using oligo(dT) 12–18 primers and SuperScript II reverse transcriptase (GIBCO-BRL). PCR Analysis PCR analysis was performed according to the method described previously (49–51). In brief, 50 ng of genomic DNA or cDNA was amplified by PCR in a programmable thermal cycler (Takara, Tokyo, Japan) using specific sense and antisense primers for the mouse PrP gene (58CATTTTGGCAACGACTGGGAGGAC38 and 58GACTCCATCAAAGGGACCTGAAGC38; the size of the expected product is 551 bp) (26) or b-actin gene (58GAGCACAGCTTCTTTGCAGCTCCT38 and 58GGTCAGGATACCTCTCTTGCTCTG38; the size of the expected product is 255 bp) (57) as a reaction standard. PCR was carried out in 50 µl of reaction mixture containing Taq DNA polymerase buffer (20 mM Tris– HCl, pH 8.4, 50 mM KCl, 200 µM dNTP, 1.5 mM MgCl2, 0.5 µM each primer) and 1.25 U Taq DNA polymerase (GIBCO-BRL). The amplification program consisted of a denaturing step at 94°C for 1 min, an annealing step at 61°C for 40 s, and an extension step at 72.9°C for 50 s for 30 cycles. In RT-PCR analysis, total RNA was processed for PCR without inclusion of the step of reverse transcription to confirm the absence of contaminating genomic DNA. Western Blot Analysis Western blot analysis was performed according to the method described previously (46–48). To prepare total cellular protein extracts, the cells and tissues were homogenized in a lysis buffer composed of 50 mM Tris–HCl, pH 6.8, 2 mM EDTA, 2 mM phenylmethylsulfonyl fluoride, 5 µg/ml leupeptin, 20 µg/ml aprotinin, 10 µg/ml pepstatin A, 2% sodium dodecyl sulfate (SDS). Then, they were centrifuged at 12,000 rpm for 30 min at room temperature (RT). The supernatants were collected for separation on 6, 8, 10, or 12% SDS– polyacrylamide gel electrophoresis (SDS–PAGE). After gel electrophoresis, proteins transferred onto nitrocellulose membranes were immunolabeled at RT for 1 h with goat anti-mouse HSP105 antibody (1:2000), goat antimouse HSP90a antibody (1:2000), mouse anti-human HSP72 monoclonal antibody (1:4000), goat anti-mouse HSC70 antibody (1:2000), goat anti-mouse HSP60 anti-
body (1:2000), or goat anti-mouse HSP25 antibody (1:2000). They were then incubated at RT for 1 h with horseradish peroxidase (HRP)-conjugated anti-goat IgG (1:2000) for HSP105, HSP90a, HSC70, HSP60, or HSP25 or with HRP-conjugated anti-mouse IgG (1: 2000) for HSP72. All the primary and secondary antibodies described above except for the mouse anti-human HSP72 monoclonal antibody (Amersham International plc, Buckinghamshire, England) were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). The specific reaction was visualized on an autoradiographic film (Hyperfilm) using the enhanced chemiluminescence (ECL)–Western blot detection system (Amersham). The protein concentration was determined by the Bradford assay kit (Bio-Rad, Hercules, CA). Immunocytochemistry Immunocytochemical studies were performed according to the methods described previously (46–48). Briefly, the cells on coverglasses were fixed at 4°C for 15 min in 4% paraformaldehyde in 0.1 M phosphate buffer (pH 7.4), followed by a 30-min incubation in phosphatebuffered saline containing 0.5% Triton X-100. They were then incubated with the goat antibodies against HSP105, HSP90a, HSC70, HSP60, or HSP25 (1:20 each) or with the mouse anti-HSP72 monoclonal antibody (1:100) described above, followed by incubation with FITC-conjugated anti-goat IgG (1:40; Santa Cruz Biotechnology) or with FITC-conjugated anti-mouse IgG (1:40; Santa Cruz Biotechnology). They were washed and incubated with TRITC-labeled phalloidin (15 µg/ml; Sigma, St. Louis, MO) which reacts with F actin bundles (58). The incubation with primary and secondary antibodies described above was performed at RT for 30 min. After several washes, the coverglasses mounted on slides with glycerol–polyvinyl alcohol were examined under a Zeiss Universal Microscope equipped with phase contrast, fluorescein, and rhodamine optics. The intensity of immunolabeling was graded as (2) negative, (1) weakly positive, and (11) intensely positive. Photographs were taken on Kodak Tri-X Pan (ASA 400) films. RESULTS
Absence of the PrP Gene in Cultured Skin Fibroblasts Isolated from the PrP2/2 Mice At first, the absence of the PrP gene in cultured skin fibroblasts isolated from the PrP2/2 mice utilized in our study was confirmed by PCR analysis. The PrP gene was found to be undetectable at both genomic DNA and mRNA levels in SFK cells derived from the PrP2/2 mice, whereas its expression was detectable in SFH cells derived from the PrP1/1 mice (Fig. 1a, lanes 3 and 4;
108
SATOH ET AL.
FIG. 1. Absence of the PrP gene in cultured skin fibroblasts isolated from the PrP2/2 mice. Two cell lines termed SFK and SFH were established from primary cultures of skin fibroblasts derived from the PrP2/2 mice (SFK) or from the PrP1/1 mice (SFH). Fifty nanograms of (a) genomic DNA or (b) cDNA prepared from total RNA by reverse transcription was amplified by PCR using the primers specific for the b-actin gene (the expected size of the product is 255 bp) or the PrP gene (the expected size of the product is 551 bp). The amplified products were separated on a 1.5% agarose gel. (a) PCR analysis of the PrP gene at the genomic DNA level. Lanes 1 to 4, as follows: (lane 1) the b-actin gene in SFK; (lane 2) the b-actin gene in SFH; (lane 3) the PrP gene in SFK; and (lane 4) the PrP gene in SFH. (b) RT-PCR analysis of the PrP gene at the mRNA level. (Top) The PrP gene and (bottom) the b-actin gene. Lanes 1 to 4, as follows: (lane 1) RNA of SFK processed for PCR omitting the step of reverse transcription; (lane 2) RNA of SFK processed for PCR with inclusion of the step of reverse transcription; (lane 3) RNA of SFH processed for PCR omitting the step of reverse transcription; and (lane 4) RNA of SFH processed for PCR with inclusion of the step of reverse transcription. The DNA size marker (bp) is shown on the left.
Fig. 1b, top, lanes 2 and 4). In contrast, the b-actin gene was expressed in both SFK and SFH cells (Fig. 1a, lanes 1 and 2; Fig. 1b, bottom, lanes 2 and 4). In RT-PCR analysis, no products were amplified in total RNA isolated from each sample processed for PCR without reverse transcription, confirming that a contamination of genomic DNA was excluded (Fig. 1b, lanes 1 and 3). Heat-Inducible Expression of HSP105 in Cultured Skin Fibroblasts Isolated from the PrP2/2 and PrP1/1 Mice The cells were exposed to heat stress by incubation either at 43°C for 20 min or at 42°C for 6 h in a water bath, allowed to recover at 37°C for 0–72 h, and then processed for Western blot analysis and immunocytochemistry. Under unstressed conditions, very low levels of HSP105 expression were identified in both SFK and SFH cells by Western blot analysis (Fig. 2A, lane 1). The constitutive expression was below the detection limit by immunocytochemistry. After exposure to a 20
min heat shock at 43°C, the levels of HSP105 expression were elevated markedly in both cell types at 3–72 h postrecovery with its maximal expression at 8 h (Fig. 2A, lanes 2–5). At the peak of HSP105 expression, a weak and diffuse HSP105 immunoreactivity was identified in the cytoplasmic and nuclear regions of these cells (data not shown). HSP105 expression was not enhanced in these cells by exposure to the longer period of heat stress (42°C/6 h) (Fig. 2A, lane 6). The pattern of expression and induction of HSP105 following heat stress was not different between SFK and SFH cells. Nonexpression of HSP90a in Cultured Skin Fibroblasts Isolated from the PrP2/2 and PrP1/1 Mice HSP90a was undetectable by Western blot analysis and immunocytochemistry in both SFK and SFH cells under unstressed and heat-stressed conditions during the whole recovery time (Fig. 2B, lanes 1–5), while it was detectable at an appreciable level in unstressed
PrP-DEFICIENT CELLS EXPRESS HSP
109
HeLa cells (Fig. 2B, lane 7). HSP90a was not induced in SFK or SFH cells even after exposure to the longer period of heat stress (42°C/6 h) (Fig. 2B, lane 6). Heat-Inducible Expression of HSP72 in Cultured Skin Fibroblasts Isolated from the PrP2/2 and PrP1/1 Mice HSP72 was barely detectable in both SFK and SFH cells by Western blot analysis under unstressed conditions (Fig. 3A, lane 1) in which an extremely weak band of HSP72 became visible when the blots were overexposed on an autoradiographic film (data not shown). After exposure to heat stress (43°C/20 min), HSP72 was
FIG. 3. Western blot analysis of HSP72 and HSC70 in cultured skin fibroblasts isolated from the PrP2/2 and PrP1/1 mice. The cultured skin fibroblast cell lines termed SFK (PrP2/2) and SFH (PrP1/1) were either unstressed or heat-stressed at 43°C for 20 min followed by recovery at 37°C for 3–72 h or heat-stressed at 42°C for 6 h without recovery. Total cellular protein extracts were separated on a 12% SDS–PAGE gel, transferred onto a nitrocellulose membrane, and immunolabeled with specific antibodies. The left half is the blots of SFK, while the right half is those of SFH. (A) HSP72. (B) HSC70. Lanes 1–6, as follows: (lane 1) unstressed; (lane 2) 3 h, (lane 3) 8 h, (lane 4) 24 h, and (lane 5) 72 h postrecovery after exposure to heat stress (43°C/20 min); and (lane 6) immediately after exposure to heat stress (42°C/6 h). Each lane represents 10 µg of protein prior to transblotting. The molecular weight marker (kDa) is shown on the left. FIG. 2. Western blot analysis of HSP105 and HSP90a in cultured skin fibroblasts isolated from the PrP2/2 and PrP1/1 mice under unstressed and heat-stressed conditions. The cultured skin fibroblast cell lines termed SFK (PrP2/2 ) and SFH (PrP1/1 ) were either unstressed or heat-stressed at 43°C for 20 min followed by recovery at 37°C for 3–72 h or heat-stressed at 42°C for 6 h without recovery. Total cellular protein extracts were separated on a (A) 6% or (B) 10% SDS–PAGE gel, transferred onto a nitrocellulose membrane, and immunolabeled with specific antibodies. The left half is the blots of SFK, while the right half is those of SFH. (A) HSP105. (B) HSP90a. Lanes 1–6, as follows: (lane 1) unstressed; (lane 2) 3 h, (lane 3) 8 h, (lane 4) 24 h, and (lane 5) 72 h postrecovery after exposure to heat stress (43°C/20 min); and (lane 6) immediately after exposure to heat stress (42°C/6 h). Each lane (1–6) represents (A) 50 µg or (B) 20 µg of protein prior to transblotting, except for (B, lane 7) 4 µg of total cellular protein extracts of unstressed HeLa cells. The molecular weight marker (kDa) is shown on the left.
induced greatly in both cell types at 3–72 h postrecovery with its maximal expression at 3–24 h (Fig. 3A, lanes 2–5). During the whole recovery time, an intense HSP72 immunoreactivity was identified in their nuclear and cytoplasmic regions with some heterogeneous staining intensities in individual cells (Figs. 4a–4d). The dot-like structures in the nucleoplasm of these cells were found to be often devoid of HSP72 immunolabeling (Figs. 4a–4d). The HSP72 expression was also induced markedly in both cell types by exposure to the longer period of heat stress (42°C/6 h) (Fig. 3A, lane 6). The pattern of expression, induction, and subcellular
110
SATOH ET AL.
PrP-DEFICIENT CELLS EXPRESS HSP
111
location of HSP72 following heat stress was not different between SFK and SFH cells. Constitutive Expression of HSC70 in Cultured Skin Fibroblasts Isolated from the PrP2/2/ and PrP1/1 Mice Under unstressed conditions, HSC70 expression was detectable at high levels in both SFK and SFH cells by Western blot analysis (Fig. 3B, lane 1). The levels of HSC70 expression in both cell types remained unchanged following exposure to heat stress (43°C/20 min) during the whole recovery period (Fig. 3B, lanes 2–5). An intense HSC70 immunoreactivity forming dot-like accumulations was located in their nucleoplasmic regions (Figs. 4e–4h). The levels of HSC70 expression were unaltered again in these cells after exposure to the longer period of heat stress (42°C/6 h) (Fig. 3B, lane 6). The pattern of expression and subcellular location of HSC70 was not different between SFK and SFH cells under any conditions examined. Constitutive Expression of HSP60 in Cultured Skin Fibroblasts Isolated from the PrP2/2 and PrP1/1 Mice Under unstressed conditions, HSP60 expression was detectable at high levels in both SFK and SFH cells by Western blot analysis (Fig. 5A, lane 1). The levels of HSP60 expression in both cell types remained unchanged following exposure to heat stress (43°C/20 min) during the whole recovery period (Fig. 5A, lanes 2–5). An intense and fine-granular HSP60 immunoreactivity was identified in the cytoplasm but not in the nucleus of these cells under unstressed and heatstressed conditions (Figs. 6a–6d). The levels of HSP60 expression were unaltered again in these cells after exposure to the longer period of heat stress (42°C/6 h) (Fig. 5A, lane 6). The pattern of expression and subcellular location of HSP60 was not different between SFK and SFH cells under any conditions examined. Heat-Inducible Expression of HSP25 in Cultured Skin Fibroblasts Isolated from the PrP2/2 and PrP1/1 Mice Under unstressed conditions, low levels of HSP25 expression were detectable in both SFK and SFH cells by Western blot analysis (Fig. 5B, lane 1). After exposure to a 20-min heat shock at 43°C, the levels of HSP25 expression were elevated markedly in both cell
FIG. 5. Western blot analysis of HSP60 and HSP25 in cultured skin fibroblasts isolated from the PrP2/2 and PrP1/1 mice. The cultured skin fibroblast cell lines termed SFK (PrP2/2 ) and SFH (PrP1/1 ) were either unstressed or heat-stressed at 43°C for 20 min followed by recovery at 37°C for 3–72 h or heat-stressed at 42°C for 6 hr without recovery. Total cellular protein extracts were separated on a 12% SDS–PAGE gel, transferred onto a nitrocellulose membrane, and immunolabeled with specific antibodies. The left half is the blots of SFK, while the right half is those of SFH. (A) HSP60. (B) HSP25. Lanes 1–6, as follows: (lane 1) unstressed; (lane 2) 3 h, (lane 3) 8 h, (lane 4) 24 h, and (lane 5) 72 h postrecovery after exposure to heat stress (43°C/20 min); and (lane 6) immediately after exposure to heat stress (42°C/6 h). Each lane represents 10 µg of protein prior to transblotting. The molecular weight marker (kDa) is shown on the left.
types at 3–72 h postrecovery with its maximal expression at 8–24 h (Fig. 5B, lanes 2–5). An intense and diffuse HSP25 immunoreactivity was identified in the cytoplasm but not in the nucleus of these cells under unstressed and heat-stressed conditions (Figs. 6e–6h). HSP25 expression was also induced greatly in these cells by exposure to the longer period of heat stress
FIG. 4. Immunocytochemistry of HSP72 and HSC70 in cultured skin fibroblasts isolated from the PrP2/2 and PrP1/1 mice. The cultured skin fibroblast cell lines termed SKF (PrP2/2) and SFH (PrP1/1) were either unstressed or heat-stressed at 43°C for 20 min, allowed to recover at 37°C for 24 h, and then processed for double-labeling immunocytochemistry. (a, b) SFK at 24 h postrecovery after heat stress: (a) HSP72; (b) phalloidin. (c, d) SFH at 24 h postrecovery after heat stress: (c) HSP72; (d) phalloidin. (e,f ) unstressed SFK: (e) HSC70; (f ) phalloidin. (g, h) unstressed SFH: (g) HSC70; (h) phalloidin. Bar, 15 µm.
112
SATOH ET AL.
PrP-DEFICIENT CELLS EXPRESS HSP
113
(42°C/6 h) (Fig. 5B, lane 6). The pattern of expression, induction, and subcellular location of HSP25 following heat stress was not different between SFK and SFH cells. These results indicate that the pattern of constitutive and heat-inducible expression of major HSPs is similar between normal and PrP-deficient fibroblasts in culture. Constitutive Expression of Major HSPs in Brain Tissues Isolated from the PrP2/2 and PrP1/1 Mice Finally, the expression of major HSPs was studied by Western blot analysis in the brain tissues isolated form the aged PrP2/2 and PrP1/1 mice, the target organ in prion diseases. High levels of the constitutive expression of HSP105, HSC70, HSP60, and HSP25 were identified in the brain extracts derived from both mice without significant differences in the levels of their expression (Fig. 7, lanes 1–8). The constitutive expression of neither HSP90a nor HSP72 was detectable in the brain tissues of both mice when 20 µg of total protein of the extracts was analyzed (data not shown). These results indicate that the pattern of constitutive expression of major HSPs is similar between normal and PrP-deficient brain tissues. DISCUSSION
Using Western blot analysis and immunocytochemistry, the present study has demonstrated that the pattern of heat-inducible expression and subcellular location of HSP105, HSP72, HSC70, HSP60, and HSP25 is not significantly different between two distinct cultured skin fibroblasts isolated from the PrP2/2 and PrP1/1 mice. Furthermore, the pattern of constitutive expression of HSP105, HSC70, HSP60, and HSP25 is similar between the brain tissues isolated from the PrP2/2 and PrP1/1 mice. Our observations indicate that the constitutive and heat-inducible expression of major HSPs is not defective in the PrP-deficient cells. These results suggest that the PrPC protein may not serve as a sensor or a regulator for the heat shock response in the cells. The biological functions of PrPC remain unknown (37, 38, 40). A previous study revealed that the PrPC protein attached to the outer surface of cell membrane by a glycosyl phosphatidylinositol anchor is involved in activation of lymphocytes in response to mitogens (10). Recent studies have shown that the PrP2/2 mice exhibit
FIG. 7. Western blot analysis of major HSPs in brain tissues isolated from the PrP2/2 and PrP1/1 mice. Total protein extracts were prepared from the brain tissues of the cerebrum isolated from the PrP2/2 and PrP1/1 mice at ages of 70 to 80 weeks. They were separated on a 8% (for HSP105) or 12% (for HSC70, HSP60, and HSP25) SDS–PAGE gel, transferred onto a nitrocellulose membrane, and immunolabeled with specific antibodies. (A) HSP105. (B) HSC70. (C) HSP60. HSP25. Lanes 1, 3, 5, and 7 the brain tissues of the PrP2/2 mice; lanes 2, 4, 6, and 8, those of the PrP1/1 mice. Each lane represents 10 µg (lanes 3–6) or 20 µg (lanes 1, 2, 7, and 8) of protein prior to transblotting. The molecular weight marker (kDa) is shown on the left.
normal early development and maturation, suggesting that PrPC is a dispensable protein in the histogenesis (8, 27). On the other hand, the PrP2/2 mice are completely protected against scrapie infection and against prion-mediated neurotoxicity, indicating that the expression of PrPC is essential for induction of the prion diseases (4, 5, 9, 39, 43). It has been shown that the PrP2/2 mice display an altered pattern of circadian activity rhythms, an impaired GABAA receptor-mediated fast inhibition in the hippocampus and a progressive cerebellar ataxia due to loss of the Purkinje cells, although the molecular mechanisms accounting for these abnormalities remain to be further elucidated (13, 44, 56). Recently, it has been proven that PrPC exists as a membrane-associated cupper-binding protein in vivo (7). Interestingly, the activity of Cu/Zn SOD, a major antioxidant enzyme, is found to be decreased substantially in the brains of the PrP2/2 mice (6). Based on these findings, the hypothesis could be put forward that the inability to control the stress responses due to generation of excessive oxygen free radicals, a potent inducer of HSP synthesis might affect physiological functions in the PrP-deficient cells (20, 32). However, our observations that HSP induction by heat stress is
FIG. 6. Immunocytochemistry of HSP60 and HSP25 in cultured skin fibroblasts isolated from the PrP2/2 and PrP1/1 mice. The cultured skin fibroblast cell lines termed SFK (PrP2/2 ) and SFH (PrP1/1 ) were either unstressed or heat-stressed at 43°C for 20 min, allowed to recover at 37°C for 24 h, and then processed for double-labeling immunocytochemistry. (a,b) unstressed SFK: (a) HSP60; (b) phalloidin. (c,d) unstressed SFH: (c) HSP60; (d) phalloidin. (e,f ) SFK at 24 h postrecovery after heat stress: (e) HSP25; (f ) phalloidin. (g,h) SFH at 24 h postrecovery after heat stress: (g) HSP25; (h) phalloidin. Bar, 15 µm.
114
SATOH ET AL.
not affected by either the existence or the absence of PrPC in the cells disagree with this hypothesis. A number of previous studies showed that HSPs play a protective role against irreversible damage in the cells exposed to stressful insults, while the deficient HSP induction makes the cells highly vulnerable to stress (19, 24, 41, 45). Our results where no differences were observed in the induction of major HSPs between the PrP2/2 and PrP1/1 cell types argue against the possibility that a reduced level of HSP synthesis might be the direct cause for the progressive degeneration of Purkinje cells in the cerebellum of the PrP2/2 mice (44). In our study, the HSP90a protein was undetectable in both PrP2/2 and PrP1/1 fibroblasts under unstressed and heat-stressed conditions, while its expression was identified in unstressed HeLa cells. These observations are consistent with several studies which reported that a set of HSPs is not expressed in certain cell types (1, 28, 46). In conclusion, the pattern of constitutive and heatinducible expression and subcellular location of major HSPs is similar between the PrP2/2 and PrP1/1 cells and tissues.
8.
9.
10.
11.
12.
13.
14. 15.
ACKNOWLEDGMENTS This work was in part supported by grants to J.S. from Grant-inAid for Scientific Research on Priority Areas (Regulation of Cellular Functions by Molecular Chaperones 09276225) and Grant-in-Aid for Scientific Research (C2-08670715) from the Ministry of Education, Science, and Culture of Japan; the Japan Brain Foundation; the Naito Foundation; and the Narabayashi Trust for ALS Research.
16.
17. 18. 19.
REFERENCES 1.
2.
3.
4.
5.
6.
7.
Aujame, L., and C. Morgan. 1985. Nonexpression of a major heat shock gene in mouse plasmacytoma MPC-11. Mol. Cell. Biol. 5: 1780–1783. Bendheim, P. E., H. R. Brown, R. D. Rudelli, L. J. Scala, N. L. Goller, G. Y. Wen, R. J. Kascsak, N. R. Cashman, and D. C. Bolton. 1992. Nearly uniquitous tissue distribution of the scrapie agent precursor protein. Neurology 42: 149–156. Borchelt, D. R., M. Scott, A. Taraboulos, N. Stahl, and S. B. Prusiner. 1990. Scrapie and cellular prion proteins differ in their kinetics of synthesis and topology in cultured cells. J. Cell Biol. 110: 743–752. Brandner, S., S. Isenmann, A. Raeber, M. Fischer, A. Sailer, Y. Kobayashi, S. Marino, C. Weissmann, and A. Aguzzi. 1996. Normal host prion protein necessary for scrapie-induced neurotoxicity. Nature 379: 339–343. Brown, D. R., J. Herms, and H. A. Kretzschmar. 1994. Mouse cortical cells lacking cellular PrP survive in culture with a neurotoxic PrP fragment. NeuroReport 5: 2057–2060. Brown, D. R., W. J. Schulz-Schaeffer, B. Schmidt, and H. A. Kretzschmar. 1997. Prion protein-deficient cells show altered response to oxidative stress due to decreased SOD-1 activity. Exp. Neurol. 146: 104–112. Brown, D. R., K. Qin, J. W. Herms, A. Madlung, J. Manson, R. Strome, P. E. Fraser, T. Kruck, A. von Bohlen, W. SchulzSchaeffer, A. Giese, D. Westaway, and H. Kretzschmar. 1997.
20.
21.
22.
23.
24.
25.
The cellular prion protein binds copper in vivo. Nature 390: 684–687. Bu¨eler, H., M. Fischer, Y. Lang, H. Bluethmann, H.-P. Lipp, S. J. Dearmond, S. B. Prusiner, M. Aguet, and C. Weissmann. 1992. Normal development and behaviour of mice lacking the neuronal cell-surface PrP protein. Nature 356: 577–582. Bu¨eler, H., A. Aguzzi, A. Sailer, R.-A. Geriner, P. Autenried, M. Aguet, and C. Weissmann. 1993. Mice devoid of PrP are resistant to scrapie. Cell 73: 1339–1347. Cashman, N. R., R. Loertscher, J. Nalbantoglu, I. Shaw, R. J. Kascsak, D. C. Bolton, and P. E. Bendheim. 1990. Cellular isoform of the scrapie agent protein participates in lymphocyte activation. Cell 61: 185–192. Caughey, B., R. E. Race, and B. Chesebro. 1988. Detection of prion protein mRNA in normal and scrapie-infected tissues and cell lines. J. Gen. Virol. 69: 711–716. Chernoff, Y. O., S. L. Lindquist, B.-I. Ono, S. G. Inge-Vechtomov, and S. W. Libman. 1995. Role of the chaperone protein Hsp104 in propagation of the yeast prion-like factor [ psi 1]. Science 268: 880–884. Collinge, J., M. A. Whittington, K. C. L. Sidle, C. J. Smith, M. S. Palmer, A. R. Clarke, and J. G. R. Jefferys. 1994. Prion protein is necessary for normal synaptic function. Nature 370: 295–297. Craig, E. A., and C. A. Gross. 1991. Is hsp70 the cellular thermometer? Trends Biochem. Sci. 16: 135–140. DebBurman, S. K., Raymond, G. J., Caughey, B., and S. Lindquist. 1997. Chaperone-supervised conversion of prion protein to its protease-resistant form. Proc. Natl. Acad. Sci. USA 94: 13938–13943. Diedrich, J. F., R. I. Carp, and A. T. Haase. 1993. Increased expression of heat shock protein, transferrin, and b2-microglobulin in astrocytes during scrapie. Microb. Pathogen. 15: 1–6. Gething, M.-J., and J. Sambrook. 1992. Protein folding in the cell. Nature 355: 33–45. Hartl, F. U. 1996. Molecular chaperones in cellular protein folding. Nature 381: 571–580. Johnston, R. N., and B. L. Kucey. 1988. Competitive inhibition of hsp70 gene expression causes thermosensitivity. Science 242: 1551–1554. Kamii, H., H. Kinouchi, F. R. Sharp, J. Koistinaho, C. J. Epstein, and P. H. Chan. Prolonged expression of hsp70 mRNA following transient focal cerebral ischemia in transgenic mice overexpressing CuZn-superoxide dismutase. J. Cereb. Blood Flow. Metab. 14: 478–486. Kato, S., A. Hirano, T. Umahara, J. F. Llena, F. Herz, and E. Ohama. 1992. Ultrastructural and immunohistochemical studies on ballooned cortical neurons in Creutzfeldt-Jakob disease: Expression of aB-crystallin, ubiquitin and stress-response protein 27. Acta Neuropathol. 84: 443–448. Kenward, N., J. Hope, M. Landon, and R. J. Mayer. 1994. Expression of polyubiquitin and heat-shock protein 70 genes increases in the later stages of disease progression in scrapieinfected mouse brain. J. Neurochem. 62: 1870–1877. Kocisko, D. A., J. H. Come, S. A. Priola, B. Chesebro, G. J. Raymond, P. T. Lansbury, and B. Caughey. 1994. Cell-free formation of protease-resistant prion protein. Nature 370: 471– 474. Lavoie, J. N., G. Gingras-Breton, R. M. Tanguay, and J. Landry. 1993. Induction of Chinese hamster HSP27 gene expression in mouse cells confers resistance to heat shock. HSP27 stabilization of the microfilament organization. J. Biol. Chem. 268: 3420–3429. Lindquist, S., and E. A. Craig. 1988. The heat-shock proteins. Annu. Rev. Genet. 22: 631–677.
PrP-DEFICIENT CELLS EXPRESS HSP 26.
27.
28.
29. 30. 31.
32.
33.
34.
35.
36.
37. 38. 39.
40. 41.
42.
43.
Locht, C., B. Chesebro, R. Race, and J. M. Keith. 1986. Molecular cloning and complete sequence of prion protein cDNA from mouse brain infected with the scrapie agent. Proc. Natl. Acad. Sci. USA 83: 6372–6376. Manson, J. C., A. R. Clarke, M. L. Hooper, L. Aitchison, I. McConnell, and J. Hope. 1994. 129/Ola mice carrying a null mutation in PrP that abolishes mRNA production are developmentally normal. Mol. Neurobiol. 94: 121–127. Mathur, S. K., L. Sistonen, I. R. Brown, S. P. Murphy, K. D. Sarge, and R. I. Morimoto. 1994. Deficient induction of human hsp70 heat shock gene transcription in Y79 retinoblastoma cells despite activation of heat shock factor 1. Proc. Natl. Acad. Sci. USA 91: 8695–8699. Metel, R. 1996. Putting prions to the test. Science 273: 184–189. Nowak, T. S., Jr. 1993. Synthesis of heat shock/stress proteins during cellular injury. Ann. N.Y. Acad. Sci. 679: 142–156. Oesch, B., D. Westaway, M. Wa¨lchli, M. P. McKinley, S. B. H. Kent, R. Aebersold, R. A. Barry, P. Tempst, D. B. Teplow, L. E. Hood, S. B. Prusiner, and C. Weissmann. 1985. A cellular gene encodes scrapie PrP 27–30 protein. Cell 40: 735–746. Omar, R., and M. Pappolla. 1993. Oxygen free radicals as inducers of heat shock protein synthesis in cultured human neuroblastoma cells: Relevance to neurodegenerative disease. Eur. Arch. Psychiatry Clin. Neurosci. 242: 262–267. Pan, K.-M., M. Baldwin, J. Nguyen, M. Gasset, A. Serban, D. Groth, I. Mehlhorn, Z. Huang, R. J. Fletterick, F. E. Cohen, and S. B. Prusiner. 1993. Conversion of a-helices into b-sheets features in the formation of the scrapie prion proteins. Proc. Natl. Acad. Sci. USA 90: 10962–10966. Parsell, D. A., and S. Lindquist. 1993. The function of heatshock proteins in stress tolerance: Degradation and reactivation of damaged proteins. Annu. Rev. Genet. 27: 437–496. Parsell, D. A., A. S. Kowal, M. A. Singer, and S. Lindquist. 1994. Protein disaggregation mediated by heat-shock protein Hsp104. Nature 372: 475–478. Patino, M. M., J.-J. Liu, J. R. Glover, and S. Lindquist. 1996. Support for the prion hypothesis for inheritance of a phenotypic trait in yeast. Science 273: 622–626. Prusiner, S. B. 1991. Molecular biology of prion diseases. Science 252: 1515–1522. Prusiner, S. B. 1993. Genetic and infectious prion diseases. Arch. Neurol. 50: 1129–1153. Prusiner, S. B., D. Groth, A. Serban, R. Koehler, D. Foster, M. Torchia, D. Burton, S.-L. Yang, and S. J. DeArmond. 1993. Ablation of the prion protein (PrP) gene in mice prevents scrapie and facilitates production of anti-PrP antibodies. Proc. Natl. Acad. Sci. USA 90: 10608–10612. Prusiner, S. B. 1997. Prion diseases and the BSE crisis. Science 278: 245–251. Riabowol, K. T., L. A. Mizzen, and W. J. Welch. 1988. Heat shock is lethal to fibroblasts microinjected with antibodies against hsp70. Science 242: 433–436. Robakis, N. K., P. R. Sawh, G. C. Wolfe, R. Rubenstein, R. I. Carp, and M. A. Innis. 1986. Isolation of a cDNA clone encoding the leader peptide of prion protein and expression of the homologous gene in various tissues. Proc. Natl. Acad. Sci. USA 83: 6377–6381. Sakaguchi, S., S. Katamine, K. Shigematsu, A. Nakatani, R. Moriuchi, N. Nishida, K. Kurokawa, R. Nakaoke, H. Sato, K. Jishage, J. Kuno, T. Noda, and T. Miyamoto. 1995. Accumula-
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
55.
56.
57.
58.
115
tion of proteinase K-resistant prion protein (PrP) is restricted by the expression level of normal PrP in mice inoculated with a mouse-adapted strain of the Creutzfeldt-Jakob disease agent. J. Virol. 69: 7586–7592. Sakaguchi, S., S. Katamine, N. Nishida, R. Moriuchi, K. Shigematsu, T. Sugimoto, A. Nakatani, Y. Kataoka, T. Houtani, S. Shirabe, H. Okada, S. Hasegawa, T. Miyamoto, and T. Noda. 1996. Loss of cerebellar Purkinje cells in aged mice homozygous for a disrupted PrP gene. Nature 380: 528–531. Sanchez, Y., J. Taulien, K. A. Brokovich, and S. Lindquist. 1992. Hsp104 is required for tolerance to many forms of stress. EMBO J. 11: 2357–2364. Satoh, J.-I., T. Tabira, T. Yamamura, and S. U. Kim. 1994. HSP72 induction by heat stress is not universal in mammalian neural cell lines. J. Neurosci. Res. 37: 44–53. Satoh, J.-I., and S. U. Kim. 1994. HSP72 induction by heat stress in human neurons and glial cells in culture. Brain Res. 653: 243–250. Satoh, J.-I., and S. U. Kim. 1995. Differential expression of heat shock protein HSP27 in human neurons and glial cells in culture. J. Neurosci. Res. 41: 805–818. Satoh, J.-I., Y. B. Lee, and S. U. Kim. 1995. T-cell costimulatory molecules B7-1 (CD80) and B7-2 (CD86) are expressed in human microglia but not in astrocytes in culture. Brain Res. 704: 92–96. Satoh, J.-I., M. Yukitake, K. Kurohara, and Y. Kuroda. 1997. Retinoic acid-induced neuronal differentiation regulates expression of mRNAs for neurotrophins and neurotrophin receptors in a human embryonal carcinoma cell line NTera2. Neuropathology 17: 80–88. Satoh, J.-I., K. Kurohara, M. Yukitake, and Y. Kuroda. 1997. Interleukin-15, a T cell growth factor, is expressed in human neural cell lines and tissues. J. Neurol. Sci., in press. Schirmer, E. C., and S. Lindquist. 1997. Interactions of the chaperone HSP104 with yeast Sup35 and mammalian PrP. Proc. Natl. Acad. Sci. USA 94: 13932–13937. Tatzelt, J., J. Zuo, R. Voellmy, M. Scott, U. Hartl, S. B. Prusiner, and W. J. Welch. 1995. Scrapie prions selectively modify the stress response in neuroblastoma cells. Proc. Natl. Acad. Sci. USA 92: 2944–2948. Telling, G. C., M. Scott, K. K. Hsiao, D. Foster, S.-L. Yang, M. Torchia, K. C. Sidle, J. Collinge, S. J. DeArmond, and S. B. Prusiner. 1994. Transmission of Creutzfeldt-Jakob disease from humans to transgenic mice expressing chimeric human-mouse prion protein. Proc. Natl. Acad. Sci. USA 91: 9936–9940. Telling, G. C., M. Scott, J. Mastrianni, R. Gabizon, M. Torchia, F. E. Cohen, S. J. DeArmond, and S. B. Prusiner. 1995. Prion propagation in mice expressing human and chimeric PrP transgenes implicates the interaction of cellular PrP with another protein. Cell 83: 79–90. Tobler, I., S. E. Gaus, T. Deboer, P. Achermann, M. Fischer, T. Ru¨licke, M. Moser, B. Oesch, P. A. McBride, and J. C. Manson. 1996. Altered circadian activity rhythms and sleep in mice devoid of prion protein. Nature 380: 639–642. Tokunaga, K., H. Taniguchi, K. Yoda, M. Shimizu, and S. Sakiyama. 1986. Nucleotide sequence of a full-length cDNA for mouse cytoskeletal b-actin mRNA. Nucleic Acids Res. 14: 2829. Wulf, E., A. Deboben, F. A. Bautz, H. Faulstich, and T. Wieland. 1979. Fluorescent phallotoxin, a tool for the visualization of cellular actin. Proc. Natl. Acad. Sci. USA 76: 4498–4502.