Domains of Pit-1 required for transcriptional synergy with GATA-2 on the TSHβ gene

Molecular and Cellular Endocrinology 196 (2002) 53
/66 www.elsevier.com/locate/mce

Domains of Pit-1 required for transcriptional synergy with GATA-2 on the TSHb gene David F. Gordon *, Whitney W. Woodmansee, Jennifer N. Black, Janet M. Dowding, Jamie Bendrick-Peart, William M. Wood, E. Chester Ridgway Division of Endocrinology, Department of Medicine, University of Colorado Health Sciences Center, Box B151, 4200 E. Ninth Avenue, Denver, CO 80262, USA Received 29 May 2002; accepted 10 July 2002

Abstract Previous studies showed that Pit-1 functionally cooperates with GATA-2 to stimulate transcription of the TSHb gene. Pit-1 and GATA-2 are uniquely coexpressed in pituitary thyrotropes and activate transcription by binding to a composite promoter element. To define the domains of Pit-1 important for functional cooperativity with GATA-2, we cotransfected a set of Pit-1 deletions with an mTSHb-luciferase reporter. Plasmids were titrated to express equivalent amounts of protein. A mutant containing a deletion of the hinge region between the POU and homeodomains retained the ability to fully synergize with GATA-2. In contrast, mutants containing deletions of amino acids 2
/80 or 72
/125 demonstrated 56 or 34% of the synergy found with the full-length protein, suggesting that these regions contributed to cooperativity. Mutants with deletions of the POU-specific or homeodomain further reduced the effect signifying the requirement for DNA binding. GST interaction studies demonstrated that only the homeodomain of Pit-1 interacted with GATA-2. Finally, several mutations between the Pit-1 and GATA-2 sites on the TSHb promoter reduced binding for each factor and greatly reduced ternary complex formation. Thus multiple domains of Pit-1 are required for full synergy with GATA-2 and sequences between the two binding sites contribute to co-occupancy with both factors on the proximal TSHb promoter. # 2002 Elsevier Science Ireland Ltd. All rights reserved. Keywords: Transcription; Synergy; TSHb; Ternary complex; Protein
/protein interaction

1. Introduction Transcriptional activation of cell-specific genes often involves the functional cooperativity of combinations of factors that bind to adjacent or overlapping composite cis -acting DNA elements. In pituitary thyrotropes, two transcription factors, Pit-1 and GATA-2 are important for mediating thyrotrope-specific expression of the TSHb gene (Gordon et al., 1997). While the Pit-1 is expressed in three of the six terminally differentiated cells within the pituitary; somatotropes, lactotropes, and thyrotropes (Li et al., 1990); expression of GATA-2 is restricted to gonadotropes and thyrotropes (Dasen et al., 1999). Thus, in the anterior pituitary, this unique combination of Pit-1 and GATA-2 only exists in

* Corresponding author. Tel.: /1-303-315-6675; fax: /1-303-3154525 E-mail address: [email protected] (D.F. Gordon).

thyrotropes where they play critical roles in cell-type specification and maintenance of this unique cell type (Dasen et al., 1999). We have previously shown that these two factors can bind to adjacent and overlapping sequences located within a composite cis -acting region on the proximal TSHb promoter (Gordon et al., 1997; Haugen et al., 1996). We showed that this region binds nuclear proteins from thyrotrope cells as determined by DNase I protection analysis. Furthermore, we demonstrated that this protection is due to the simultaneous binding of both Pit-1 and GATA-2 by gel mobility shift assays. In cotransfection experiments into nonpituitary cells lacking either factor, both are necessary but neither is sufficient to activate high levels of TSHb promoter activity. Mutations within the mouse TSHb gene that abolish the binding of either Pit-1 or GATA-2 result in low promoter activity in transfected TtT-97 thyrotropes that are indistinguishable from that seen with an empty expression vector. Additionally, we and others have

0303-7207/02/$ - see front matter # 2002 Elsevier Science Ireland Ltd. All rights reserved. PII: S 0 3 0 3 - 7 2 0 7 ( 0 2 ) 0 0 2 2 3 - X

54

D.F. Gordon et al. / Molecular and Cellular Endocrinology 196 (2002) 53
/66

used GST-fusion interaction studies to show that the two factors can physically interact (Dasen et al., 1999; Gordon et al., 1997). The GATA family of transcription factors are expressed in a variety of cell types. GATA-1 is found in erythroid cells, mast cells, and megakaryocytes. It binds to a consensus (A/T)GATA(A/G) sequence by virtue of two zinc fingers (Tsai et al., 1989) and plays a pivotal role in erythropoiesis (Orkin, 1995). GATA-2 was first identified in erythroid progenitors, endothelial and mast cells (Dorfman et al., 1992) but is now known to be expressed in a wide variety of tissues including heart, kidney, brain, pituitary, and placenta (Gordon et al., 1997; Ma et al., 1997; Nagai et al., 1994); GATA-3 is most abundantly expressed in T lymphocytes, endothelial cells, and in the developing nervous system (George et al., 1994; Ko et al., 1991; Ma et al., 1997); while GATA-4 is generally restricted to the heart and gonads (Laverriere et al., 1994; Narita et al., 1996). Two additional members of the family, GATA-5 and GATA-6 are expressed in several non-hematopoietic cell types and participate in regulating cardiac, lung, and genito-urinary tract development (Liang et al., 2001; Molkentin et al., 2000; Yang et al., 2002). Despite the conservation of zinc fingers among family members and the ability to bind to the canonical site, individual GATA factors have developed a more expansive range of recognition sites that allow them to discriminate among similar sequences as determined by random site selection studies (Ko and Engel, 1993). High affinity sites are often composed of double GATA motifs with the factor usually binding as a monomer. The Nterminal finger domain of GATA-1 is also important for protein
/protein interactions with accessory proteins, such as Friend of GATA (Tsang et al., 1997). Other proteins that interact and transcriptionally cooperate with the zinc fingers of GATA factors include Sp1, PU.1, and E-RC-1 (Blobel et al., 1995, 1998; Merika and Orkin, 1995). GATA factors independent of Pit-1 appear to play a role in expression of the a-glycoprotein hormone and SF1 genes in pituitary gonadotrope cells (Steger et al., 1994; Zhao et al., 2001). Pit-1 is a 291 amino acid transcription factor that contains both a POU-specific and POU-homeodomain that contribute to DNA binding. Pit-1 is critical for final specification of the somatotrope, lactotrope and thyrotrope lineages in the pituitary since naturally occurring mouse mutations result in a lack of these cells (Camper et al., 1990; Lin et al., 1994). Pit-1 has been shown to be a strong activator of the GH and PRL genes (Bodner et al., 1988; Ingraham et al., 1988), and a weak activator by itself of the TSHb gene (Gordon et al., 1997; Haugen et al., 1993). Although Pit-1 is necessary to regulate all these hormone genes, factors in addition to Pit-1, acting through composite elements, have been shown to play important roles in gene-specific transcription. Ets-1 and

Pit-1 have been shown to functionally synergize on the proximal rat PRL promoter as well as to mediate the Ras-induced response (Bradford et al., 1996; Howard and Maurer, 1995). Additional synergistic interactions involving Pit-1 with other transcription factors on the PRL, GH, and Pit-1 genes have been reported (Day et al., 1990; Simmons et al., 1990; Bach et al., 1995; Cohen et al., 2001). The ability of a cell-restricted factor like Pit-1 to functionally interact with a wide variety of different factors has led to the idea that it can recruit more ubiquitously expressed factors to a particular composite element and act as a cell-specific integrator (Bradford et al., 1996). Pit-1 contains a number of distinct domains, each of whose function or accessibility is dependent on a particular transcriptional partner as well as promoter context. No information currently exists on the domains of Pit-1 required for functional synergy with GATA-2 on the TSHb promoter. The present study utilizes a cotransfection reconstitution system and protein
/protein interaction assays to dissect the domains of Pit-1 that are required for transcriptional cooperativity on the mouse TSHb promoter and delineates the POU-homeodomain of Pit-1 as the site of physical interaction with GATA-2. We also describe important sequences in the proximal TSHb promoter that allow for co-occupancy of both factors. Furthermore, we show that multiple domains throughout the protein are required for full transcriptional synergy including those located both within and outside the region of protein
/protein interaction.

2. Materials and methods 2.1. Construction of HA-tagged Pit-1 deletions Several Pit-1 deletion constructs have previously been described (Theill et al., 1989) and were kindly provided by Drs. F. Schaufele and A. Gutierrez
/Hartmann. These were used as templates in a PCR reaction to allow fusion with a hemaglutinin (HA) epitope tag in the cytomegalovirus (CMV) expression vector pCGN-2 (Gordon et al., 1997). For constructs with internal Pit1 deletions of D72
/125, D72
/100, D101
/125, D124
/ 178, D178
/201, D200
/211, and D209
/252, templates were amplified with a sense strand amplimer GAGCGGCCGCAGTTGCCAACCTTTCACCTCG containing codons 2
/8 with a Not I site (underlined) and the antisense strand amplimer GAGCGGCCGCTTATCTGCACTCAAGATG containing codons 287
/ 291 with a stop codon and a Not I site. Constructs with C-terminal deletions of D255
/291 and D209
/291 were amplified from wild type (wt) rPit-1 using the same sense strand primer along with the antisense primer GAGCGGCCGCTTACTCGAGATTCAATTCTTC or GAGCGGCCGCTTACACTTTTTCATTGTA-

D.F. Gordon et al. / Molecular and Cellular Endocrinology 196 (2002) 53
/66

CAAAGCTCC, respectively. Constructs with N-terminal deletions of D2
/45, and D2
/80 were amplified from wt rPit-1 using GAGCGGCCGCTCCACAGCGACAGGACTTC or GAGCGGCCGCTTTCCAGACCACACCCTG, respectively along with the original antisense primer. PCR products of the expected sizes were electrophoresed through agarose gels, excised, purified by Qiaex II resin (Qiagen, Valencia, CA), digested with Not I and ligated to Not I linearized pCGN-2. The complete nucleotide sequences for all inserts were verified by DNA sequencing using the chain termination method (Sanger et al., 1977). 2.2. Transfection into CV-1 cells Construction of the /392 to /40 mTSHb firefly luciferase vector has been described previously (Wood et al., 1989). For cotransfection experiments a 2.4-kb endfilled Eco RI fragment containing the hGATA-2 coding region was cloned downstream of the immediate/early CMV enhancer/promoter at a unique Not I site within pCGN-2. CV-1 cells were transiently transfected using a previously described calcium phosphate method (Chen and Okayama, 1987) as described (Gordon et al., 1997). The cells were cotransfected with 10 mg of a /392//40 mTSHb firefly luciferase construct alone or in combination with 4 mg of pCGN-2
/hGATA-2 and/or varying amounts of pCGN-2
/rPit-1 (up to 2 mg). Analysis of dose response curves by Western blot analysis were performed to determine the amount of Pit 1 plasmid used for functional promoter assays to ensure that similar amounts of protein were expressed. The total amount of plasmid used in a transfection assay was adjusted to a total of 16 mg with empty pCGN2. Each transfection also contained 25 ng Renilla luciferase plasmid (Promega, Madison, WI) as an internal transfection control. A Rous sarcoma virus promoter luciferase plasmid and an empty pA3 luciferase plasmid were transfected in parallel as positive and negative controls, respectively. Cells were harvested after 48 h of incubation at 37 8C, subjected to freeze thaw extraction and assayed for dual firefly and renilla luciferase activity. Luciferase activity was measured in a Monolight 3010 luminometer using a Dual Luciferase† Reporter Assay System (Promega). Firefly luciferase light units were normalized to Renilla luciferase activity. Promoter activities are shown as the mean value9/S.E.M. Aliquots of the same cells used in transfection experiments were also used to determine expression levels of HA-tagged proteins by Western blot analysis. 2.3. Production of Pit-1 deletions in bacteria Pit-1 sequences in pCGN2 were excised with Not I and cloned into the linearized Not I site in a modified pGEX-2TK plasmid to produce in-frame fusions with

55

the 26-kDa fragment of glutathione S -transferase (GST). Fusions containing the isolated domains from 2
/80, 72
/125, and 199
/291 were amplified from rPit-1 using the appropriate primers with a Not-1 site. PCR products of the expected size were excised from agarose gels following electrophoresis, purified by Qiaex II resin (Qiagen), cleaved with Not I and ligated to the modified pGEX-2T plasmid in frame with GST. All inserts were verified by DNA sequence analysis. 2.4. GST interaction studies Bacterial extracts containing the recombinant fusion GST-Pit 1 or GST alone were prepared essentially as described previously with some modifications (Gordon et al., 1997). A freshly streaked colony was resuspended in 200 ml of sterile water and plated onto an LB plate containing 100 mg/ml ampicillin. The lawn of bacteria was scraped from the plate and used to seed a 200 ml LB-ampicillin culture that was grown to an optical density (600 nm) of 0.8, then induced with 1 mM of isopropyl-D-thiogalactopyranoside for 2 h. The bacterial cells were harvested, centrifuged for 10 min at 1000 /g, and the cell pellet resuspended in 20 ml of fusion protein buffer (150 mM NaCl, 16 mM NaH2PO4, 4 mM Na2HPO4, 1% Triton X-100, 2.5 mM DTT, 0.5 mM phenylmethylsulfonyl fluoride (PMSF), supplemented with a protease inhibitor cocktail) (Complete, Roche). Bacteria were lysed by sonication and supernatant obtained as previously described (Smith and Johnson, 1988). The supernatant (30 ml) containing GST-Pit-1 fusions or GST alone was mixed with 0.5 ml of a 50% slurry of glutathione Sepharose 4B (Pharmacia LKB) for 1 h at 4 8C followed by washing three times with 30 ml fusion protein buffer. An aliquot of the bound protein was boiled for 3 min and the concentration was determined by the method of Lowry (Lowry et al., 1951) using a Bio-Rad DC kit and by comparison of samples with known amounts (2
/6 mg) of bovine serum albumin on a protein gel and stained with Coomassie Blue. Coding sequences for hGATA-2 were cloned in pSG5 and proteins synthesized and labeled with 35S-methionine (NEN) using a reticulocyte lysate coupled transcription
/translation system (TNT, Promega Biotec). The GST
/Pit-1 or GST immobilized beads (25% slurry) were mixed with 5 ml 35S-labeled hGATA2 in a total volume of 500 ml binding buffer (40 mM HEPES, pH 7.5, 100 mM NaCl, 0.5 mM EDTA, 5 mM MgCl2, 1 mM DTT, 0.05% Nonidet P-40, 100 mg/ml ethidium bromide, 1 mM ZnCl2, 0.5 mM PMSF supplemented with protease inhibitors. The suspension was mixed on a rotator at room temperature for one hour and beads were allowed to settle by gravity for 10 min and washed as described (Smith and Johnson, 1988). The beads were resuspended in 100 ml of 2 / treatment buffer (0.125 M

56

D.F. Gordon et al. / Molecular and Cellular Endocrinology 196 (2002) 53
/66

Tris
/Cl pH 6.8, 4% SDS, 20% glycerol, 10% 2-mercaptoethanol), boiled for 90 s, separated by SDS polyacrylamide gel electrophoresis, and subjected to autoradiography for 16
/24 h.

3. Results 3.1. The combination of Pit-1 and GATA-2 transcriptionally activates the proximal mouse TSHb promoter

2.5. Western blots CV-1 cells transiently transfected with HA-epitope tagged rPit-1 and/or hGATA-2 were harvested with phosphate-buffered saline (150 mM NaCl, 16 mM NaH2PO4, 4 mM Na2HPO4) containing 3 mM EDTA, pelleted, and resuspended in 100 ml 50 mM Tris
/HCl, pH 8, 0.5% SDS, 2 mM EDTA, 2 mM sodium orthovanadate, 1 mM PMSF, 1 mM dithiothreitol, and protease inhibitors. Lysed extracts were passed 7 / through a 25 gauge needle to shear genomic DNA. Protein concentration was determined as described above. Equal amounts (50 mg) of protein were separated on a 10% polyacrylamide
/SDS gel, and transferred to an Immobilon-P (PVDF) membrane (Millipore, Bedford, MA) by electroblotting overnight at 100 mA. Non-specific binding was blocked with 7.5% nonfat milk in TBST (20 mM Tris
/Cl, pH 7.5, 137 mM NaCl, 0.2% Tween 20) for 1 h. Filters were incubated for 1 h at room temperature with a mouse monoclonal anti(HA)
/peroxidase antibody (Roche, 0.1 mg/ml) at a dilution of 1:1000 in TBST supplemented with 1% milk. After three 10 min washes with TBST, HA tagged proteins were detected using an ECL chemiluminescent kit (Amersham Life Science, Arlington Heights, IL). 2.6. Gel mobility shifts COS-1 cells (750 000) were transiently transfected with full length hGATA-2 in the vector pSG5, containing an SV40 promoter using the calcium-phosphate precipitation method and whole cell extracts prepared as described (Gordon et al., 1997). Purified peptides containing the dual zinc fingers of human GATA-2 encoding amino acids 290
/409 were a generous gift of Dr J. Omichinski, University of Georgia. Double stranded oligonucleotide probes containing mTSHb sequences are described in the text and were annealed and radiolabeled by filling-in recessed 3? termini with [a32P]-dCTP using reverse transcriptase (Promega-Biotech). Protein extracts were preincubated for 15 min on ice with 1000 ng poly dI:dC in a buffer containing 25 mM Tris
/Cl, pH 7.9, 5 mM MgCl2, 50 mM KCl, 1 mM EDTA, 1 mM DTT, 4 mM spermidine
/HCl, 1 mM ZnCl2, 1 mg bovine serum albumin, and 8% ficoll (W:V). After the addition of 20 000 cpm of the [32P]-probe (specific activity 2
/3/108 cpm/mg), the mixture was incubated for 20 min at 15 8C and electrophoresed on a 4% nondenaturing acrylamide gel. Gels were vacuum dried and exposed to Kodak MR film for autoradiography for 16
/48 h.

Cell-specific transcription of highly differentiated genes in the anterior pituitary requires the precise binding and interplay of sets of tissue-restricted transcription factors to cis -acting promoter elements. We have previously shown that Pit-1 and GATA-2 transcriptionally synergize on the proximal mouse TSHb promoter (Gordon et al., 1997). When either factor alone is introduced as a CMV expression vector into non-TSHb expressing CV-1 cells lacking each factor, along with a /392//40 TSHb luciferase reporter, little additional promoter activity is found compared with the activity exhibited by an equivalent amount of empty pCGN-2 (Fig. 1A). We performed a dose response curve of Pit-1 with a constant amount (4 mg) of GATA-2 shown to produce a maximal response. We found that 0.25 mg of Pit-1 displayed little cooperative effect while doses from 0.5 to 2 mg stimulated promoter activity in a dose dependent manner to a maximum of 10
/12-fold (Fig. 1A). There was also a corresponding dose-dependent increase in the amount of HA tagged Pit-1 protein expressed (Fig. 1B) while no signal was present when cells were transfected with pCGN-2 (lanes 1 and 2). The amount of HA
/Pit-1 detected in cells transfected with 1 mg of the Pit-1 expression vector was equivalent in the absence (Fig. 1B, lanes 3 and 4) or presence of cotransfected GATA-2 (lanes 7 and 8). Thus the presence of GATA-2 did not alter the steady state levels of Pit-1 in transfected CV-1 cells. Even though we can detect the appearance of the Pit-1 fusion protein with 0.25 mg of Pit-1 plasmid, there appears to be a threshold amount of protein necessary to elicit synergy with GATA-2. Thus, there probably needs to be a certain percent of the TSHb promoter co-occupied by GATA-2/ Pit-1 in a ternary complex in order to recruit a sufficient level of coactivators. 3.2. A promoter mutation that affects simultaneous Pit-1 and GATA-2 occupancy By both gel mobility shift assays and DNase I protection studies, we have previously shown that a region of the proximal mouse TSHb promoter, termed P1 can bind nuclear proteins contained in TtT-97 thyrotropic tumors that we subsequently identified as Pit-1 and GATA-2 (Gordon et al., 1997; Haugen et al., 1996). A schematic diagram of the P1 region from position /140 to /80 relative to the transcription initiation site is shown in Fig. 2A. Within this region are two sequences that resemble consensus binding sites A A /T /TTATNCAT (Ingraham et al., 1988) for Pit-1

D.F. Gordon et al. / Molecular and Cellular Endocrinology 196 (2002) 53
/66

57

Fig. 1. Pit-1 and GATA-2 synergize to stimulate mTSHb promoter activity in CV-1 cells. Panel A: Dose response of Pit-1. CV-1 cells were transiently transfected with 10 mg of mTSHb promoter (/392 to /40) fused to firefly luciferase, 4 mg pCGN2
/GATA-2, 25 ng pCMV
/Renilla luciferase, and the indicated amount of pCGN2
/Pit-1. Each set of transfections were performed 4
/5 times and are expressed as the fold stimulation relative to the pCGN2 empty vector control9/S.E.M. Panel B: Protein levels of Pit-1. Aliquots of the total cell lysates were electrophoresed through 10% polyacrylamide
/SDS gels, transferred to PVDF membranes, and HA tagged Pit-1 (35 kDa) was immunoblotted with a mouse monoclonal anti HA antibody and assayed by a chemiluminescent assay.

(boxed */Fig. 2A), AAATTCAT (/122 to /115 antisense strand) and AAAAGCAT (/107 to /100 antisense strand). In addition, there are two sequences that resemble consensus GATA-2 binding sites (underlined in Fig. 2A) (Ko and Engel, 1993), AGATGC (/109 to /104 sense strand) and AGATAA (/98 to /93 sense strand). We previously showed that three mutations (Mut 3, Mut 5, and Mut 7, Fig. 2A) which disrupted the upstream Pit-1 site, the overlapping Pit-1 and GATA-2 sites, or the downstream GATA-2 site respectively, resulted in dramatically lowered promoter activity in the context of a /392//40 mTSHb luciferase reporter transiently transfected into primary TtT-97 thyrotrope cells (Haugen et al., 1996). By DNase protection analysis, we found that Mut 3 resulted in abrogation of Pit-1 binding, Mut 7 in loss of GATA-2 binding, and Mut 5 in loss of both detectable Pit-1 and GATA-2 binding. We verified these findings by using gel mobility

shift studies with DNA duplexes containing Mut 3 and Mut 7 and showed in these more sensitive assays that these mutations failed to bind detectable levels of either Pit-1 or GATA-2 and each eliminated a ternary complex formed by the combination of both factors (Gordon et al., 1997). Thus the middle overlapping Pit-1 and GATA-2 sites cannot by themselves bind either transcription factor in the absence of the outer Pit-1 and GATA-2 sites. In order to test binding and ternary complex formation in the P1 region, we performed additional gel mobility shift studies with the wild type fragment and a fragment containing the Mut 5 mutation. As we showed previously, the wild type P1 fragment from /134 to /84 formed single complexes with Pit-1 (Fig. 2B) and GATA-2. We could also demonstrate the latter complex with a peptide containing both zinc fingers of GATA-2 (lane 2) as well as with the full length protein (lane 7). When both factors were

58

D.F. Gordon et al. / Molecular and Cellular Endocrinology 196 (2002) 53
/66

Fig. 2. Simultaneous binding by Pit-1 and GATA-2 on the mTSHb promoter maps to a composite element in the proximal promoter. Panel A: Nucleotide sequence of the sense strand of the proximal (P1) region of the mTSHb 5? flanking region from /140 to /80 that binds Pit-1 and GATA2. Two sequences resembling consensus Pit-1 sites are boxed and two sequences resembling GATA binding sites are underlined. Shown below are three promoter mutants, Mut 3, Mut 7, and Mut 5 within the context of the P1 region that have been previously shown to abrogate Pit-1 and GATA2 transcriptional synergy (Haugen et al., 1996) in transfected primary TtT-97 thyrotropic tumor cells. Panel B: Gel mobility shifts using a duplex wild type (wt) /134 to /84 radiolabeled mTSHb probe in the absence and presence of GATA-2, Pit-1 or a combination of both factors as indicated. Free probe migrates at the bottom of the gel. On the left half of the figure assays were performed with a GATA-2 DNA binding peptide encoding amino acids 290
/409 (dual zinc fingers) and Pit-1, alone or in combination (lanes 1
/4). Identical assays were performed with full length hGATA-2 expressed in COS cells (lanes 5
/8). On the right is shown the gel shift pattern using the Mut 5 probe (lanes 9
/12). Probes were radiolabeled to the same specific activity and equal amounts of protein were utilized.

combined we also detected an additional slower migrating complex consistent with a ternary complex suggesting co-occupancy of the TSHb probe with both Pit-1 and GATA-2 (Fig. 2B). This slower migrating complex was formed with both the dual zinc finger peptide (lane 4) and with the full length GATA-2 (lane 8), a finding consistent for the presence of both proteins in the complex. In addition, there was a substantial fraction of the probe complexed with singly occupied GATA-2 or Pit-1 perhaps due to limiting amounts of one or the other protein. Interestingly, although we did not detect Pit-1 or GATA-2 binding to the mutated promoter

fragments in earlier DNase footprint studies, we did find that the Mut 5 probe caused a substantial reduction in the amounts of Pit-1 and GATA-2 that could form single complexes even though the outer Pit-1 and GATA-2 binding sites were intact. However, when the two factors were combined with the Mut 5 probe the ternary complex was greatly reduced even with longer exposures (Fig. 2B). To explore this binding site arrangement in more detail, two additional mutations were tested to determine the effect of spacing and/or sequence between the upstream Pit-1 site and downstream GATA-2 site. First,

D.F. Gordon et al. / Molecular and Cellular Endocrinology 196 (2002) 53
/66

we removed the 5 bp which contained the transversion mutations in Mut 5, termed Mut A. Second, we removed the 5 bp just downstream of those changed by Mut 5, termed Mut B. Both deletions bring the outer Pit-1 and GATA-2 sites 5 bp closer together, or 12 of a DNA helix turn. A comparison of the wt, Mut A, and Mut B sequences is shown in Fig. 3A. Mut A completely removed both overlapping Pit-1/GATA-2 sites while Mut B retained the GATA site but changed the Pit-1 like sequence from AAAGCAT to TCTGCAT. These were performed to distinguish whether the sequence of the overlapping Pit-1/GATA-2 site was important or

59

whether spacing alone played a role in binding of either factor and in ternary complex formation. Results of gel mobility shifts using these duplex probes are shown in Fig. 3B. Similar to the results with Mut 5 (Fig. 2B), removal of sequences from /110 to /106 within Mut A resulted in dramatically lowered binding of Pit-1 alone (lane 6), GATA-2 alone (lane 7), and marked reduction of the ternary complex (lane 8). This shows the importance of this sequence in that both a transversion mutation or its complete removal affected the ability of both factors to simultaneous load onto the TSHb promoter and diminished the affinity for each protein

Fig. 3. Effect of 5 bp mutations within the overlapping Pit-1/GATA-2 site of the mTSHb proximal promoter on Pit-1 and GATA-2 binding. Panel A: Shown on the top is the sense strand of the mTSHb promoter as depicted in Fig. 2A. Two 5 bp mutations, termed Mut A and Mut B are shown below in context of the /140//80 sequence. Dashed lines represent the nucleotides removed from each mutation. Panel B: Gel mobility shifts were performed with the /134//84 duplex wild type mTSHb probe (lanes 1
/4), the Mut A probe (lanes 5
/8), and the Mut B probe (lanes 9
/12). Probes were incubated in the absence of protein (none) or with full length GATA-2, Pit-1, or a combination (combo) as indicated.

60

D.F. Gordon et al. / Molecular and Cellular Endocrinology 196 (2002) 53
/66

to bind to the remaining Pit-1 and GATA-2 sites, respectively. Thus the sequence from /110 to /106 contributed to high affinity binding of either factor and to ternary complex formation, suggesting a complex bipartite and overlapping site. In contrast, the removal of sequences from /103 to /99 (Mut B) resulted in a similar gel shift profile as the wild type probe. These findings demonstrate the importance of the sequence from /110 to /106 rather than spacing being responsible for high affinity binding and ternary complex formation. 3.3. DNA-independent physical interaction of Pit-1 with GATA-2 We have previously shown that full length Pit-1 protein, expressed as a GST fusion, will physically interact with radiolabeled GATA-2 synthesized in vitro using a GST pulldown assay (Gordon et al., 1997). The interaction occurred in dilute solution in the absence of any contaminating DNA since it was detected in the presence of 100 mg/ml ethidium bromide, which has been shown to eliminate nonspecific DNA-dependent tethering effects (Lai and Herr, 1992). To map the domains of Pit-1 that participate in the interaction with GATA-2 we produced N-terminal, C-terminal, and internal deletions as GST fusions. Additionally we produced several isolated domains of Pit-1 as fusions with GST and purified each chimeric protein on glutathione
/agarose beads prior to initiating binding studies with 35S-labeled GATA-2 produced in a coupled transcription
/translation reaction using rabbit reticulocyte lysates as described in Section 2. A schematic representation of the deletions that were utilized for these studies is shown in Fig. 4. Aliquots of each purified GST fusion were size separated by SDS polyacrylamide gel electrophoresis and stained with coomassie blue in parallel with 2
/6 mg of bovine serum albumin which served as mass standards (Fig. 5A and B). All the truncations and internal deletions resulted in single bands of the appropriate size consistent with their predicted molecular masses. The isolated domains also produced the appropriately sized proteins, although the GST fusion of the amino terminus containing amino acids 2
/82 exhibited a considerable amount of smaller products. This may be due to premature termination by the use of mammalian codons in bacteria or to posttranslational degradation. We then used equivalent amounts of each fusion for the interacting studies. As shown in Fig. 5C, 35S-GATA-2 binds specifically to immobilized intact wt Pit-1 but not to GST alone. Comparison of bound 35S-GATA-2 with 20% of the input levels of the radiolabeled protein indicates a significant portion (28%) is bound under these dilute solution conditions. Removal of amino acids 2
/45, 2
/80, 72
/125, 101
/125, 178
/201, 200
/ 211, 209
/252, or 252
/292 still showed substantial

protein
/protein interactions with 35S-GATA-2. The levels of the 178
/201 deletion were comparable to the other deletions in other experiments (not shown). However, when the entire homeodomain from 209
/ 291 was deleted, the interaction between the two proteins was abrogated indicating that this domain was responsible for the interaction. We verified this by expressing GST fusions of individual domains consisting of amino acids 2
/82, 72
/125, and 199
/291. In agreement with the above deletion studies and with another study (Dasen et al., 1999), we determined that only the homeodomain containing fragment (aa 199
/291) interacted with radiolabeled GATA-2. Thus one of the two domains involved in DNA binding to consensus Pit-1 sites also plays a role in physical interaction with GATA-2. 3.4. Domains of Pit-1 involved with functional cooperativity with GATA-2 Each of the amino-terminal, carboxy-terminal, and internal deletions were constructed in the vector pCGN2 (Gordon et al., 1997). This resulted in the production of a fusion of Pit-1 in frame with a HA tag and allowed the monitoring of the protein levels of the Pit-1 mutants in parallel with HA
/GATA-2, from aliquots of the same cell lysates used to detect luciferase reporter gene activity. We first transfected CV-1 cells with the wild type Pit-1 construct in parallel with 10 mg of a /392// 40 mTSHb luciferase reporter and a CMV
/Renilla luciferase vector used to normalize for transfection efficiency in each experimental plate. As is shown in Fig. 6A, transfection of wild type Pit-1 in the absence of GATA-2 resulted in low TSHb promoter activity (:/ 1.6-fold) when compared to the activity found with the empty pCGN-2 vector control. In addition, none of the 11 Pit-1 mutations were higher than the activity found with full length Pit-1. Next we repeated these transfection experiments utilizing each Pit-1 mutation in the presence of cotransfected GATA-2 in order to determine which domains contributed to functional cooperativity. The results are shown in Fig. 6B. We expressed the promoter activity of each Pit-1 mutant relative to wild type Pit-1 as 100% for individual transfections. We also show a synergy index which was calculated by taking the activity of the combination of each Pit-1 mutant with GATA-2 divided by the sum of the activity of Pit-1 and GATA-2 alone. A deletion of amino acids 200
/211 which removed the hinge region located between the POU-specific domain and the homeodomain resulted in TSHb promoter activity that was indistinguishable from the wild type Pit-1 construct. Mutations with progressive deletions of the amino terminal 45 or 80 amino acids exhibited much lower promoter activity of 58 and 56% of the wild type levels, respectively. A mutation containing a deletion of the region amino terminal of the

D.F. Gordon et al. / Molecular and Cellular Endocrinology 196 (2002) 53
/66

61

Fig. 4. Schematic diagram of the structure of wild type Pit-1 and a series of N-terminal, C-terminal, and internal deletions. The POU-specific domain (amino acids 132
/198) and the POU-homeodomain (amino acids 214
/273) involved in high affinity DNA binding (overlined) are shown in different shaded boxes within the C-terminal half of the protein. Broken lines in the deletion mutants indicate the regions that were deleted. Shown on the bottom three lines are depictions of peptides encoding isolated domains of Pit-1 that were used in subsequent protein-protein interaction studies. GST represents an amino terminal fusion of each Pit-1 construct with the 26 kDa GST protein.

POU-specific domain (amino acids 72
/125) in the presence of an intact amino terminus and DNA binding domain (Fig. 4) was slightly more deleterious exhibiting a level of 34% of wild type activity. We also found that mutations containing a deletion of each half of this region with removal of amino acids 72
/100 and 101
/ 125 also had lower activity of 38 and 43%, respectively showing that each half contributes to synergy with GATA-2. The most detrimental mutations involved removal of key regions in both the POU and homeodomains. Removal of two separate regions of the POU-specific domain containing amino acids 124
/178 or 178
/201 both resulted in diminished activity of only 20
/28% of the wild type Pit-1. Finally, deletions of either the amino terminal or carboxy-terminal portion of the homeodomain reduced activity to less than 13
/ 15% of wild type. Finally, we demonstrate in Fig. 6C that the levels of each Pit-1 mutation were expressed at equivalent amounts when compared to each other and to the levels of the GATA-2 synergistic partner. We can therefore conclude that multiple domains of Pit-1, including the amino terminus, the region upstream of the POU domain, as well as both the POU and homeodomains are required for full promoter activity when Pit-1 synergizes with GATA-2. This suggests that the final ordered structure of Pit-1 when co-occupying its composite element with GATA-2 on the TSHb promoter may involve contributions of multiple do-

mains throughout the protein. Thus, physical interaction alone between the two factors is not responsible for full transcriptional synergy.

4. Discussion Combinatorial interactions of transcription factors with cis -acting DNA elements, underly the precise cellspecific expression of genes encoding the peptide hormones produced in the pituitary gland. The thyrotrope cell is the sole source for expression of the TSHb subunit within the body, while the a-subunit is co-expressed in thyrotropes and gonadotropes. During pituitary development, the reciprocal interactions of Pit-1 and GATA2 have been shown to mediate the effects of transient signaling gradients in determining pituitary cell types (Dasen et al., 1999). The current studies confirm our previous findings that Pit-1 and GATA-2 can interact synergistically on TSHb transcription resulting in a 10
/ 12-fold amplification of promoter activity in nonpituitary cells lacking either factor. The current report also shows that the Pit-1 effect is dose-dependent as careful titration studies demonstrate that an increasing transcriptional effect results from increasing Pit-1 protein. We also show that GATA-2 physically interacts with the homeodomain of Pit-1 and that multiple other domains throughout the protein, in addition to the protein
/

62

D.F. Gordon et al. / Molecular and Cellular Endocrinology 196 (2002) 53
/66

Fig. 5. Mapping of domains of Pit-1 that physically interact with GATA-2. Panels A and B: Wild type Pit-1 or a set of N-terminal, Cterminal, or internal deletions (Fig. 4) were produced in E. coli as fusions with the 26 kDa fragment of GST. Following sonication of bacteria, aliquots of the GST fusions within the supernatant were purified on GST beads, electrophoresed on 10% polyacrylamide
/SDS gels, and stained with coomassie blue. On the left are the positions of molecular size standards shown in kDa. In parallel lanes are indicated the amounts (2
/6 mg) of purified bovine serum albumin (BSA) to allow estimation of the amount of each GST fusion. Panel C: In vitro binding reactions. Binding assays were performed in dilute solution using 2 mg of each GST fusion on 20 ml beads incubated with equal amounts of in vitro translated 35S-labeled GATA-2. The first lane in each set shows the autoradiographic signal from 20% of the input of GATA-2 added to each binding reaction.

protein interaction domain, within the amino two thirds of the protein are required for high levels of functional synergy. Finally, we demonstrated the critical importance of the sequence of the cis -acting element at which Pit-1 and GATA-2 simultaneously occupy the proximal promoter. These studies show that it is the sequence of the 16 bp intervening sequence that is critical and not the actual spacing between the flanking Pit-1 and GATA-2 sites. Thus, the central overlapping Pit-1/ GATA-2 sequence plays an important role in contributing to the structural and functional integrity of Pit-1 and GATA-2 interactions on the TSHb promoter. The composite DNA element within the TSHb promoter, which binds Pit-1 and GATA2, appears to be a minimum of 30 bp. The element has a 5? Pit-1 site and a 3? GATA-2 site (Fig. 2A). In between these two sites are 16 bp which include overlapping additional putative Pit-1 and GATA-2 sites. Our previous studies have shown that mutation of either the outer Pit-1 or GATA-2 sites (Fig. 2A) completely abolishes protein binding and transactivation (Gordon et al., 1997). However, the central overlapping Pit-1/GATA-2 site is also important because mutation within this region also eliminates activity (Haugen et al., 1996). This central mutation (Mut 5) decreases the affinity of both Pit-1 and GATA-2 for the flanking sites, but most importantly, it dramatically reduces the ternary complex formed where both factors co-occupy the DNA element (Fig. 2B). It is possible that the binding of one factor may enhance the binding of its partner protein as has been shown for Pax5 recruiting Ets-1 (Fitzsimmons et al., 2001) to the mb-1 promoter or with Phox and SRF (Grueneberg et al., 1992). Since Pit-1 and GATA-2 bind the promoter in very close proximity to each other, and that their DNA binding domains interact, the binding of one factor may alter the affinity of its partner for the TSHb proximal promoter. When Pit-1 or GATA-2 binding were each reduced with a mutation involving the overlapping site (Mut 5 or Mut A) there may have been insufficient bound factor to recruit adequate levels of the partner resulting in the observed reduction of the ternary complex (Figs. 2B, 3B). Determination of equilibrium dissociation constants (Kd) for Pit-1 in the presence or absence of GATA-2 will be required to test and quantify this hypothesis. Mechanistically, the binding of Pit-1 may provide stabilizing effects through direct contacts with GATA-2, it may induce stabilizing contacts for it with DNA, or it may alter the conformation of the DNA. It is currently unknown whether other thyrotrope-specific genes are regulated by such a unique composite element. We also carefully analyzed which portions of the Pit-1 protein were important for physical interaction with GATA-2. Only the deletion of the entire POU-homeodomain abrogated the interaction while it was retained with just the isolated homeodomain. Interestingly, when

D.F. Gordon et al. / Molecular and Cellular Endocrinology 196 (2002) 53
/66

63

Fig. 6. Mapping the domains of Pit-1 involved in functional transcriptional synergy with GATA-2 on the mTSHb promoter. Panel A: CV-1 cells were transiently transfected with 10 mg of mTSHb promoter (/392 to /40) luciferase, 1 mg of wild type (WT) or the indicated Pit-1 deletion plasmid. Each reaction also contained 25 ng pCMV
/Renilla luciferase used as an internal transfection control. Each set of transfections were performed 7 times and are expressed as the fold stimulation relative to the promoter activity exhibited by the pCGN2 empty vector control9/S.E.M. Panel B: The same series of Pit-1 deletions utilized above were tested in the presence of 4 mg pCGN2
/GATA-2. Each set of transfections was performed 7 times. Relative promoter activity is normalized to the promoter activity obtained with wild type Pit-1 and GATA-2, which is 10
/12 times the level of the promoterless control. Error bars are 9/S.E.M. On the right is shown the synergy index which is the activity from the combination of each Pit-1 deletion in the presence of GATA-2 divided by the sum of each factor alone. Panel C: Aliquots of whole cell extracts following a representative transfection experiment utilizing HA-tagged GATA-2 along with HA-tagged wild type Pit-1 or the indicated Pit-1 deletions used in Panel B were electrophoresed on 10% polyacrylamide
/SDS gels, transferred to PVDF membranes and immunoblotted with a mouse monoclonal anti-HA antibody, followed by incubation with a horseradish peroxidase conjugated secondary antibody and a chemiluminescent assay.

we removed either the N- or C-terminal halves of the homeodomain, interaction was retained. This suggests

that a rather broad series of residues, perhaps involving more than one of the three a-helical structures within

64

D.F. Gordon et al. / Molecular and Cellular Endocrinology 196 (2002) 53
/66

the homeodomain contribute to protein
/protein interactions with the N-terminal zinc finger and adjacent basic region of GATA-2. This appears likely since several widely dispersed amino acid substitutions in the homeodomain of Pit-1 reduced but did not eliminate GATA-2 interaction (Dasen et al., 1999). Thus, the homeodomain not only determines protein
/DNA interactions but also protein
/protein interactions between Pit-1 and GATA-2. The functional consequences of these deletions on synergy with GATA-2 was extremely complex. As expected, deletion of the homeodomain (aa 209
/291) disrupted all detectable DNA binding (Ingraham et al., 1988), ternary complex formation, physical interaction with GATA-2 (Fig. 5C), and had profound effects on functional cooperativity (Fig. 6B), reducing transcription to a level exhibited by the empty vector. However, functional synergy was also reduced to a lesser extent with deletions outside of the homeodomain including the POU-specific domain, the N-terminal 80 amino acids, and the region containing amino acids 72
/125. Our findings are similar to that found with two cardiac transcription factors, Nkx2.5 and GATA-4, which also pair a homeodomain protein with a GATA factor. These factors physically and functionally interact on the ANF promoter (Durocher et al., 1997). In this study, the homeodomain of Nkx2.5 interacted with the second zinc finger and C terminal extension of GATA-4. Additionally, functional synergy was reduced with removal of the homeodomain or deletion of either the C-terminal or Nterminal portions of Nkx2.5. Thus, the composite site of interaction between the homeodomain with a GATA factor accounts for just a portion of the functional synergy. It is likely that other domains of both proteins can form functional interactions with additional transcriptional coactivators. Supporting this is the observation that both Pit-1 and GATA factors can interact with CREB binding protein, CBP (Cohen et al., 1999; Blobel et al., 1998). It is also possible that regions outside the homeodomain of Pit-1 contribute to a conformational change in GATA-2 to more efficiently activate transcription or alternatively, that a novel hybrid domain formed by regions of both bound factors can recruit coactivators to the TSHb promoter. In other systems, the N-terminal domain of Pit-1 has also been shown to be functionally important. An early study showed that the amino terminal deletions 2
/45 or 48
/73 resulted in loss of activation on rat GH promoter activity, thus defining a trans -activation domain (Theill et al., 1989). Furthermore, these investigators showed that the region from 72
/125 could be removed without affecting GH promoter activation, in fact it resulted in 3 fold higher activation over that exhibited from wild type Pit-1 although protein levels were not determined for these constructs following transfection. These findings differ from the present study on the TSHb promoter as

we could not detect any trans -activation activity in the absence of the GATA-2 partner (Fig. 1A). Limited mapping studies have broadly determined some of the sites of functional synergy and physical interaction between Pit-1 and several of its partner transcription factors. For example, Bradford et al. recently showed that Ets-1 can functionally and physically interact with the homeodomain of Pit-1 (Bradford et al., 2000) while an additional interaction surface was mapped to the b-domain in an alternatively spliced Pit-1 isoform (Pit-1b), which failed to synergize with the partner protein (Diamond and Gutierrez-Hartmann, 1996). Oct-1 has also been shown to form interactions with Pit-1 at its homeodomain (Voss et al., 1991). This has subsequently been found to involve both DNAdependent and DNA-independent interactions (Lai and Herr, 1992). Interaction between p-Lim (lhx-3) and Pit-1 broadly mapped to both the POUS and POUH, since deletions of each one separately abrogated binding (Bach et al., 1995). The POUS and POUH also take part in interactions with the coactivator, CBP, on at least two separable regions of that large protein, and the corepressor NCoR could compete for this binding to Pit-1 (Xu et al., 1998). Several interactions have been mapped to the amino terminus of Pit-1. The panpituitary activator P-OTX (PitX1) was initially discovered in a two-hybrid screen with the amino terminus of Pit-1 that included amino acids 1
/128 as the bait. Subsequent studies showed that this protein failed to interact with the POUS domain of Pit-1 (Szeto et al., 1996) while the homeodomain was not tested. Synergy with Zn-15 mapped broadly to the amino terminal trans -activation domain of Pit-1 (Lipkin et al., 1993) while a smaller deletion, lacking amino acids 72
/100, eliminated synergism with the T3Rb (Chang et al., 1996) but did not reduce the transcriptional activation when compared to the wild type protein on the rGH promoter. In contrast, the site of Pit-1 synergy with the estrogen receptor on the PRL distal promoter mapped to amino acids 45
/72 and involved two key tyrosine residues (Holloway et al., 1995). Thus multiple regions of Pit-1 play a role in synergistic interactions with a variety of other partner proteins. In contrast to these other studies, its functional interaction with GATA-2 involves virtually the entire molecule suggesting that its final conformation on the TSHb promoter is key in forming an active transcriptional complex. Pit-1 has been shown to bind to a loose consensus sequence (A/A T /TTATNCAT) although there are variations with a variety of Pit-1 responsive elements on target genes. The flexibility of the linker region between these domains allowed different configurations of Pit-1 to form on different consensus sites. These differences led to distinct associations of different cofactors on the promoters containing these sites which could mediate activation or repression dependent on pituitary cell type.

D.F. Gordon et al. / Molecular and Cellular Endocrinology 196 (2002) 53
/66

Interestingly, the linker region between amino acids 200 and 211, separating the POUS from the POUH, was dispensable for synergy with GATA-2 (Fig. 6B) so perhaps the POUS and POUH contacts are closer together than those established for the PRL-1P and the GH-1 sites (Scully et al., 2000). The linker peptide of POU family members tethers the POUS and POUH subdomains so that they behave as a heterodimer (Herr and Cleary, 1995) with an increased affinity for DNA over the isolated subdomains alone. The linker region of Pit-1 allows a high degree of conformational flexibility to allow it to recognize different binding sites (Phillips and Luisi, 2000). The actual DNA contacts made by both the POUS and POUH of Pit-1 will await co-crystallization studies with the proximal TSHb site. In summary, it is likely that the DNA sequences within the P1 region of the TSHb gene behave as a docking platform which recruits multiple components of a fundamental regulatory assembly initiated by the binding of Pit-1 and GATA-2 to allow thyrotropespecific transcription. Future studies will be designed to further unravel the complex mysteries that determine TSHb gene activation, a cell-specific process that occurs only in 5
/10% of normal pituitary cells.

Acknowledgements We thank Drs Arthur Gutierrez
/Hartmann (University of Colorado Health Sciences Center) and Fred Schaufele (University of California at San Francisco) for providing the rat Pit-1 deletions, Dr Stuart Orkin (Harvard Medical School) for the human GATA-2 expression vector, and Dr James Omichinski (University of Georgia) for the purified GATA-2 dual zinc finger peptide. We also thank Suzy Lewis, Rhonda L. Mouser, and Amina Gordon for providing excellent technical support. These studies were funded by NIH grants NIH RO1-DK36843-14 and RO1-DK47407-06 to E.C.R. and NIH K08-DK02813-02 to WWW.

References Bach, I., Rhodes, S.J., Pearse, I.I., Heinzel, T., Gloss, B., Scully, K.M., Sawchenko, P.E., Rosenfeld, M.G., 1995. P-Lim, a LIM homeodomain factor, is expressed during pituitary organ and cell commitment and synergizes with Pit-1. Proc. Natl. Acad. Sci. USA 92, 2720
/2724. Blobel, G.A., Nakajima, T., Eckner, R., Montminy, M.R., Orkin, S.H., 1998. CREB-binding protein cooperates with transcription factor GATA-1 and is required for erythroid differentiation. Proc. Natl. Acad. Sci. USA 95, 2061
/2066. Blobel, G.A., Sieff, C.A., Orkin, S.H., 1995. Ligand dependent repression of the erythroid transcription factor GATA-1 by the estrogen receptor. Mol. Cell. Biol. 15, 3147
/3153.

65

Bodner, M., Castrillo, J., Theill, L.E., Deerinck, T., Ellisman, M., Karin, M., 1988. The pituitary-specific transcription factor GHF-1 is a homeobox-containing protein. Cell 55, 505
/518. Bradford, A.P., Brodsky, K.S., Diamond, S.E., Kuhn, L.C., Liu, Y., Gutierrez-Hartmann, A., 2000. The Pit-1 homeodomain and betadomain interact with Ets-1 and modulate synergistic activation of the rat prolactin promoter. J. Biol. Chem. 275, 3100
/3106. Bradford, A.P., Conrad, K.E., Tran, P.H., Ostrowski, M.C., Gutierrez, H., 1996. GHF-1/Pit-1 functions as a cell-specific integrator of ras signaling by targeting the ras pathway to a composite Ets-1/ GHF-1 response element. J. Biol. Chem. 271, 24639
/24648. Camper, S.A., Saunders, T.L., Katz, R.W., Reeves, R.H., 1990. The Pit-1 transcription factor gene is a candidate for the murine snell dwarf mutation. Genomics 8, 586
/590. Chang, W., Zhou, W., Theill, L.E., Baxter, J.D., Schaufele, F., 1996. An activation function in Pit-1 required selectively for synergistic transcription. J. Biol. Chem 271, 17733
/17738. Chen, C., Okayama, H., 1987. High efficiency transformation of mammalian cells by plasmid DNA. Mol. Cell. Biol. 7, 2745
/2752. Cohen, L.E., Hashimoto, K., Zanger, K., Wondisford, F., Radovick, S., 2001. CREB-independent regulation by CBP is a novel mechanism of human growth hormone gene expression. J. Clin. Invest. 104, 1123
/1128. Cohen, L.E., Hashimoto, Y., Zanger, K., Wondisford, F., Radovick, S., 1999. CREB-independent regulation by CBP is a novel mechanism of human growth hormone gene expression. J. Clin. Invest 104, 1123
/1130. Dasen, J.S., O’Connell, S.M., Flynn, S.E., Treier, M., Gleiberman, A.S., Szeto, D.P., Hooshmand, F., Aggarwal, A.K., Rosenfeld, M.G., 1999. Reciprocal interactions of Pit1 and GATA2 mediate signaling gradient-induced determination of pituitary cell types. Cell 97, 587
/598. Day, R.N., Koike, S., Sakai, M., Muramatsu, M., Maurer, R.A., 1990. Both Pit-1 and the estrogen receptor are required for estrogen responsiveness of the rat prolactin gene. Mol. Endocrinol. 4, 1964
/ 1971. Diamond, S.E., Gutierrez-Hartmann, A., 1996. A 26-amino acid insertion domain defines a functional transcription switch motif in Pit-1 beta. J. Biol. Chem. 271, 28925
/28932. Dorfman, D.M., Wilson, D.B., Bruns, G.A., Orkin, S.H., 1992. Human transcription factor GATA-2: evidence for regulation of preproendothelin-1 gene expression in endothelial cells. J. Biol. Chem. 267, 1279
/1285. Durocher, D., Charron, F., Warren, R., Schwartz, R.J., Nemer, M., 1997. The cardiac transcription factors Nkx2-5 and GATA-4 are mutual cofactors. EMBO J. 16, 5687
/5696. Fitzsimmons, D., Lutz, R., Wheat, W., Chamberlin, H.M., Hagman, J., 2001. Highly conserved amino acids in Pax and Ets proteins are required for DNA binding and ternary complex assembly. Nucleic Acids Res. 29, 4154
/4165. George, K.M., Leonard, M.W., Roth, M.E., Liew, K.H., Kioussis, D., Grosveld, F., Engel, J.D., 1994. Embryonic expression and cloning of the murine GATA-3 gene. Development 120, 2673
/2682. Gordon, D.F., Lewis, S.R., Haugen, B.R., James, A., McDermott, M.T., Wood, W.M., Ridgway, E.C., 1997. Pit-1 and GATA-2 interact and functionally cooperate to activate the thyrotropin beta subunit promoter. J. Biol. Chem. 272, 24339
/24347. Grueneberg, D.A., Natesan, S., Alexandre, C., Gilman, M.Z., 1992. Human and Drosophila homeodomain proteins that enhance the DNA-binding activity of serum response factor. Science 257, 1089
/1095. Haugen, B.R., McDermott, M.T., Gordon, D.F., Rupp, C.L., Wood, W.M., Ridgway, E.C., 1996. Determinants of thyrotrope-specific TSH-beta promoter activation: Cooperation of Pit-1 with another factor. J. Biol. Chem. 271, 385
/389.

66

D.F. Gordon et al. / Molecular and Cellular Endocrinology 196 (2002) 53
/66

Haugen, B.R., Wood, W.M., Gordon, D.F., Ridgway, E.C., 1993. A thyrotrope-specific variant of Pit-1 transactivates the thyrotropin beta promoter. J. Biol. Chem. 268, 20818
/20824. Herr, W., Cleary, M.L., 1995. The POU domain: versatility in transcriptional regulation by a flexible two-in-one DNA-binding domain. Genes Dev. 9, 1679
/1693. Holloway, J.M., Szeto, D.P., Scully, K.M., Glass, C.K., Rosenfeld, M.G., 1995. Pit-1 binding to specific DNA sites as a monomer or dimer determines gene-specific use of a tyrosine-dependent synergy domain. Genes Dev. 9, 1992
/2006. Howard, P., Maurer, R.A., 1995. A composite Ets/Pit-1 binding site in the prolactin gene can mediate transcriptional responses to multiple signal transduction pathways. J. Biol. Chem. 270, 20930
/20936. Ingraham, H., Chen, R., Mangalam, H.J., Elsholtz, H.P., Flynn, S.E., Lin, C.R., Simmons, D.M., Swanson, L., Rosenfeld, M.G., 1988. A tissue-specific transcription factor containing a homeodomain specifies a pituitary phenotype. Cell 55, 519
/529. Ko, L.J., Engel, J.D., 1993. DNA-binding specificities of the GATA transcription factor family. Mol. Cell. Biol. 13, 4011
/4022. Ko, L.J., Yamamoto, M., Leonard, M.W., George, K.M., Ting, P., Engel, J.D., 1991. Murine and human t-lymphocyte GATA-3 factors mediate transcription through a cis -regulatory element within the human T-cell receptor delta gene enhancer. Mol. Cell. Biol. 11, 2778
/2784. Lai, J.S., Herr, W., 1992. Ethidium bromide provides a simple tool for identifying genuine DNA-independent protein associations. Proc. Natl. Acad. Sci. USA 89, 6958
/6962. Laverriere, A.C., MacNeill, C., Mueller, C., Poelmann, R.E., Burch, J.B., Evans, T., 1994. GATA-4/5/6, a subfamily of three transcription factors transcribed in developing heart and gut. J. Biol. Chem. 269, 23177
/23184. Li, S., Crenshaw, E.B., Rawson, E.J., Simmons, D.M., Swanson, L.W., Rosenfeld, M.G., 1990. Dwarf locus mutants lacking three pituitary cell types result from mutations in the POU-domain gene pit-1. Nature 347, 528
/533. Liang, Q., De Windt, L.J., Witt, S.A., Kimball, T.R., Markham, B.E., Molkentin, J.D., 2001. The transcription factors GATA4 and GATA6 regulate cardiomyocyte hypertrophy in vitro and in vivo. J. Biol. Chem. 276, 30245
/30253. Lin, S.C., Li, S., Drolet, D.W., Rosenfeld, M.G., 1994. Pituitary ontogeny of the Snell dwarf mouse reveals Pit-1-independent and Pit-1-dependent origins of the thyrotrope. Development 120, 515
/ 522. Lipkin, S.M., Naar, A.M., Kalla, K.A., Sack, R.A., Rosenfeld, M.G., 1993. Identification of a novel zinc finger protein binding a conserved element critical for Pit-1-dependent growth hormone gene expression. Genes Dev. 7, 1674
/1687. Lowry, O.H., Rosebrough, N.J., Farr, A.L., Randall, R.J., 1951. Protein measurement with the Folin Phenol reagent. J. Biol. Chem. 193, 265
/275. Ma, G.T., Roth, M.E., Groskopf, J.C., Tsai, F.Y., Orkin, S.H., Grosveld, F., Engel, J.D., Linzer, D.I., 1997. GATA-2 and GATA3 regulate trophoblast specific gene expression in vivo. Development 124, 907
/914. Merika, M., Orkin, S.H., 1995. Functional synergy and physical interactions of the erythroid transcription factor GATA-1 with the Kruppel family proteins Sp1 and EKLF. Mol. Cell. Biol. 15, 2437
/ 2447. Molkentin, J.D., Tymitz, K.M., Richardson, J.A., Olson, E.N., 2000. Abnormalities of the genitourinary tract in female mice lacking GATA5. Mol. Cell Biol. 20, 5256
/5260. Nagai, T., Harigae, H., Ishihara, H., Motohashi, H., Minegishi, N., Tsuchiya, S., Hayashi, N., Gu, L., Andres, B., Engel, J.D.,

Yamamoto, M., 1994. Transcription factor GATA-2 is expressed in erythroid, early myeloid, and CD34/ human leukemia derived cell lines. Blood 84, 1074
/1084. Narita, N., Bielinska, M., Wilson, D.B., 1996. Cardiomyocyte differentiation by GATA-4 deficient embryonic stem cells. Development 122, 3755
/3764. Orkin, S.H., 1995. Transcription factors and hematopoietic development. J. Biol. Chem. 270, 4955
/4958. Phillips, K., Luisi, B., 2000. The virtuoso of versatility: POU proteins that flex to fit. J. Mol. Biol. 302, 1023
/1039. Sanger, F., Nicklen, S., Coulson, A.R., 1977. DNA sequencing with chain terminating inhibitors. Proc. Natl. Acad. Sci. USA 74, 5463
/ 5468. Scully, K.M., Jacobson, E.M., Jepsen, K., Lunyak, V., Viadiu, H., Carriere, C., Rose, D.W., Hooshmand, F., Aggarwal, A.K., Rosenfeld, M.G., 2000. Allosteric effects of Pit-1 DNA sites on long-term repression in cell type specification. Science 290, 1127
/ 1131. Simmons, D.M., Voss, J.W., Holloway, J.M., Broide, R.S., Rosenfeld, M.G., Swanson, L.W., 1990. Pituitary cell phenotypes involve cellspecific Pit-1 mRNA translation and synergistic interactions with other classes of transcription factors. Genes Dev. 4, 695
/711. Smith, D.B., Johnson, K.S., 1988. Single step purification of polypeptides expressed in Escherichia coli as fusions with glutathione S transferase. Gene 67, 31
/40. Steger, D.J., Hecht, J.H., Mellon, P.L., 1994. GATA-binding proteins regulate the human gonadotropin alpha-subunit gene in the placenta and pituitary gland. Mol. Cell. Biol. 14, 5592
/5602. Szeto, D.P., Ryan, A.K., O’Connell, S.M., Rosenfeld, M.G., 1996. POTX: a Pit-1 interacting homeodomain factor expressed during anterior pituitary development. Proc. Natl. Acad. Sci. USA 93, 7706
/7710. Theill, L.E., Castrillo, J., Wu, D., Karin, M., 1989. Dissection of functional domains of the pituitary specific transcription factor GHF1. Nature 342, 945
/948. Tsai, S.F., Martin, D.I., Zon, L.I., D’Andrea, A.D., Wong, G.G., Orkin, S.H., 1989. Cloning of cDNA for the major DNA binding protein of the erythroid lineage through expression in mammalian cells. Nature 339, 446
/451. Tsang, A.P., Visvader, J.E., Turner, C.A., Fujiwara, Y., Yi, C., Weiss, M.J., Crossley, M., Orkin, S.H., 1997. FOG, a multitype zinc finger protein, acts as a cofactor for transcription factor GATA-1 in erythroid and megakaryocytic differentiation. Cell 90, 109
/119. Voss, J.W., Wilson, L., Rosenfeld, M.G., 1991. POU-domain proteins Pit-1 and Oct-1 interact to form a heteromeric complex and can cooperate to induce expression of the prolactin promoter. Genes Dev. 5, 1309
/1320. Wood, W.M., Kao, M.Y., Gordon, D.F., Ridgway, E.C., 1989. Thyroid hormone regulates the mouse thyrotropin beta subunit gene promoter in transfected primary thyrotropes. J. Biol. Chem. 264, 14840
/14847. Xu, L., Lavinsky, R.M., Dasen, J.S., Flynn, S.E., McInerney, E.M., Mullen, T.M., Heinzel, T., Szeto, D., Korzus, E., Kurokawa, R., Aggarwal, A.K., Rose, D.W., Glass, C.K., Rosenfeld, M.G., 1998. Signal-specific co-activator domain requirements for Pit-1 activation. Nature 395, 301
/306. Yang, H., Lu, M.M., Zhang, L., Whitsett, J.A., Morrisey, E.E., 2002. GATA6 regulates differentiation of distal lung epithelium. Development 129, 2233
/2246. Zhao, L., Bakke, M., Krimkevich, Y., Cushman, L.J., Parlow, A.F., Camper, S.A., Parker, K.L., 2001. Steroidogenic factor 1 (SF1) is essential for pituitary gonadotrope function. Development 128, 147
/154.