- Email: [email protected]
Hepatozoon and Theileria species detected in ticks collected from mammals and snakes in Thailand
G Model TTBDIS-441; No. of Pages 7
ARTICLE IN PRESS Ticks and Tick-borne Diseases xxx (2015) xxx–xxx
Contents lists available at ScienceDirect
Ticks and Tick-borne Diseases journal homepage: www.elsevier.com/locate/ttbdis
Original article
Hepatozoon and Theileria species detected in ticks collected from mammals and snakes in Thailand Chalao Sumrandee a , Visut Baimai a,b , Wachareeporn Trinachartvanit a , Arunee Ahantarig a,b,∗ a
Biodiversity Research Cluster, Department of Biology, Faculty of Science, Mahidol University, Rama 6 Road, Bangkok 10400, Thailand Center of Excellence for Vectors and Vector-Borne Diseases, Faculty of Science, Mahidol University at Salaya, Phutthamonthon 4 Road, Nakhon Pathom 73170, Thailand b
a r t i c l e
i n f o
Article history: Received 16 June 2014 Received in revised form 26 January 2015 Accepted 8 February 2015 Available online xxx Keywords: Hepatozoon Thailand Theileria Tick
a b s t r a c t We report the detection of Hepatozoon and Theileria in 103 ticks from mammals and snakes in Thailand. By using a genus-specific 18S rRNA PCR, Hepatozoon and Theileria spp. were detected in 8% and 18%, respectively, of ticks (n = 79) removed from mammals. Of the ticks removed from snakes (n = 24), 96% were infected with Hepatozoon spp., but none were infected with Theileria. Phylogenetic analysis revealed that Hepatozoon spp. detected from Dermacentor astrosignatus and Dermacentor auratus ticks from Wild boar (Sus scrofa) formed a phylogenetic group with many isolates of Hepatozoon felis that were distantly related to a species group containing Hepatozoon canis and Hepatozoon americanum. In contrast, a phylogenetic analysis of the Hepatozoon sequences of snake ticks revealed that Hepatozoon spp. from Amblyomma varanense from King cobra (Ophiophagus hannah) and Amblyomma helvolum ticks from Indochinese rat snake (Ptyas korros), and Asiatic water snake (Xenochrophis piscator) are grouped with Hepatozoon spp. recently isolated from Monocellate cobras, Reticulated pythons and Burmese pythons, all of Thai origin, and with Hepatozoon sp. 774c that has been detected from a tick species obtained from Argus monitors in Australia. A phylogenetic analysis demonstrated that Theileria spp. from Rhipicephalus (Boophilus) microplus, Haemaphysalis obesa, and Haemaphysalis lagrangei ticks from Sambar deer (Cervus unicolor) cluster with the Theileria cervi isolates WU11 and 239, and Theileria sp. Iwate 141. We report for the first time a Hepatozoon species that shares genetic similarity with Hepatozoon felis found in Dermacentor astrosignatus and Dermacentor auratus ticks collected from Wild boars in Thailand. In addition, we found the presence of a Theileria cervi-like sp. which suggests the potential role of Haemaphysalis lagrangei as a Theileria vector in Thailand. © 2015 Elsevier GmbH. All rights reserved.
Introduction Hepatozoon spp. are apicomplexan haemoparasites belonging to the family Hepatozoidae of the phylum Apicomplexa and comprise over 300 Hepatozoon species. Members of this family have been described in reptiles, birds, and mammals (Smith, 1996). Unlike Theileria and bacterial pathogens that are transmitted via the salivary glands of infective ticks, Hepatozoon transmission to vertebrates occurs by the ingestion of infected ticks or by the predation of other infected vertebrates (Smith, 1996).
∗ Corresponding author at: Department of Biology, Faculty of Science, Mahidol University, Rama 6 Road, Bangkok 10400, Thailand. Tel.: +66 2 201 5380; fax: +66 2 354 7161. E-mail address: [email protected] (A. Ahantarig).
Canine and feline hepatozoonoses are the most economically important tick-borne hepatozoonoses in the world. They are caused by infections of Hepatozoon americanum and Hepatozoon canis. Hepatozoon americanum is prevalent in the United States and is transmitted by Amblyomma americanum (Vincent-Johnson et al., 1997), whereas H. canis is widely distributed and transmitted by the brown dog tick, Rhipicephalus sanguineus (Baneth et al., 2001). In Thailand, Hepatozoon infections have received little attention. A small number of studies have reported H. canis infections in dogs and cats (Jittapalapong and Tipsawake, 1991; Jittapalapong et al., 2006). Additionally, two Hepatozoon species that are closely related to frog and Water python Hepatozoon species were found in Flatheaded and Leopard cats respectively (Salakij et al., 2008, 2010). Theileria spp. are intracellular protozoa belonging to the phylum Apicomplexa, family Theileridae. They infect lymphocytes, causing several clinical signs of theileriosis in wild and domestic
http://dx.doi.org/10.1016/j.ttbdis.2015.02.003 1877-959X/© 2015 Elsevier GmbH. All rights reserved.
Please cite this article in press as: Sumrandee, C., et al., Hepatozoon and Theileria species detected in ticks collected from mammals and snakes in Thailand. Ticks Tick-borne Dis. (2015), http://dx.doi.org/10.1016/j.ttbdis.2015.02.003
G Model TTBDIS-441; No. of Pages 7
ARTICLE IN PRESS C. Sumrandee et al. / Ticks and Tick-borne Diseases xxx (2015) xxx–xxx
2
ruminants (d’Oliveira et al., 1995). Ixodid ticks of the genera Amblyomma, Rhipicephalus, Boophilus, Hyalomma, and Haemaphysalis are responsible for the transmission of Theileria, whereas ticks of various genera serve as hepatozoonosis vectors, including Amblyomma, Dermacentor, Haemaphysalis, Ixodes, and Rhipicephalus (Otranto and Wall, 2008). The two Theileria species that have caused the greatest economic losses in livestock production worldwide are Theileria annulata and Theileria parva. T. annulata causes tropical theileriosis in many tropical regions of the world. It is prevalent across southern Europe, northern Africa and Asia (Bishop et al., 2004, 2008). Theileria parva causes East Coast fever, which has a distribution limited to the eastern, central, and southern parts of Africa (Gachohi et al., 2012). Neither of these two Theileria has been reported in Thailand (Ahantarig et al., 2008). In Thailand, a group of benign Theileria species responsible for bovine theileriosis belongs to the Theileria sergenti/buffeli/orientalis group (Kakuda et al., 1998; Altangerel et al., 2011). Although theileriosis has been reported in livestock from many regions in Thailand, and numerous tick species have been identified as vectors of theileriosis in several parts of the world (Bishop et al., 2004), there have been no reports documenting the existence of Theileria in Thai ticks. Although many tick species have been recorded in various species of mammals, birds and reptiles in Thailand (Tanskul et al., 1983), these tick vectors have not been examined for the presences of Hepatozoon and Theileria. Thus, the goal of the present study was to assay ticks collected from snakes and mammals in Thailand for Hepatozoon and Theileria. Prevalence, DNA sequence variations and phylogenetic analysis of the detected 18S rRNA genes were also reported.
Materials and methods Tick sample collection and identification From September 2008 to November 2010, ticks were collected from mammals and snakes from different regions of Thailand (Table 1). Ticks were immediately stored in 70% alcohol and then transported to Mahidol University, Bangkok, Thailand, where they were stored at −20 ◦ C. Ticks were then morphologically identified using available standard taxonomic keys (Tanskul and Inlao, 1989; Kohls, 1957).
Cloning of amplified DNA fragments The positive PCR products from tick samples were purified using a High Pure PCR product purification kit (Roche). The quality of the purified DNA was evaluated by electrophoresis on a 1% agarose gel. The purified PCR product was ligated into pGEM-T easy vector (Promega) following the manufacturer’s protocol. The recombinant plasmid vector was transformed into E. coli JM109. The transformed E. coli was selected by the blue-white selection method. Three transformed colonies for each amplicon/gene were grown overnight in LB medium with ampicillin. Plasmid DNA from three clones of a single PCR amplicon for each gene were purified using a High Pure Plasmid Isolation kit (Roche) and sequenced in both directions using M13 forward and reverse primers. DNA sequencing DNA sequencing reactions were carried out in both directions using the M13 forward and reverse primers and performed with BigDye Terminator v3.1 Cycle Sequencing Kits (Applied BioSystems, USA). Sequencing products were analysed using a Genetic Analyzer 3730XL automated DNA sequencing system (Applied BioSystems, USA) at Macrogen Inc., Seoul, South Korea. Molecular characterisation and phylogenetic analysis DNA sequences were aligned and edited using the CLUSTALW program (Thompson et al., 1994) and BIOEDIT program version 7.0.5.3 (Hall, 1999) respectively. The obtained consensus sequences had primer sequences removed before sequences were compared with published sequences in the GenBank database. After consensus sequences were edited, the sequences were then submitted to Genbank in order to obtain the corresponding accession numbers (Table 2). The BLAST program (http://www.ncbi.nlm.nih.gov) was used to determine genetic relationships and sequence identities in the GenBank database (Altschul et al., 1997). A neighbour-joining phylogenetic tree was reconstructed using a Kimura 2-parameter distance model with Molecular Evolutionary Genetics Analysis (MEGA) v.5.05 software (Tamura et al., 2011). All DNA gaps and missing data were excluded from the analyses. Bootstrap analysis, used to estimate the node reliability of the trees, was conducted with 1000 replicates (Felsenstein, 1989) as implemented in MEGA 5.
DNA extraction Results Ticks were washed by immersion in 70% ethanol for 1 min. Then, the ticks were air-dried on sterile filter papers for 3–5 min. A fine sterile scalpel blade was used to bilaterally bisect individual ticks. The ticks were individually crushed using a sterile pestle, and the DNA was extracted using a DNA blood minikit (Qiagen GmbH, Germany) following the manufacturer’s instructions.
DNA amplification with PCR The quality of the extracted tick DNA was determined by amplification of the tick mitochondrial (mt) 16S rDNA gene using the primers 16S +1 (CTGCTCAATGATTTTTT AAATTGCTGTGG) and 16S −1(CCGGTCTGAACTCAGATCAAGT) (Black and Piesman, 1994). The presence of Hepatozoon and Theileria in ticks was detected via PCR, using the primer pairs HepF300 (GCTAATACATGAGCAAAATCTCAA) with HepR900 (CGGAA TTAA CCAGACAAAT) (Vilcins et al., 2009) and 989 (AGTTTCTGACCTATCAG) with 990 (TTGCCTTAAACTTCCTTG) (Allsopp et al., 1993) in order.
Tick species from mammals and snakes A total of 79 tick samples belonging to 4 genera and 8 species were collected from three mammal species at different localities in Thailand (Table 1). Of these 79 tick samples, 75 were adults, three were nymphs and one was larva. Four genera and eight species of ticks were identified from these animal hosts. Of the eight species, four species belonged to the genus Haemaphysalis, two species belonged to Dermacentor, one species belonged to Rhipicephalus and one to Amblyomma. Ticks of the genus Haemaphysalis were the most abundant, including H. darjeeling, H. hystricis, H. lagrangei, and H. obesa. The numbers, stages, genera and species of the ticks collected from mammals in different localities of Thailand are listed in Table 1. Three tick species, including A. testudinarium, D. auratus, and D. astrosignatus, were collected from Wild boars in Chiang Mai and Phang Nga provinces. Seven tick species comprising H. lagrangei, A. testudinarium, Amblyomma sp., H. hystricis, H. obesa, H. darjeeling, R. microplus, Rhipicephalus sp., Dermacentor sp. and Haemaphysalis sp.
Please cite this article in press as: Sumrandee, C., et al., Hepatozoon and Theileria species detected in ticks collected from mammals and snakes in Thailand. Ticks Tick-borne Dis. (2015), http://dx.doi.org/10.1016/j.ttbdis.2015.02.003
G Model TTBDIS-441; No. of Pages 7
ARTICLE IN PRESS C. Sumrandee et al. / Ticks and Tick-borne Diseases xxx (2015) xxx–xxx
3
Table 1 The animal hosts among snakes and mammals in Thailand and the detection of Hepatozoon and Theileria in ticks collected from them. Stages and sex of ticks: L (larva), N (nymph), M (male), and F (female). Asiatic water snake = Xenochrophis piscator, Indochinese rat snake = Ptyas korros, King cobra = Ophiophagus hannah, Burmese python = Python molurus bivittatus, Sambar deer = Cervus unicolor, Barking deer = Muntiacus muntjak, and Wild boar = Sus scrofa. Animal host
Tick species (number and stage of tick)
Asiatic water snake (n = 1) Indochinese rat snake (n = 1) King cobra (n = 4) Burmese python (n = 1)
A. helvolum (3F) A. helvolum (1F) A. varanense (3M, 16F) A. helvolum (1F)
No. of PCR-positive ticks/no. of ticks examined (% infection)
Total in snake ticks Sambar deer (n = 3)
Sambar deer (n = 1) Barking deer (n = 1) Wild boar (n = 1) Wild boar (n = 2) Wild boar (n = 2)
A. testudinarium (1F) H. darjeeling (1F) H. hystricis (1F) H. lagrangei (16M, 5F) H. obesa (3F) and Haemaphysalis sp. (1L) Dermacentor sp. (1N) Rhipicephalus (Boophilus) microplus (3M, 6F) and Rhipicephalus sp. Amblyomma sp. (1N) H.lagrangei (2F) R. (B.) microplus (8M, 13F) A. testudinarium (1F) D. auratus (1F) D. auratus (4M, 5F) D. astrosignatus (2M, 3F)
Total in ticks from mammals
were found infesting Sambar deer in Chaiyaphume and Nakhon Nayok provinces. Rhipicephalus (Boophilus) microplus was found on Barking deer from the Chiang Mai province and Sambar deer in the Nakhon Nayok province. All ticks collected from Barking deer in Chiang Mai province belonged to the species R. microplus. Haemaphysalis lagrangei was the most abundant tick species found in Sambar deer, whereas R. microplus was the most abundant on Barking deer from Chiang Mai. Additionally, a total of 24 tick samples were collected from four snake species. All ticks collected were semi-engorged or fully engorged. Two tick species were identified: Amblyomma varanense and Amblyomma helvolum (Table 1).
Prevalence of Hepatozoon in ticks collected from mammals and snakes In ticks collected from mammals, Hepatozoon spp. were detected in 8% (n = 79) of the ticks. Only two tick species in the genus Dermacentor (D. auratus and D. astrosignatus) yielded positive results, both of which were collected from Wild boar in Phang Nga province. Overall, the prevalences of Hepatozoon in D. auratus and D. astrosignatus from all collection sites were 36% (4/11) and 40% (2/5), respectively (Table 1). The other six tick species (A. testudinarium,
Location
Hepatozoon
Theileria
2/3 (67%) 1/1 (100%) 19/19 (100%) 1/1 (100%)
0 0 0 0
23/24 (96%)
0
0 0/1 0/1 0/22 0/3 0 0
0 0/1 0/1 8/22 (36%) 3/3 (100%) 0 3/10 (30%)
Khao Yai National Park Khao Yai National Park Khao Yai National Park Khao Yai National Park Khao Yai National Park Khao Yai National Park Khao Yai National Park
0 0/2 0 0 0 4/9 (44%) 2/5 (40%)
0 0/2 0 0 0 0/9 0/5
Phu Khieo Wildlife Sanctuary Phu Khieo Wildlife Sanctuary Doi Saket district, Chiang Mai Doi Saket district, Chiang Mai Doi Saket district, Chiang Mai Sri Phanga National Park Sri Phanga National park
6/79 (8%)
14/79 (18%)
Mueang district, Phichit Nam Phong district, Khon Kaen Nam Phong district, Khon Kaen Khao Yai National Park
H. darjeeling, H. hystricis, H. lagrangei, H. obesa, and R. microplus) were PCR-negative for Hepatozoon (Table 1). Of the 24 snake ticks examined, 23 ticks (96%) were PCR positive. Among tick species, 4/5 (80%) of A. helvolum were infected with Hepatozoon, whereas 19/19 (100%) of A. varanense were found to be infected with the Hepatozoon.
Prevalence of Theileria in ticks collected from mammals and snakes Of the 79 ticks that were collected from mammals, Theileria DNA was detected in 18% (14/79 ticks) of the ticks examined. Haemaphysalis obesa was the most frequently infected with Theileria (100%; 3/3 ticks), followed by H. lagrangei (32%; 8/25 ticks) and R. microplus (10%; 3/31 ticks), whereas five other tick species (A. testudinarium, D. astrosignatus, D. auratus, H. darjeeling, and H. hystricis) were PCR-negative for Theileria (Table 1). Among mammalian hosts, three ticks collected from Sambar deer in Khao Yai National park, Nakhon Nayok province were only Theileria positive. The prevalence of H. lagrangei, H. obesa, and R. microplus at this collection site were 36% (8/22 ticks), 100% (3/3 ticks), and 30% (3/10 ticks), respectively. In contrast, all ticks collected from snakes were PCR-negative for Theileria.
Table 2 Nucleotide sequence accession numbers of Hepatozoon and Theileria species that were detected in this study. Hepatozoon and Theileria species
Tick species
Host
Location
Accession number (from this study)
Hepatozoon sp. CS-2012 clone APOH1 Hepatozoon sp. CS-2012 clone APPK1 Hepatozoon sp. CS-2012 clone APXP2 Hepatozoon sp. CS-2012 isolate Dermacentor astrosignatus Hepatozoon sp. CS-2012 isolate D. auratus Theileria sp. CS2012 isolate H. lagrangei Theileria sp. CS2012 isolate H. lagrangei Theileria sp. CS2012 isolate Heamaphysalis obesa Theileria sp. CS2012 isolate Rhipicephalus (B.) microplus
A. varanense A. helvolum A. helvolum D. astrosignatus D. auratus H. lagrangei H. lagrangei H. obesa R. (B) microplus
King cobra Indochinese rat snake Asiatic water snake Wild boar Wild boar Sambar deer Sambar deer Sambar deer Sambar deer
Khon Kaen Khon Kaen Phichit Phang Nga Phang Nga Nakhon Nayok Nakhon Nayok Nakhon Nayok Nakhon Nayok
JQ670908 JQ670909 JQ670910 JQ751276 KF318169 JQ751277 JQ751278 JQ751279 KC140747
Please cite this article in press as: Sumrandee, C., et al., Hepatozoon and Theileria species detected in ticks collected from mammals and snakes in Thailand. Ticks Tick-borne Dis. (2015), http://dx.doi.org/10.1016/j.ttbdis.2015.02.003
G Model TTBDIS-441; No. of Pages 7 4
ARTICLE IN PRESS C. Sumrandee et al. / Ticks and Tick-borne Diseases xxx (2015) xxx–xxx
Fig. 1. Phylogenetic relationships of Hepatozoon species based on the 18S rRNA gene. The tree was generated by the neighbour-joining method using Kimura two-parameter distances with 24 Hepatozoon species/isolates. GenBank accession numbers are given in parentheses. Toxoplasma gondii was chosen as an outgroup. The numbers at the side of nodes indicate bootstrap support. The scale bar indicates the number of substitutions per nucleotide position/site.
DNA sequence determination of Hepatozoon in ticks collected from mammals and snakes Among mammals, a sequence analysis of the 18S rRNA gene of Hepatozoon from two D. astrosignatus and four D. auratus ticks revealed that their DNA sequences were identical. All of these ticks were taken from Wild boars in the Phang Nga province. Table 2 summarised nucleotide sequence accession numbers of Hepatozoon and Theileria species that were detected in this study. Sequence determination by BLAST analysis revealed that both Hepatozoon sp. CS-2012 isolate D. astrosignatus (accession number JQ751276) and Hepatozoon sp. CS-2012 isolate D. auratus (accession number KF318169) displayed 98.2% (555/565 bp) similarity to H. felis isolate LaCONES/Asiatic lion 05 (HQ829442) and H. felis isolate LaCONES/Indian leopard 01 (HQ829443), which were taken from Asiatic lions and Indian leopards from India, respectively (Pawar and Shivaji, unpublished). An analysis of the 18S rRNA gene of Hepatozoon from A. helvolum ticks that were collected from an Asiatic water snake revealed that
their sequences were identical. A sequence submitted to GenBank under the accession number JQ670910 and tentatively named Hepatozoon sp. CS2012 isolate A. helvolum shared 99.6% identity to Hepatozoon sp. 1 PL-2013 isolate S23 (KF524357) that was previously isolated from Naja kaouthia (Monocellate cobra) in Thailand (Salakij et al., unpublished). Of the 585 bp of the 18S rRNA gene analysed, there were 2–9 base differences among three isolates of Hepatozoon sp. CS-2012 that were detected from A. varanense and A. helvolum ticks. A Hepatozoon genotype, namely the Hepatozoon sp. CS2012 isolate from A. helvolum ticks taken from an Indochinese rat snake in this study (accession numbers JQ670909), was identical (585/585) to the Hepatozoon sp. 1 PL-2013 isolate S23 (KF524357) that was recently isolated from Naja kaouthia (Monocellate cobra) in Thailand (Salakij et al., unpublished). An analysis of 19 18S rRNA gene sequences from 19 Hepatozoonpositive A. varanense ticks that were collected from King cobras exhibited 100% identity. A sequence was submitted to GenBank under accession number JQ670908. This sequence was tentatively named Hepatozoon sp. CS2012 isolate A. varanense. BLAST analysis
Please cite this article in press as: Sumrandee, C., et al., Hepatozoon and Theileria species detected in ticks collected from mammals and snakes in Thailand. Ticks Tick-borne Dis. (2015), http://dx.doi.org/10.1016/j.ttbdis.2015.02.003
G Model TTBDIS-441; No. of Pages 7
ARTICLE IN PRESS C. Sumrandee et al. / Ticks and Tick-borne Diseases xxx (2015) xxx–xxx
5
Fig. 2. Phylogenetic relationships of Theileria species based on 18S rRNA gene. The tree was generated by the neighbour-joining method using Kimura two-parameter distances. GenBank accession numbers are given in parentheses. Sarcocystis singaporensis was chosen as an outgroup. Numbers at the side of nodes indicate bootstrap support. The scale bar indicates the number of substitutions per nucleotide position per site.
revealed that the 18S rRNA gene sequence amplified from A. varanense was 100% (585/585) identical to the sequences corresponding to the Hepatozoon sp. 1 PL-2013 isolate S34 (KF524359) that was isolated from Python reticulatus (Reticulated python) and the Hepatozoon sp. 1 PL-2013 isolate S45 (KF524360) that was isolated from Python molurus (Burmese python), all of which were from Thailand (Salakij et al., unpublished).
DNA sequence determination of Theileria in ticks collected from mammals A sequence analysis of approximately 1098 bp amplified PCR products of the 18S rRNA gene revealed that all Theileria sequences from 14 positive ticks (14/79 ticks) were identical. Of these 14 sequences, four sequences from three different tick species positive for Theileria were submitted to GenBank, including a sequence of Theileria from H. obesa (accession numbers JQ751279) designated as Theileria sp. CS2012 isolate H. obesa, a sequence of Theileria from R. microplus (accession number KC140747) for Theileria sp. CS2012 isolate R. microplus, and two sequences of Theileria sp. CS2012 isolate H. lagrangei (accession numbers JQ751277 and JQ751278), which were both obtained from H. lagrangei ticks removed from two different Sambar deer. A sequence determination of 1067 bp (excluding primer sequences) by BLAST analysis revealed that all Theileria-positive ticks were closely related to several Theileria
species. The most closely related known species were the T. cervi isolates WU11 (HQ184411) and 239 (HQ184406), previously characterised from Chinese Sika deer (Cervus nippon) (He et al., unpublished) with a homology at 1064/1067 (99.7%) bp or, rather, only three bases difference. Additionally, Theileria detected from ticks in this study was also 99.7% identical to many isolates of Theileria that have infected Sika deer in Japan [e.g., Theileria sp. ex Yamaguchi Sika deer isolates 22, 52, 47 (accession numbers AF529271–AF529273) and Theileria sp. Iwate 141(AB602888)] (Ikawa and Itagaki, unpublished).
Phylogenetic analysis Phylogenetic analysis of Hepatozoon from Wild boar and snake ticks Hepatozoon species detected from wild boar ticks [i.e., Hepatozoon sp. CS-2012 isolate D. astrosignatus (accession number JQ751276) and Hepatozoon sp. CS-2012 isolate D. auratus (accession number KF318169)] formed a phylogenetic group with many isolates of H. felis (bootstrap support at 54%) but were distantly related to a species group containing H. canis and H. americanum (bootstrap support lower than 50%) (Fig. 1). A phylogenetic analysis of the Hepatozoon 18S rRNA gene sequences from snake ticks in this study demonstrated that Hepatozoon sp. CS2012 isolated from A. varanense and A. helvolum ticks
Please cite this article in press as: Sumrandee, C., et al., Hepatozoon and Theileria species detected in ticks collected from mammals and snakes in Thailand. Ticks Tick-borne Dis. (2015), http://dx.doi.org/10.1016/j.ttbdis.2015.02.003
G Model TTBDIS-441; No. of Pages 7
ARTICLE IN PRESS C. Sumrandee et al. / Ticks and Tick-borne Diseases xxx (2015) xxx–xxx
6
grouped with Hepatozoon sp. 1 PL-2013 ticks that were recently isolated from Monocellate cobras (KF524357), Reticulated pythons (KF524359) and Burmese pythons (KF524360), all of which were taken from Thailand (Salakij et al., unpublished), and Hepatozoon sp. 774c (EU430234), which was detected from a tick species taken from Argus monitors in Australia (Vilcins et al., 2009) (Fig. 1). Phylogenetic analysis of Theileria from Sambar deer ticks A phylogenetic analysis of Theileria 18S rRNA gene sequences demonstrated that Theileria sp. CS2012 isolated from R. microplus, H. obesa, and H. lagrangei segregate in the same cluster as the T. cervi isolate WU11 (HQ184411), T. cervi isolate 239 (HQ184406), and Theileria sp. Iwate 141(AB602888) isolate with a bootstrap value of 100% (Fig. 2). Additionally, Theileria sp. CS2012 isolated from ticks in this study were distantly related to a group of benign Theileria spp. that commonly infect cattle and buffaloes. Discussion Here, we report for the first time a Hepatozoon species that shares genetic similarity with H. felis found in D. astrosignatus and D. auratus ticks collected from Wild boars. This finding indicates that D. astrosignatus and D. auratus ticks may be the definitive invertebrate hosts of H. felis. Hepatozoon felis, a known felid pathogen, was identified in 34.1% of Ixodes tasmani that were collected from Tasmanian devils in Australia (Vilcins et al., 2009), whereas in the current study, over 40% of D. astrosignatus and D. auratus ticks collected from wild boars were determined to be infected with a Hepatozoon sp. closely related to H. felis. It seems that H. felis from ticks parasitising Wild boars (Sus scrofa) has a greater chance of infecting domestic animals (particularly dogs and cats). Dermacentor auratus ticks have been recorded from dogs in Thailand (Parola et al., 2003). However, H. felis infection in dogs and cats remains unreported in the country. Wild boars harbour a vast number of viruses, bacteria and parasites. They play an important role in the epidemiology of zoonotic diseases that are transmissible to domestic animals and humans (Meng et al., 2009; Michalik et al., 2012). Wild boar is one of the most important host mammals for many tick species, including more than six tick species recorded in Thailand (Tanskul et al., 1983). In this study, three tick species were collected from Wild boars. Two of these species were infected with Hepatozoon spp. closely related to H. felis. It has been suggested that increased interactions between sylvatic and domestic cycles heightens the chances of pathogen exposure among domestic animals and humans (Meng et al., 2009). In this study, Hepatozoon DNA was detected in both tick species collected from snakes, similar to the results of a study by Vilcins et al. (2009) that found all ticks collected from snakes and lizards in Australia to be infected with Hepatozoon. However, the prevalence in ticks collected from snakes in this study were very high, at 96%, whereas 57.7% of the tick samples collected from Australian reptiles were infected with Hepatozoon. Although Hepatozoon DNA was not examined from snake hosts in this study, the finding that Hepatozoon infected all A. varanense ticks collected from King cobras in the Khon Kaen province was in agreement with a study by Chukanhom et al. (2008), in which a blood smear examination of 28 of 30 (93%) King cobras from the same study sites revealed infection by Hepatozoon. All of these findings suggest that King cobras are common intermediate hosts, whereas A. varanense ticks are the definitive invertebrate hosts. The prevalence of Theileria, in ticks collected from Sambar deer, ranged from 30 to 100% in three tick species (H. obesa, H. lagrangei, and R. microplus), which is similar to previously reported prevalences of T. cervi. The prevalence of T. cervi-like sp. in R. microplus
tick collected from Sambar deer in this study was as high as 30%. Many species of deer from many regions of the world have been reported to be infected with T. cervi. For example, Elk (Cervus canadensis) (Chae et al., 1999), White-tailed deer (Odocoileus virginianus), and Reindeer (Rangifer tarandus) in the US (Garner et al., 2012); Pampas deer (Ozotoceros bezoarticus) in Brazil (Silveira et al., 2013); and Sika deer (Cervus nippon) in China and Japan have been shown to be infected with T. cervi (He et al., 2012). The high prevalence of T. cervi in many deer species suggests that deer act as a reservoir for Theileria. Although T. cervi infection in White-tailed deer normally gives rise to mild symptoms, mortality from T. cervi infection in Reindeer has been reported (Garner et al., 2012). The pathogenic role of T. cervi in Sambar deer from Thailand is unknown. Three of the five tick species collected from Sambar deer were infected with a T. cervilike sp., suggesting that Sambar deer are a reservoir for this Theileria. The finding of T. cervi-like sp. in ticks collected from Sambar deer indicates that ticks identified as possible vectors of T. cervi-like sp. and Sambar deer serve as asymptomatic carriers and hosts of T. cervi-like sp. in Thailand. This is the first identification of T. cervi-like sp. in a variety of tick species (H. lagrangei, H. obesa, R. microplus) collected from Sambar deer (Cervus unicolor) in Thailand. We postulate that these tick species are the main vector of cervine theileriosis in Thailand. Although this study reported two Hepatozoon species in which one species was closely phylogenetically related to H. ayorgbor detected in snake ticks (A. helvolum and A. varanense) and another closely related to H. felis detected from D. astrosignatus and D. auratus ticks that were collected from Wild boar, human infection by Hepatozoon is unlikely to occur because this parasite is transmitted by ingestion of a tick rather than by a tick bite. The involuntary ingestion of Hepatozoon-infected ticks is most likely to occur in people who place the head of snake into their mouth as part of a snake show. In contrast, the transmission of T. cervi-like sp. to humans may occur because two tick species (H. lagrangei and H. obesa) that have been determined to be infected with the Theileria species in this study were recorded as tick species that commonly bite humans in Thailand (Tanskul et al., 1983). New Hepatozoon and Theileria species should also be detected and reported in ticks collected from other type of vertebrates in Thailand. Acknowledgements This work was supported by researched grant from the Faculty of Science, Mahidol University, Thailand (SCM55-004). This work was also supported by a grant from Strategic Scholarships Fellowships Frontier Research Networks, Office of Higher Education Commission, Ministry of Education and a Mahidol University Research grant (SCJV1099000737). References Ahantarig, A., Trinachartvanit, W., Milne, J.R., 2008. Tick borne pathogens and disease of animals and humans in Thailand. Southeast Asian J. Trop. Med. Public Health 39, 1015–1032. Allsopp, B.A., Baylis, H.A., Allsopp, M.T.E.P., Cavalier-Smith, T., Bishop, R.P., Carrington, D.M., Sopanpal, B., Spooner, P., 1993. Discrimination between six species of Theileria using oligonucleotide probes which detect small subunit ribosomal RNA sequences. Parasitology 107, 157–165. Altangerel, K., Sivakumar, T., Inpankaew, T., Jittapalapong, S., Terkawi, M.A., Ueno, A., Xuan, X., Igarashi, I., Yokoyama, N., 2011. Molecular prevalence of different genotypes of Theileria orientalis detected from cattle and water buffaloes in Thailand. J. Parasitol. 97, 1075–1079. Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z., Miller, W., Lipman, D.J., 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25, 3389–3402. Baneth, G., Samish, M., Alekseev, E., Aroch, I., Shkap, V., 2001. Transmission of Hepatozoon canis to dogs by naturally-fed percutaneously-injected Rhipicephalus sanguineus ticks. J. Parasitol. 87, 606–611.
Please cite this article in press as: Sumrandee, C., et al., Hepatozoon and Theileria species detected in ticks collected from mammals and snakes in Thailand. Ticks Tick-borne Dis. (2015), http://dx.doi.org/10.1016/j.ttbdis.2015.02.003
G Model TTBDIS-441; No. of Pages 7
ARTICLE IN PRESS C. Sumrandee et al. / Ticks and Tick-borne Diseases xxx (2015) xxx–xxx
Bishop, R., Musoke, A., Morzaria, S., Gardner, M., Nene, V., 2004. Theileria: intracellular protozoan parasites of wild and domestic ruminants transmitted by ixodid ticks. Parasitology 129, S271–S283. Bishop, R., Musoke, A., Skilton, R., Morzaria, S., Gardner, M., Nene, V., 2008. Theileria: life cycle stages associated with the ixodid tick vector. In: Bowman, A.S., Nutall, P.A. (Eds.), Ticks, Biology, Disease and Control. Cambridge University Press, UK, pp. 308–324. Black, W.C., Piesman, J., 1994. Phylogeny of hard- and soft-tick taxa (Acari: Ixodida) based on mitochondrial 16S rDNA sequences. Proc. Natl. Acad. Sci. U. S. A. 91, 10034–10038. Chae, J.S., Waghela, S.D., Craig, T.M., Kocan, A.A., Wagner, G.G., Holman, P.J., 1999. Two Theileria cervi SSU rRNA gene sequence types found in isolates from whitetailed deer and elk in North America. J. Wildl. Dis. 135, 458–465. Chukanhom, K., Papirom, P., Aunpromma, S., Noksaguna, P., Yurum, N., Saenprasert, P.,2008. Incidence of blood parasite in king cobra in Kok Sanga village at Khon Kaen province. In: Veterinary Meeting of Khon Kaen University. Faculty of Veterinary Medicine, Khon Kaen University, Khon Kaen, pp. 215–218 http://vet.kku.ac.th/semi9 2551/023-%A4%B3%D4%B5-%CB%B9%E9%D2%20215221%20new.pdf d’Oliveira, C., van der Weide, M., Habela, M.A., Jacquiet, P., Jongejan, F., 1995. Detection of Theileria annulata in blood samples of carrier cattle by PCR. J. Clin. Microbiol. 33, 2665–2669. Felsenstein, J., 1989. PHYLIP – phylogeny inference package (version 3.2). Cladistics 5, 164–166. Gachohi, J., Skilton, R., Hansen, F., Ngumi, P., Kitala, P., 2012. Epidemiology of East Coast fever (Theileria parva infection) in Kenya: past, present and the future. Parasites Vectors 5, 194. Garner, B.C., Holman, P., Berent, L.M., 2012. Theileriosis in a reindeer (Rangifer tarandus tarandus) associated with a potentially novel Theileria sp. Vet. Clin. Pathol. 41, 497–501. Hall, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 41, 95–98. He, L., Feng, H.H., Zhang, W.J., Zhang, Q.L., Fang, R., Wang, L.X., Tu, P., Zhou, Y.Q., Zhao, J.L., Oosthuizen, M.C., 2012. Occurrence of Theileria and Babesia species in water buffalo (Bubalus babalis, Linnaeus, 1758) in the Hubei province, South China. Vet. Parasitol. 186, 490–496. Jittapalapong, S., Tipsawake, S., 1991. Survey of blood protozoa and blood parasites of pet dogs in Samut-Prakan Province. Kasetsart J.: Nat. Sci. 25, 75–82. Jittapalapong, S., Rungphisutthipongse, O., Maruyama, S., Schaefer, J.J., Stich, R.W., 2006. Detection of Hepatozoon canis in stray dogs and cats in Bangkok, Thailand. Ann. N. Y. Acad. Sci. 1081, 479–488. Kakuda, T., Shiki, M., Kubota, S., Sugimoto, C., Brown, W.C., Kosum, C., Nopporn, S., Onuma, M., 1998. Phylogeny of benign Theileria species from cattle in Thailand, China and the U.S.A. based on the major piroplasm surface protein and small subunit ribosomal RNA genes. Int. J. Parasitol. 28, 1261–1267. Kohls, G.M., 1957. Malaysian parasites XVIII Ticks (Ixodidae) of Borneo and Malaya. Study Inst. Med. Res. Malaya 1 28, 65–94.
7
Meng, X.J., Lindsay, D.S., Sriranganathan, N., 2009. Wild boars as sources for infectious diseases in livestock and humans. Philos. Trans. R. Soc. B: Biol. Sci. 364, 2697–2707. ´ Michalik, J., Stanczak, J., Cieniuch, S., Racewicz, M., Sikora, B., Dabert, M., 2012. Wild boars as hosts of human–pathogenic Anaplasma phagycytophilum variants. Emerg. Infect. Dis. 18, 998–1001. Otranto, D., Wall, R., 2008. New strategies for the control of arthropod vectors of disease in dogs and cats. Med. Vet. Entomol. 22, 291–302. Parola, P., Cornet, J., Sanogo, Y., Miller, R.S., Thein, H.V., Gonzalez, J.P., Raoult, D., Telford III, S.R., 2003. Detection of Ehrlichia spp., Anaplasma spp., Rickettsia spp., and other eubacteria in ticks from the Thai-Myanmar border and Vietnam. J. Clin. Microbiol. 41, 1600–1608. Salakij, C., Salakij, J., Narkkong, N.A., Sirinarumitr, T., Pattanarangsan, R., 2008. Hematologic, cytochemical, ultrastructural, and molecular findings of Hepatozoon-infected flat-headed cats (Prionailurus planiceps). Vet. Clin. Pathol. 37, 31–41. Salakij, C., Sirinarumitr, T., Tongthainun, D., 2010. Molecular characterization of Hepatozoon species in a leopard cat (Prionailurus bengalensis) from Thailand. Vet. Clin. Pathol. 39, 199–202. Silveira, J.A., Rabelo, E.M., Lacerda, A.C., Borges, P.A., Tomás, W.M., Pellegrin, A.O., Tomich, R.G., Ribeiro, M.F., 2013. Molecular detection and identification of hemoparasites in pampas deer (Ozotoceros bezoarticus Linnaeus, 1758) from the Pantanal Brazil. Ticks Tick Borne Dis. 4, 341–345. Smith, T.G., 1996. The genus Hepatozoon (Apicomplexa: Adeleina). J. Parasitol. 82, 565–585. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA 5 molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739. Tanskul, P., Inlao, I., 1989. Key to adult ticks of Haemaphysalis Koch, 1884, in Thailand with notes on change in taxonomy (Acari: Metastigmata: Ixodoidea). J. Med. Entomol. 36, 560–573. Tanskul, P., Strark, H.E., Inlao, I., 1983. A checklist of ticks of Thailand (Acari: Metastigmata: Ixodoidea). J. Med. Entomol. 20, 330–341. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position specific gap penalties and weight matrix choice. Nucleic Acid Res. 22, 4673–4680. Vilcins, I.M., Old, M.J., Elizabeth, E., 2009. Detection of a Hepatozoon and spotted fever group Rickettsia species in the common marsupial tick (Ixodes tasmani) collected from wild Tasmanian devils (Sarcophilus harrisii), Tasmania. Vet. Parasitol. 162, 23–31. Vincent-Johnson, N., Macintire, D.K., Lindsay, D.S., Lenz, S.D., Baneth, G., Shkap, V., Blagburn, B.L., 1997. A new Hepatozoon species from dogs: description of the causative agent of canine hepatozoonosis in North America. J. Parasitol. 83, 1165–1172.
Please cite this article in press as: Sumrandee, C., et al., Hepatozoon and Theileria species detected in ticks collected from mammals and snakes in Thailand. Ticks Tick-borne Dis. (2015), http://dx.doi.org/10.1016/j.ttbdis.2015.02.003
ARTICLE IN PRESS Ticks and Tick-borne Diseases xxx (2015) xxx–xxx
Contents lists available at ScienceDirect
Ticks and Tick-borne Diseases journal homepage: www.elsevier.com/locate/ttbdis
Original article
Hepatozoon and Theileria species detected in ticks collected from mammals and snakes in Thailand Chalao Sumrandee a , Visut Baimai a,b , Wachareeporn Trinachartvanit a , Arunee Ahantarig a,b,∗ a
Biodiversity Research Cluster, Department of Biology, Faculty of Science, Mahidol University, Rama 6 Road, Bangkok 10400, Thailand Center of Excellence for Vectors and Vector-Borne Diseases, Faculty of Science, Mahidol University at Salaya, Phutthamonthon 4 Road, Nakhon Pathom 73170, Thailand b
a r t i c l e
i n f o
Article history: Received 16 June 2014 Received in revised form 26 January 2015 Accepted 8 February 2015 Available online xxx Keywords: Hepatozoon Thailand Theileria Tick
a b s t r a c t We report the detection of Hepatozoon and Theileria in 103 ticks from mammals and snakes in Thailand. By using a genus-specific 18S rRNA PCR, Hepatozoon and Theileria spp. were detected in 8% and 18%, respectively, of ticks (n = 79) removed from mammals. Of the ticks removed from snakes (n = 24), 96% were infected with Hepatozoon spp., but none were infected with Theileria. Phylogenetic analysis revealed that Hepatozoon spp. detected from Dermacentor astrosignatus and Dermacentor auratus ticks from Wild boar (Sus scrofa) formed a phylogenetic group with many isolates of Hepatozoon felis that were distantly related to a species group containing Hepatozoon canis and Hepatozoon americanum. In contrast, a phylogenetic analysis of the Hepatozoon sequences of snake ticks revealed that Hepatozoon spp. from Amblyomma varanense from King cobra (Ophiophagus hannah) and Amblyomma helvolum ticks from Indochinese rat snake (Ptyas korros), and Asiatic water snake (Xenochrophis piscator) are grouped with Hepatozoon spp. recently isolated from Monocellate cobras, Reticulated pythons and Burmese pythons, all of Thai origin, and with Hepatozoon sp. 774c that has been detected from a tick species obtained from Argus monitors in Australia. A phylogenetic analysis demonstrated that Theileria spp. from Rhipicephalus (Boophilus) microplus, Haemaphysalis obesa, and Haemaphysalis lagrangei ticks from Sambar deer (Cervus unicolor) cluster with the Theileria cervi isolates WU11 and 239, and Theileria sp. Iwate 141. We report for the first time a Hepatozoon species that shares genetic similarity with Hepatozoon felis found in Dermacentor astrosignatus and Dermacentor auratus ticks collected from Wild boars in Thailand. In addition, we found the presence of a Theileria cervi-like sp. which suggests the potential role of Haemaphysalis lagrangei as a Theileria vector in Thailand. © 2015 Elsevier GmbH. All rights reserved.
Introduction Hepatozoon spp. are apicomplexan haemoparasites belonging to the family Hepatozoidae of the phylum Apicomplexa and comprise over 300 Hepatozoon species. Members of this family have been described in reptiles, birds, and mammals (Smith, 1996). Unlike Theileria and bacterial pathogens that are transmitted via the salivary glands of infective ticks, Hepatozoon transmission to vertebrates occurs by the ingestion of infected ticks or by the predation of other infected vertebrates (Smith, 1996).
∗ Corresponding author at: Department of Biology, Faculty of Science, Mahidol University, Rama 6 Road, Bangkok 10400, Thailand. Tel.: +66 2 201 5380; fax: +66 2 354 7161. E-mail address: [email protected] (A. Ahantarig).
Canine and feline hepatozoonoses are the most economically important tick-borne hepatozoonoses in the world. They are caused by infections of Hepatozoon americanum and Hepatozoon canis. Hepatozoon americanum is prevalent in the United States and is transmitted by Amblyomma americanum (Vincent-Johnson et al., 1997), whereas H. canis is widely distributed and transmitted by the brown dog tick, Rhipicephalus sanguineus (Baneth et al., 2001). In Thailand, Hepatozoon infections have received little attention. A small number of studies have reported H. canis infections in dogs and cats (Jittapalapong and Tipsawake, 1991; Jittapalapong et al., 2006). Additionally, two Hepatozoon species that are closely related to frog and Water python Hepatozoon species were found in Flatheaded and Leopard cats respectively (Salakij et al., 2008, 2010). Theileria spp. are intracellular protozoa belonging to the phylum Apicomplexa, family Theileridae. They infect lymphocytes, causing several clinical signs of theileriosis in wild and domestic
http://dx.doi.org/10.1016/j.ttbdis.2015.02.003 1877-959X/© 2015 Elsevier GmbH. All rights reserved.
Please cite this article in press as: Sumrandee, C., et al., Hepatozoon and Theileria species detected in ticks collected from mammals and snakes in Thailand. Ticks Tick-borne Dis. (2015), http://dx.doi.org/10.1016/j.ttbdis.2015.02.003
G Model TTBDIS-441; No. of Pages 7
ARTICLE IN PRESS C. Sumrandee et al. / Ticks and Tick-borne Diseases xxx (2015) xxx–xxx
2
ruminants (d’Oliveira et al., 1995). Ixodid ticks of the genera Amblyomma, Rhipicephalus, Boophilus, Hyalomma, and Haemaphysalis are responsible for the transmission of Theileria, whereas ticks of various genera serve as hepatozoonosis vectors, including Amblyomma, Dermacentor, Haemaphysalis, Ixodes, and Rhipicephalus (Otranto and Wall, 2008). The two Theileria species that have caused the greatest economic losses in livestock production worldwide are Theileria annulata and Theileria parva. T. annulata causes tropical theileriosis in many tropical regions of the world. It is prevalent across southern Europe, northern Africa and Asia (Bishop et al., 2004, 2008). Theileria parva causes East Coast fever, which has a distribution limited to the eastern, central, and southern parts of Africa (Gachohi et al., 2012). Neither of these two Theileria has been reported in Thailand (Ahantarig et al., 2008). In Thailand, a group of benign Theileria species responsible for bovine theileriosis belongs to the Theileria sergenti/buffeli/orientalis group (Kakuda et al., 1998; Altangerel et al., 2011). Although theileriosis has been reported in livestock from many regions in Thailand, and numerous tick species have been identified as vectors of theileriosis in several parts of the world (Bishop et al., 2004), there have been no reports documenting the existence of Theileria in Thai ticks. Although many tick species have been recorded in various species of mammals, birds and reptiles in Thailand (Tanskul et al., 1983), these tick vectors have not been examined for the presences of Hepatozoon and Theileria. Thus, the goal of the present study was to assay ticks collected from snakes and mammals in Thailand for Hepatozoon and Theileria. Prevalence, DNA sequence variations and phylogenetic analysis of the detected 18S rRNA genes were also reported.
Materials and methods Tick sample collection and identification From September 2008 to November 2010, ticks were collected from mammals and snakes from different regions of Thailand (Table 1). Ticks were immediately stored in 70% alcohol and then transported to Mahidol University, Bangkok, Thailand, where they were stored at −20 ◦ C. Ticks were then morphologically identified using available standard taxonomic keys (Tanskul and Inlao, 1989; Kohls, 1957).
Cloning of amplified DNA fragments The positive PCR products from tick samples were purified using a High Pure PCR product purification kit (Roche). The quality of the purified DNA was evaluated by electrophoresis on a 1% agarose gel. The purified PCR product was ligated into pGEM-T easy vector (Promega) following the manufacturer’s protocol. The recombinant plasmid vector was transformed into E. coli JM109. The transformed E. coli was selected by the blue-white selection method. Three transformed colonies for each amplicon/gene were grown overnight in LB medium with ampicillin. Plasmid DNA from three clones of a single PCR amplicon for each gene were purified using a High Pure Plasmid Isolation kit (Roche) and sequenced in both directions using M13 forward and reverse primers. DNA sequencing DNA sequencing reactions were carried out in both directions using the M13 forward and reverse primers and performed with BigDye Terminator v3.1 Cycle Sequencing Kits (Applied BioSystems, USA). Sequencing products were analysed using a Genetic Analyzer 3730XL automated DNA sequencing system (Applied BioSystems, USA) at Macrogen Inc., Seoul, South Korea. Molecular characterisation and phylogenetic analysis DNA sequences were aligned and edited using the CLUSTALW program (Thompson et al., 1994) and BIOEDIT program version 7.0.5.3 (Hall, 1999) respectively. The obtained consensus sequences had primer sequences removed before sequences were compared with published sequences in the GenBank database. After consensus sequences were edited, the sequences were then submitted to Genbank in order to obtain the corresponding accession numbers (Table 2). The BLAST program (http://www.ncbi.nlm.nih.gov) was used to determine genetic relationships and sequence identities in the GenBank database (Altschul et al., 1997). A neighbour-joining phylogenetic tree was reconstructed using a Kimura 2-parameter distance model with Molecular Evolutionary Genetics Analysis (MEGA) v.5.05 software (Tamura et al., 2011). All DNA gaps and missing data were excluded from the analyses. Bootstrap analysis, used to estimate the node reliability of the trees, was conducted with 1000 replicates (Felsenstein, 1989) as implemented in MEGA 5.
DNA extraction Results Ticks were washed by immersion in 70% ethanol for 1 min. Then, the ticks were air-dried on sterile filter papers for 3–5 min. A fine sterile scalpel blade was used to bilaterally bisect individual ticks. The ticks were individually crushed using a sterile pestle, and the DNA was extracted using a DNA blood minikit (Qiagen GmbH, Germany) following the manufacturer’s instructions.
DNA amplification with PCR The quality of the extracted tick DNA was determined by amplification of the tick mitochondrial (mt) 16S rDNA gene using the primers 16S +1 (CTGCTCAATGATTTTTT AAATTGCTGTGG) and 16S −1(CCGGTCTGAACTCAGATCAAGT) (Black and Piesman, 1994). The presence of Hepatozoon and Theileria in ticks was detected via PCR, using the primer pairs HepF300 (GCTAATACATGAGCAAAATCTCAA) with HepR900 (CGGAA TTAA CCAGACAAAT) (Vilcins et al., 2009) and 989 (AGTTTCTGACCTATCAG) with 990 (TTGCCTTAAACTTCCTTG) (Allsopp et al., 1993) in order.
Tick species from mammals and snakes A total of 79 tick samples belonging to 4 genera and 8 species were collected from three mammal species at different localities in Thailand (Table 1). Of these 79 tick samples, 75 were adults, three were nymphs and one was larva. Four genera and eight species of ticks were identified from these animal hosts. Of the eight species, four species belonged to the genus Haemaphysalis, two species belonged to Dermacentor, one species belonged to Rhipicephalus and one to Amblyomma. Ticks of the genus Haemaphysalis were the most abundant, including H. darjeeling, H. hystricis, H. lagrangei, and H. obesa. The numbers, stages, genera and species of the ticks collected from mammals in different localities of Thailand are listed in Table 1. Three tick species, including A. testudinarium, D. auratus, and D. astrosignatus, were collected from Wild boars in Chiang Mai and Phang Nga provinces. Seven tick species comprising H. lagrangei, A. testudinarium, Amblyomma sp., H. hystricis, H. obesa, H. darjeeling, R. microplus, Rhipicephalus sp., Dermacentor sp. and Haemaphysalis sp.
Please cite this article in press as: Sumrandee, C., et al., Hepatozoon and Theileria species detected in ticks collected from mammals and snakes in Thailand. Ticks Tick-borne Dis. (2015), http://dx.doi.org/10.1016/j.ttbdis.2015.02.003
G Model TTBDIS-441; No. of Pages 7
ARTICLE IN PRESS C. Sumrandee et al. / Ticks and Tick-borne Diseases xxx (2015) xxx–xxx
3
Table 1 The animal hosts among snakes and mammals in Thailand and the detection of Hepatozoon and Theileria in ticks collected from them. Stages and sex of ticks: L (larva), N (nymph), M (male), and F (female). Asiatic water snake = Xenochrophis piscator, Indochinese rat snake = Ptyas korros, King cobra = Ophiophagus hannah, Burmese python = Python molurus bivittatus, Sambar deer = Cervus unicolor, Barking deer = Muntiacus muntjak, and Wild boar = Sus scrofa. Animal host
Tick species (number and stage of tick)
Asiatic water snake (n = 1) Indochinese rat snake (n = 1) King cobra (n = 4) Burmese python (n = 1)
A. helvolum (3F) A. helvolum (1F) A. varanense (3M, 16F) A. helvolum (1F)
No. of PCR-positive ticks/no. of ticks examined (% infection)
Total in snake ticks Sambar deer (n = 3)
Sambar deer (n = 1) Barking deer (n = 1) Wild boar (n = 1) Wild boar (n = 2) Wild boar (n = 2)
A. testudinarium (1F) H. darjeeling (1F) H. hystricis (1F) H. lagrangei (16M, 5F) H. obesa (3F) and Haemaphysalis sp. (1L) Dermacentor sp. (1N) Rhipicephalus (Boophilus) microplus (3M, 6F) and Rhipicephalus sp. Amblyomma sp. (1N) H.lagrangei (2F) R. (B.) microplus (8M, 13F) A. testudinarium (1F) D. auratus (1F) D. auratus (4M, 5F) D. astrosignatus (2M, 3F)
Total in ticks from mammals
were found infesting Sambar deer in Chaiyaphume and Nakhon Nayok provinces. Rhipicephalus (Boophilus) microplus was found on Barking deer from the Chiang Mai province and Sambar deer in the Nakhon Nayok province. All ticks collected from Barking deer in Chiang Mai province belonged to the species R. microplus. Haemaphysalis lagrangei was the most abundant tick species found in Sambar deer, whereas R. microplus was the most abundant on Barking deer from Chiang Mai. Additionally, a total of 24 tick samples were collected from four snake species. All ticks collected were semi-engorged or fully engorged. Two tick species were identified: Amblyomma varanense and Amblyomma helvolum (Table 1).
Prevalence of Hepatozoon in ticks collected from mammals and snakes In ticks collected from mammals, Hepatozoon spp. were detected in 8% (n = 79) of the ticks. Only two tick species in the genus Dermacentor (D. auratus and D. astrosignatus) yielded positive results, both of which were collected from Wild boar in Phang Nga province. Overall, the prevalences of Hepatozoon in D. auratus and D. astrosignatus from all collection sites were 36% (4/11) and 40% (2/5), respectively (Table 1). The other six tick species (A. testudinarium,
Location
Hepatozoon
Theileria
2/3 (67%) 1/1 (100%) 19/19 (100%) 1/1 (100%)
0 0 0 0
23/24 (96%)
0
0 0/1 0/1 0/22 0/3 0 0
0 0/1 0/1 8/22 (36%) 3/3 (100%) 0 3/10 (30%)
Khao Yai National Park Khao Yai National Park Khao Yai National Park Khao Yai National Park Khao Yai National Park Khao Yai National Park Khao Yai National Park
0 0/2 0 0 0 4/9 (44%) 2/5 (40%)
0 0/2 0 0 0 0/9 0/5
Phu Khieo Wildlife Sanctuary Phu Khieo Wildlife Sanctuary Doi Saket district, Chiang Mai Doi Saket district, Chiang Mai Doi Saket district, Chiang Mai Sri Phanga National Park Sri Phanga National park
6/79 (8%)
14/79 (18%)
Mueang district, Phichit Nam Phong district, Khon Kaen Nam Phong district, Khon Kaen Khao Yai National Park
H. darjeeling, H. hystricis, H. lagrangei, H. obesa, and R. microplus) were PCR-negative for Hepatozoon (Table 1). Of the 24 snake ticks examined, 23 ticks (96%) were PCR positive. Among tick species, 4/5 (80%) of A. helvolum were infected with Hepatozoon, whereas 19/19 (100%) of A. varanense were found to be infected with the Hepatozoon.
Prevalence of Theileria in ticks collected from mammals and snakes Of the 79 ticks that were collected from mammals, Theileria DNA was detected in 18% (14/79 ticks) of the ticks examined. Haemaphysalis obesa was the most frequently infected with Theileria (100%; 3/3 ticks), followed by H. lagrangei (32%; 8/25 ticks) and R. microplus (10%; 3/31 ticks), whereas five other tick species (A. testudinarium, D. astrosignatus, D. auratus, H. darjeeling, and H. hystricis) were PCR-negative for Theileria (Table 1). Among mammalian hosts, three ticks collected from Sambar deer in Khao Yai National park, Nakhon Nayok province were only Theileria positive. The prevalence of H. lagrangei, H. obesa, and R. microplus at this collection site were 36% (8/22 ticks), 100% (3/3 ticks), and 30% (3/10 ticks), respectively. In contrast, all ticks collected from snakes were PCR-negative for Theileria.
Table 2 Nucleotide sequence accession numbers of Hepatozoon and Theileria species that were detected in this study. Hepatozoon and Theileria species
Tick species
Host
Location
Accession number (from this study)
Hepatozoon sp. CS-2012 clone APOH1 Hepatozoon sp. CS-2012 clone APPK1 Hepatozoon sp. CS-2012 clone APXP2 Hepatozoon sp. CS-2012 isolate Dermacentor astrosignatus Hepatozoon sp. CS-2012 isolate D. auratus Theileria sp. CS2012 isolate H. lagrangei Theileria sp. CS2012 isolate H. lagrangei Theileria sp. CS2012 isolate Heamaphysalis obesa Theileria sp. CS2012 isolate Rhipicephalus (B.) microplus
A. varanense A. helvolum A. helvolum D. astrosignatus D. auratus H. lagrangei H. lagrangei H. obesa R. (B) microplus
King cobra Indochinese rat snake Asiatic water snake Wild boar Wild boar Sambar deer Sambar deer Sambar deer Sambar deer
Khon Kaen Khon Kaen Phichit Phang Nga Phang Nga Nakhon Nayok Nakhon Nayok Nakhon Nayok Nakhon Nayok
JQ670908 JQ670909 JQ670910 JQ751276 KF318169 JQ751277 JQ751278 JQ751279 KC140747
Please cite this article in press as: Sumrandee, C., et al., Hepatozoon and Theileria species detected in ticks collected from mammals and snakes in Thailand. Ticks Tick-borne Dis. (2015), http://dx.doi.org/10.1016/j.ttbdis.2015.02.003
G Model TTBDIS-441; No. of Pages 7 4
ARTICLE IN PRESS C. Sumrandee et al. / Ticks and Tick-borne Diseases xxx (2015) xxx–xxx
Fig. 1. Phylogenetic relationships of Hepatozoon species based on the 18S rRNA gene. The tree was generated by the neighbour-joining method using Kimura two-parameter distances with 24 Hepatozoon species/isolates. GenBank accession numbers are given in parentheses. Toxoplasma gondii was chosen as an outgroup. The numbers at the side of nodes indicate bootstrap support. The scale bar indicates the number of substitutions per nucleotide position/site.
DNA sequence determination of Hepatozoon in ticks collected from mammals and snakes Among mammals, a sequence analysis of the 18S rRNA gene of Hepatozoon from two D. astrosignatus and four D. auratus ticks revealed that their DNA sequences were identical. All of these ticks were taken from Wild boars in the Phang Nga province. Table 2 summarised nucleotide sequence accession numbers of Hepatozoon and Theileria species that were detected in this study. Sequence determination by BLAST analysis revealed that both Hepatozoon sp. CS-2012 isolate D. astrosignatus (accession number JQ751276) and Hepatozoon sp. CS-2012 isolate D. auratus (accession number KF318169) displayed 98.2% (555/565 bp) similarity to H. felis isolate LaCONES/Asiatic lion 05 (HQ829442) and H. felis isolate LaCONES/Indian leopard 01 (HQ829443), which were taken from Asiatic lions and Indian leopards from India, respectively (Pawar and Shivaji, unpublished). An analysis of the 18S rRNA gene of Hepatozoon from A. helvolum ticks that were collected from an Asiatic water snake revealed that
their sequences were identical. A sequence submitted to GenBank under the accession number JQ670910 and tentatively named Hepatozoon sp. CS2012 isolate A. helvolum shared 99.6% identity to Hepatozoon sp. 1 PL-2013 isolate S23 (KF524357) that was previously isolated from Naja kaouthia (Monocellate cobra) in Thailand (Salakij et al., unpublished). Of the 585 bp of the 18S rRNA gene analysed, there were 2–9 base differences among three isolates of Hepatozoon sp. CS-2012 that were detected from A. varanense and A. helvolum ticks. A Hepatozoon genotype, namely the Hepatozoon sp. CS2012 isolate from A. helvolum ticks taken from an Indochinese rat snake in this study (accession numbers JQ670909), was identical (585/585) to the Hepatozoon sp. 1 PL-2013 isolate S23 (KF524357) that was recently isolated from Naja kaouthia (Monocellate cobra) in Thailand (Salakij et al., unpublished). An analysis of 19 18S rRNA gene sequences from 19 Hepatozoonpositive A. varanense ticks that were collected from King cobras exhibited 100% identity. A sequence was submitted to GenBank under accession number JQ670908. This sequence was tentatively named Hepatozoon sp. CS2012 isolate A. varanense. BLAST analysis
Please cite this article in press as: Sumrandee, C., et al., Hepatozoon and Theileria species detected in ticks collected from mammals and snakes in Thailand. Ticks Tick-borne Dis. (2015), http://dx.doi.org/10.1016/j.ttbdis.2015.02.003
G Model TTBDIS-441; No. of Pages 7
ARTICLE IN PRESS C. Sumrandee et al. / Ticks and Tick-borne Diseases xxx (2015) xxx–xxx
5
Fig. 2. Phylogenetic relationships of Theileria species based on 18S rRNA gene. The tree was generated by the neighbour-joining method using Kimura two-parameter distances. GenBank accession numbers are given in parentheses. Sarcocystis singaporensis was chosen as an outgroup. Numbers at the side of nodes indicate bootstrap support. The scale bar indicates the number of substitutions per nucleotide position per site.
revealed that the 18S rRNA gene sequence amplified from A. varanense was 100% (585/585) identical to the sequences corresponding to the Hepatozoon sp. 1 PL-2013 isolate S34 (KF524359) that was isolated from Python reticulatus (Reticulated python) and the Hepatozoon sp. 1 PL-2013 isolate S45 (KF524360) that was isolated from Python molurus (Burmese python), all of which were from Thailand (Salakij et al., unpublished).
DNA sequence determination of Theileria in ticks collected from mammals A sequence analysis of approximately 1098 bp amplified PCR products of the 18S rRNA gene revealed that all Theileria sequences from 14 positive ticks (14/79 ticks) were identical. Of these 14 sequences, four sequences from three different tick species positive for Theileria were submitted to GenBank, including a sequence of Theileria from H. obesa (accession numbers JQ751279) designated as Theileria sp. CS2012 isolate H. obesa, a sequence of Theileria from R. microplus (accession number KC140747) for Theileria sp. CS2012 isolate R. microplus, and two sequences of Theileria sp. CS2012 isolate H. lagrangei (accession numbers JQ751277 and JQ751278), which were both obtained from H. lagrangei ticks removed from two different Sambar deer. A sequence determination of 1067 bp (excluding primer sequences) by BLAST analysis revealed that all Theileria-positive ticks were closely related to several Theileria
species. The most closely related known species were the T. cervi isolates WU11 (HQ184411) and 239 (HQ184406), previously characterised from Chinese Sika deer (Cervus nippon) (He et al., unpublished) with a homology at 1064/1067 (99.7%) bp or, rather, only three bases difference. Additionally, Theileria detected from ticks in this study was also 99.7% identical to many isolates of Theileria that have infected Sika deer in Japan [e.g., Theileria sp. ex Yamaguchi Sika deer isolates 22, 52, 47 (accession numbers AF529271–AF529273) and Theileria sp. Iwate 141(AB602888)] (Ikawa and Itagaki, unpublished).
Phylogenetic analysis Phylogenetic analysis of Hepatozoon from Wild boar and snake ticks Hepatozoon species detected from wild boar ticks [i.e., Hepatozoon sp. CS-2012 isolate D. astrosignatus (accession number JQ751276) and Hepatozoon sp. CS-2012 isolate D. auratus (accession number KF318169)] formed a phylogenetic group with many isolates of H. felis (bootstrap support at 54%) but were distantly related to a species group containing H. canis and H. americanum (bootstrap support lower than 50%) (Fig. 1). A phylogenetic analysis of the Hepatozoon 18S rRNA gene sequences from snake ticks in this study demonstrated that Hepatozoon sp. CS2012 isolated from A. varanense and A. helvolum ticks
Please cite this article in press as: Sumrandee, C., et al., Hepatozoon and Theileria species detected in ticks collected from mammals and snakes in Thailand. Ticks Tick-borne Dis. (2015), http://dx.doi.org/10.1016/j.ttbdis.2015.02.003
G Model TTBDIS-441; No. of Pages 7
ARTICLE IN PRESS C. Sumrandee et al. / Ticks and Tick-borne Diseases xxx (2015) xxx–xxx
6
grouped with Hepatozoon sp. 1 PL-2013 ticks that were recently isolated from Monocellate cobras (KF524357), Reticulated pythons (KF524359) and Burmese pythons (KF524360), all of which were taken from Thailand (Salakij et al., unpublished), and Hepatozoon sp. 774c (EU430234), which was detected from a tick species taken from Argus monitors in Australia (Vilcins et al., 2009) (Fig. 1). Phylogenetic analysis of Theileria from Sambar deer ticks A phylogenetic analysis of Theileria 18S rRNA gene sequences demonstrated that Theileria sp. CS2012 isolated from R. microplus, H. obesa, and H. lagrangei segregate in the same cluster as the T. cervi isolate WU11 (HQ184411), T. cervi isolate 239 (HQ184406), and Theileria sp. Iwate 141(AB602888) isolate with a bootstrap value of 100% (Fig. 2). Additionally, Theileria sp. CS2012 isolated from ticks in this study were distantly related to a group of benign Theileria spp. that commonly infect cattle and buffaloes. Discussion Here, we report for the first time a Hepatozoon species that shares genetic similarity with H. felis found in D. astrosignatus and D. auratus ticks collected from Wild boars. This finding indicates that D. astrosignatus and D. auratus ticks may be the definitive invertebrate hosts of H. felis. Hepatozoon felis, a known felid pathogen, was identified in 34.1% of Ixodes tasmani that were collected from Tasmanian devils in Australia (Vilcins et al., 2009), whereas in the current study, over 40% of D. astrosignatus and D. auratus ticks collected from wild boars were determined to be infected with a Hepatozoon sp. closely related to H. felis. It seems that H. felis from ticks parasitising Wild boars (Sus scrofa) has a greater chance of infecting domestic animals (particularly dogs and cats). Dermacentor auratus ticks have been recorded from dogs in Thailand (Parola et al., 2003). However, H. felis infection in dogs and cats remains unreported in the country. Wild boars harbour a vast number of viruses, bacteria and parasites. They play an important role in the epidemiology of zoonotic diseases that are transmissible to domestic animals and humans (Meng et al., 2009; Michalik et al., 2012). Wild boar is one of the most important host mammals for many tick species, including more than six tick species recorded in Thailand (Tanskul et al., 1983). In this study, three tick species were collected from Wild boars. Two of these species were infected with Hepatozoon spp. closely related to H. felis. It has been suggested that increased interactions between sylvatic and domestic cycles heightens the chances of pathogen exposure among domestic animals and humans (Meng et al., 2009). In this study, Hepatozoon DNA was detected in both tick species collected from snakes, similar to the results of a study by Vilcins et al. (2009) that found all ticks collected from snakes and lizards in Australia to be infected with Hepatozoon. However, the prevalence in ticks collected from snakes in this study were very high, at 96%, whereas 57.7% of the tick samples collected from Australian reptiles were infected with Hepatozoon. Although Hepatozoon DNA was not examined from snake hosts in this study, the finding that Hepatozoon infected all A. varanense ticks collected from King cobras in the Khon Kaen province was in agreement with a study by Chukanhom et al. (2008), in which a blood smear examination of 28 of 30 (93%) King cobras from the same study sites revealed infection by Hepatozoon. All of these findings suggest that King cobras are common intermediate hosts, whereas A. varanense ticks are the definitive invertebrate hosts. The prevalence of Theileria, in ticks collected from Sambar deer, ranged from 30 to 100% in three tick species (H. obesa, H. lagrangei, and R. microplus), which is similar to previously reported prevalences of T. cervi. The prevalence of T. cervi-like sp. in R. microplus
tick collected from Sambar deer in this study was as high as 30%. Many species of deer from many regions of the world have been reported to be infected with T. cervi. For example, Elk (Cervus canadensis) (Chae et al., 1999), White-tailed deer (Odocoileus virginianus), and Reindeer (Rangifer tarandus) in the US (Garner et al., 2012); Pampas deer (Ozotoceros bezoarticus) in Brazil (Silveira et al., 2013); and Sika deer (Cervus nippon) in China and Japan have been shown to be infected with T. cervi (He et al., 2012). The high prevalence of T. cervi in many deer species suggests that deer act as a reservoir for Theileria. Although T. cervi infection in White-tailed deer normally gives rise to mild symptoms, mortality from T. cervi infection in Reindeer has been reported (Garner et al., 2012). The pathogenic role of T. cervi in Sambar deer from Thailand is unknown. Three of the five tick species collected from Sambar deer were infected with a T. cervilike sp., suggesting that Sambar deer are a reservoir for this Theileria. The finding of T. cervi-like sp. in ticks collected from Sambar deer indicates that ticks identified as possible vectors of T. cervi-like sp. and Sambar deer serve as asymptomatic carriers and hosts of T. cervi-like sp. in Thailand. This is the first identification of T. cervi-like sp. in a variety of tick species (H. lagrangei, H. obesa, R. microplus) collected from Sambar deer (Cervus unicolor) in Thailand. We postulate that these tick species are the main vector of cervine theileriosis in Thailand. Although this study reported two Hepatozoon species in which one species was closely phylogenetically related to H. ayorgbor detected in snake ticks (A. helvolum and A. varanense) and another closely related to H. felis detected from D. astrosignatus and D. auratus ticks that were collected from Wild boar, human infection by Hepatozoon is unlikely to occur because this parasite is transmitted by ingestion of a tick rather than by a tick bite. The involuntary ingestion of Hepatozoon-infected ticks is most likely to occur in people who place the head of snake into their mouth as part of a snake show. In contrast, the transmission of T. cervi-like sp. to humans may occur because two tick species (H. lagrangei and H. obesa) that have been determined to be infected with the Theileria species in this study were recorded as tick species that commonly bite humans in Thailand (Tanskul et al., 1983). New Hepatozoon and Theileria species should also be detected and reported in ticks collected from other type of vertebrates in Thailand. Acknowledgements This work was supported by researched grant from the Faculty of Science, Mahidol University, Thailand (SCM55-004). This work was also supported by a grant from Strategic Scholarships Fellowships Frontier Research Networks, Office of Higher Education Commission, Ministry of Education and a Mahidol University Research grant (SCJV1099000737). References Ahantarig, A., Trinachartvanit, W., Milne, J.R., 2008. Tick borne pathogens and disease of animals and humans in Thailand. Southeast Asian J. Trop. Med. Public Health 39, 1015–1032. Allsopp, B.A., Baylis, H.A., Allsopp, M.T.E.P., Cavalier-Smith, T., Bishop, R.P., Carrington, D.M., Sopanpal, B., Spooner, P., 1993. Discrimination between six species of Theileria using oligonucleotide probes which detect small subunit ribosomal RNA sequences. Parasitology 107, 157–165. Altangerel, K., Sivakumar, T., Inpankaew, T., Jittapalapong, S., Terkawi, M.A., Ueno, A., Xuan, X., Igarashi, I., Yokoyama, N., 2011. Molecular prevalence of different genotypes of Theileria orientalis detected from cattle and water buffaloes in Thailand. J. Parasitol. 97, 1075–1079. Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z., Miller, W., Lipman, D.J., 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25, 3389–3402. Baneth, G., Samish, M., Alekseev, E., Aroch, I., Shkap, V., 2001. Transmission of Hepatozoon canis to dogs by naturally-fed percutaneously-injected Rhipicephalus sanguineus ticks. J. Parasitol. 87, 606–611.
Please cite this article in press as: Sumrandee, C., et al., Hepatozoon and Theileria species detected in ticks collected from mammals and snakes in Thailand. Ticks Tick-borne Dis. (2015), http://dx.doi.org/10.1016/j.ttbdis.2015.02.003
G Model TTBDIS-441; No. of Pages 7
ARTICLE IN PRESS C. Sumrandee et al. / Ticks and Tick-borne Diseases xxx (2015) xxx–xxx
Bishop, R., Musoke, A., Morzaria, S., Gardner, M., Nene, V., 2004. Theileria: intracellular protozoan parasites of wild and domestic ruminants transmitted by ixodid ticks. Parasitology 129, S271–S283. Bishop, R., Musoke, A., Skilton, R., Morzaria, S., Gardner, M., Nene, V., 2008. Theileria: life cycle stages associated with the ixodid tick vector. In: Bowman, A.S., Nutall, P.A. (Eds.), Ticks, Biology, Disease and Control. Cambridge University Press, UK, pp. 308–324. Black, W.C., Piesman, J., 1994. Phylogeny of hard- and soft-tick taxa (Acari: Ixodida) based on mitochondrial 16S rDNA sequences. Proc. Natl. Acad. Sci. U. S. A. 91, 10034–10038. Chae, J.S., Waghela, S.D., Craig, T.M., Kocan, A.A., Wagner, G.G., Holman, P.J., 1999. Two Theileria cervi SSU rRNA gene sequence types found in isolates from whitetailed deer and elk in North America. J. Wildl. Dis. 135, 458–465. Chukanhom, K., Papirom, P., Aunpromma, S., Noksaguna, P., Yurum, N., Saenprasert, P.,2008. Incidence of blood parasite in king cobra in Kok Sanga village at Khon Kaen province. In: Veterinary Meeting of Khon Kaen University. Faculty of Veterinary Medicine, Khon Kaen University, Khon Kaen, pp. 215–218 http://vet.kku.ac.th/semi9 2551/023-%A4%B3%D4%B5-%CB%B9%E9%D2%20215221%20new.pdf d’Oliveira, C., van der Weide, M., Habela, M.A., Jacquiet, P., Jongejan, F., 1995. Detection of Theileria annulata in blood samples of carrier cattle by PCR. J. Clin. Microbiol. 33, 2665–2669. Felsenstein, J., 1989. PHYLIP – phylogeny inference package (version 3.2). Cladistics 5, 164–166. Gachohi, J., Skilton, R., Hansen, F., Ngumi, P., Kitala, P., 2012. Epidemiology of East Coast fever (Theileria parva infection) in Kenya: past, present and the future. Parasites Vectors 5, 194. Garner, B.C., Holman, P., Berent, L.M., 2012. Theileriosis in a reindeer (Rangifer tarandus tarandus) associated with a potentially novel Theileria sp. Vet. Clin. Pathol. 41, 497–501. Hall, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 41, 95–98. He, L., Feng, H.H., Zhang, W.J., Zhang, Q.L., Fang, R., Wang, L.X., Tu, P., Zhou, Y.Q., Zhao, J.L., Oosthuizen, M.C., 2012. Occurrence of Theileria and Babesia species in water buffalo (Bubalus babalis, Linnaeus, 1758) in the Hubei province, South China. Vet. Parasitol. 186, 490–496. Jittapalapong, S., Tipsawake, S., 1991. Survey of blood protozoa and blood parasites of pet dogs in Samut-Prakan Province. Kasetsart J.: Nat. Sci. 25, 75–82. Jittapalapong, S., Rungphisutthipongse, O., Maruyama, S., Schaefer, J.J., Stich, R.W., 2006. Detection of Hepatozoon canis in stray dogs and cats in Bangkok, Thailand. Ann. N. Y. Acad. Sci. 1081, 479–488. Kakuda, T., Shiki, M., Kubota, S., Sugimoto, C., Brown, W.C., Kosum, C., Nopporn, S., Onuma, M., 1998. Phylogeny of benign Theileria species from cattle in Thailand, China and the U.S.A. based on the major piroplasm surface protein and small subunit ribosomal RNA genes. Int. J. Parasitol. 28, 1261–1267. Kohls, G.M., 1957. Malaysian parasites XVIII Ticks (Ixodidae) of Borneo and Malaya. Study Inst. Med. Res. Malaya 1 28, 65–94.
7
Meng, X.J., Lindsay, D.S., Sriranganathan, N., 2009. Wild boars as sources for infectious diseases in livestock and humans. Philos. Trans. R. Soc. B: Biol. Sci. 364, 2697–2707. ´ Michalik, J., Stanczak, J., Cieniuch, S., Racewicz, M., Sikora, B., Dabert, M., 2012. Wild boars as hosts of human–pathogenic Anaplasma phagycytophilum variants. Emerg. Infect. Dis. 18, 998–1001. Otranto, D., Wall, R., 2008. New strategies for the control of arthropod vectors of disease in dogs and cats. Med. Vet. Entomol. 22, 291–302. Parola, P., Cornet, J., Sanogo, Y., Miller, R.S., Thein, H.V., Gonzalez, J.P., Raoult, D., Telford III, S.R., 2003. Detection of Ehrlichia spp., Anaplasma spp., Rickettsia spp., and other eubacteria in ticks from the Thai-Myanmar border and Vietnam. J. Clin. Microbiol. 41, 1600–1608. Salakij, C., Salakij, J., Narkkong, N.A., Sirinarumitr, T., Pattanarangsan, R., 2008. Hematologic, cytochemical, ultrastructural, and molecular findings of Hepatozoon-infected flat-headed cats (Prionailurus planiceps). Vet. Clin. Pathol. 37, 31–41. Salakij, C., Sirinarumitr, T., Tongthainun, D., 2010. Molecular characterization of Hepatozoon species in a leopard cat (Prionailurus bengalensis) from Thailand. Vet. Clin. Pathol. 39, 199–202. Silveira, J.A., Rabelo, E.M., Lacerda, A.C., Borges, P.A., Tomás, W.M., Pellegrin, A.O., Tomich, R.G., Ribeiro, M.F., 2013. Molecular detection and identification of hemoparasites in pampas deer (Ozotoceros bezoarticus Linnaeus, 1758) from the Pantanal Brazil. Ticks Tick Borne Dis. 4, 341–345. Smith, T.G., 1996. The genus Hepatozoon (Apicomplexa: Adeleina). J. Parasitol. 82, 565–585. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA 5 molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739. Tanskul, P., Inlao, I., 1989. Key to adult ticks of Haemaphysalis Koch, 1884, in Thailand with notes on change in taxonomy (Acari: Metastigmata: Ixodoidea). J. Med. Entomol. 36, 560–573. Tanskul, P., Strark, H.E., Inlao, I., 1983. A checklist of ticks of Thailand (Acari: Metastigmata: Ixodoidea). J. Med. Entomol. 20, 330–341. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position specific gap penalties and weight matrix choice. Nucleic Acid Res. 22, 4673–4680. Vilcins, I.M., Old, M.J., Elizabeth, E., 2009. Detection of a Hepatozoon and spotted fever group Rickettsia species in the common marsupial tick (Ixodes tasmani) collected from wild Tasmanian devils (Sarcophilus harrisii), Tasmania. Vet. Parasitol. 162, 23–31. Vincent-Johnson, N., Macintire, D.K., Lindsay, D.S., Lenz, S.D., Baneth, G., Shkap, V., Blagburn, B.L., 1997. A new Hepatozoon species from dogs: description of the causative agent of canine hepatozoonosis in North America. J. Parasitol. 83, 1165–1172.
Please cite this article in press as: Sumrandee, C., et al., Hepatozoon and Theileria species detected in ticks collected from mammals and snakes in Thailand. Ticks Tick-borne Dis. (2015), http://dx.doi.org/10.1016/j.ttbdis.2015.02.003