Detection of viremia by a one step polymerase chain reaction method in hepatitis C virus infection

Vrus Research, 30 (1993) 303-315 0 1993 Ekvier Science Publishers B.V.

All rights reserved 0168-1702/93/$06.00

Virus Research

VIRUS 00944

Detection of viremia by a one step polymerase chain reaction method in hepatitis C virus infection Nafees Ahmad a*, Gilbert M. Schiff b and Bahige M. Baroudy a Divisions of a Molecular Vkology and b Clinical Vkology, James N. Gamble Institute of Medical Research, 2141 Auburn Avenue, Cincinnati, OH 45219, USA

(Received 5 February 1993; revision received 15 July 1993; accepted 22 July 1993)

Summary A simple, sensitive, and specific one step polymerase chain reaction (PCR) method for the detection of hepatitis C virus (HCV) RNA in infected patients’ serum or plasma samples is described. We performed the one step PCR amplification in combination with the initial step of reverse transcription by using oligonucleotide primers derived from the conserved 5’untranslated region (5’-UTR) of the HCV genome. By utilizing this strategy, there was no need for nested or second stage PCR amplification. The PCR products (ACNE) were easily visualized by agarose gel electrophoresis and ethidium bromide staining. Furthermore, the PCR products were characterized by Southern blot hybridization and DNA sequencing. We then used the one step PCR amplification method to detect the presence of HCV RNA in several infected patients’ samples with acute and chronic infections. There was a 100% concordance between the results of PCR and second generation recombinant immunoblot assay (RIBA II). In addition, this method was found to be useful in determining viremia in HCV infected patients with indeterminate RIBA II results. The 5’-UTR of the HCV genome, being the most conserved region among different viral isolates, could be amplified by PCR for the detection of HCV RNA, as shown here, as well as serving as a potential target for antiviral agents. Non-A, non-B hepatitis; PCR amplification; Hepatitis region; Acute infection; Chronic infection; Viremia

* ~rres~nd~ng

author.

C virus; 5’-Untranslated

304

The ~t~olo~ic~ agent of most posttrans~sion non-A, non-B hepatitis ~N~BH) cases is believed to be the hepatitis C virus (HCV) (Choo et al., 1988; Kuo et al., 1989; Ho~gbton et al., 1991). The genome of HCV is a positive sense, singlestranded linear RNA of appro~mately 9.5 kb with an organization and certain characteristics of flaviviruses and pestivi~ses (Kato et al., 1990; Miller and Purcell, 1990). The nucl~otide sequence of HCV ~e~orne reveaIed the existence of a single, continuous translational open reading frame (ORF) of 3011 amino acids (Kato et al., 1990, Takamizawa et aI., 1991). A 5’-untranslated region (5”~UTRj of approximately 324-341 ~~cleotides (nt) precedes the large coding sequences ~Houghton et al., 1988, 1991; Kato et al., 1990; Han et al., 1991) and represents the most hig~y conserved sequence among different HCV isolates (K&o et al., 1990; Choo et al,, 1991; Han et aL, 1991; Takamizawa et al., 1991). The diagffosis of HCV infection is based on the detection of HCV antibodies in infected patients’ blood (Kuo et al., 1989; Kotwal et al,, 1992). The direct detection of HCV RNA in infected patients’ samples is difficult because of its low abundance. Therefore, pol~er~e chain reaction (PCZR>has been utifized to ampii~ reverse transcribed cDNA to permit detection of HCV RNA in blood or tissue biopsy specimens CGarson et al., 1990a; Kaneko et al., 199Q Weiner et al., 1990). Using PCR amplification, it has been found that viremia can be detected within only a few days folI~wing exposure to the virus and several weeks before elevation of circu1ating alanine amjno transferase (ALT) and HCV antibody Ievels (Carson et al., 1990a, b; Shimuzu et al., 1990). In most cases, PCR ampli~cation has consisted of either a nested or second stage amplification (Okamoto et al., 1990; Cristiano et al., l991), which have increased risk of ~ntamination and false positive results (&etch et al., 1993). To overcome these limitations and probIems, we report a one step PCR ampIification method in ~mbination with the initial step of reverse tra~~riptio~ by using oiigonuc1eotide primers derived from the 5’UTR to detect the presence of HCV RNA in infected patients’ serum or pIasma samples. Furthe~ore, the one step PCR ~plificati~n described here detected viremia in HCV infected patients and was found useful for the detection of HCV RNA in patients and blood donors even when RIBA II results were indeterminate.

jackals

and Meth~s

Serum or pIasma samples from 11, different HCV infected patients were provided by Dr. Paul V. Holland, Sacramento Medical Foundation Center for Blood Research, Sacramento, CA. The ELISA and REI3A II results of the HCV infected patients are summarized in Table 1. We also anaIyzed 236 samples from patients evaluated for suspected HCV, pediatric patients foIlowing liver transplan-

305 TABLE 1 ELISA and RIBA II results of HCV infected patients Patient

ELISA

RIBA II

C-loo

c-200 c/c-22

A B C D E F G H I J K Nl N2 N3 N4 N5 N6

NR R R R NR NR NR NR NR NR NR NR NR NR NR NR NR

NR R R R R R R R R R ND NR NR NR NR NR NR

5-1-1

C-loo -

c33c -

C22-3 _

+ + +

+ + +

+ + + +

_

-

-

-

f -

-

-

+ + t-

+ + + + + + + + _

SOD _ _ -

INTERP NR R R R R I R I R I I

NR, nonreactive; - , negative; R, reactive; +, positive; I, indeterminate (only one band out of four was reactive using RIBA II); ND, not determined, Patient A was an organ recipient on immunosuppressive drugs before and after transplantation and was an acute case; patients B, C, and D were chronic cases; patients E-K were HCV infected patients with reactive and indeterminate RIBA II results; Nl to N6 were normal donors (negative controls).

tation, and institutionalized cases received from University of Cincinnati Medical Center and Children’s Hospital Medical Center, Cincinnati, OH. RNA isolation RNA was extracted by a modification of the guanidinium isothiocynate procedure (Chomczyniski and Sacchi, 1987) from 1.0 ml of serum by mixing with 5.0 ml of an extraction buffer (4 M guanidinium isothio~ate, 0.5% sarcosyl, 25 mM sodium citrate, pH 7, and 100 mM 2-mercaptoethanol). Sodium acetate (2 M) was added to a final concentration of 100 mM and followed by several extractions with phenol-chloroform. Finally, RNA was precipitated once by isopropyl alcohol and several times by ethanol in the presence of carrier yeast tRNA. After centrifugation, the RNA pellet was washed with 70% ethanol, dried and resuspended in 100 ~1 of RNase-free water and 2 ~1 of RNasin (40,000 U/ml, Promega Corp., Madison, WI). Reverse transctiptionand PCR amplification PCR amplification was performed in combination with the initial step of reverse transcription of HCX RNA extracted from infected patients’ plasma or serum samples as a single step procedure. The nucleotide sequences of the oligonu-

306

cleotide primers were deduced from the published HCV sequence (Houghton et al., 1988; Choo et al., 1991) and synthesized according to the published HCV primers (Okamoto et al., 1990; Thaler et al., 1991) with some modifications by using a Pharmacia Gene Assembler as shown in Table 2. To avoid contamination, all the samples were dispensed in a laminar flow hood in biosafety level 3 facility free from all laboratory used DNAs. The annealing temperatures of HCV cDNA and various primer pairs were optimized for better yield and specificity (Rychlik et al., 1990). Reverse transcription and PCR amplification were performed in the same tube in a 50 ~1 reaction mixture containing 3 ~1 RNA, 5 ~1 10 X PCR buffer (100 mM Tris-HCl, pH 8.3, 500 mM KCI, 15 mM MgCI, 0.01% gelatin), 200 PM each dATP, dCTP, dGTP, TIP, 0.2-1.0 PM of each HCV primer pair, 10 units of reverse transcriptase (Invitrogen, San Diego, CA), and 2.5 units of Taq polymerase (Perkin-Elmer, Cetus, Norwalk, CT). The reverse transcription was carried out at 43°C for 30 min in the thermocycler (Perkin-Elmer, Cetus) followed by PCR amplification for 35 cycles consisting of denaturation at 94°C for 1.5 min, annealing at 58°C for 2 min, and extension at 70°C for 3 min. The thermocycler was placed in a small separate room where no DNA was used. The PCR products were analyzed by electrophoresis on 1.8% agarose (Bethesda Research Lab., Gaithersburg, MD) gels containing 0.5 pg/ml ethidium bromide. The gels were viewed and photographed on a UV light box. Southern blot hybridization

After electrophoresis, the PCR products (cDNA~) were denatured with 0.5 N NaOH for 30 min, neutralized with 0.5 M Tris (pH 7.5) and 1.5 M NaCl for 1 h at room temperature with constant shaking, and transferred to nitrocellulose filters in 20 X SSC for 12-24 h (Sambrook et al., 1989). The nitrocellulose filters were dried at room temperature and baked for 2 h at 80°C under vacuum. The filters were prehybridized at 42°C in 6 X SSC, 5 X Denhardt’s solution, 0.1% SDS and 100 pg/ml denatured salmon sperm DNA. Hybridization was performed for 4-8 h in the same solution containing 5 ng of [Y-~*PIATP end labeled oligonucleotide

TABLE 2 Nucleotide sequence of the oligonucleotide primers used in

PCR amplification

Primer

Polarity

Nucleotide position a

Nucleotide sequence b

HCV-38 HCV-37 HCV-39 HCVd 1 HCV-65 HCV40

+ + +

-319 to -91 to - 118 to - 297 to -96 to -204to

CACTCCACCATGAATCACTCCCC

a

-297 -74 -94 - 278 -77 -17.5

CCCAACACTACTCGGCTA AGTCTTGCGGGGGCACGCCCAAATC CTGTGAGGAACTACTGTCTT AACACTACTCGGCTAGCAGT CCATAGTGGTCTGCGGAACCGGTGAGTACA

Nucleotide position refers to the numbers as described previously (Houghton et al., 1988: Choo et al., 1991). b Nucleotide sequences of the primers were deduced from the published HCV sequence (Houghton et al., 1988; Choo et al., 1991).

307

probe per ml. The filters were washed three to four times with 2 X SSC at room temperature and then three times for 5 min each at 60°C in 6 x SSC, dried, and exposed to X-ray film with an intensifying screen at - 70°C.

The PCR products (cDNAs) which were positive by Southern hybridization were blunt ended, kinased, and cloned into the SmaI site of pGem 3Zf ( +) vector (Promega Corp, Madison, WI). Bacterial colonies were screened for the presence of recombinants by restriction enzyme analysis of the plasmid DNA, The clones with the correct size of inserts were selected and propagated for single stranded DNA and nucleotide sequencing was performed according to Sequenase protocol (U.S. Biochemicals Corp., Cleveland, OH).

In vitro transcription In order to generate synthetic HCV RNA, the plasmid pGem 3Zf (+ ) carrying 246 bp of the 5’-UTR of HCV was linearized at the unique E&dIII site downstream of the HCV insert. It was then used to synthesize 246 nt RNA of the 5’UTR of HCV by using T7 bacteriophage RNA polymerase (Promega Corp., Madison, WI). After in vitro transcription, the reaction mixture was treated with RNase-free DNase in order to remove the DNA template. The RNA was purified by filtration on a Sephadex G-SO column and analyzed on acrylamide gel. The concentration of HCV RNA was determined by measuring optical density at 260 nm.

Results

To amplify the 5’-UTR of HCV from an infected patient’s plasma (patient A), the initial steps of reverse transcription and PCR amplification were performed in the same tube by using HCV oligonucleotide primers shown in Table 2. Both primers were added simultaneously and the initial step of reverse transcription was carried out at 43°C followed by PCR. Fig. I shows the 1.8% agarose gel electrophoresis of the PCR products obtained as a result of amplification of the 5’UTR of HCV by using primer pairs HCV-38/HCV-37, HCV-38/HCV-39, and HCVJl/HCV-65. These primer pairs yielded 246 bp, 226 bp, and 220 bp cDNA fragments, respectively, as shown in lanes 1, 2, and 3 (Fig. 1X The PCR products were easily visualized on agarose gel electrophoresis after ethidium bromide staining. The PCR amplification was dependent on the presence of reverse transcriptase and Taq polymerase in the reaction mixture Qanes I, 2, and 33 whereas no PCR products resulted when reverse transcriptase (lanes 4,5, and 6) or Taq (lanes 7, 8, and 3) was not added to the reaction mixture, In tubes where reverse transcriptase was included but no Taq was added, cDNA synthesis took place but could not be visualized on agarose gel (lanes 7, 8, and 9). We found the

308 El

EZ/NS1

N82

N83

NM

N85

3'

ATB NCV

5’ P -> ltcv-3e(+) -319 to -297

polyprotein

+1

-91

to -74

-> Hcv-39(+) -319 to -297 -> acv-rl(+) -297 to -279

G-39(-, -110 to

-94


Fig. 1. PCR amplification of the 5’-untranslated region of HCV genome from infected patient’s plasma. Genomic organization of HCV is shown on the top and the boxes represent each protein region. C, core; El, envelope 1; E2, envelope 2, NSl-NS5, nonstructural protein; UTR, untranslated region. The arrows denote the polarity of the primers: + (+) denotes the genomic (sense) strand and + (-) denotes the complementary (antisense) strand. The antisense primers were used for the initial step of reverse transcription of HCV RNA to cDNA followed by PCR as a single step procedure. The bottom part of the figure shows the 1.8% agarose gel electrophoresis of the PCR products obtained with various primer pairs. From left to right: M, 1 kb DNA marker, lane 1, 246 bp band obtained by primer pair HCV-38/HCV-37; lane 2, 226 bp band obtained by primer pair HCV-38/HCV-39; lane 3, 220 bp band obtained by primer pair HCV-51/HCV-65 from the RNA extracted from an HCV infected patient’s plasma (patient A); lanes 4-6, HCV RNA and PCR mix but no reverse transcriptase (RT) with primer pairs HCV-38/HCV-37, HCV-38/HCV-39, and HCV-51/HCV-65, respectively; lanes 7-9, HCV RNA, RT, and PCR mix but no Taq with primer pairs HCV-38/HCV-37, HCV-38/HCV-39, and HCV-51/HCV-65, respectively; lanes 10-12, uninfected plasma (Nl, normal donor) with RT, Taq, PCR mix and primer pairs HCV-38/HCV-37, HCV-38/HCV-39, and HCV-51/HCV-65, respectively.

optimal annealing temperature for HCV cDNA and primer pairs HCV-38/HCV-37 and HCV-38/HCV-39 to be 5%60°C and the maximum yield was also obtained under the conditions described above. The amplification of the 5’-UTR of HCV by one step PCR method was also dependent on the quality of RNA extracted from

309

patients’ samples. We found that repeated extraction with phenol-chloroform, several precipitations by ethanol in the presence of carrier RNA, and washing the RNA pellet with 70% ethanol increased the sensitivity of the PCR to a significant level. Sensitivity of one step PCR amplification method Fig. 2 shows the sensitivity of the one step PCR amplification method of HCV RNA extracted from an infected patient’s plasma (patient A) as compared to synthetic HCV RNA (in vitro synthesized 5’-UTR of HCV by T7 bacteriophage RNA polymerase). RNA equivalent to 15 ~1, 5 ~1, and 1 ~1 of patient’s plasma (lanes 1,2, and 3) and varying concentrations of synthetic HCV RNA of 50, 10,0.5, 0.01, and 0.001 fg (lanes 4-8) were subjected to the one step PCR amplification in combination with reverse transcription as described above and one-third of the PCR products were analyzed by electrophoresis on a 1.8% agarose gel. This method detected HCV RNA easily from 5 ~1 of patient’s plasma (lane 2) and the analytical sensitivity of PCR as determined for synthetic HCV RNA was approximately 28 HCV genomes (lane 7).

Ml

23

4

5

6

7

8

9

10

1,018 506,517 220

Fig. 2. Sensitivity of one step PCR amplification method. RNA extracted from an HCV infected patient plasma (patient A) and synthetic HCV RNA were subjected to one step PCR amplification by using primer pair HCV-38/HCV-37 and analyzed by electrophoresis on a 1.8% agarose gel. From left to right: Lane M, 1 kb DNA marker; lanes 1-3, RNA equivalent to 15 ~1, 5 ~1 and 1 ~1 of HCV infected patient’s plasma; lanes 4-8, varying concentrations of 50, 10, 0.5, 0.01, and 0.001 fg of synthetic HCV RNA, and lanes 9-10, RNA extracted from normal donors (Nl-N2). The expected size fragments (246 bp) are visualized in HCV infected patient’s plasma and synthetic HCV RNA lanes.

310

Detection of HCV RNA by one step PCR method in several patients with acute and chronic infections We used four different infected patients, patient A (no detectable HCV antibody, under immunosuppressive drugs) with acute infection, patients B, C, D, with chronic infection, and four uninfected sera samples Nl-N4 (Table 1) to detect the presence of HCV RNA by one step PCR amplification by using primer pairs HCV-38/HCV-37 and HCV-38/HCV-39 which worked more efficiently than HCV-51/HCV-65 as shown in Fig. 1. We amplified 246 bp or 226 bp bands in all four HCV infected patients, whereas the uninfected samples were found to be negative. Fig. 3A shows the result of the PCR amplification of the 5’-UTR from patients A-D where lanes 2 and 3 represent the 246 bp and 226 bp bands from patient A by using primer pairs HCV-38/HCV-37 and HCV-38/HCV-39, respectively, lane 6 the 246 bp band from patient B obtained by primer pair HCV38/HCV-37, and lanes 7 and 10 the 246 bp bands from patient C and patient D, respectively, using primer pairs HCV-38/HCV-37. Lanes 4, 5, 8, and 9 represent negative controls (normal sera, Nl-N4), and 11 (yeast RNA) where no PCR fragments were seen.

A

B

lkb

1

2

3

4

6

6

7

8

9

10

11

Fig. 3. (A) Detection of HCV RNA by one step PCR amplification in several patients with acute and chronic infections. From left to right: 1 kb DNA marker; lane 1, control from manufacturer (Perkin Elmer, Cents); lanes 2-3, 246 bp and 226 bp bands amplified from patient A obtained by primer pairs HCV-38/HCV-37 and HCV-38/HCV-39, respectively; lanes 4-5, uninfected plasma (Nl-N2) with primer pairs HCV-38/HCV-37 and HCV-38/HCV-39, respectively; lane 6, 246 bp band amplified from patient B obtained by primer pair HCV-38/HCV-37; lane 7, 246 bp band amplified from patient C obtained by primer pairs HCV-38/HCV-37; lanes 8-9, uninfected sera (N3-N4) with primer pair HCV-38/HCV-37; lane 10, 246 bp band amplified from patient D obtained by primer pair HCV38/HCV-37, lane 11, yeast RNA. (B) Southern blot analysis of the PCR products. The PCR products (cDNAs) shown on agarose gel (Fig. 3A) were hybridized by using an internal 32P-labeled oligonucleotide probe (HCV40) indicated as P in Fig. 1. From left to right: 1 kb DNA marker hybridized with 1 kb [32P]DNA; lanes 2, 3, 6, 7, and 10 hybridized with the probe (HCV-401, whereas the negative control lanes 4,5, 8, 9, and 11 did not hybridize.

311

Characte~at~o~

of the PCR amp~i~ed products

In order to further characterize these PCR amplified products, the cDNAs (Fig. 3A) were transferred to nitrocellulose filters and Southern hybridization was performed by using an internal oligonucleotide probe (HCV-40, Table 2) designated as P in Fig. 1. This oligonucleotide does not overlap with any of the primers used either for reverse transcription or PCR amplification. As shown in Fig. 3B, lanes 2,3,6,7, and 10 hybridized with “2P-labeled oligonucleotide probe (HCV-40) confining that the bands shown in Fig. 3A represent HCV specific cDNAs. Moreover, these fragments (cDNAs) were subjected to nucleotide sequencing and showed approximately 98% homology (data not shown) compared to I-ICY-1 isolate (Choo et al., 1991). This suggests that primer pairs HCV-38/HCV-37 and HCV-38/HCV-39 could be used to amplify the 5’-UTR by the one step PCR method to detect the presence of HCV RNA in infected patients’ samples. Detection of viremia by one step PCR method in HCV infected patients with reactive and indeterminate RiBA II results

We were provided with a coded panel of two categories of seven HCV infected serum samples: three with reactive RIBA II (C33C and C22-3 reactive) and four with ind~te~inate RIBA II (only one band reactive out of four), results shown in

Ml23456189

1,01a 506, 517 220

Fig. 4. Detection of viremia by one step PCR amplification method in HCV infected patients with reactive and indete~inate RIBA II results. The 246 bp fragments were amplified by one step PCR method from RNA extracted from HCV infected patients’ sera by using primer pairs HCV-38/HCV-37 and analyzed by electrophoresis on a 1.8% agarose gel. Lane M, 1 kb DNA marker: lane 1, patient E, lane 2, patient F; lane 3, patient G, Iane 4, patient H; lane 5, patient I; lane 6, patient 3; lane ‘7,patient K; lane 8, N5 (uninfected serum); lane 9, N6 (uninfected serum).

312

Table 1. These results were revealed to us after the PCR ~pl~cation was done. The results of PCR amplification of 246 bp from the 5’-UTR of HCV are shown in Fig. 4. The one step PCR method detected the presence of HCV RNA in all the infected serum samples with reactive RIBA II (lanes 1, 3, and 5 for patients E, G, and I, respectively) and indeterminate RIBA II (lanes 2, 4, 6, and 7 for patients F, H, J, and K, respectively) results. The PCR products (cDbJAs) were further unfixed by Southern blot hybridization by using an internal oligonucleotide probe, HCV-40. There was a 100% concordance between the results of PCR and RIBA II. Furthermore, the one step PCR method detected HCV RNA even in those infected patients who had indeterminate RIBA II results. We have used this method for the detection of HCV RNA from 236 patients’ samples for suspected HCV infection, pediatric patients following liver transplantation, and institutionalized cases. The PCR anaIysis correlated with the results of immunological assays and clinical case histories (data not shown).

Discussion

We have described a simple, sensitive, and highly specific one step PCR amplification method in combination with the initial step of reverse transcription for the detection of HCV RNA in infected patients’ serum or plasma samples with acute and chronic infections by using oligonucleotide primers derived from the conserved 5’-UTR of the HCV genome. The PCR products were easily visualized by agarose gel electrophoresis and ethidium bromide staining (Fig. 11, eliminating the need for nested or second stage PCR amplification as described before (Okamoto et al., 1990; Cristiano et al., 1991). This was further supported by the characterization of PCR products (cDNAs) by Southern blot hybridization and DNA sequencing. The nucleotide sequence of the characterized fragments represented the 5’-UTR of HCV genome and showed approximately 98% homology among different viral isolates. The major concerns with PCR, in addition to sensitivity, are contamination and false positive results. The nested or second stage PCR amplification provides more sensitivity but has increased risk of contamination because of manipulation of first round PCR product (cDNA). Recently Gretch et al. (1993) described a one stage PCR method followed by liquid hybridization with identical sensitivities (10 molecules) for both the one stage and nested PCR. The data shown here establish that one step PCR amplification offers sufficient sensitivity and less potential for contamination. The analytical sensitivity of this method can be interpreted to be approximately 28 HCV molecules as determined for purified synthetic HCV RNA (Fig. 2). We also observed that the one step PCR method was more sensitive when RNA was extracted from HCV infected plasma rather than serum. The sensitivity, specificity, and yield of the PCR product were also dependent on the anneating temperature of template and primers (Rychilk et al., 1990). PCR amplification has been utilized to detect HCV infection in seronegative NANB hepatitis patients (Weiner et al., 1990). This approach provides a definite

313

advantage over the immunological tests. This was also true in the case of vertical transmission of HCV from mother to child where many of these infants showed evidence of viremia detected by PCR in the absence of seroconversion (Thaler et al., 1991). The PCR amplification described here was found very useful in the detection of HCV RNA in several infected patients with acute and chronic infections as well as blood donors and infected patients with reactive RIBA II results. There was a 100% concordance between the results of PCR and RIBA II. Our one step PCR method also provided valuable information concerning the viremic status of several HCV infected patients even when their RIBA II results were indeterminate (Fig. 41, implying that this method could be used for the detection of HCV in the absence of confirmed RIBA II results. There was no evidence of contamination or false positive results observed by this method, when uninfected serum samples from normal donors (Figs. 1, 2, 3 and 4) or 236 samples from suspected HCV patients, pediatric patients following liver transplantation, and institutionalized cases (manuscripts in preparation) were analyzed. Our one step PCR method can also be used to monitor antiviral or other therapeutic agents’ efficacy. We have tested several serum samples of HCV infected patients whose RNA levels became undetectable by this method after interferon treatment (unpublished observations). Kanai et al. (1990) have shown a decrease of viral RNA level in HCV infected patients in response to interferon therapy. The one step PCR could be used widely as a reliable diagnostic test for the detection of HCV in patients and blood donors, as shown here, because viremia can be detected before the appearance of HCV antibody and the elevation of ALT levels (Garson et al., 1990a, b; Shimizu et al., 1990). This will provide a better opportunity to detect HCV infection at an early stage. The 5’-UTR of HCV being the most conserved region among different viral isolates suggests an important role of this sequence in viral replication. A complete mutational analysis of the 5’-UTR sequence is required in order to understand the role this region plays in HCV replication. However, the highly conserved nature of the 5’-UTR makes this region vital in detection and replication of HCV as well as a potential target for antiviral agents. The association of HCV with hepatocellular carcinoma and other liver disease is not clear. Nevertheless, several studies have demonstrated that HCV infection is present in a large proportion of patients with chronic hepatitis, cirrhosis of the liver, and hepatocellular carcinoma (Rakela and Rakela, 1979; Realdi et al., 1982; Resnick et al., 1983; Kiyosawa et al., 1987; Bruix et al., 1989; Columbo et al., 1991). Using oligonucleotide primers derived from the conserved 5’-UTR, PCR amplification, as shown here, will be useful in detecting HCV RNA in serum and infected liver tissue in order to correlate the association of HCV with chronic liver disease.

Acknowledgements

We thank Dr. Paul V. Holland and I. Ken Kuramoto, Sacramento Medical Foundation Center for Blood Research, Sacramento, CA, for providing serum and

314

plasma samples of HCV infected patients. We also thank John M. Marrocco for technical assistance and MS Ellen Shupe and MS Rebecca Burgess for typing the manuscript.

References Bruix, J., Barrera, J., Calvert, X., Ercilla, G, Costa, J., Sanchez-Tapias, J., Ventura, M., Vail, M., Bruguera, M., Bru, C., Castillo, R. and Rodes, J. (1989) Prevalence of antibodies to hepatitis C virus in Spanish patients with hepatocellular carcinoma and hepatic cirrhosis. Lancet 2, 1004-1006. Chomczyniski, P. and Sacchi, N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156-9. Choo, Q.-L., Kuo, G., Weiner, A.J., Qverby, L.R., Bradley, D.W. and Houghton, M. (1988) Isolation of a cDNA derived from a blood-borne non-A, non-B viral hepatitis genome. Science 244, 359-362. Choo, Q.-L., Richman, K.H., Han, J.H., Berger, K., Lee, C., Dong, C. and Gallegos, C. (1991) Genetic organization and diversity of the hepatitis C virus. Proc. Natl. Acad. Sci. USA 88, 2451-2455. Columbo, M., Kuo, G., Choo, Q.-L., Donato, M.F., Ninno, E., Tommasine, M., Diofuard, N. and Houghton, M. (1989) Prevalence of antibodies to hepatitis C virus in Italian patients with hepatocellular carcinoma. Lancet 2, 1006-1008. Cristiano, K., Bisceglie, A., Hoofangle, J.H. and Finestone, S.M. (1991) Hepatitis C viral RNA in serum of patients with chronic non-A, non-B hepatitis. Detection by the polymerase chain reaction using multiple primer sets. Hepatology 14, 51-55. Dienstag, J.R. (1990) Hepatitis non-A, non-B: C at last. Gastroenterology 99, 1177-1180. Garson, J.A., Ring, C., Tuke, P. and Tedder, R.S. (1990a) Enhanced detection by PCR analysis of hepatitis C virus RNA. Lancet 336, 878-879. Garson, J.A., Tuke, P.W., Makris, M., Briggs, M., Machin, S.J., Preston, F.E. and Tedder, R.S. (1990b) Demonstration of viremia patterns in haemophiliacs treated with hepatitis C virus contaminated factor VIII concentrates, Lancet 336, 1022-1025. Gretch, D.R., Wilson, J.J., Carithers Jr., R.L., Rosa, C.D., Han, J.H. and Corey, L. (1993) Detection of hepatitis C virus RNA: Comparison of one stage polymerase chain reaction (PCR) with nested set PCR. J. Clin. Microbial. 31, 289-291. Han, J.H., Sbyamala, V., Richman, K.H., Brauer, M.J., Irvine, B., Urdea, MS. and Tekamp-Olson, P. (1991) Characterization of terminal regions of hepatitis C viral RNA. Identification of conserved sequences in the 5’-untranslated region and poly (A) tails at the 3’ end. Proc. Natl. Acad. Sci. USA 88, 1711-1715. Houghton, M., Choo, Q.-L. and Kuo, G. (1988) European patent application number 88310922.5, Publication number 0318216. Houghton, M., Weiner, A., Han, J., Kuo, G. and Choo, Q.-L. (1991) Molecular biology of hepatitis C viruses, implications for diagnosis, development and control of viral disease. Hepatology 14, 381-388. Kanai, K., Iwata, K., Nakao, K., Kako, M. and Okamoto, H. (19901 Suppression of hepatitis C virus RNA by interferon*. Lancet 336, 25. Kaneko, S., Unoura, M., Kohayashi, M., Kuno, K., Murakami, S. and Hattori, N. (1990) Detection of serum hepatitis C virus RNA. Lancet 335, 996. Kato, N., Hijikata, M., Ootsuyama, Y., Nakagawa, M., Ohkoshi, S., Sugimura, T. and Shimotohno, S. (1990) Molecular cloning of the human hepatitis C virus genome from Japanese patients with non-A, non-B hepatitis. Proc. Natl. Acad. Sci. USA 87, 9524-9528. Kiyosawa, K., Akahana, Y., Nayata, A. and Furuta, S. (1987) Hepatocellular carcinoma after non-A, non-B post transfusion hepatitis. Am. J. Gastroenterol. 78, 777-781. Kotwal, G.J., Baroudy, B.M., Kuramoto, I.K., McDonald, F.F., Schiff, G.M., Holland, P.V. and Zeldis, J.B. (1992) Detection of acute hepatitis C virus infection by ELISA using a synthetic peptide comprising a structural epitope. Proc. Nat]. Acad. Sci. USA 89, 4486-4489.

315 &to, G., Choo, Q.-L., After, H.J., Gitnick, G.L., Redeker, A.J., Purcell, R.H., Miyamura, T., Dienstag, J.L., Alter, M.J., Stevens, C.E., Tegtmier, G.E., Bonino, F., Coiombo, M., Lee, W.S., Kuo, G., Berger, F., Shuster, .J.R., Qverby, L.R., Bradley, D.W. and Houghton, M. (1989) An assay for circulating antibodies to a major etiologic virus of human non-A, non-B hepatitis. Science 244, 362-364. Miller, R.H. and Purcell, R.H. (1990) Hepatitis C virus shares amino acid sequence similarity with pestivirus and flavivirus as well as members of two piant virus supergroups. Proc. Natl. Acad. Sci. USA 87, 2057-2061. Okamoto, H., Okada, S., Sugiyama, Y., Tanaka, T., Sugai, Y., Akahane, Y., Machida, A., Mishiro, S., Yoshizawa, H., Miyakawa, Y. and Mayumi, M. (1990) Detection of hepatitis C virus RNA by a two stage polymerase chain reaction with two pairs of primers deduced from the 5’ noncoding regions. Japan. J. Exp. Med. 60,215-222. Rakela, J. and Redekar, A.J. (1979) Chronic liver disease after acute non-A, non-B viral hepatitis. Gastroenterology 77, 1200-1202. Realdi, G., Alberta, A., Rugge, M,, Riobi, A.M., Tremoiade, F. and Schirazappa, L. (1990. Long-term follow-up of acute and chronic non-A, non-B post-transfusion hepatitis: evidence of progression to liver cirrhosis. Gut 23, 270-275. Resnick, R.H., Stone, K. and Antonioli, D. (1983) Primary hepatocellular carcinoma following non-A, non-B hepatitis. Dig. Dis. Sci. 28, 908-911. Rychlik, W., Spencer, W.J. and Rhoads, R.E. (1990) Optimization of the annealing temperature for DNA amplification in vitro. Nucleic Acids Res. 18, 6409-6412. Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning. A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Shim&, Y.K., Weiner, A.J., Rosenblatt, J., Wong, D.C., Shapiro, M., Popken, T., Houghton, M., Alter, H.J. and Purcell, R.H. (1990) Early events in hepatitis C virus infection of chimpanzee. Proc. Natl. Acad. Sci. USA 87,6441-6444. Takamizawa, A., Mori, C., Manabe, I., Murakami, S., Fujita, J., Onishi, E., Andoh, T., Yoshida, 1. and Okayama, H. (1991) Structure and organization of hepatitis C virus genome isolated from human carriers. J. Viral. 65, 1105-1113. Tbaler, M.M., Park, C.-K., Landers, D.V., Wara, D.W., Houghton, M., Veerman-Wanters, G., Sweet, R.L. and Han, J.H. (1991) Vertical transmission of hepatitis C virus. Lancet 338, 17-18. Weiner, A.J., Kuo, G., Bradley, D.W., Bonino, F., Saracco, G., Lee, C., Rosenbelt, J., Choo, Q.-L. and Houghton, M. (1990) Detection of hepatitis C viral sequences in non-A, non-B hepatitis. Lancet 335, l-3.