- Email: [email protected]
Detection of Theileria and Babesia species in ticks collected from cattle
Veterinary Parasitology 148 (2007) 156–160 www.elsevier.com/locate/vetpar
Short communication
Detection of Theileria and Babesia species in ticks collected from cattle§ A. Ica a,*, Z. Vatansever b, A. Yildirim a, O. Duzlu a, A. Inci a a b
Department of Parasitology, Faculty of Veterinary Medicine, University of Erciyes, 38090 Kayseri, Turkey Department of Parasitology, Faculty of Veterinary Medicine, University of Ankara, 06110 Ankara, Turkey Received 23 March 2007; received in revised form 31 May 2007; accepted 4 June 2007
Abstract The present study was carried out to detect tick species that infest cattle, and Theileria and Babesia species transmitted by these ticks in Kayseri province (Turkey). A total of 300 cattle were examined for tick infestations. Of the 300 cattle, 117 (39%) were infested with ticks. A total of 1160 ticks belonging to 11 Ixodid genera were collected from the infested animals and their shelters. The most prevalent tick species was Boophilus annulatus 26.37% (306/1160) followed by Hyalomma marginatum marginatum 21.12% (245/1160) and Rhipicephalus turanicus 18.7% (217/1160). The collected ticks were separated into 43 tick pools, according to their species. These pools were examined for bovine Theileria and Babesia species (Theileria sp., Babesia sp., Theileria annulata, T. buffeli/orientalis, Babesia bigemina, B. bovis and B. divergens) by using the reverse line blotting method (RLB). Of the 43 tick pools examined, 6 (14%) were infected with B. bigemina, 4 (9.3%) with T. annulata, and 1 (2.3%) with Babesia sp., whereas 1 (2.3%) displayed mixed infection with T. annulata + B. bigemina. The sequence and phylogenetic analyses of Babesia sp., which could not be identified to the species level by RLB, were performed. In the phylogenetic tree, Babesia sp. (Kayseri 1) grouped with Babesia sp. (Kashi 2), Babesia sp. (Kashi 1), Babesia sp. (Xinjiang) and B. orientalis with 96.8–100% identity. # 2007 Elsevier B.V. All rights reserved. Keywords: Cattle; Tick; Theileria; Babesia; Reverse line blotting
1. Introduction Theileriosis and babesiosis are tick-borne diseases which cause major economic losses, and affect many domestic animals, mainly cattle and sheep, in tropical and sub tropical regions (Uilenberg, 1995). Ixodid ticks are vectors in the transmission of these diseases. Information about the epidemiology of tick-borne diseases, especially on the transmission dynamics of
§
Nucleotide sequence data reported in this paper are available in GenBank, EMBL and DDBJ databases under accession number EF434786. * Corresponding author. Tel.: +90 352 3380006; fax: +90 352 3392312. E-mail address: [email protected] (A. Ica). 0304-4017/$ – see front matter # 2007 Elsevier B.V. All rights reserved. doi:10.1016/j.vetpar.2007.06.003
vector ticks is essential for the elaboration of efficient control strategies (Morzaria et al., 1992). In addition to information on the prevalence of these diseases in ruminants, the isolation and identification of these parasites in vector ticks is also important in the epidemiology of the diseases. The most prevalent tick-borne parasitic disease of cattle is tropical theileriosis. The causative agent of this disease, Theileria annulata, is transmitted by a number of Hyalomma ticks. Although H. a. anatolicum, H. d. detritum and H. dromedarii are considered as the main vectors in the field, other species such as H. a. excavatum and H. m. marginatum can transmit the disease under laboratory conditions and may play a role in the epidemiology of the disease in the field (EstradaPena et al., 2004).
A. Ica et al. / Veterinary Parasitology 148 (2007) 156–160
Bovine babesiosis is mainly caused by Babesia bigemina, B. bovis and B. divergens. These parasites are transmitted by Boophilus microplus, B. decolaratus, B. geiyi, B. annulatus, Rhipicephalus evertsi, R. bursa, Ixodes ricinus and I. persulcatus (Friedhoff, 1988; Estrada-Pena et al., 2004). Molecular methods including the polymerase chain reaction (PCR) and reverse line blotting (RLB) are frequently used for the identification of bovine Theileria and Babesia species in ticks (d’Oliveira et al., 1997; Georges et al., 2001). The aim of this study was to detect the bovine Theileria and Babesia species in ticks collected from naturally infested cattle with Ixodid ticks in Central Anatolia. 2. Materials and methods 2.1. Collection of ticks and establishment of tick pools The present study was carried out in Kayseri province located in Central Anatolia. The study material was collected from 300 cattle, randomly selected from eight districts of Kayseri province, and their shelters between March and September in 2006. The ticks were collected manually from cattle, as well as from the cracks and crevices in the shelters. Adult ticks were identified under a stereo-microscope, according to general identification keys (Estrada-Pena et al., 2004). Of the ticks that were separated according to their species, engorged nymphs and engorged females were placed into an incubator with a temperature of 28 8C and relative humidity of 85%, for moulting and egg laying, respectively. The ticks were divided into 43 pools, according to the study centers and their species and were frozen in liquid nitrogen. Of the 43 tick pools, one comprised larvae that hatched from the eggs laid by engorged females of B. annulatus. Another pool was composed of unfed adult
157
ticks obtained upon the moulting of the engorged nymphs of B. annulatus, and a third pool included unfed adult ticks obtained upon the moulting of engorged nymphs of H. a. anatolicum. 2.2. DNA isolation and PCR amplification The frozen ticks were crushed into a powder with sterile and disposable grinding pestles. Genomic DNA was extracted using a commercial kit (Qiagen Tissue Kit, Qiagen, Hilden, Germany). The PCR was performed as described by Gubbels et al. (1999) and Georges et al. (2001). For the amplification of the variable V4 region of Theileria and Babesia species, RLB-F2 (50 -GACACAGGGAGGTAGTGACAAG-30 ) and RLB-R2 (50 biotin*-CTAAGAATTTCACCTCTGACAGT-30 ) (MWG, Germany) were used as forward and reverse primers, respectively. 2.3. Reverse line blot hybridization The specific oligonucleotide probes shown in Table 1 were used in RLB (MWG, Germany). The preparation of the membrane and the application of the RLB were performed as described by Gubbels et al. (1999) and Georges et al. (2001). 2.4. Sequence analysis After amplification of the hypervariable V4 region of the 18S rRNA gene of a sample which was positive with only catchall and Babesia sp. probe, with RLBF2 and RLBR2 primers, 403 bp. DNA fragment was generated. The PCR product was purified using a commercial kit (PCR Clean up, Genemark, Taiwan) and was sequenced. 2.5. Sequence alignment and phylogenetic analysis The MegAlign component of the 7.1.0 (DNASTAR, Madison, WI) version of the Lasergene software was
Table 1 The 50 -30 sequences of the probes with aminolinkers which were adhered to a biodyne C membranea Oligonucleotide probe
Sequence
Reference
Catchall Theileria sp. Babesia sp. Theileria annulata Theileria buffeli/orientalis Babesia bovis Babesia bigemina Babesia divergens
TAATGGTTAATAGGARCRGTTG TGATGGGAATTTAAACC(CT)CTTCCA CCT(GT)GGTAATGGTTAATAGGAA CCTCTGGGGTCTGTGCA GGCTTATTTCGG(AT)TTGATTTT CAGGTTTCGCCTGTATAATTGAG CGTTTTTTCCCTTTTGTTGG GTTAATATTGACTAATGTCGAG
Gubbels et al. (1999) Nagore et al. (2004) Schnittger et al. (2004) Georges et al. (2001) Gubbels et al. (1999) Georges et al. (2001) Gubbels et al. (1999) Gubbels et al. (1999)
a
T: thymine; A: adenine; C: cytosine; G: guanine; R: A or G.
158
A. Ica et al. / Veterinary Parasitology 148 (2007) 156–160
used for the alignment and phylogenetic analysis of the sequence. A phylogenetic tree was created from the sequences of the 18S rRNA genes of Babesia species originated from different hosts available in Genbank and the sequences described here. 2.6. Statistical analysis The differences between different parameters were evaluated by using the chi-square test (x2). 3. Results In the present study, 117 (39%) of the 300 cattle examined were infested with ticks. A total of 1160 ticks were collected from the infested cattle and their shelters. Among the 300 animals examined, the mean number of ticks per animal was 3.67; with an inter quartile range (IQR) of 0–4. The number of ticks per animal ranged between 0 and 92. After the identification of the collected ticks, 11 tick species were determined. The distribution of the identified tick species according to the study centers were shown in Table 2. The difference in distribution of the ticks according to the study centers was found to be statistically significant (P < 0.001). Most of the infested animals were infested with more than one tick species. The highest levels of infestation in the animals were demonstrated to have occurred with H. m. marginatum 20.3% (61/300) and R. turanicus 10.3% (31/300). Out of 43 tick pools examined for Theileria and Babesia species by RLB, 12 were given positive reactions to catchall probe. Of the 12 positive samples, 6 (14%) were infected with B. bigemina, 4 (9.3%) with T. annulata, and 1 (2.3%) with Babesia sp., whereas 1
(2.3%) displayed mixed infection with T. annulata + B. bigemina. All T. annulata and B. bigemina positive samples were also given positive signals to Theileria sp. and Babesia sp. probes, respectively. Furthermore, B. bigemina was found in unfed larvae obtained upon the lay of eggs by engorged B. annulatus females included in one of the tick pools, and T. annulata was detected in the unfed adult ticks obtained upon the moulting of engorged H. a. anatolicum nymphs collected from the walls of a shelter, in another pool. Of the 12 positive pools, one pool comprising H. m. marginatum ticks collected from cattle did not show any reaction with the other species-specific probes except catchall and Babesia sp. probes. The constructed tree after phylogenetic analysis showed that Babesia sp. (Kayseri 1) was in the same clade with unidentified Babesia species and B. orientalis (Fig. 1). The percent identity of Babesia sp. (Kayseri 1) with the unidentified Babesia species included in the same clade, namely, Babesia sp. (Kashi 2), Babesia sp. (Kashi 1), Babesia sp. (Xinjiang) and B. orientalis were 100%, 99.8%, 90.8% and 96.8%, respectively. 4. Discussion Information on the prevalence of tick-borne pathogens in potential vector ticks of the region is essential for the epidemiology of tick-borne diseases. In the previous studies, the prevalent tick species were reported as Haemaphysalis, Hyalomma, Boophilus, Rhipicephalus and Dermacentor in Central Anatolia (Sayin et al., 1997; Inci et al., 2002b, 2003). In the present study, the identified species are in compliance with previous reports. To date, the prevalence of tick-borne diseases, particularly Theileria and Babesia infections, in the
Table 2 The distribution of tick species according to the study centers Tick species
Tomarza Pinarbasi
Boophilus annulatus 26 Haemaphysalis parva 0 Haemaphysalis sulcata 0 Hyalomma marginatum marginatum 0 Hyalomma anatolicum anatolicum 0 Hyalomma a. excavatum 0 Hyalomma detritum detritum 0 Rhipicephalus turanicus 0 Rhipicephalus bursa 0 Rhipicephalus sanguineus 0 Dermacentor marginatus 0 Total
26 (2.2)
Values given in brackets indicate percentages.
66 96 2 66 0 0 0 0 0 0 20
Gemerek 158 0 0 72 1 0 1 159 3 0 0
Develi 0 0 0 67 0 0 0 42 0 0 0
Yesilhisar 0 0 0 0 79 50 0 15 0 2 0
Sariz 0 10 2 36 0 0 0 0 20 0 0
Sarioglan Incesu 5 0 0 4 0 3 0 1 5 1 0
250 (21.6) 394 (34.0) 109 (9.4) 146 (12.6) 68 (5.9) 19 (1.6)
51 0 0 0 29 0 68 0 0 0 0
Total 306 106 4 245 109 53 69 217 28 3 20
(26.4) (9.1) (0.3) (21.1) (9.4) (4.6) (5.9) (18.7) (2.4) (0.3) (1.7)
148 (12.8) 1160 (100.0)
A. Ica et al. / Veterinary Parasitology 148 (2007) 156–160
159
Fig. 1. Neighbor-joining phylogenetic tree of the 18S rRNA gene of Babesia sp. (Kayseri 1) and some valid Babesia species available in Genbank.
region have been generally investigated in host animals and these parasites were found prevalent in the region (Inci et al., 2002a,b). In the present study, the prevalence of bovine Theileria and Babesia species in ticks were determined as 28%. This result is in accordance with previous studies carried out in the same region. T. annulata is transmitted transstadially by H. a. anatolicum (Bhattacharyulu et al., 1975) whereas B. bigemina is transmitted both transovarially and transstadially by Boophilus annulatus (Friedhoff, 1988). In the present study, demonstrating of B. bigemina DNA in unfed larvae, which hatched from eggs laid by engorged B. annulatus females, points out to the transovarial transmission of B. annulatus to subsequent generations, and is also an indication of the vector potential. Furthermore, the presence of T. annulata DNA in the unfed adult ticks moulted from engorged H. a. anatolicum nymphs collected from the shelters indicates the transstadial transmission, and the vector potential of the tick. According to the created phylogenetic tree, Babesia sp. (Kayseri 1) was included in the same clade with the unidentified Babesia isolates from China, and B. orientalis. The origin of Kashi 1 and Kashi 2, which were discovered in China, being Hyalomma ticks (Luo et al., 2005) also suggest identity or similarity with Babesia sp. (Kayseri 1) isolated from H. m. marginatum. Our results indicated that, Babesia sp. (Kayseri 1) was also in the same clade with B. orientalis, known to cause mortality in buffaloes. On the other hand, Babesia sp. (Kayseri 1) was determined to belong to a branch completely different from other bovine Babesia species, including B. bigemina, B. bovis and B. divergens.
In conclusion, the molecular diagnosis of Theileria and Babesia species in the prevalent tick species of the region has demonstrated the prevalence of bovine Theileria and Babesia parasites in ticks, and the risk of cattle to contract theileriosis and babesiosis. Determination of T. annulata and B. bigemina in unfed adult of H. a. anatolicum and unfed larvae of B. annulatus, respectively, has exhibited the vector potential of these ticks. Furthermore, the results of the molecular and phylogenetic analyses of the Babesia sp. (Kayseri 1) isolate have pointed out to the possible existence of novel species in the region. For this reason, phylogenetic analyses have been concluded to be required for Theileria and Babesia species to be reported from the region in the future. Acknowledgements This study was financially supported by Erciyes University Research Fund (EUBAP-Project Number VA-05-05) and European Commission (MEDLABAB Contract No. 003691 INCO-DEV). The author thanks all veterinarians and technicians for their kind helps during field studies. References Bhattacharyulu, Y., Chaudhri, R.P., Gill, B.S., 1975. Studies on the development of Theileria annulata (Dschunkowzky and Luhs, 1904) in the tick-Hyalomma anatolicum anatolicum (Koch, 1844). Ann. Parasitol. Hum. Comp. 50, 397–408. d’Oliveira, C., van der Weide, M., Jacquiet, P., Jongejan, F., 1997. Detection of Theileria annulata by the PCR in ticks (Acari:
160
A. Ica et al. / Veterinary Parasitology 148 (2007) 156–160
Ixodidae) collected from cattle in Mauritania. Exp. Appl. Acarol. 21, 279–291. Estrada-Pena, A., Bouattour, A., Camicas, J.L., Walker, A.R., 2004. Ticks of Domestic Animals in the Mediterranean Region, 1st ed. University of Zaragoza, Spain. Friedhoff, K.T., 1988. Transmission of Babesia. In: Ristic, M. (Ed.), Babesiosis of Domestic Animals and Man. CRC Press, Boca Raton, FL, pp. 23–52. Georges, K., Loria, G.R., Riili, S., Greco, A., Caracappa, S., Jongejan, F., Sparagano, O., 2001. Detection of haemoparasites in cattle by reverse line blot hybridisation with a note on the distribution of ticks in Sicily. Vet. Parasitol. 99, 273–286. Gubbels, J.M., de Vos, A.P., van der Weide, M., Viseras, J., Schouls, L.M., de Vries, E., Jongejan, F., 1999. Simultaneous detection of bovine Theileria and Babesia species by reverse line blot hybridization. J. Clin. Microbiol. 37, 1782–1789. Inci, A., Cakmak, A., Ica, A., Gunay, O., 2002a. Kayseri yoresinde tropikal theileriosis’e bagli ekonomik kayiplar. Turkiye Parazitol. Derg. 26, 156–160 (in Turkish). Inci, A., Cakmak, A., Karaer, Z., Dincer, S., Sayin, F., Ica, A., 2002b. Kayseri yoresinde sigirlarda babesiosis’in seroprevalansi. Turk. J. Vet. Anim. Sci. 26, 1345–1350 (in Turkish). Inci, A., Nalbantoglu, S., Cam, Y., Atasever, A., Karaer, Z., Cakmak, A., Sayin, F., Yukari, B.A., Ica, A., Deniz, A., 2003. Kayseri
yoresinde koyun ve kecilerde theileriosis ve kene enfestasyonlari. Turk. J. Vet. Anim. Sci. 27, 57–60 (in Turkish). Luo, J., Yin, H., Liu, Z., Yang, D., Guan, G., Liu, A., Ma, M., Dang, S., Lu, B., Sun, C., Bai, Q., Lu, W., Chen, P., 2005. Molecular phylogenetic studies on an unnamed bovine Babesia sp. based on small subunit ribosomal RNA gene sequences. Vet. Parasitol. 133, 1–6. Morzaria, S., Katende, J., Kairo, A., Nene, V., Musoke, A., 1992. New methods for the diagnosis of Babesia bigemina infection. Mem. Inst. Oswaldo Cruz. 87, 201–205. Nagore, D., Garcia-Sanmartin, J., Garcia-Perez, A.L., Juste, R.A., Hurtado, A., 2004. Identification, genetic diversity and prevalence of Theileria and Babesia species in a sheep population from Northern Spain. Int. J. Parasitol. 34, 1059–1067. Sayin, F., Dincer, S., Karaer, Z., Dumanli, N., Cakmak, A., Inci, A., Yukari, B.A., Vatansever, Z., 1997. Status of tick infestation of sheep and goats in Turkey. Parassitologia 39, 145–152. Schnittger, L., Yin, H., Qi, B., Gubbels, M.J., Beyer, D., Niemann, S., Jongejan, F., Ahmed, J.S., 2004. Simultaneous detection and differentiation of Theileria and Babesia parasites infecting small ruminants by reverse line blotting. Parasitol. Res. 92, 189–196. Uilenberg, G., 1995. International collaborative research: significance of tick-borne hemoparasitic diseases to world animal health. Vet. Parasitol. 57, 19–41.
Short communication
Detection of Theileria and Babesia species in ticks collected from cattle§ A. Ica a,*, Z. Vatansever b, A. Yildirim a, O. Duzlu a, A. Inci a a b
Department of Parasitology, Faculty of Veterinary Medicine, University of Erciyes, 38090 Kayseri, Turkey Department of Parasitology, Faculty of Veterinary Medicine, University of Ankara, 06110 Ankara, Turkey Received 23 March 2007; received in revised form 31 May 2007; accepted 4 June 2007
Abstract The present study was carried out to detect tick species that infest cattle, and Theileria and Babesia species transmitted by these ticks in Kayseri province (Turkey). A total of 300 cattle were examined for tick infestations. Of the 300 cattle, 117 (39%) were infested with ticks. A total of 1160 ticks belonging to 11 Ixodid genera were collected from the infested animals and their shelters. The most prevalent tick species was Boophilus annulatus 26.37% (306/1160) followed by Hyalomma marginatum marginatum 21.12% (245/1160) and Rhipicephalus turanicus 18.7% (217/1160). The collected ticks were separated into 43 tick pools, according to their species. These pools were examined for bovine Theileria and Babesia species (Theileria sp., Babesia sp., Theileria annulata, T. buffeli/orientalis, Babesia bigemina, B. bovis and B. divergens) by using the reverse line blotting method (RLB). Of the 43 tick pools examined, 6 (14%) were infected with B. bigemina, 4 (9.3%) with T. annulata, and 1 (2.3%) with Babesia sp., whereas 1 (2.3%) displayed mixed infection with T. annulata + B. bigemina. The sequence and phylogenetic analyses of Babesia sp., which could not be identified to the species level by RLB, were performed. In the phylogenetic tree, Babesia sp. (Kayseri 1) grouped with Babesia sp. (Kashi 2), Babesia sp. (Kashi 1), Babesia sp. (Xinjiang) and B. orientalis with 96.8–100% identity. # 2007 Elsevier B.V. All rights reserved. Keywords: Cattle; Tick; Theileria; Babesia; Reverse line blotting
1. Introduction Theileriosis and babesiosis are tick-borne diseases which cause major economic losses, and affect many domestic animals, mainly cattle and sheep, in tropical and sub tropical regions (Uilenberg, 1995). Ixodid ticks are vectors in the transmission of these diseases. Information about the epidemiology of tick-borne diseases, especially on the transmission dynamics of
§
Nucleotide sequence data reported in this paper are available in GenBank, EMBL and DDBJ databases under accession number EF434786. * Corresponding author. Tel.: +90 352 3380006; fax: +90 352 3392312. E-mail address: [email protected] (A. Ica). 0304-4017/$ – see front matter # 2007 Elsevier B.V. All rights reserved. doi:10.1016/j.vetpar.2007.06.003
vector ticks is essential for the elaboration of efficient control strategies (Morzaria et al., 1992). In addition to information on the prevalence of these diseases in ruminants, the isolation and identification of these parasites in vector ticks is also important in the epidemiology of the diseases. The most prevalent tick-borne parasitic disease of cattle is tropical theileriosis. The causative agent of this disease, Theileria annulata, is transmitted by a number of Hyalomma ticks. Although H. a. anatolicum, H. d. detritum and H. dromedarii are considered as the main vectors in the field, other species such as H. a. excavatum and H. m. marginatum can transmit the disease under laboratory conditions and may play a role in the epidemiology of the disease in the field (EstradaPena et al., 2004).
A. Ica et al. / Veterinary Parasitology 148 (2007) 156–160
Bovine babesiosis is mainly caused by Babesia bigemina, B. bovis and B. divergens. These parasites are transmitted by Boophilus microplus, B. decolaratus, B. geiyi, B. annulatus, Rhipicephalus evertsi, R. bursa, Ixodes ricinus and I. persulcatus (Friedhoff, 1988; Estrada-Pena et al., 2004). Molecular methods including the polymerase chain reaction (PCR) and reverse line blotting (RLB) are frequently used for the identification of bovine Theileria and Babesia species in ticks (d’Oliveira et al., 1997; Georges et al., 2001). The aim of this study was to detect the bovine Theileria and Babesia species in ticks collected from naturally infested cattle with Ixodid ticks in Central Anatolia. 2. Materials and methods 2.1. Collection of ticks and establishment of tick pools The present study was carried out in Kayseri province located in Central Anatolia. The study material was collected from 300 cattle, randomly selected from eight districts of Kayseri province, and their shelters between March and September in 2006. The ticks were collected manually from cattle, as well as from the cracks and crevices in the shelters. Adult ticks were identified under a stereo-microscope, according to general identification keys (Estrada-Pena et al., 2004). Of the ticks that were separated according to their species, engorged nymphs and engorged females were placed into an incubator with a temperature of 28 8C and relative humidity of 85%, for moulting and egg laying, respectively. The ticks were divided into 43 pools, according to the study centers and their species and were frozen in liquid nitrogen. Of the 43 tick pools, one comprised larvae that hatched from the eggs laid by engorged females of B. annulatus. Another pool was composed of unfed adult
157
ticks obtained upon the moulting of the engorged nymphs of B. annulatus, and a third pool included unfed adult ticks obtained upon the moulting of engorged nymphs of H. a. anatolicum. 2.2. DNA isolation and PCR amplification The frozen ticks were crushed into a powder with sterile and disposable grinding pestles. Genomic DNA was extracted using a commercial kit (Qiagen Tissue Kit, Qiagen, Hilden, Germany). The PCR was performed as described by Gubbels et al. (1999) and Georges et al. (2001). For the amplification of the variable V4 region of Theileria and Babesia species, RLB-F2 (50 -GACACAGGGAGGTAGTGACAAG-30 ) and RLB-R2 (50 biotin*-CTAAGAATTTCACCTCTGACAGT-30 ) (MWG, Germany) were used as forward and reverse primers, respectively. 2.3. Reverse line blot hybridization The specific oligonucleotide probes shown in Table 1 were used in RLB (MWG, Germany). The preparation of the membrane and the application of the RLB were performed as described by Gubbels et al. (1999) and Georges et al. (2001). 2.4. Sequence analysis After amplification of the hypervariable V4 region of the 18S rRNA gene of a sample which was positive with only catchall and Babesia sp. probe, with RLBF2 and RLBR2 primers, 403 bp. DNA fragment was generated. The PCR product was purified using a commercial kit (PCR Clean up, Genemark, Taiwan) and was sequenced. 2.5. Sequence alignment and phylogenetic analysis The MegAlign component of the 7.1.0 (DNASTAR, Madison, WI) version of the Lasergene software was
Table 1 The 50 -30 sequences of the probes with aminolinkers which were adhered to a biodyne C membranea Oligonucleotide probe
Sequence
Reference
Catchall Theileria sp. Babesia sp. Theileria annulata Theileria buffeli/orientalis Babesia bovis Babesia bigemina Babesia divergens
TAATGGTTAATAGGARCRGTTG TGATGGGAATTTAAACC(CT)CTTCCA CCT(GT)GGTAATGGTTAATAGGAA CCTCTGGGGTCTGTGCA GGCTTATTTCGG(AT)TTGATTTT CAGGTTTCGCCTGTATAATTGAG CGTTTTTTCCCTTTTGTTGG GTTAATATTGACTAATGTCGAG
Gubbels et al. (1999) Nagore et al. (2004) Schnittger et al. (2004) Georges et al. (2001) Gubbels et al. (1999) Georges et al. (2001) Gubbels et al. (1999) Gubbels et al. (1999)
a
T: thymine; A: adenine; C: cytosine; G: guanine; R: A or G.
158
A. Ica et al. / Veterinary Parasitology 148 (2007) 156–160
used for the alignment and phylogenetic analysis of the sequence. A phylogenetic tree was created from the sequences of the 18S rRNA genes of Babesia species originated from different hosts available in Genbank and the sequences described here. 2.6. Statistical analysis The differences between different parameters were evaluated by using the chi-square test (x2). 3. Results In the present study, 117 (39%) of the 300 cattle examined were infested with ticks. A total of 1160 ticks were collected from the infested cattle and their shelters. Among the 300 animals examined, the mean number of ticks per animal was 3.67; with an inter quartile range (IQR) of 0–4. The number of ticks per animal ranged between 0 and 92. After the identification of the collected ticks, 11 tick species were determined. The distribution of the identified tick species according to the study centers were shown in Table 2. The difference in distribution of the ticks according to the study centers was found to be statistically significant (P < 0.001). Most of the infested animals were infested with more than one tick species. The highest levels of infestation in the animals were demonstrated to have occurred with H. m. marginatum 20.3% (61/300) and R. turanicus 10.3% (31/300). Out of 43 tick pools examined for Theileria and Babesia species by RLB, 12 were given positive reactions to catchall probe. Of the 12 positive samples, 6 (14%) were infected with B. bigemina, 4 (9.3%) with T. annulata, and 1 (2.3%) with Babesia sp., whereas 1
(2.3%) displayed mixed infection with T. annulata + B. bigemina. All T. annulata and B. bigemina positive samples were also given positive signals to Theileria sp. and Babesia sp. probes, respectively. Furthermore, B. bigemina was found in unfed larvae obtained upon the lay of eggs by engorged B. annulatus females included in one of the tick pools, and T. annulata was detected in the unfed adult ticks obtained upon the moulting of engorged H. a. anatolicum nymphs collected from the walls of a shelter, in another pool. Of the 12 positive pools, one pool comprising H. m. marginatum ticks collected from cattle did not show any reaction with the other species-specific probes except catchall and Babesia sp. probes. The constructed tree after phylogenetic analysis showed that Babesia sp. (Kayseri 1) was in the same clade with unidentified Babesia species and B. orientalis (Fig. 1). The percent identity of Babesia sp. (Kayseri 1) with the unidentified Babesia species included in the same clade, namely, Babesia sp. (Kashi 2), Babesia sp. (Kashi 1), Babesia sp. (Xinjiang) and B. orientalis were 100%, 99.8%, 90.8% and 96.8%, respectively. 4. Discussion Information on the prevalence of tick-borne pathogens in potential vector ticks of the region is essential for the epidemiology of tick-borne diseases. In the previous studies, the prevalent tick species were reported as Haemaphysalis, Hyalomma, Boophilus, Rhipicephalus and Dermacentor in Central Anatolia (Sayin et al., 1997; Inci et al., 2002b, 2003). In the present study, the identified species are in compliance with previous reports. To date, the prevalence of tick-borne diseases, particularly Theileria and Babesia infections, in the
Table 2 The distribution of tick species according to the study centers Tick species
Tomarza Pinarbasi
Boophilus annulatus 26 Haemaphysalis parva 0 Haemaphysalis sulcata 0 Hyalomma marginatum marginatum 0 Hyalomma anatolicum anatolicum 0 Hyalomma a. excavatum 0 Hyalomma detritum detritum 0 Rhipicephalus turanicus 0 Rhipicephalus bursa 0 Rhipicephalus sanguineus 0 Dermacentor marginatus 0 Total
26 (2.2)
Values given in brackets indicate percentages.
66 96 2 66 0 0 0 0 0 0 20
Gemerek 158 0 0 72 1 0 1 159 3 0 0
Develi 0 0 0 67 0 0 0 42 0 0 0
Yesilhisar 0 0 0 0 79 50 0 15 0 2 0
Sariz 0 10 2 36 0 0 0 0 20 0 0
Sarioglan Incesu 5 0 0 4 0 3 0 1 5 1 0
250 (21.6) 394 (34.0) 109 (9.4) 146 (12.6) 68 (5.9) 19 (1.6)
51 0 0 0 29 0 68 0 0 0 0
Total 306 106 4 245 109 53 69 217 28 3 20
(26.4) (9.1) (0.3) (21.1) (9.4) (4.6) (5.9) (18.7) (2.4) (0.3) (1.7)
148 (12.8) 1160 (100.0)
A. Ica et al. / Veterinary Parasitology 148 (2007) 156–160
159
Fig. 1. Neighbor-joining phylogenetic tree of the 18S rRNA gene of Babesia sp. (Kayseri 1) and some valid Babesia species available in Genbank.
region have been generally investigated in host animals and these parasites were found prevalent in the region (Inci et al., 2002a,b). In the present study, the prevalence of bovine Theileria and Babesia species in ticks were determined as 28%. This result is in accordance with previous studies carried out in the same region. T. annulata is transmitted transstadially by H. a. anatolicum (Bhattacharyulu et al., 1975) whereas B. bigemina is transmitted both transovarially and transstadially by Boophilus annulatus (Friedhoff, 1988). In the present study, demonstrating of B. bigemina DNA in unfed larvae, which hatched from eggs laid by engorged B. annulatus females, points out to the transovarial transmission of B. annulatus to subsequent generations, and is also an indication of the vector potential. Furthermore, the presence of T. annulata DNA in the unfed adult ticks moulted from engorged H. a. anatolicum nymphs collected from the shelters indicates the transstadial transmission, and the vector potential of the tick. According to the created phylogenetic tree, Babesia sp. (Kayseri 1) was included in the same clade with the unidentified Babesia isolates from China, and B. orientalis. The origin of Kashi 1 and Kashi 2, which were discovered in China, being Hyalomma ticks (Luo et al., 2005) also suggest identity or similarity with Babesia sp. (Kayseri 1) isolated from H. m. marginatum. Our results indicated that, Babesia sp. (Kayseri 1) was also in the same clade with B. orientalis, known to cause mortality in buffaloes. On the other hand, Babesia sp. (Kayseri 1) was determined to belong to a branch completely different from other bovine Babesia species, including B. bigemina, B. bovis and B. divergens.
In conclusion, the molecular diagnosis of Theileria and Babesia species in the prevalent tick species of the region has demonstrated the prevalence of bovine Theileria and Babesia parasites in ticks, and the risk of cattle to contract theileriosis and babesiosis. Determination of T. annulata and B. bigemina in unfed adult of H. a. anatolicum and unfed larvae of B. annulatus, respectively, has exhibited the vector potential of these ticks. Furthermore, the results of the molecular and phylogenetic analyses of the Babesia sp. (Kayseri 1) isolate have pointed out to the possible existence of novel species in the region. For this reason, phylogenetic analyses have been concluded to be required for Theileria and Babesia species to be reported from the region in the future. Acknowledgements This study was financially supported by Erciyes University Research Fund (EUBAP-Project Number VA-05-05) and European Commission (MEDLABAB Contract No. 003691 INCO-DEV). The author thanks all veterinarians and technicians for their kind helps during field studies. References Bhattacharyulu, Y., Chaudhri, R.P., Gill, B.S., 1975. Studies on the development of Theileria annulata (Dschunkowzky and Luhs, 1904) in the tick-Hyalomma anatolicum anatolicum (Koch, 1844). Ann. Parasitol. Hum. Comp. 50, 397–408. d’Oliveira, C., van der Weide, M., Jacquiet, P., Jongejan, F., 1997. Detection of Theileria annulata by the PCR in ticks (Acari:
160
A. Ica et al. / Veterinary Parasitology 148 (2007) 156–160
Ixodidae) collected from cattle in Mauritania. Exp. Appl. Acarol. 21, 279–291. Estrada-Pena, A., Bouattour, A., Camicas, J.L., Walker, A.R., 2004. Ticks of Domestic Animals in the Mediterranean Region, 1st ed. University of Zaragoza, Spain. Friedhoff, K.T., 1988. Transmission of Babesia. In: Ristic, M. (Ed.), Babesiosis of Domestic Animals and Man. CRC Press, Boca Raton, FL, pp. 23–52. Georges, K., Loria, G.R., Riili, S., Greco, A., Caracappa, S., Jongejan, F., Sparagano, O., 2001. Detection of haemoparasites in cattle by reverse line blot hybridisation with a note on the distribution of ticks in Sicily. Vet. Parasitol. 99, 273–286. Gubbels, J.M., de Vos, A.P., van der Weide, M., Viseras, J., Schouls, L.M., de Vries, E., Jongejan, F., 1999. Simultaneous detection of bovine Theileria and Babesia species by reverse line blot hybridization. J. Clin. Microbiol. 37, 1782–1789. Inci, A., Cakmak, A., Ica, A., Gunay, O., 2002a. Kayseri yoresinde tropikal theileriosis’e bagli ekonomik kayiplar. Turkiye Parazitol. Derg. 26, 156–160 (in Turkish). Inci, A., Cakmak, A., Karaer, Z., Dincer, S., Sayin, F., Ica, A., 2002b. Kayseri yoresinde sigirlarda babesiosis’in seroprevalansi. Turk. J. Vet. Anim. Sci. 26, 1345–1350 (in Turkish). Inci, A., Nalbantoglu, S., Cam, Y., Atasever, A., Karaer, Z., Cakmak, A., Sayin, F., Yukari, B.A., Ica, A., Deniz, A., 2003. Kayseri
yoresinde koyun ve kecilerde theileriosis ve kene enfestasyonlari. Turk. J. Vet. Anim. Sci. 27, 57–60 (in Turkish). Luo, J., Yin, H., Liu, Z., Yang, D., Guan, G., Liu, A., Ma, M., Dang, S., Lu, B., Sun, C., Bai, Q., Lu, W., Chen, P., 2005. Molecular phylogenetic studies on an unnamed bovine Babesia sp. based on small subunit ribosomal RNA gene sequences. Vet. Parasitol. 133, 1–6. Morzaria, S., Katende, J., Kairo, A., Nene, V., Musoke, A., 1992. New methods for the diagnosis of Babesia bigemina infection. Mem. Inst. Oswaldo Cruz. 87, 201–205. Nagore, D., Garcia-Sanmartin, J., Garcia-Perez, A.L., Juste, R.A., Hurtado, A., 2004. Identification, genetic diversity and prevalence of Theileria and Babesia species in a sheep population from Northern Spain. Int. J. Parasitol. 34, 1059–1067. Sayin, F., Dincer, S., Karaer, Z., Dumanli, N., Cakmak, A., Inci, A., Yukari, B.A., Vatansever, Z., 1997. Status of tick infestation of sheep and goats in Turkey. Parassitologia 39, 145–152. Schnittger, L., Yin, H., Qi, B., Gubbels, M.J., Beyer, D., Niemann, S., Jongejan, F., Ahmed, J.S., 2004. Simultaneous detection and differentiation of Theileria and Babesia parasites infecting small ruminants by reverse line blotting. Parasitol. Res. 92, 189–196. Uilenberg, G., 1995. International collaborative research: significance of tick-borne hemoparasitic diseases to world animal health. Vet. Parasitol. 57, 19–41.