- Email: [email protected]
Detection and molecular characterization of Babesia, Theileria, and Hepatozoon species in hard ticks collected from Kagoshima, the southern region in Japan
Accepted Manuscript Title: Detection and molecular characterization of Babesia, Theileria, and Hepatozoon species in hard ticks collected from Kagoshima, the southern region in Japan Authors: Tatsunori Masatani, Kei Hayashi, Masako Andoh, Morihiro Tateno, Yasuyuki Endo, Masahito Asada, Kodai Kusakisako, Tetsuya Tanaka, Mutsuyo Gokuden, Nodoka Hozumi, Fumiko Nakadohzono, Tomohide Matsuo PII: DOI: Reference:
S1877-959X(17)30148-6 http://dx.doi.org/doi:10.1016/j.ttbdis.2017.03.007 TTBDIS 810
To appear in: Received date: Revised date: Accepted date:
29-9-2016 22-3-2017 26-3-2017
Please cite this article as: Masatani, Tatsunori, Hayashi, Kei, Andoh, Masako, Tateno, Morihiro, Endo, Yasuyuki, Asada, Masahito, Kusakisako, Kodai, Tanaka, Tetsuya, Gokuden, Mutsuyo, Hozumi, Nodoka, Nakadohzono, Fumiko, Matsuo, Tomohide, Detection and molecular characterization of Babesia, Theileria, and Hepatozoon species in hard ticks collected from Kagoshima, the southern region in Japan.Ticks and Tickborne Diseases http://dx.doi.org/10.1016/j.ttbdis.2017.03.007 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Detection and molecular characterization of Babesia, Theileria, and Hepatozoon species in hard ticks collected from Kagoshima, the southern region in Japan
Tatsunori Masatani a, 1 *, Kei Hayashi b, c 1, Masako Andoh d, Morihiro Tateno e, Yasuyuki Endo e
, Masahito Asada f, Kodai Kusakisako g, Tetsuya Tanaka g, Mutsuyo Gokuden h, Nodoka
Hozumi h, Fumiko Nakadohzono h, Tomohide Matsuo i
a
Transboundary Animal Diseases Research Center, Joint Faculty of Veterinary Medicine,
Kagoshima University, 1-21-24 Korimoto, Kagoshima 890-0065, Japan
b
Laboratory of Veterinary Parasitology, Faculty of Agriculture, Iwate University, 3-18-8 Ueda,
Morioka 020-8550, Japan
c
Department of Pathogenetic Veterinary Science, United Graduate School of Veterinary
Science, Gifu University, 1-1 Yanagido, Gifu 501-1193, Japan.
d
Laboratory of Veterinary Public Health, Joint Faculty of Veterinary Medicine, Kagoshima
University, 1-21-24 Korimoto, Kagoshima 890-0065, Japan.
e
Laboratory of Small Animal Internal Medicine, Joint Faculty of Veterinary Medicine,
Kagoshima University, 1-21-24 Korimoto, Kagoshima 890-0065, Japan
1
f
Department of Protozoology, Institute of Tropical Medicine (NEKKEN), Nagasaki University,
1-12-4 Sakamoto, Nagasaki 852-8523, Japan.
g
Laboratory of Infectious Diseases, Joint Faculty of Veterinary Medicine, Kagoshima
University, 1-21-24 Korimoto, Kagoshima 890-0065, Japan
h
Kagoshima Prefectural Institute for Environmental Research and Public Health, 11-40 Kinko-
cho, Kagoshima 892-0835, Japan.
i
Laboratory of Parasitology, Joint Faculty of Veterinary Medicine, Kagoshima University, 1-
21-24 Korimoto, Kagoshima 890-0065, Japan
* Correspondence:
Tatsunori Masatani, DVM, PhD.
E-mail: [email protected]; [email protected]
Address: Transboundary Animal Diseases Research Center, Joint Faculty of Veterinary Medicine, Kagoshima University, 1-21-24 Korimoto, Kagoshima 890-0065, Japan
Tel: +81-99-285-8708 / Fax: +81-99-285-3589
1
T. Masatani and K. Hayashi contributed equally to this work.
2
Abstract
To reveal the distribution of tick-borne parasites, we established a novel nested polymerase chain reaction (PCR) system to detect the most common agents of tick-borne parasitic diseases, namely Babesia, Theileria, and Hepatozoon parasites. We collected host-seeking or animalfeeding ticks in Kagoshima Prefecture, the southernmost region of Kyusyu Island in southwestern Japan. Twenty of the total of 776 tick samples displayed a specific band of the appropriate size (approximately 1.4–1.6 kbp) for the 18S rRNA genes in the novel nested PCR (20/776: 2.58%). These PCR products have individual sequences of Babesia (from 8 ticks), Theileria (from 9 ticks: one tick sample including at least two Theileria spp. sequences), and Hepatozoon spp. (from 3 ticks). Phylogenetic analyses revealed that these sequences were close to those of undescribed Babesia spp. detected in feral raccoons in Japan (5 sequences; 3 sequences being identical), Babesia gibsoni-like parasites detected in pigs in China (3 sequences; all sequences being identical), Theileria spp. detected in sika deer in Japan and China (10 sequences; 2 sequences being identical), Hepatozoon canis (one sequence), and Hepatozoon spp. detected in Japanese martens in Japan (two sequences). In summary, we showed that various tick-borne parasites exist in Kagoshima, the southern region in Japan by using the novel nested PCR system. These including undescribed species such as Babesia gibsoni-like parasites previously detected in pigs in China. Importantly, our results revealed
3
new combinations of ticks and protozoan parasites in southern Japan. The results of this study will aid in the recognition of potential parasitic animal diseases caused by tick-borne parasites.
Keywords: Japan; ; ; ; ; , Kagoshima Prefecture, Tick, Babesia, Theileria, Hepatozoon
1. Introduction
Ticks are hematophagous ectoparasites of animals and humans. Although ticks may cause anemia in infested hosts, their medical and veterinary importance is mostly due to their capacity to transmit virus, bacteria, and protozoan parasites to animals and humans, in which they may cause a diverse range of illnesses commonly referred to as tick-borne diseases (TBDs) (de la Fuente et al., 2008; Otranto et al., 2014). A large number of novel TBD agents have been identified in the past two decades (Kernif et al., 2016), and there is an urgent need to control these diseases for both public health and veterinary medicine. To develop effective control strategies for TBDs, it is important to identify the vector ticks of the pathogens in the target geographical region (Aktas, 2014).
The genera Babesia, Theileria, and Hepatozoon are the majority of tick-transmitted protozoan parasites that infect wild and domestic mammals (Słodki et al., 2011). These parasites live in mammalian blood cells and sometimes cause severe diseases and death in infected animals. Babesia and Theileria are included in the order Piroplasmida. Babesia parasites infect
4
red blood cells (RBCs) in a wide range of mammals including cattle, sheep, horses, dogs, and rodents (Schnittger et al., 2012). At least 7 species of Babesia parasites including Babesia microti, Babesia divergens, and Babesia venatorum infect humans and sometimes cause severe symptoms and occasionally death (Hildebrandt et al., 2013; Homer et al., 2000; Gray et al., 2010).
Theileria parasites infect various domestic and wild ruminants,
causing diseases of varying degrees of severity (Mans et al., 2015). In a broad classification based on the ability of parasites to transform the leukocytes of host animals, Theileria parasites are divided into two groups consisting of malignant species (e.g., Theileria parva and Theileria annulata) and benign species (e.g., Theileria orientalis) (Sivakumar et al., 2014a). Hepatozoon parasites are intraerythrocytic parasites that have been found in almost all groups of vertebrates including reptiles, birds, and amphibians (Smith, 1996). Of these, Hepatozoon canis and Hepatozoon felis, the causative agents of canine and feline hepatozoonoses, respectively, are important species in veterinary medicine (Baneth, 2011).
Although there are some recent reports of detection of tick-borne parasites from questing ticks in Hokkaido and Okinawa (Yokoyama et al., 2012; Sivakumar et al., 2014b), there have been very few molecular epidemiological studies on protozoan parasites from questing ticks in other regions of Japan. Kyushu is the most southwesterly of the four main islands of Japan (Fig. 1A). There are several reports about tick-borne protozoan parasites isolated from animals in the
5
southwestern region of Japan including Kyushu (El-Dakhly et al., 2013; Tateno et al., 2013), but molecular epidemiological studies on parasites from ticks collected in Kyushu are limited.
In this study, to reveal the distribution of tick-borne parasites in ticks from the southern region of Japan, we collected hard ticks from the mainland of Kagoshima Prefecture, the southernmost area of Kyushu (Fig. 1B). We established a novel nested polymerase chain reaction (PCR) system to detect most TBD-causing protozoa, namely Babesia, Theileria, and Hepatozoon species. We performed molecular screening of these parasites to determine their prevalence in the collected ticks and conducted phylogenetic characterization.
2. Materials and methods
2.1. Collection of ticks
From March 2013 to March 2015, host-seeking adult and nymphal ticks were collected by flagging over vegetation from several areas in the mainland of Kagoshima Prefecture (Fig. 1 and Table 1). Flagging points were similar environments outside cities (natural parks and community-based forest), crossing zones of areas of human residence and territories of wild animals (i.e., deer, wild boars, raccoon dogs, badgers). Ticks were also collected from animals, captured stray dogs, and hunted sika deer and wild boar (Table 2). The collected ticks were identified morphologically to determine species, sex, and developmental stage.
6
2.2. DNA extraction from ticks
Total DNA was prepared from the whole bodies of collected ticks using NaOH (Takano et al., 2014). Briefly, ticks were lysed in 50 l of 25 mM NaOH for 10 min at 95°C. After adding 4 l of Tris-HCl (1 M, pH 7.5) for neutralization, the lysate was centrifuged at 4°C. The resulting supernatant was stored at −20°C until use as template DNA for nested PCR as described subsequently in the text.
2.3. Primer design and nested PCR
For primer design, some sequences of the 18S rRNA genes of Babesia spp. (B. gibsoni, AF175300; B. bovis, AY150059; and B. divergens, U16370), Theileria spp. (T. orientalis, AB016074; Theileria cervi, AY735119; T. parva, AF013418; and T. annulata, AY508466), and Hepatozoon spp. (H. canis, JX112783; and H. felis, AB771576) were obtained from GenBank. The sequences were aligned using ClustalW (http://www.ebi.ac.uk/Tools/msa/clustalw2/) and were visually checked for regions that have homologies among parasites. Primers were designed by using ApE software (http://biologylabs.utah.edu/jorgensen/wayned/ape/). The specificity of the designed primers was confirmed by additional BLAST searches (http://blast.ncbi.nlm.nih.gov/Blast.cgi). The names and sequences of the primers are shown in Table 3.
7
The first PCR was performed in a 10-l volume containing 0.5 l of stored DNA template, 0.3 l of each first primer (10 M, BTH 18S 1st F and R; Table 3), 0.3 l of Tks Gflex DNA polymerase (1.25 U/l) (TaKaRa Bio Inc., Shiga, Japan), 5 l of 2 × Gflex PCR Buffer (Mg2+, dNTP plus [final concentrations of 1 mM and 200 M, respectively]; TaKaRa Bio Inc.), and 4.1 l of nuclease-free water (Promega, Madison, WI, USA). The PCR program consisted of an initial denaturation step for 1 min at 94℃, 30 cycles of denaturation for 10 s at 98 ℃, annealing for 15 s at 55℃, and extension for 45 s at 68 ℃, and a final extension for 5 min at 68℃. The second PCR was performed using the same conditions with 0.3 l of each second primer (10 M, BTH 18S 2nd F and R; Table 3) and 0.5 l of the first PCR amplification mixture as the template after 10-fold dilution in nuclease-free water. The second PCR products were subjected to 1% agarose gel electrophoresis, stained with ethidium bromide, and then visualized under ultraviolet light.
2.4. Sequencing and phylogenetic analysis
Appropriate sizes of DNA fragments obtained from the second PCR were excised from the gel and purified using a NucleoSpin Gel and PCR Clean-up Kit (MACHEREY-NAGEL, Düren, Germany), and the sequences were determined by the dideoxy chain termination method (BigDye v3.1 Cycle Sequencing Kit; Applied Biosystems, Foster City, CA, USA) using BTH
8
18S 2nd F, BTH 18S 2nd R, and Inner Seq primers (Table 3). A DNA fragment with mixed infection of parasites was inserted into a pGEM-T easy vector (Promega) after adding adenine residues to the 3’-ends of both strands using 10 × A-attachment Mix (Toyobo, Osaka, Japan), and the inserted nucleotide sequences (10 clones) were analyzed. The obtained sequences were compared to those already registered in the NCBI nucleotide database (http://www.ncbi.nlm.nih.gov/nuccore/). Then the sequences were aligned, and phylogenetic trees were constructed using the maximum likelihood method in MEGA version 6.06 (Tamura et al., 2013) with the Kimura 2-parameter + Γ model (Kimura, 1980) for Babesia spp., Tamura and Nei + Γ model (Tamura and Nei, 1993) for Theileria spp., and Tamura 3-parameter + Γ model (Tamura, 1992) for Hepatozoon spp., which were selected using the maximum likelihood test. Node support was assessed using 1000 bootstrap replicates. The nucleotide sequence data for the analyzed 18S rRNA genes of Theileria, Babesia, and Hepatozoon spp. are available in the GenBank database under accession numbers LC169075–LC169095 (Table 4).
3. Results and discussion
To detect parasite genes from tick samples broadly, we attempted to establish a novel nested PCR to detect genes from the tick-borne protozoan parasites Babesia, Theileria, and Hepatozoon spp. We obtained some sequence data for the 18S rRNA genes of Babesia,
9
Theileria, and Hepatozoon spp. from GenBank and designed nested PCR primer sets specific for these parasites (Table 3). Nested PCR using these primer sets with blood DNA samples from clinically diagnosed animals naturally infected with B. gibsoni, T. orientalis, H. canis, and H. felis and DNA samples from animal blood experimentally inoculated with B. microti and B. bovis produced positive PCR products of the expected size (approximately 1.4–1.6 kbp) for the 18S rRNA gene (Supplemental Fig. S1). Although there appeared to be an additional band in a sample (Fig. S1, lane 6), there was no problem with sequencing after excision and purification of the expected size of a DNA fragment.
A total of 624 host-seeking ticks from vegetation (Table 1) and 152 host-feeding ticks from hunted sika deer and wild boars and captured stray dogs were collected (Table 2). The majority of collected ticks were in the nymphal stage (513/776, 66.1%). Adult female ticks (167/776, 21.5%) and male ticks (96/776, 12.4%) were less numerous than nymphal ticks. The most abundant tick genus was Haemaphysalis (690/776, 88.9%). The majority of collected Haemaphysalis ticks were H. longicornis (287/776, 37.0%), Haemaphysalis flava (199/776, 25.6%), and Haemaphysalis formosensis (167/776, 21.5%). Amblyomma testudinarium ticks (73/776, 9.41%) were collected mainly from hunted wild boars (Table 2).
10
A total of 20 tick samples produced bands of the appropriate size via the novel nested PCR (Table 4; 20/776: 2.58%). Nineteen of the 20 sequenced second PCR products have individual sequences of Babesia (8 ticks), Theileria (8 ticks), and Hepatozoon (3 ticks) (Table 4). Sequencing of the second PCR product from one tick sample (MT509) revealed that this sample contained multiple parasites because mixed peaks were observed in a chromatogram. Conventional TA cloning of the second PCR product from MT509 followed by sequence determination revealed that the tick sample contained at least two sequences of Theileria spp. (LC169088 and LC169089).
The nucleotide sequences of Babesia spp. detected in this study were analyzed, and they are depicted in a phylogenetic tree (Fig. 2). We detected five Babesia sequences from H. flava and H. formosensis (LC169078–LC169082; the sequences of LC169080, LC169081 and LC169082 being 100% identical), and the sequences were identical or extremely close to these of Babesia spp. from feral raccoons (Procyon lotor) in Hokkaido (similarity, 98.6%–100%) (Jinnai et al., 2009). These results suggest that H. flava and H. formosensis can be vectors of Babesia spp. Moreover, the fact that almost identical sequences were detected from ticks collected in Hokkaido and Kyushu suggests that Babesia spp. are distributed throughout Japan. Since the feral raccoon infected with Babesia spp. (Babesia sp. MA361-1: AB251610 and MA361-2: AB251611) did not show any lesions or splenomegaly, a major sign of babesiosis, in a previous
11
study (Jinnai et al., 2009), we hypothesized that the Babesia spp. detected in this study also may not cause severe damage in host animals. Further study is necessary to determine the pathogenicity of these Babesia spp.
Notably, we detected other Babesia parasites in 3 ticks (A. testudinarium) from a wild boar (LC169083-85) (Fig. 2), and their sequences were extremely close to that of B. gibsoni-like parasites detected in Chinese pigs (JX962780). Because B. gibsoni has been considered to not infect animals other than Canidae, detection of this pathogen was surprising. However, since the three PCR-positive ticks were collected from the same host and the sequences were 100% identical, it is unlikely that these ticks fed on Canidae hosts infected with B. gibsoni in a previous life stage. Although the genetic sequence of the B. gibsoni-like parasite isolated from Chinese pigs was only provided in GenBank and there is no detailed information available, this parasite and the B. gibsoni-like parasite detected in this study may represent a new species that can infect Suidae as hosts. Further detailed data and surveillance of the B. gibsoni-like parasite are necessary for identification.
A phylogenic tree of Theileria spp. including sequences detected in this study is shown in Fig. 3. We detected 10 sequences of Theileria parasites from H. longicornis, H. flava, H. formosensis, and H. kitaokai. Of these, three sequences (LC169086, LC169087, and LC169089)
12
were similar to those of Theileria spp. detected in the blood of sika deer in north China (similarity, 99.3-100%) (Liu et al., 2016), and the remaining seven sequences (LC169088 and LC169090–LC169095) were similar to those of Theileria isolated from sika deer in Japan (Ikawa et al., 2011). These sika deer Theileria spp. are considered to be benign parasites, and there is no report of the species being detected in livestock animals. Although previous studies showed that sika deer play an important role as reservoir hosts for several species of Theileria (He et al., 2012; Liu et al., 2016; Inokuma et al., 2004 and 2008), the species of tick that transmits the parasites has yet to be determined. Since some Theileria genes identified in this study were detected from Haemaphysalis ticks collected from vegetation (LC169086, LC169090, LC169091 and LC169092), our results suggest that many species of Haemaphysalis ticks could possibly be vectors of sika deer-infecting Theileria spp. In this study, we did not detect Theileria parasites of livestock such as T. orientalis, which are distributed in nearly all regions in Japan including Kyushu (Yokoyama et al., 2011; Masatani et al., 2016). The reason for this may be that we collected ticks from bushes of natural parks and a community-based forest but not pastures. Since the southern part of Kyushu has a thriving livestock industry and many pastures, the distribution of tick-borne livestock parasites in fields near pastures need to be investigated in further studies.
13
The results of phylogenetic analysis of the sequence data from Hepatozoon spp. detected in this study are shown in Fig. 4. Of the three Hepatozoon spp. detected in this study, a sequence from H. longicornis (LC169075) was identified as H. canis (similarity, 98.6-100%). On the other hand, the remaining two sequences from H. longicornis (LC169076) and H. hystricis (LC169077) were closely related to a Hepatozoon sp. detected in the myocardium of Japanese martens in Japan (FJ595127–FJ595131) (similarity, 98.1-98.9 % and 97.6-98.2 %, respectively) and the blood of European pine martens in Spain (EF222257) (Kubo et al., 2009; CriadoFornelio et al., 2009) (similarity, 99.2% and 99.8%, respectively). It was reported that a Hepatozoon sp. from pine martens causes myocarditis and myositis (Simpson et al., 2005). Although the detailed life cycles and pathogenesis of these marten Hepatozoon parasites for other animals including dogs and cats are unknown, our results suggest that H. longicornis and H. hystricis can be the vectors of them.
Since molecular epidemiological studies on protozoan parasites from ticks in southern Japan is limited, we expected that this region would have unique species of tick-borne parasites that have never been detected in Japan. However, we detected parasites closely related to previously reported species, including a Babesia sp. from a feral raccoon, Theileria sp. from sika deer, and Hepatozoon sp. from Japanese martens. Since these parasites were detected throughout Japan including northern regions (Jinnai et al., 2009; Ikawa et al., 2011; Inokuma et al, 2004 and
14
2008; Kubo et al., 2009), our results suggest that the distributions of tick-borne parasite species throughout Japan are similar.
In conclusion, this is the first report describing the presence of tick-borne parasites in ticks in the southern region in Japan. Interestingly, our results indicate that there are several undescribed protozoan parasite species in ticks collected in the region. The results of this surveillance study will be helpful for future epidemiological and phylogenetic studies on Babesia, Theileria, and Hepatozoon spp. in Japan. Moreover, importantly, we identified new combinations of ticks and protozoan parasites. Of course, the presence of parasitic DNA in tick samples does not necessarily mean that they are biological vectors. The pathogenicity of most of the parasites detected in this study to humans and animals is unknown. Further epidemiological studies are required to clarify the relationships among ticks, parasites, and mammalian hosts.
Conflict interests
The authors declare no conflicts of interest.
Acknowledgments
This study was supported by a Grant-in-Aid for Scientific Research (B) from the Japan Society for the Promotion of Science (JSPS) (KAKENHI Grant No. 15H05264).
15
References
Aktas, M., 2014. A survey of ixodid tick species and molecular identification of tick-borne pathogens. Vet. Parasitol. 200, 276-283.
Baneth, G., 2011. Perspective on canine and feline hepatozoonosis. Vet. Parasitol. 181, 3-11.
Criado-Fornelio, A., Buling, A., Casado, N., Gimenez, C., Ruas, J., Wendt, L., de Rosa-Farias, N., Pinheiro, M., Rey-Valeiron, C., Barda-Carretero, J.C., 2009. Molecular characterization of arthtopod-borne hematozoans in wild mammals from Brazil, Venezuela and Spain. Acta Parasitol. 54, 187-193.
de la Fuente, J., Estrada-Pena, A., Venzal, J.M., Kocan, K.M., Sonenshine, D.E., 2008. Overview: ticks as vectors of pathogens that cause disease in humans and animals. Front Biosci. 13, 6938-6946.
El-Dakhly, K.M., Goto, M., Noishiki, K., El-Nahass, el-S., Hirata, A., Sakai, H., Takashima, Y., El-Morsey, A., Yanai, T., 2013. Prevalence and diversity of Hepatozoon canis in naturally infected dogs in Japanese islands and peninsulas. Parasitol. Res. 112, 3267-3274.
Gray, J., Zintl, A., Hildebrandt, A., Hunfeld, K.P., Weiss, L., 2010. Zoonotic babesiosis: overview of the disease and novel aspects of pathogen identity. Ticks Tick Borne Dis. 1, 3-10.
16
He, L., Khan, M.K., Zhang, W.J., Zhang, Q.L., Zhou, Y.Q., Hu, M., Zhao, J., 2012. Detection and identification of Theileria infection in sika deer (Cervus nippon) in China. J. Parasitol. 98, 598-603.
Hildebrandt, A., Gray, J.S., Hunfeld, K.P., 2013. Human babesiosis in Europe: what clinicians need to know. Infection. 41, 1057-1072.
Homer, M.J., Aguilar-Delfin, I., Telford, 3rd S.R., Krause, P.J., Persing, D.H., 2000. Babesiosis. Clin. Microbiol. Rev. 13, 451-469.
Ikawa, K., Aoki, M., Ichikawa, M., Itagaki, T., 2011. Occurrence of two distinct Theileria lineages in sika deer (Cervus nippon) of Iwate Prefecture, Japan. J. Vet. Med. Sci. 73, 13711373.
Inokuma, H., Tsuji, M., Kim, S.J., Fujimoto, T., Nagata, M., Hosoi, E., Arai, S., Ishihara, C., Okuda, M., 2004. Phylogenetic analysis of Theileria sp. from sika deer, Cervus nippon, in Japan. Vet. Parasitol. 120, 339-345.
Inokuma, H., Nagata, M., Hosoi, E., Itamoto, K., Okuda, M., 2008. Divergence of p33/34 gene of Theileria found in Cervus nippon in Japan. J. Vet. Med. Sci. 70, 401-405.
Jinnai, M., Kawabuchi-Kurata, T., Tsuji, M., Nakajima, R., Fujisawa, K., Nagata, S., Koide, H., Matoba, Y., Asakawa, M., Takahashi, K., Ishihara, C., 2009. Molecular evidence for the
17
presence of new Babesia species in feral raccoons (Procyon lotor) in Hokkaido, Japan. Vet. Parasitol. 162, 241-247.
Kernif, T., Leulmi, H., Raoult, D., Parola, P., 2016. Emerging tick-borne bacterial pathogens. Microbiol. Spectr. 4, EI10-0012-2016.
Kimura, M., 1980. A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol. 16, 111-120.
Kubo, M., Nagataki, M., Agatsuma, T., Sakai, H., Masegi, T., Panciera, R.J., Yanai, T., 2009. Parasitological and molecular features of the Hepatozoon species in the myocardium of Japanese martens (Martes melampus melampus). J. Parasitol. 95, 1496-1502.
Liu, J., Yang, J., Guan, G., Liu, A., Wang, B., Luo, J., Yin, H., 2016. Molecular detection and identification of piroplasms in sika deer (Cervus nippon) from Jilin Province, China. Parasit. Vectors 9, 156.
Mans, B.J., Pienaar, R., Latif, A.A., 2015. A review of Theileria diagnostics and epidemiology. Int. J. Parasitol. Parasites Wildl. 4, 104-118.
Masatani, T., Yoshihara, S., Matsubara, A., Gotoh, T., Takahashi, H., Tanaka, T., Andoh, M., Endo, Y., Matsuo, T., 2016. Dynamics of Theileria orientalis genotype population in cattle in a year-round grazing system. Acta Parasitol. 61, 419-424.
18
Otranto, D., Dantas-Torres, F., Giannelli, A., Latrofa, M.S., Cascio, A., Cazzin, S., Ravagnan, S., Montarsi, F., Zanzani, S.A., Manfredi, M.T., Capelli, G., 2014. Ticks infesting humans in Italy and associated pathogens. Parasit. Vectors 7, 328.
Schnittger, L., Rodriguez, A.E., Florin-Christensen, M., Morrison, D.A., 2012. Babesia: a world emerging. Infect. Genet. Evol. 12, 1788-1809.
Simpson, V.R., Panciera, R.J., Hargreaves, J., McGarry, J.W., Scholes, S.F., Bown, K.J., Birtles, R.J., 2005. Myocarditis and myositis due to infection with Hepatozoon species in pine martens (Martes martes) in Scotland. Vet. Rec. 156, 442-446.
Sivakumar, T., Hayashida, K., Sugimoto, C., Yokoyama, N., 2014a. Evolution and genetic diversity of Theileria. Infect. Genet. Evol. 27, 250-263.
Sivakumar, T., Tattiyapong, M., Okubo, K., Suganuma, K., Hayashida, K., Igarashi, I., Zakimi, S., Matsumoto, K., Inokuma, H., Yokoyama, N., 2014b. PCR detection of Babesia ovata from questing ticks in Japan. Ticks Tick Borne Dis. 5, 305-310.
Słodki, J., Jasik, K.P., Kepa, M., Idzik, D., Wojtyczka, R.D., 2011. Tick-transmitted diseases caused by apicomplexa. Acta Protozool. 50, 155-161.
Smith, T.G., 1996. The genus Hepatozoon (Apicomplexa: Adeleina). J. Parasitol. 82, 565-585.
19
Takano, A., Toyomane, K., Konnai, S., Ohashi, K., Nakao, M., Ito, T., Andoh, M., Maeda, K., Watarai, M., Sato, K., Kawabata, H., 2014. Tick surveillance for relapsing fever spirochete Borrelia miyamotoi in Hokkaido, Japan. PLoS ONE 9, e104532.
Tamura, K., 1992. Estimation of the number of nucleotide substitutions when there are strong transition-transversion and G + C-content biases. Mol. Biol. Evol. 9, 678-687.
Tamura, K., Nei, M., 1993. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol. Biol. Evol. 10, 512-526.
Tamura, K., Stecher, G., Peterson, D., Filipski, A., Kumar, S., 2013. MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0. Mol. Biol. Evol. 30, 2725-2729.
Tateno, M., Nishio, T., Matsuo, T., Sakuma, M., Nakanishi, N., Izawa, M., Asari, Y., Okamura, M., Shimokawa-Miyama, T., Setoguchi, A., Endo, Y., 2013. Epidemiological survey of tickborne protozoal infection in Iriomote cats and Tsushima leopard cats in Japan. J. Vet. Med. Sci. 75, 985-989.
Yokoyama, N., Ueno, A., Mizuno, D., Kuboki, N., Khukhuu, A., Igarashi, I., Miyahara, T., Shiraishi, T., Kudo, R., Oshiro, M., Zakimi, S., Sugimoto, C., Matsumoto, K., Inokuma, H., 2011. Genotypic diversity of Theileria orientalis detected from cattle grazing in Kumamoto and Okinawa prefectures of Japan. J. Vet. Med. Sci. 73, 305-312.
20
Yokoyama, N., Sivakumar, T., Ota, N., Igarashi, I., Nakamura, Y., Yamashina, H., Matsui, S., Fukumoto, N., Hata, H., Kondo, S., Oshiro, M., Zakimi, S., Kuroda, Y., Kojima, N., Matsumoto, K., Inokuma, H., 2012. Genetic diversity of Theileria orientalis in tick vectors detected in Hokkaido and Okinawa, Japan. Infect Genet Evol. 12, 1669-1675.
21
Figure legends
Fig. 1.
Map of Kagoshima Prefecture. (A) Map of Japan. (B) Enlarged map of Kagoshima Prefecture (boxed area in panel A).
Fig. 2.
Phylogenetic tree based on nucleotide sequences of the 18s rRNA genes (1403 to 1405 bp) of Babesia spp. detected in this study along with reference sequences. This tree was constructed using the maximum likelihood method in MEGA version 6.06 with the Kimura 2-parameter + Γ model. Branch lengths correlate to the number of substitutions inferred according to the scale bar. Bootstrap values are shown as percentages at nodes based on 1000 replicates, and values lower than 80% were omitted.
Fig. 3.
Phylogenetic tree based on nucleotide sequences of the 18s rRNA genes (1497 bp) of Theileria spp. detected in this study along with reference sequences. This tree was constructed using the maximum likelihood method in MEGA version 6.06 with the Tamura and Nei + Γ model. Branch lengths correlate to the number of substitutions inferred according to the scale bar.
22
Bootstrap values are shown as percentages at nodes based on 1000 replicates, and values lower than 80% were omitted.
Fig. 4.
Phylogenetic tree based on nucleotide sequences of the 18s rRNA genes (622 to 625 bp) of Hepatozoon spp. detected in this study along with reference sequences. This tree was constructed using the maximum likelihood method in MEGA version 6.06 with the Tamura 3parameter + Γ model. Branch lengths correlate to the number of substitutions inferred according to the scale bar. Bootstrap values are shown as percentages at nodes based on 1000 replicates, and values lower than 80% were omitted.
23
A
B Hokkaido Kagoshima Prefecture
Honshu
Kyushu
50km Okinawa
500km
Fig. 1 Masatani et al.
24
LC169080 / LC169081 / LC169082 Babesia sp. MT753 / MT763 / MT775 (H. flava) AB935168 Babesia sp. KA25073 (Raccoon) Japan LC169079 Babesia sp. I38 (H. formosensis) AB251610 Babesia sp. MA361-1 (Raccoon) Japan AB251611 Babesia sp. MA361-2 (Raccoon) Japan LC169078 Babesia sp. MT61 (H. formosensis) JQ867356 B. hongkongensis (Cat) China AB251612 Babesia sp. SAP131 (Raccoon) Japan AB478329 B. gibsoni (Dog) Japan LC169083 / LC169084 / LC169085 B. gibsoni G111 / G112 / G134 (A. testudinarium) JX962780 B. gibsoni (Pig) China DQ028958 Babesia sp. AJB-2006 (Raccoon) USA AB251608 Babesia sp. MA230 (Raccoon) Japan AY150059 B. bovis (Cattle) Portugal
Fig. 2 Masatani et al.
25
LC169091 Theileria sp. MT593 (H. flava) LC169092 Theileria sp. MT604 (H. formosensis) LC169094 Theileria sp. G163 (H. kitaokai) LC169090 Theileria sp. MT592 (H. flava) AB602882 Theileria sp. Iwate116 (Sika deer) Japan LC169088 Theileria sp. MT509-1 (H. formosensis) LC169095 Theileria sp. G164 (H. kitaokai) LC169093 Theileria sp. G162 (H. kitaokai) KJ188207 T. capreoli (Red deer) China AB520956 T. orientalis (Cattle) Australia AB602880 Theileria sp. Iwate2-1 (Japanese serow) Japan AY260172 T. ovis (Sheep) Turkey U97054 T. cervi Type F (White-tailed deer) USA U97055 T. cervi Type G (White-tailed deer) USA AF078815 T. mutans (Cattle) Kenya AY262121 T. uilenbergi (Sheep) China LC169089 Theileria sp. MT509-2 (H. formosensis) KT959232 Theileria sp. TH327 (Sika deer) China LC169086 Theileria sp. MT102 (H. longicornis) LC169087 Theileria sp. MT158 (H. longicornis) AF013418 T. parva (Buffalo) Kenya AF499604 T. bicornis (South Africa) Black rhinoceros
Fig. 3 Masatani et al.
26
LC169076 Hepatozoon sp. MT456 (H. longicornis) FJ595128 Hepatozoon sp. JM-2 (Japanese marten) Japan FJ595127 Hepatozoon sp. JM-1 (Japanese marten) Japan FJ595129 Hepatozoon sp. JM-3 (Japanese marten) Japan FJ595130 Hepatozoon sp. JM-4 (Japanese marten) Japan FJ595131 Hepatozoon sp. JM-5 (Japanese marten) Japan LC169077 Hepatozoon sp. I35 (H. hystricis) EF222257 Hepatozoon sp. (European pine marten) Spain FJ595132 Hepatozoon sp. JM-6 (Japanese marten) Japan AB771576 H. felis (Tsushima leopard cat) Japan AF176836 H. americanum (Dog) USA EU041717 H. ursi (Japanese black bear) Japan DQ439540 H. canis (Dog) Venezuela AF418558 Hepatozoon sp. (Dog) Japan AY150067 H. canis (Fox) Spain LC169075 H. canis MT208 (H. longicornis) FJ769388 B. gibsoni (Dog) Taiwan
Fig. 4 Masatani et al.
27
Table 1. Ticks collected by flagging over vegetation. Tick
Nymph
Female
Male
Total
H. longicornis
187
26
6
219
H. flava
138
22
31
191
H. formosensis
139
8
12
159
H. hystricis
11
8
4
23
H. kitaokai
0
4
3
7
A. testudinarium
1
3
8
12
I. nipponensis
9
0
0
9
I. turdus
3
0
0
3
I. ovatus
0
1
0
1
488
72
64
624
Total Table 2. Ticks collected from animals. Animal
Tick
Sika deer
H. longicornis
8
19
0
27
H. flava
0
0
2
2
H. formosensis
2
0
0
2
A. testudinarium
1
0
0
1
H. longicornis
0
3
0
3
H. flava
0
0
4
4
H. formosensis
1
5
0
6
H. kitaokai
0
7
0
7
A. testudinarium
2
32
26
60
H. longicornis
9
29
0
38
H. flava
2
0
0
2
25
95
32
152
Wild boar
Dog
Total
Nymph
Female
Male
Total
28
Table 3. Oligonucleotide primers used for nested PCR and sequencing of 18S rRNA genes from Babesia, Theileria and Hepatozoon in this study. Primer BTH 18S 1st F BTH 18S 1st R BTH 18S 2nd F BTH 18S 2nd R Inner Seq
Sequence (5’ – 3’) GTGAAACTGCGAATGGCTCATTAC AAGTGATAAGGTTCACAAAACTTCCC GGCTCATTACAACAGTTATAGTTTATTTG CGGTCCGAATAATTCACCGGAT AAGTCTGGTGCCAGCAGC
Purpose 1st PCR 2nd PCR / Sequencing Sequencing
29
Table 4. Detected tick-borne parasites in this study. Tick ID
Tick species and collection
Stage of tick
Accession No.
MT61 Babesia sp.
H. formosensis, vegetation
Nymph
LC169078
I38 Babesia sp.
H. formosensis, vegetation
Male
LC169079
MT75 3 Babesia sp.
H. flava, vegetation
Nymph
LC169080
MT76 3 Babesia sp.
H. flava, vegetation
Nymph
LC169081
MT77 5 Babesia sp.
H. flava, vegetation
Male
LC169082
G111 Babesia gibsoni
A. testudinarium, wild boar
Female
LC169083
G112 B. gibsoni
A. testudinarium, wild boar
Female
LC169084
G135 B. gibsoni
A. testudinarium, wild boar
Female
LC169085
MT10 2 Theileria sp.
H. longicornis, vegetation
Nymph
LC169086
MT15 8 Theileria sp.
H. longicornis, sika deer
Female (engorged) LC169087
Detected parasites
H. formosensis, sika deer
Nymph
LC169088, LC169089
MT59 2 Theileria sp.
H. flava, vegetation
Nymph
LC169090
MT59 3 Theileria sp.
H. flava, vegetation
Nymph
LC169091
MT60 4 Theileria sp.
H. formosensis, vegetation
Nymph
LC169092
G162 Theileria sp.
H. kitaokai, sika deer
Female (engorged) LC169093
G163 Theileria sp.
H. kitaokai, sika deer
Female (engorged) LC169094
G164 Theileria sp.
H. kitaokai, sika deer
Female (engorged) LC169095
MT50 9
Theileria spp. (2 species)
30
MT20 8 H. canis
H. longicornis, dog
Female
LC169075
MT45 6 Hepatozoon sp.
H. longicornis, vegetation
Nymph
LC169076
H. hystricis, vegetation
Female
LC169077
I35 Hepatozoon sp.
31
S1877-959X(17)30148-6 http://dx.doi.org/doi:10.1016/j.ttbdis.2017.03.007 TTBDIS 810
To appear in: Received date: Revised date: Accepted date:
29-9-2016 22-3-2017 26-3-2017
Please cite this article as: Masatani, Tatsunori, Hayashi, Kei, Andoh, Masako, Tateno, Morihiro, Endo, Yasuyuki, Asada, Masahito, Kusakisako, Kodai, Tanaka, Tetsuya, Gokuden, Mutsuyo, Hozumi, Nodoka, Nakadohzono, Fumiko, Matsuo, Tomohide, Detection and molecular characterization of Babesia, Theileria, and Hepatozoon species in hard ticks collected from Kagoshima, the southern region in Japan.Ticks and Tickborne Diseases http://dx.doi.org/10.1016/j.ttbdis.2017.03.007 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Detection and molecular characterization of Babesia, Theileria, and Hepatozoon species in hard ticks collected from Kagoshima, the southern region in Japan
Tatsunori Masatani a, 1 *, Kei Hayashi b, c 1, Masako Andoh d, Morihiro Tateno e, Yasuyuki Endo e
, Masahito Asada f, Kodai Kusakisako g, Tetsuya Tanaka g, Mutsuyo Gokuden h, Nodoka
Hozumi h, Fumiko Nakadohzono h, Tomohide Matsuo i
a
Transboundary Animal Diseases Research Center, Joint Faculty of Veterinary Medicine,
Kagoshima University, 1-21-24 Korimoto, Kagoshima 890-0065, Japan
b
Laboratory of Veterinary Parasitology, Faculty of Agriculture, Iwate University, 3-18-8 Ueda,
Morioka 020-8550, Japan
c
Department of Pathogenetic Veterinary Science, United Graduate School of Veterinary
Science, Gifu University, 1-1 Yanagido, Gifu 501-1193, Japan.
d
Laboratory of Veterinary Public Health, Joint Faculty of Veterinary Medicine, Kagoshima
University, 1-21-24 Korimoto, Kagoshima 890-0065, Japan.
e
Laboratory of Small Animal Internal Medicine, Joint Faculty of Veterinary Medicine,
Kagoshima University, 1-21-24 Korimoto, Kagoshima 890-0065, Japan
1
f
Department of Protozoology, Institute of Tropical Medicine (NEKKEN), Nagasaki University,
1-12-4 Sakamoto, Nagasaki 852-8523, Japan.
g
Laboratory of Infectious Diseases, Joint Faculty of Veterinary Medicine, Kagoshima
University, 1-21-24 Korimoto, Kagoshima 890-0065, Japan
h
Kagoshima Prefectural Institute for Environmental Research and Public Health, 11-40 Kinko-
cho, Kagoshima 892-0835, Japan.
i
Laboratory of Parasitology, Joint Faculty of Veterinary Medicine, Kagoshima University, 1-
21-24 Korimoto, Kagoshima 890-0065, Japan
* Correspondence:
Tatsunori Masatani, DVM, PhD.
E-mail: [email protected]; [email protected]
Address: Transboundary Animal Diseases Research Center, Joint Faculty of Veterinary Medicine, Kagoshima University, 1-21-24 Korimoto, Kagoshima 890-0065, Japan
Tel: +81-99-285-8708 / Fax: +81-99-285-3589
1
T. Masatani and K. Hayashi contributed equally to this work.
2
Abstract
To reveal the distribution of tick-borne parasites, we established a novel nested polymerase chain reaction (PCR) system to detect the most common agents of tick-borne parasitic diseases, namely Babesia, Theileria, and Hepatozoon parasites. We collected host-seeking or animalfeeding ticks in Kagoshima Prefecture, the southernmost region of Kyusyu Island in southwestern Japan. Twenty of the total of 776 tick samples displayed a specific band of the appropriate size (approximately 1.4–1.6 kbp) for the 18S rRNA genes in the novel nested PCR (20/776: 2.58%). These PCR products have individual sequences of Babesia (from 8 ticks), Theileria (from 9 ticks: one tick sample including at least two Theileria spp. sequences), and Hepatozoon spp. (from 3 ticks). Phylogenetic analyses revealed that these sequences were close to those of undescribed Babesia spp. detected in feral raccoons in Japan (5 sequences; 3 sequences being identical), Babesia gibsoni-like parasites detected in pigs in China (3 sequences; all sequences being identical), Theileria spp. detected in sika deer in Japan and China (10 sequences; 2 sequences being identical), Hepatozoon canis (one sequence), and Hepatozoon spp. detected in Japanese martens in Japan (two sequences). In summary, we showed that various tick-borne parasites exist in Kagoshima, the southern region in Japan by using the novel nested PCR system. These including undescribed species such as Babesia gibsoni-like parasites previously detected in pigs in China. Importantly, our results revealed
3
new combinations of ticks and protozoan parasites in southern Japan. The results of this study will aid in the recognition of potential parasitic animal diseases caused by tick-borne parasites.
Keywords: Japan; ; ; ; ; , Kagoshima Prefecture, Tick, Babesia, Theileria, Hepatozoon
1. Introduction
Ticks are hematophagous ectoparasites of animals and humans. Although ticks may cause anemia in infested hosts, their medical and veterinary importance is mostly due to their capacity to transmit virus, bacteria, and protozoan parasites to animals and humans, in which they may cause a diverse range of illnesses commonly referred to as tick-borne diseases (TBDs) (de la Fuente et al., 2008; Otranto et al., 2014). A large number of novel TBD agents have been identified in the past two decades (Kernif et al., 2016), and there is an urgent need to control these diseases for both public health and veterinary medicine. To develop effective control strategies for TBDs, it is important to identify the vector ticks of the pathogens in the target geographical region (Aktas, 2014).
The genera Babesia, Theileria, and Hepatozoon are the majority of tick-transmitted protozoan parasites that infect wild and domestic mammals (Słodki et al., 2011). These parasites live in mammalian blood cells and sometimes cause severe diseases and death in infected animals. Babesia and Theileria are included in the order Piroplasmida. Babesia parasites infect
4
red blood cells (RBCs) in a wide range of mammals including cattle, sheep, horses, dogs, and rodents (Schnittger et al., 2012). At least 7 species of Babesia parasites including Babesia microti, Babesia divergens, and Babesia venatorum infect humans and sometimes cause severe symptoms and occasionally death (Hildebrandt et al., 2013; Homer et al., 2000; Gray et al., 2010).
Theileria parasites infect various domestic and wild ruminants,
causing diseases of varying degrees of severity (Mans et al., 2015). In a broad classification based on the ability of parasites to transform the leukocytes of host animals, Theileria parasites are divided into two groups consisting of malignant species (e.g., Theileria parva and Theileria annulata) and benign species (e.g., Theileria orientalis) (Sivakumar et al., 2014a). Hepatozoon parasites are intraerythrocytic parasites that have been found in almost all groups of vertebrates including reptiles, birds, and amphibians (Smith, 1996). Of these, Hepatozoon canis and Hepatozoon felis, the causative agents of canine and feline hepatozoonoses, respectively, are important species in veterinary medicine (Baneth, 2011).
Although there are some recent reports of detection of tick-borne parasites from questing ticks in Hokkaido and Okinawa (Yokoyama et al., 2012; Sivakumar et al., 2014b), there have been very few molecular epidemiological studies on protozoan parasites from questing ticks in other regions of Japan. Kyushu is the most southwesterly of the four main islands of Japan (Fig. 1A). There are several reports about tick-borne protozoan parasites isolated from animals in the
5
southwestern region of Japan including Kyushu (El-Dakhly et al., 2013; Tateno et al., 2013), but molecular epidemiological studies on parasites from ticks collected in Kyushu are limited.
In this study, to reveal the distribution of tick-borne parasites in ticks from the southern region of Japan, we collected hard ticks from the mainland of Kagoshima Prefecture, the southernmost area of Kyushu (Fig. 1B). We established a novel nested polymerase chain reaction (PCR) system to detect most TBD-causing protozoa, namely Babesia, Theileria, and Hepatozoon species. We performed molecular screening of these parasites to determine their prevalence in the collected ticks and conducted phylogenetic characterization.
2. Materials and methods
2.1. Collection of ticks
From March 2013 to March 2015, host-seeking adult and nymphal ticks were collected by flagging over vegetation from several areas in the mainland of Kagoshima Prefecture (Fig. 1 and Table 1). Flagging points were similar environments outside cities (natural parks and community-based forest), crossing zones of areas of human residence and territories of wild animals (i.e., deer, wild boars, raccoon dogs, badgers). Ticks were also collected from animals, captured stray dogs, and hunted sika deer and wild boar (Table 2). The collected ticks were identified morphologically to determine species, sex, and developmental stage.
6
2.2. DNA extraction from ticks
Total DNA was prepared from the whole bodies of collected ticks using NaOH (Takano et al., 2014). Briefly, ticks were lysed in 50 l of 25 mM NaOH for 10 min at 95°C. After adding 4 l of Tris-HCl (1 M, pH 7.5) for neutralization, the lysate was centrifuged at 4°C. The resulting supernatant was stored at −20°C until use as template DNA for nested PCR as described subsequently in the text.
2.3. Primer design and nested PCR
For primer design, some sequences of the 18S rRNA genes of Babesia spp. (B. gibsoni, AF175300; B. bovis, AY150059; and B. divergens, U16370), Theileria spp. (T. orientalis, AB016074; Theileria cervi, AY735119; T. parva, AF013418; and T. annulata, AY508466), and Hepatozoon spp. (H. canis, JX112783; and H. felis, AB771576) were obtained from GenBank. The sequences were aligned using ClustalW (http://www.ebi.ac.uk/Tools/msa/clustalw2/) and were visually checked for regions that have homologies among parasites. Primers were designed by using ApE software (http://biologylabs.utah.edu/jorgensen/wayned/ape/). The specificity of the designed primers was confirmed by additional BLAST searches (http://blast.ncbi.nlm.nih.gov/Blast.cgi). The names and sequences of the primers are shown in Table 3.
7
The first PCR was performed in a 10-l volume containing 0.5 l of stored DNA template, 0.3 l of each first primer (10 M, BTH 18S 1st F and R; Table 3), 0.3 l of Tks Gflex DNA polymerase (1.25 U/l) (TaKaRa Bio Inc., Shiga, Japan), 5 l of 2 × Gflex PCR Buffer (Mg2+, dNTP plus [final concentrations of 1 mM and 200 M, respectively]; TaKaRa Bio Inc.), and 4.1 l of nuclease-free water (Promega, Madison, WI, USA). The PCR program consisted of an initial denaturation step for 1 min at 94℃, 30 cycles of denaturation for 10 s at 98 ℃, annealing for 15 s at 55℃, and extension for 45 s at 68 ℃, and a final extension for 5 min at 68℃. The second PCR was performed using the same conditions with 0.3 l of each second primer (10 M, BTH 18S 2nd F and R; Table 3) and 0.5 l of the first PCR amplification mixture as the template after 10-fold dilution in nuclease-free water. The second PCR products were subjected to 1% agarose gel electrophoresis, stained with ethidium bromide, and then visualized under ultraviolet light.
2.4. Sequencing and phylogenetic analysis
Appropriate sizes of DNA fragments obtained from the second PCR were excised from the gel and purified using a NucleoSpin Gel and PCR Clean-up Kit (MACHEREY-NAGEL, Düren, Germany), and the sequences were determined by the dideoxy chain termination method (BigDye v3.1 Cycle Sequencing Kit; Applied Biosystems, Foster City, CA, USA) using BTH
8
18S 2nd F, BTH 18S 2nd R, and Inner Seq primers (Table 3). A DNA fragment with mixed infection of parasites was inserted into a pGEM-T easy vector (Promega) after adding adenine residues to the 3’-ends of both strands using 10 × A-attachment Mix (Toyobo, Osaka, Japan), and the inserted nucleotide sequences (10 clones) were analyzed. The obtained sequences were compared to those already registered in the NCBI nucleotide database (http://www.ncbi.nlm.nih.gov/nuccore/). Then the sequences were aligned, and phylogenetic trees were constructed using the maximum likelihood method in MEGA version 6.06 (Tamura et al., 2013) with the Kimura 2-parameter + Γ model (Kimura, 1980) for Babesia spp., Tamura and Nei + Γ model (Tamura and Nei, 1993) for Theileria spp., and Tamura 3-parameter + Γ model (Tamura, 1992) for Hepatozoon spp., which were selected using the maximum likelihood test. Node support was assessed using 1000 bootstrap replicates. The nucleotide sequence data for the analyzed 18S rRNA genes of Theileria, Babesia, and Hepatozoon spp. are available in the GenBank database under accession numbers LC169075–LC169095 (Table 4).
3. Results and discussion
To detect parasite genes from tick samples broadly, we attempted to establish a novel nested PCR to detect genes from the tick-borne protozoan parasites Babesia, Theileria, and Hepatozoon spp. We obtained some sequence data for the 18S rRNA genes of Babesia,
9
Theileria, and Hepatozoon spp. from GenBank and designed nested PCR primer sets specific for these parasites (Table 3). Nested PCR using these primer sets with blood DNA samples from clinically diagnosed animals naturally infected with B. gibsoni, T. orientalis, H. canis, and H. felis and DNA samples from animal blood experimentally inoculated with B. microti and B. bovis produced positive PCR products of the expected size (approximately 1.4–1.6 kbp) for the 18S rRNA gene (Supplemental Fig. S1). Although there appeared to be an additional band in a sample (Fig. S1, lane 6), there was no problem with sequencing after excision and purification of the expected size of a DNA fragment.
A total of 624 host-seeking ticks from vegetation (Table 1) and 152 host-feeding ticks from hunted sika deer and wild boars and captured stray dogs were collected (Table 2). The majority of collected ticks were in the nymphal stage (513/776, 66.1%). Adult female ticks (167/776, 21.5%) and male ticks (96/776, 12.4%) were less numerous than nymphal ticks. The most abundant tick genus was Haemaphysalis (690/776, 88.9%). The majority of collected Haemaphysalis ticks were H. longicornis (287/776, 37.0%), Haemaphysalis flava (199/776, 25.6%), and Haemaphysalis formosensis (167/776, 21.5%). Amblyomma testudinarium ticks (73/776, 9.41%) were collected mainly from hunted wild boars (Table 2).
10
A total of 20 tick samples produced bands of the appropriate size via the novel nested PCR (Table 4; 20/776: 2.58%). Nineteen of the 20 sequenced second PCR products have individual sequences of Babesia (8 ticks), Theileria (8 ticks), and Hepatozoon (3 ticks) (Table 4). Sequencing of the second PCR product from one tick sample (MT509) revealed that this sample contained multiple parasites because mixed peaks were observed in a chromatogram. Conventional TA cloning of the second PCR product from MT509 followed by sequence determination revealed that the tick sample contained at least two sequences of Theileria spp. (LC169088 and LC169089).
The nucleotide sequences of Babesia spp. detected in this study were analyzed, and they are depicted in a phylogenetic tree (Fig. 2). We detected five Babesia sequences from H. flava and H. formosensis (LC169078–LC169082; the sequences of LC169080, LC169081 and LC169082 being 100% identical), and the sequences were identical or extremely close to these of Babesia spp. from feral raccoons (Procyon lotor) in Hokkaido (similarity, 98.6%–100%) (Jinnai et al., 2009). These results suggest that H. flava and H. formosensis can be vectors of Babesia spp. Moreover, the fact that almost identical sequences were detected from ticks collected in Hokkaido and Kyushu suggests that Babesia spp. are distributed throughout Japan. Since the feral raccoon infected with Babesia spp. (Babesia sp. MA361-1: AB251610 and MA361-2: AB251611) did not show any lesions or splenomegaly, a major sign of babesiosis, in a previous
11
study (Jinnai et al., 2009), we hypothesized that the Babesia spp. detected in this study also may not cause severe damage in host animals. Further study is necessary to determine the pathogenicity of these Babesia spp.
Notably, we detected other Babesia parasites in 3 ticks (A. testudinarium) from a wild boar (LC169083-85) (Fig. 2), and their sequences were extremely close to that of B. gibsoni-like parasites detected in Chinese pigs (JX962780). Because B. gibsoni has been considered to not infect animals other than Canidae, detection of this pathogen was surprising. However, since the three PCR-positive ticks were collected from the same host and the sequences were 100% identical, it is unlikely that these ticks fed on Canidae hosts infected with B. gibsoni in a previous life stage. Although the genetic sequence of the B. gibsoni-like parasite isolated from Chinese pigs was only provided in GenBank and there is no detailed information available, this parasite and the B. gibsoni-like parasite detected in this study may represent a new species that can infect Suidae as hosts. Further detailed data and surveillance of the B. gibsoni-like parasite are necessary for identification.
A phylogenic tree of Theileria spp. including sequences detected in this study is shown in Fig. 3. We detected 10 sequences of Theileria parasites from H. longicornis, H. flava, H. formosensis, and H. kitaokai. Of these, three sequences (LC169086, LC169087, and LC169089)
12
were similar to those of Theileria spp. detected in the blood of sika deer in north China (similarity, 99.3-100%) (Liu et al., 2016), and the remaining seven sequences (LC169088 and LC169090–LC169095) were similar to those of Theileria isolated from sika deer in Japan (Ikawa et al., 2011). These sika deer Theileria spp. are considered to be benign parasites, and there is no report of the species being detected in livestock animals. Although previous studies showed that sika deer play an important role as reservoir hosts for several species of Theileria (He et al., 2012; Liu et al., 2016; Inokuma et al., 2004 and 2008), the species of tick that transmits the parasites has yet to be determined. Since some Theileria genes identified in this study were detected from Haemaphysalis ticks collected from vegetation (LC169086, LC169090, LC169091 and LC169092), our results suggest that many species of Haemaphysalis ticks could possibly be vectors of sika deer-infecting Theileria spp. In this study, we did not detect Theileria parasites of livestock such as T. orientalis, which are distributed in nearly all regions in Japan including Kyushu (Yokoyama et al., 2011; Masatani et al., 2016). The reason for this may be that we collected ticks from bushes of natural parks and a community-based forest but not pastures. Since the southern part of Kyushu has a thriving livestock industry and many pastures, the distribution of tick-borne livestock parasites in fields near pastures need to be investigated in further studies.
13
The results of phylogenetic analysis of the sequence data from Hepatozoon spp. detected in this study are shown in Fig. 4. Of the three Hepatozoon spp. detected in this study, a sequence from H. longicornis (LC169075) was identified as H. canis (similarity, 98.6-100%). On the other hand, the remaining two sequences from H. longicornis (LC169076) and H. hystricis (LC169077) were closely related to a Hepatozoon sp. detected in the myocardium of Japanese martens in Japan (FJ595127–FJ595131) (similarity, 98.1-98.9 % and 97.6-98.2 %, respectively) and the blood of European pine martens in Spain (EF222257) (Kubo et al., 2009; CriadoFornelio et al., 2009) (similarity, 99.2% and 99.8%, respectively). It was reported that a Hepatozoon sp. from pine martens causes myocarditis and myositis (Simpson et al., 2005). Although the detailed life cycles and pathogenesis of these marten Hepatozoon parasites for other animals including dogs and cats are unknown, our results suggest that H. longicornis and H. hystricis can be the vectors of them.
Since molecular epidemiological studies on protozoan parasites from ticks in southern Japan is limited, we expected that this region would have unique species of tick-borne parasites that have never been detected in Japan. However, we detected parasites closely related to previously reported species, including a Babesia sp. from a feral raccoon, Theileria sp. from sika deer, and Hepatozoon sp. from Japanese martens. Since these parasites were detected throughout Japan including northern regions (Jinnai et al., 2009; Ikawa et al., 2011; Inokuma et al, 2004 and
14
2008; Kubo et al., 2009), our results suggest that the distributions of tick-borne parasite species throughout Japan are similar.
In conclusion, this is the first report describing the presence of tick-borne parasites in ticks in the southern region in Japan. Interestingly, our results indicate that there are several undescribed protozoan parasite species in ticks collected in the region. The results of this surveillance study will be helpful for future epidemiological and phylogenetic studies on Babesia, Theileria, and Hepatozoon spp. in Japan. Moreover, importantly, we identified new combinations of ticks and protozoan parasites. Of course, the presence of parasitic DNA in tick samples does not necessarily mean that they are biological vectors. The pathogenicity of most of the parasites detected in this study to humans and animals is unknown. Further epidemiological studies are required to clarify the relationships among ticks, parasites, and mammalian hosts.
Conflict interests
The authors declare no conflicts of interest.
Acknowledgments
This study was supported by a Grant-in-Aid for Scientific Research (B) from the Japan Society for the Promotion of Science (JSPS) (KAKENHI Grant No. 15H05264).
15
References
Aktas, M., 2014. A survey of ixodid tick species and molecular identification of tick-borne pathogens. Vet. Parasitol. 200, 276-283.
Baneth, G., 2011. Perspective on canine and feline hepatozoonosis. Vet. Parasitol. 181, 3-11.
Criado-Fornelio, A., Buling, A., Casado, N., Gimenez, C., Ruas, J., Wendt, L., de Rosa-Farias, N., Pinheiro, M., Rey-Valeiron, C., Barda-Carretero, J.C., 2009. Molecular characterization of arthtopod-borne hematozoans in wild mammals from Brazil, Venezuela and Spain. Acta Parasitol. 54, 187-193.
de la Fuente, J., Estrada-Pena, A., Venzal, J.M., Kocan, K.M., Sonenshine, D.E., 2008. Overview: ticks as vectors of pathogens that cause disease in humans and animals. Front Biosci. 13, 6938-6946.
El-Dakhly, K.M., Goto, M., Noishiki, K., El-Nahass, el-S., Hirata, A., Sakai, H., Takashima, Y., El-Morsey, A., Yanai, T., 2013. Prevalence and diversity of Hepatozoon canis in naturally infected dogs in Japanese islands and peninsulas. Parasitol. Res. 112, 3267-3274.
Gray, J., Zintl, A., Hildebrandt, A., Hunfeld, K.P., Weiss, L., 2010. Zoonotic babesiosis: overview of the disease and novel aspects of pathogen identity. Ticks Tick Borne Dis. 1, 3-10.
16
He, L., Khan, M.K., Zhang, W.J., Zhang, Q.L., Zhou, Y.Q., Hu, M., Zhao, J., 2012. Detection and identification of Theileria infection in sika deer (Cervus nippon) in China. J. Parasitol. 98, 598-603.
Hildebrandt, A., Gray, J.S., Hunfeld, K.P., 2013. Human babesiosis in Europe: what clinicians need to know. Infection. 41, 1057-1072.
Homer, M.J., Aguilar-Delfin, I., Telford, 3rd S.R., Krause, P.J., Persing, D.H., 2000. Babesiosis. Clin. Microbiol. Rev. 13, 451-469.
Ikawa, K., Aoki, M., Ichikawa, M., Itagaki, T., 2011. Occurrence of two distinct Theileria lineages in sika deer (Cervus nippon) of Iwate Prefecture, Japan. J. Vet. Med. Sci. 73, 13711373.
Inokuma, H., Tsuji, M., Kim, S.J., Fujimoto, T., Nagata, M., Hosoi, E., Arai, S., Ishihara, C., Okuda, M., 2004. Phylogenetic analysis of Theileria sp. from sika deer, Cervus nippon, in Japan. Vet. Parasitol. 120, 339-345.
Inokuma, H., Nagata, M., Hosoi, E., Itamoto, K., Okuda, M., 2008. Divergence of p33/34 gene of Theileria found in Cervus nippon in Japan. J. Vet. Med. Sci. 70, 401-405.
Jinnai, M., Kawabuchi-Kurata, T., Tsuji, M., Nakajima, R., Fujisawa, K., Nagata, S., Koide, H., Matoba, Y., Asakawa, M., Takahashi, K., Ishihara, C., 2009. Molecular evidence for the
17
presence of new Babesia species in feral raccoons (Procyon lotor) in Hokkaido, Japan. Vet. Parasitol. 162, 241-247.
Kernif, T., Leulmi, H., Raoult, D., Parola, P., 2016. Emerging tick-borne bacterial pathogens. Microbiol. Spectr. 4, EI10-0012-2016.
Kimura, M., 1980. A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol. 16, 111-120.
Kubo, M., Nagataki, M., Agatsuma, T., Sakai, H., Masegi, T., Panciera, R.J., Yanai, T., 2009. Parasitological and molecular features of the Hepatozoon species in the myocardium of Japanese martens (Martes melampus melampus). J. Parasitol. 95, 1496-1502.
Liu, J., Yang, J., Guan, G., Liu, A., Wang, B., Luo, J., Yin, H., 2016. Molecular detection and identification of piroplasms in sika deer (Cervus nippon) from Jilin Province, China. Parasit. Vectors 9, 156.
Mans, B.J., Pienaar, R., Latif, A.A., 2015. A review of Theileria diagnostics and epidemiology. Int. J. Parasitol. Parasites Wildl. 4, 104-118.
Masatani, T., Yoshihara, S., Matsubara, A., Gotoh, T., Takahashi, H., Tanaka, T., Andoh, M., Endo, Y., Matsuo, T., 2016. Dynamics of Theileria orientalis genotype population in cattle in a year-round grazing system. Acta Parasitol. 61, 419-424.
18
Otranto, D., Dantas-Torres, F., Giannelli, A., Latrofa, M.S., Cascio, A., Cazzin, S., Ravagnan, S., Montarsi, F., Zanzani, S.A., Manfredi, M.T., Capelli, G., 2014. Ticks infesting humans in Italy and associated pathogens. Parasit. Vectors 7, 328.
Schnittger, L., Rodriguez, A.E., Florin-Christensen, M., Morrison, D.A., 2012. Babesia: a world emerging. Infect. Genet. Evol. 12, 1788-1809.
Simpson, V.R., Panciera, R.J., Hargreaves, J., McGarry, J.W., Scholes, S.F., Bown, K.J., Birtles, R.J., 2005. Myocarditis and myositis due to infection with Hepatozoon species in pine martens (Martes martes) in Scotland. Vet. Rec. 156, 442-446.
Sivakumar, T., Hayashida, K., Sugimoto, C., Yokoyama, N., 2014a. Evolution and genetic diversity of Theileria. Infect. Genet. Evol. 27, 250-263.
Sivakumar, T., Tattiyapong, M., Okubo, K., Suganuma, K., Hayashida, K., Igarashi, I., Zakimi, S., Matsumoto, K., Inokuma, H., Yokoyama, N., 2014b. PCR detection of Babesia ovata from questing ticks in Japan. Ticks Tick Borne Dis. 5, 305-310.
Słodki, J., Jasik, K.P., Kepa, M., Idzik, D., Wojtyczka, R.D., 2011. Tick-transmitted diseases caused by apicomplexa. Acta Protozool. 50, 155-161.
Smith, T.G., 1996. The genus Hepatozoon (Apicomplexa: Adeleina). J. Parasitol. 82, 565-585.
19
Takano, A., Toyomane, K., Konnai, S., Ohashi, K., Nakao, M., Ito, T., Andoh, M., Maeda, K., Watarai, M., Sato, K., Kawabata, H., 2014. Tick surveillance for relapsing fever spirochete Borrelia miyamotoi in Hokkaido, Japan. PLoS ONE 9, e104532.
Tamura, K., 1992. Estimation of the number of nucleotide substitutions when there are strong transition-transversion and G + C-content biases. Mol. Biol. Evol. 9, 678-687.
Tamura, K., Nei, M., 1993. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol. Biol. Evol. 10, 512-526.
Tamura, K., Stecher, G., Peterson, D., Filipski, A., Kumar, S., 2013. MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0. Mol. Biol. Evol. 30, 2725-2729.
Tateno, M., Nishio, T., Matsuo, T., Sakuma, M., Nakanishi, N., Izawa, M., Asari, Y., Okamura, M., Shimokawa-Miyama, T., Setoguchi, A., Endo, Y., 2013. Epidemiological survey of tickborne protozoal infection in Iriomote cats and Tsushima leopard cats in Japan. J. Vet. Med. Sci. 75, 985-989.
Yokoyama, N., Ueno, A., Mizuno, D., Kuboki, N., Khukhuu, A., Igarashi, I., Miyahara, T., Shiraishi, T., Kudo, R., Oshiro, M., Zakimi, S., Sugimoto, C., Matsumoto, K., Inokuma, H., 2011. Genotypic diversity of Theileria orientalis detected from cattle grazing in Kumamoto and Okinawa prefectures of Japan. J. Vet. Med. Sci. 73, 305-312.
20
Yokoyama, N., Sivakumar, T., Ota, N., Igarashi, I., Nakamura, Y., Yamashina, H., Matsui, S., Fukumoto, N., Hata, H., Kondo, S., Oshiro, M., Zakimi, S., Kuroda, Y., Kojima, N., Matsumoto, K., Inokuma, H., 2012. Genetic diversity of Theileria orientalis in tick vectors detected in Hokkaido and Okinawa, Japan. Infect Genet Evol. 12, 1669-1675.
21
Figure legends
Fig. 1.
Map of Kagoshima Prefecture. (A) Map of Japan. (B) Enlarged map of Kagoshima Prefecture (boxed area in panel A).
Fig. 2.
Phylogenetic tree based on nucleotide sequences of the 18s rRNA genes (1403 to 1405 bp) of Babesia spp. detected in this study along with reference sequences. This tree was constructed using the maximum likelihood method in MEGA version 6.06 with the Kimura 2-parameter + Γ model. Branch lengths correlate to the number of substitutions inferred according to the scale bar. Bootstrap values are shown as percentages at nodes based on 1000 replicates, and values lower than 80% were omitted.
Fig. 3.
Phylogenetic tree based on nucleotide sequences of the 18s rRNA genes (1497 bp) of Theileria spp. detected in this study along with reference sequences. This tree was constructed using the maximum likelihood method in MEGA version 6.06 with the Tamura and Nei + Γ model. Branch lengths correlate to the number of substitutions inferred according to the scale bar.
22
Bootstrap values are shown as percentages at nodes based on 1000 replicates, and values lower than 80% were omitted.
Fig. 4.
Phylogenetic tree based on nucleotide sequences of the 18s rRNA genes (622 to 625 bp) of Hepatozoon spp. detected in this study along with reference sequences. This tree was constructed using the maximum likelihood method in MEGA version 6.06 with the Tamura 3parameter + Γ model. Branch lengths correlate to the number of substitutions inferred according to the scale bar. Bootstrap values are shown as percentages at nodes based on 1000 replicates, and values lower than 80% were omitted.
23
A
B Hokkaido Kagoshima Prefecture
Honshu
Kyushu
50km Okinawa
500km
Fig. 1 Masatani et al.
24
LC169080 / LC169081 / LC169082 Babesia sp. MT753 / MT763 / MT775 (H. flava) AB935168 Babesia sp. KA25073 (Raccoon) Japan LC169079 Babesia sp. I38 (H. formosensis) AB251610 Babesia sp. MA361-1 (Raccoon) Japan AB251611 Babesia sp. MA361-2 (Raccoon) Japan LC169078 Babesia sp. MT61 (H. formosensis) JQ867356 B. hongkongensis (Cat) China AB251612 Babesia sp. SAP131 (Raccoon) Japan AB478329 B. gibsoni (Dog) Japan LC169083 / LC169084 / LC169085 B. gibsoni G111 / G112 / G134 (A. testudinarium) JX962780 B. gibsoni (Pig) China DQ028958 Babesia sp. AJB-2006 (Raccoon) USA AB251608 Babesia sp. MA230 (Raccoon) Japan AY150059 B. bovis (Cattle) Portugal
Fig. 2 Masatani et al.
25
LC169091 Theileria sp. MT593 (H. flava) LC169092 Theileria sp. MT604 (H. formosensis) LC169094 Theileria sp. G163 (H. kitaokai) LC169090 Theileria sp. MT592 (H. flava) AB602882 Theileria sp. Iwate116 (Sika deer) Japan LC169088 Theileria sp. MT509-1 (H. formosensis) LC169095 Theileria sp. G164 (H. kitaokai) LC169093 Theileria sp. G162 (H. kitaokai) KJ188207 T. capreoli (Red deer) China AB520956 T. orientalis (Cattle) Australia AB602880 Theileria sp. Iwate2-1 (Japanese serow) Japan AY260172 T. ovis (Sheep) Turkey U97054 T. cervi Type F (White-tailed deer) USA U97055 T. cervi Type G (White-tailed deer) USA AF078815 T. mutans (Cattle) Kenya AY262121 T. uilenbergi (Sheep) China LC169089 Theileria sp. MT509-2 (H. formosensis) KT959232 Theileria sp. TH327 (Sika deer) China LC169086 Theileria sp. MT102 (H. longicornis) LC169087 Theileria sp. MT158 (H. longicornis) AF013418 T. parva (Buffalo) Kenya AF499604 T. bicornis (South Africa) Black rhinoceros
Fig. 3 Masatani et al.
26
LC169076 Hepatozoon sp. MT456 (H. longicornis) FJ595128 Hepatozoon sp. JM-2 (Japanese marten) Japan FJ595127 Hepatozoon sp. JM-1 (Japanese marten) Japan FJ595129 Hepatozoon sp. JM-3 (Japanese marten) Japan FJ595130 Hepatozoon sp. JM-4 (Japanese marten) Japan FJ595131 Hepatozoon sp. JM-5 (Japanese marten) Japan LC169077 Hepatozoon sp. I35 (H. hystricis) EF222257 Hepatozoon sp. (European pine marten) Spain FJ595132 Hepatozoon sp. JM-6 (Japanese marten) Japan AB771576 H. felis (Tsushima leopard cat) Japan AF176836 H. americanum (Dog) USA EU041717 H. ursi (Japanese black bear) Japan DQ439540 H. canis (Dog) Venezuela AF418558 Hepatozoon sp. (Dog) Japan AY150067 H. canis (Fox) Spain LC169075 H. canis MT208 (H. longicornis) FJ769388 B. gibsoni (Dog) Taiwan
Fig. 4 Masatani et al.
27
Table 1. Ticks collected by flagging over vegetation. Tick
Nymph
Female
Male
Total
H. longicornis
187
26
6
219
H. flava
138
22
31
191
H. formosensis
139
8
12
159
H. hystricis
11
8
4
23
H. kitaokai
0
4
3
7
A. testudinarium
1
3
8
12
I. nipponensis
9
0
0
9
I. turdus
3
0
0
3
I. ovatus
0
1
0
1
488
72
64
624
Total Table 2. Ticks collected from animals. Animal
Tick
Sika deer
H. longicornis
8
19
0
27
H. flava
0
0
2
2
H. formosensis
2
0
0
2
A. testudinarium
1
0
0
1
H. longicornis
0
3
0
3
H. flava
0
0
4
4
H. formosensis
1
5
0
6
H. kitaokai
0
7
0
7
A. testudinarium
2
32
26
60
H. longicornis
9
29
0
38
H. flava
2
0
0
2
25
95
32
152
Wild boar
Dog
Total
Nymph
Female
Male
Total
28
Table 3. Oligonucleotide primers used for nested PCR and sequencing of 18S rRNA genes from Babesia, Theileria and Hepatozoon in this study. Primer BTH 18S 1st F BTH 18S 1st R BTH 18S 2nd F BTH 18S 2nd R Inner Seq
Sequence (5’ – 3’) GTGAAACTGCGAATGGCTCATTAC AAGTGATAAGGTTCACAAAACTTCCC GGCTCATTACAACAGTTATAGTTTATTTG CGGTCCGAATAATTCACCGGAT AAGTCTGGTGCCAGCAGC
Purpose 1st PCR 2nd PCR / Sequencing Sequencing
29
Table 4. Detected tick-borne parasites in this study. Tick ID
Tick species and collection
Stage of tick
Accession No.
MT61 Babesia sp.
H. formosensis, vegetation
Nymph
LC169078
I38 Babesia sp.
H. formosensis, vegetation
Male
LC169079
MT75 3 Babesia sp.
H. flava, vegetation
Nymph
LC169080
MT76 3 Babesia sp.
H. flava, vegetation
Nymph
LC169081
MT77 5 Babesia sp.
H. flava, vegetation
Male
LC169082
G111 Babesia gibsoni
A. testudinarium, wild boar
Female
LC169083
G112 B. gibsoni
A. testudinarium, wild boar
Female
LC169084
G135 B. gibsoni
A. testudinarium, wild boar
Female
LC169085
MT10 2 Theileria sp.
H. longicornis, vegetation
Nymph
LC169086
MT15 8 Theileria sp.
H. longicornis, sika deer
Female (engorged) LC169087
Detected parasites
H. formosensis, sika deer
Nymph
LC169088, LC169089
MT59 2 Theileria sp.
H. flava, vegetation
Nymph
LC169090
MT59 3 Theileria sp.
H. flava, vegetation
Nymph
LC169091
MT60 4 Theileria sp.
H. formosensis, vegetation
Nymph
LC169092
G162 Theileria sp.
H. kitaokai, sika deer
Female (engorged) LC169093
G163 Theileria sp.
H. kitaokai, sika deer
Female (engorged) LC169094
G164 Theileria sp.
H. kitaokai, sika deer
Female (engorged) LC169095
MT50 9
Theileria spp. (2 species)
30
MT20 8 H. canis
H. longicornis, dog
Female
LC169075
MT45 6 Hepatozoon sp.
H. longicornis, vegetation
Nymph
LC169076
H. hystricis, vegetation
Female
LC169077
I35 Hepatozoon sp.
31