4ICD transcriptional activation domains are required for STAT5A activated gene expression

Gene 592 (2016) 221–226

Contents lists available at ScienceDirect

Gene journal homepage: www.elsevier.com/locate/gene

Research paper

Intrinsic HER4/4ICD transcriptional activation domains are required for STAT5A activated gene expression Wen Han 1, Mary E. Sfondouris 1, Eleanor C. Semmes, Alicia M. Meyer, Frank E. Jones ⁎ Department of Cell and Molecular Biology, Tulane University, New Orleans, LA 70118, USA

a r t i c l e

i n f o

Article history: Received 5 July 2016 Received in revised form 28 July 2016 Accepted 31 July 2016 Available online 5 August 2016 Keywords: EGFR-family Regulated intramembrane proteolysis STAT5 Transactivation HER4 4ICD

a b s t r a c t The epidermal growth factor receptor family member HER4 undergoes proteolytic processing at the cell surface to release the HER4 intracellular domain (4ICD) nuclear protein. Interestingly, 4ICD directly interacts with STAT5 and functions as an obligate STAT5 nuclear chaperone. Once in the nucleus 4ICD binds with STAT5 at STAT5 target genes, dramatically potentiating STAT5 transcriptional activation. These observations raise the possibility that 4ICD directly coactivates STAT5 gene expression. Using both yeast and mammalian transactivation reporter assays, we performed truncations of 4ICD fused to a GAL4 DNA binding domain and identified two independent 4ICD transactivation domains located between residues 1022 and 1090 (TAD1) and 1192 and 1225 (TAD2). The ability of the 4ICD DNA binding domain fusions to transactivate reporter gene expression required deletion of the intrinsic tyrosine kinase domain. In addition, we identified the 4ICD carboxyl terminal TVV residues, a PDZ domain binding motif (PDZ-DBM), as a potent transcriptional repressor. The transactivation activity of the HER4 carboxyl terminal domain lacking the tyrosine kinase (CTD) was significantly lower than similar EGFR or HER2 CTD. However, deletion of the HER4 CTD PDZ-DBM enhanced HER4 CTD transactivation to levels equivalent to the EGFR and HER2 CTDs. To determine if 4ICD TAD1 and TAD2 have a physiologically relevant role in STAT5 transactivation, we coexpressed 4ICD or 4ICD lacking TAD2 or both TAD1 and TAD2 with STAT5 in a luciferase reporter assay. Our results demonstrate that each 4ICD TAD contributes additively to STAT5A transactivation and the ability of STAT5A to transactivate the β-casein promoter requires the 4ICD TADs. Taken together, published data and our current results demonstrate that both 4ICD nuclear chaperone and intrinsic coactivation activities are essential for STAT5 regulated gene expression. © 2016 Elsevier B.V. All rights reserved.

1. Introduction The EGFR-family of receptor tyrosine kinases transduce signals from the cell surface to regulate multiple developmental and cellular functions. Interestingly, each member of the EGFR-family has also been detected within cell nuclei implicating non-canonical signaling mechanisms. In fact, the EGFR-family member, HER4, appears to be uniquely adapted for nuclear signaling. For example, HER4 is the only member of the EGFR-family that undergoes regulated intramembrane proteolysis (RIP) following ligand stimulation to release an independently signaling HER4 intracellular domain (4ICD). Furthermore, HER4 physiological functions identified to date, including mammary gland Abbreviations: 4ICD, HER4 intracellular domain; TAD, transactivation domain; CTD, carboxyl-terminal domain; RIP, regulated intramembrane proteolysis; YAP, yes associated protein; ER, estrogen receptor; STAT5, signal transducer and activator of transcription 5; HRGα, heregulin alpha; WAP, whey acidic protein; DBD, DNA binding domain; PDZ-DBM, PDZ domain binding motif; 4CTD, HER4 carboxyl-terminal domain; TRD, transcriptional repressor domain; NLS, nuclear localization signal. ⁎ Corresponding author. E-mail address: [email protected] (F.E. Jones). 1 Wen Han and Mary E. Sfondouris contributed equally to this work.

http://dx.doi.org/10.1016/j.gene.2016.07.071 0378-1119/© 2016 Elsevier B.V. All rights reserved.

development and lactation (Jones, 2008), breast tumor cell proliferation (Zhu et al., 2006) and migration (Haskins et al., 2014), mammary epithelial cell differentiation (Muraoka-Cook et al., 2006; Han et al., 2016), hippocampal dendritic morphology (Allison et al., 2011), and fetal lung development (Liu et al., 2010; Zscheppang et al., 2011), are all mediated by nuclear 4ICD. Compared to the other three EGFR-family members, the signaling molecule interactome of HER4 is dramatically limited (Schulze et al., 2005; Chuu et al., 2008; Kaushansky et al., 2008), implying that cell-surface HER4 is relatively impotent at transmitting cellular signals. Accordingly, a physiological function exclusive to signals transmitted by cell surface HER4 remains to be described. Experimental evidence indicates that nuclear 4ICD regulates developmental processes and cellular responses through association with transcriptional regulators at specific genomic loci. For example, 4ICD association with the yes-associated protein (YAP) transcriptional coactivator is required for YAP driven Hippo pathway gene expression and breast tumor cell migration (Haskins et al., 2014). In addition, 4ICD associates with estrogen receptor (ER) at estrogen-regulated gene promoters to coactivate ER target gene expression and promote breast tumor cell proliferation (Zhu et al., 2006; Rokicki et al., 2010; Han and Jones, 2014). Significantly, 4ICD is a potent obligate ER coactivator

222

W. Han et al. / Gene 592 (2016) 221–226

required for expression of 38% of the estrogen-regulated genes in breast tumor cells (Han and Jones, 2014). Developmentally, nuclear 4ICD coactivates signal transducer and activator of transcription 5 (STAT5) to promote surfactant protein B expression essential for fetal lung development (Liu et al., 2010; Zscheppang et al., 2011) The most extensive and convincing evidence of a physiological role for nuclear 4ICD comes from experiments describing 4ICD coactivation of STAT5 to drive mammary differentiation. In the developing mammary gland overlapping phenotypes are observed with genetic deletion of the HER4 ligand, heregulin α (HRGα), HER4 itself, or STAT5A. Specifically, HRGα-stimulated HER4 and STAT5A are required for luminal progenitor cell differentiation, lactation at parturition, and expression of the STAT5A regulated milk-genes α-lactalbumin, β-casein, and whey acidic protein (WAP) (Liu et al., 1997; Jones et al., 1999; Miyoshi et al., 2001; Li et al., 2002; Long et al., 2003; Jones, 2008; Yamaji et al., 2009; Forster et al., 2014). Mechanistically, 4ICD directly interacts with STAT5A (Han et al., 2016), functions as a STAT5A nuclear chaperone (Williams et al., 2004; Zscheppang et al., 2011), and binds with STAT5A at WAP and βcasein gene promoters (Williams et al., 2004). Functional differentiation of mammary epithelial cells with expression of the STAT5A target genes and differentiation markers β-casein and WAP requires 4ICD coactivation of STAT5A (Muraoka-Cook et al., 2006; Muraoka-Cook et al., 2008; Han et al., 2016). Although 4ICD interaction with and nuclear transport of STAT5A is required for STAT5A regulated gene expression (Williams et al., 2004; Han et al., 2016), the direct impact of nuclear 4ICD interaction with STAT5A on target gene expression remains unclear. Here we determined if 4ICD harbors independent transactivation activity that potentiates STAT5A regulated gene expression. 2. Materials and methods 2.1. Expression plasmids For yeast expression plasmids, the HER4 carboxyl-terminal domain (4CTD; residues 989–1308) downstream of the intrinsic tyrosine kinase domain was amplified by polymerase chain reaction (PCR) and subcloned into the SalI and NotI restriction sites of pDBLeu (Invitrogen). Truncations of 4CTD were similarly subcloned into pDBLeu using PCR. All 4CTD subclones were fused in-frame with the DNA binding domain (DBD) from the GAL4 transcription factor in pDBLeu and each clone was verified by DNA sequencing and Western blot analysis. For mammalian expression, similar to yeast expression constructs described above, 4CTD and truncations were amplified by PCR and subcloned into the EcoRI and SalI sites and in-frame with the GAL4 DBD of pM (Clontech). The PPXY domain at residues 2998 to 1301 (PPPY referred to as PY3) was inactivated by altering the domain to residues HPPA to generate p4CTDmuPY3 by PCR-assisted site-directed mutagenesis using the primer 5′- CCGCCTCCACCTGCCAGACACCGGAATAC and the QuickChange II XL Site-Directed Mutagenesis Kit (Agilent). The HER4 carboxyl-terminal TVV residues (1306–1308) encode a PDZ domain binding motif (PDZ-DBM) and was deleted in 4CTD to generate p4CTDΔTVV by PCR mediated subcloning. The expression plasmid pEF-STAT5A and luciferase reporter plasmid pZZ-β-casein have been described previously (Williams et al., 2004). For expression of full-length 4ICD (residues 673–1308), 4ICD was excised from pEGFP-4ICD (Williams et al., 2004) using NotI and SalI and subcloned into the same sites of pCMV-3Tag-3 (Agilent Technologies) to retain the Flag epitope tags and generate pCMV/4ICD. The truncations in 4CTDΔ116 and 4CTDΔ286 were subcloned into pCMV/4ICD to generate pCMV/4ICDΔ116 and pCMV/4ICDΔ286, respectively. 2.2. Yeast strain and β-galactosidase assay The yeast strain MaV203 (MATα,leu2-3,112,trp1-901,his3Δ200,ade2 -101,gal4Δ,gal80 Δ,SPAL10::URA3,GAL1::lacZ,HIS3 UAS GAL1::HIS3@ LYS2,can1R,cyh2R) was transformed with pDBLeu/4CTD expression

constructs using standard procedures. For the β-galactosidase assay, yeast cells harboring different GAL4 DBD/4CTD expression constructs were cultivated overnight in minimal medium with leucine omission. The next day, cells were transferred to a 96 well plate and, after an additional 24 h of cultivation, β-galactosidase activity of cell extracts was determined using the Yeast β-Galactosidase Assay Kit (Thermo Scientific) according to the manufacturer's instructions. All samples were prepared in triplicate and each independent experiment was performed at least three times. Significant differences between experimental treatments were determined using one-way ANOVA. 2.3. Mammalian luciferase reporter assays The HEK 293T cell line was obtained from American Type Culture Collection (ATCC) and cultured in DMEM (Gibco) supplemented with 10% fetal bovine serum (FBS) and 2 mM L-glutamine. For GAL4 promoter luciferase reporter assays, 293T cells were cotransfected with pM/ 4CTD expression constructs and the GAL4 promoter luciferase reporter plasmid, pG5luc (Promega), using Lipofectamine LTX Plus Reagent (Thermo Fisher Scientific). At 48 h post-transfection, cell lysates were prepared in 200 μl of Cell Culture Lysis Reagent (Promega) and the luciferase assay was performed on 20 μl of lysate using the Luciferase Assay System (Promega) according to the manufacturer's instructions. Luciferase reporter assays of MCF-7B cells cotransfected with STAT5A, 4ICD, and pZZ-β-casein were performed exactly as described previously (Williams et al., 2004; Clark et al., 2005) using Lipofectamine LTX with Plus Reagent as the transfection reagent. As an indicator of similar transfection efficiencies, equivalent levels of protein expression and STAT5A activation were confirmed by Western blot analysis as described previously (Williams et al., 2004; Clark et al., 2005; Huynh and Jones, 2014). All samples for luciferase reporter assays were prepared in triplicate and each independent experiment was performed at least three times. Significant differences between experimental treatments were determined using the Student's t-test. 3. Results and discussion 3.1. 4ICD harbors transcriptional activation (TA) activity in yeast and mammalian systems Published reports suggest that 4ICD transactivates gene expression (Williams et al., 2004); however, a 4ICD intrinsic TA domain remains to be identified. Here we used two independent experimental systems to determine if 4ICD harbors TA activity. We fused 4ICD or the carboxyl-terminus of 4ICD lacking the intrinsic kinase domain (4CTD) to a GAL4 DNA binding domain (GAL4-DBD) (Fig. 1A) and coexpressed with a GAL4 upstream activation sequence in a β-galactosidase reporter (GAL4-UAS-βgal) in yeast cells or cotransfected in mammalian 293T cells with a GAL4-UAS luciferase reporter (GAL4-UAS-Luc). In both yeast (Fig. 1B) and 293T cells (Fig. 1C), 4ICD lacked significant TA activity when compared to basal GAL4-DBD activity. In contrast, 4CTD harbored robust TA activity with a 3-fold and 50-fold increase over basal GAL4-DBD activity in yeast (Fig. 1B) and 293T cells (Fig. 1C), respectively. 3.2. Transcriptional activation activity of 4CTD is consistent with other EGFR-family members Each member of the EGFR-family has been detected within cell nuclei where they are thought to cooperate with transcription factors to transactivate gene expression (Wang et al., 2010). To determine if, similar to 4CTD, the CTDs from the other three EGFR-family members harbor TA activity we compared all four receptor CTDs independently fused to the GAL4-DBD (Fig. 2A) and cotransfected with GAL4-UAS-Luc in 293T cells. All four EGFR-family members exhibited significant levels

W. Han et al. / Gene 592 (2016) 221–226

223

Fig. 1. The HER4 carboxyl terminus domain (4CTD) harbors transcriptional activation activity. (A) Schematic of HER4 showing transmembrane domain (TM), intracellular domain (4ICD) and carboxyl terminal domain (4CTD). Positions of functionally relevant motifs including a nuclear localization signal (NLS) and the STAT5A binding site at Y984 are indicated. The 4CTD harbors significant TA activity in both (B) yeast GAL4 β-galactosidase and (C) mammalian 293T cell GAL4 luciferase gene expression assays. The indicated expression plasmids were (B) stably expressed in the yeast strain MaV203 or (C) transiently expressed in HEK 293T cells by co-transfection with the GAL4-luciferase reporter plasmid pG5luc and at 48 h posttransfection gene expression relative to vector control was determined. All samples were prepared in triplicate and data represents the mean ± SE of at least three independent gene expression experiments. Double asterisks indicate that 4CTD was significantly greater than vector control and 4ICD as determined by one-way ANOVA (p b 0.01).

of TA activity in the GAL4-UAS-Luc assay (Fig. 2B). The EGFR and HER2 CTDs displayed equivalent high levels of activity significantly greater than 4CTD, whereas 4CTD levels were equivalent to the HER3 CTD (Fig. 2B). These results imply that the TA activity observed for 4CTD is a common property of all EGFR-family members.

3.3. 4CTD harbors transcriptional activation and inhibitory regions To further validate and identify a minimal 4CTD TA domain, we performed 293T cell TA assays on a series of carboxyl-terminal truncation mutants from the original 319 amino acid 4CTD (Fig. 3A). Interestingly, removal of the 4CTD carboxyl-terminal 34 residues in 4CTDΔ34 resulted in significantly enhanced TA activity equivalent to the maximum TA levels observed for EGFR and HER2 (compare 4CTDΔ34 to EGFR and HER2 CTDs

in Fig. 2). These results suggest that the carboxyl-terminal 34 residues of 4CTD harbors a potent transcriptional repressor domain (TRD). Further truncation of 4CTD revealed a strong TA region of 32 amino acids between residues 1192 to 1225 (Fig. 3B; compare 4CTDΔ83, 4CTDΔ100, and 4CTDΔ116). Loss of this region lowered 4CTD TA to fulllength 4CTD basal TA levels. Loss of an additional carboxyl-terminal 102 residues failed to impact 4CTD TA (Fig. 3B; compare 4CTDΔ116 and 4CTDΔ218). Another significant diminution of 4CTD TA was observed; however, as additional carboxyl-terminal sequences were removed between residues 1022 to 1090 (Fig. 3B; compare 4CTDΔ218, 4CTDΔ252, and 4CTDΔ286). Accordingly, carboxyl-terminal residue deletions to residue 1022 resulted in a complete loss of 4CTD TA (Fig. 3B). Similar results were obtained using the GAL4 yeast system (Supplementary Fig. 1). Taken together, these results indicate that 4CTD harbors a carboxylterminal TRD, as well as, two TADs located between residues 1022 to

Fig. 2. Each EGFR-family member harbors significant transcriptional activation activity. (A) Schematic showing the carboxyl terminus of each EGFR-family member fused to the GAL4-DBD. (B) The indicated expression plasmids were transiently expressed in HEK 293T cells by co-transfection with the GAL4-luciferase reporter plasmid pG5luc and at 48 h post-transfection gene expression relative to vector control was determined. All samples were prepared in triplicate and data represents the mean ± SE of at least three independent gene expression experiments. Double and triple asterisks indicate significant differences between indicated samples as determined by one-way ANOVA (p b 0.01 and p b 0.001, respectively).

224

W. Han et al. / Gene 592 (2016) 221–226

Fig. 3. 4CTD harbors two independent TA domains and a transcriptional repressor domain. (A) Schematic showing 4CTD carboxyl terminal truncations fused to GAL4-DBD. (B) The indicated expression plasmids were transiently expressed in HEK 293T cells by co-transfection with the GAL4-luciferase reporter plasmid pG5luc and at 48 h post-transfection gene expression relative to vector control was determined. All samples were prepared in triplicate and data represents the mean ± SE of at least three independent gene expression experiments. (C) Schematic of 4CTD indicating positions of two putative TA domains (TAD1 and TAD2) and a transcriptional repressor domain (TRD). Asterisks indicate significant differences between indicated samples as determined by one-way ANOVA (p b 0.05).

1090 (referred to as 4CTD TAD1) and residues 1192 to 1225 (referred to as 4CTD TAD2) (Fig. 3C). Interestingly, 4CTD TAD2 appears to be 3–4 fold more potent than 4CTD TAD1.

terminus (Sheng and Sala, 2001). Significantly, HER4 is the only EGFRfamily member that harbors a PDZ-DBM (Plowman et al., 1993) and removal of this motif results in 4CTD TA activity equivalent to the highest

3.4. The 4CTD carboxyl-terminal PDZ domain-binding motif suppresses 4CTD transcriptional activation Our TA analysis of 4CTD carboxyl-terminal truncations revealed a TA inhibitory region within the final 34 amino acids (Fig. 3 and Supplementary Fig. 1). Interestingly, this region harbors two important 4ICD functional domains. One region, a PPXY domain at residues 2998 to 1301 (referred to as PY3) serves as a recognition site for recruiting WW-containing proteins including the WWOX tumor suppressor (Schuchardt et al., 2013) and YAP transcriptional activator (Haskins et al., 2014; Schuchardt et al., 2014) (Fig. 4A). The second domain at the carboxyl-terminal residues of 4ICD from 1306 to 1308 encodes TVV which serves as a binding site for proteins harboring a PDZ domain, referred to here as PDZ domain binding motif (PDZ-DBM) (Sheng and Sala, 2001) (Fig. 4A). Through interaction with PDZ domain containing proteins, this motif mediates HER4 membrane localization (Carraway and Sweeney, 2001), promotes γ-secretase RIP to generate 4ICD (Ni et al., 2003), and facilitates HER4 association with multiple PDZ domain containing membrane proteins, including PSD-95 at neuronal synapses (Garcia et al., 2000). Altering PY3 PPPY to HPPA in 4CTDmuPY3 resulted in a small but insignificant increase in 4CTD TA in the 293T GAL4 system (Fig. 4B). In contrast, deletion of the carboxyl-terminal PDZ-DBM in 4CTDΔTVV resulted in a significant increase in 4CTD TA to levels equivalent to the highest levels of TA observed in the 4CTDΔ34 truncation (Fig. 4B). Although, the levels of 4CTDΔTVV TA were slightly lower than 4CTDΔ34, the differences lacked statistical significance. These results indicate that the PDZ-DBM represses the highest potential levels of 4CTD TA by approximately 60%. To bind PDZ domain containing proteins the functional PDZ-DBM must be positioned at the final residues of the host protein's carboxyl-

Fig. 4. The carboxyl terminal PDZ domain binding motif (PDZ-DBM) of 4CTD harbors transcriptional repressor activity. (A) Schematic of 4CTD fused to the GAL4-DBD indicating positions of altered PY3 and PDZ-DBM. (B) The indicated expression plasmids were transiently expressed in HEK 293T cells by co-transfection with the GAL4luciferase reporter plasmid pG5luc and at 48 h post-transfection gene expression relative to vector control was determined. All samples were prepared in triplicate and data represents the mean ± SE of at least three independent gene expression experiments. Asterisks indicate samples significantly greater than 4CTD as determined by Student's t-test (p b 0.05) and NS indicates that the difference between 4CTD and 4ICDmuPY3 was not significant.

W. Han et al. / Gene 592 (2016) 221–226

225

levels of EGFR and HER2 TA (Figs. 2 and 4). In light of these observations, HER3 appears to harbor relatively impotent TA activity. Furthermore, these results imply that HER4 has evolved to encode a PDZ-DBM, in part, to provide a cellular mechanism to modulate HER4 TA activity. One important function of PDZ containing proteins is to recruit and organize proteins at the cell surface (Sheng and Sala, 2001). Accordingly, the HER4 PDZ-DBM may exclude 4ICD from the nucleus and repress 4ICD TA by interacting with membrane associated PDZ containing proteins, thereby tethering the 4ICD nuclear protein and transcriptional coactivator to the cell surface. 3.5. Intrinsic 4ICD transactivation domains potentiate STAT5A transcriptional activation Our data suggests that 4ICD harbors two TADs that cooperate to transactivate gene expression (Fig. 3). We next wanted to determine if the 4ICD TADs have a physiologically relevant function. Importantly, 4ICD functions as an obligate regulator of STAT5A activity during mammary gland development and lactation. Specifically, the 4ICD/STAT5A signaling axis is necessary for STAT5A transactivation of milk-gene expression during lactation (Long et al., 2003; Tidcombe et al., 2003; Jones, 2008; Forster et al., 2014). We have previously shown that 4ICD contributes to STAT5A gene expression by functioning as a nuclear chaperone, which requires an intact 4ICD nuclear localization signal (NLS) (Williams et al., 2004) and a 4ICD phosphorylated tyrosine residue necessary for STAT5A recruitment and subsequent nuclear cotranslocation (Han et al., 2016). It is unclear, however, if the nuclear chaperone function of 4ICD is sufficient to potentiate STAT5A TA or if intrinsic 4ICD TA activity also contributes to STAT5A regulated gene expression. To address this issue, we determined if 4ICD truncations that retain STAT5A interaction and nuclear chaperone functions, but lack one or both TADs could potentiate STAT5A transactivation (Fig. 5A). As we have published previously (Williams et al., 2004; Clark et al., 2005), expression of STAT5A or 4ICD alone resulted in an insignificant increase of luciferase expression from a reporter construct driven by the β-casein promoter (Fig. 5B). In contrast, a significant increase in luciferase reporter expression was observed when STAT5A was cotransfected with 4ICD. Cotransfection of STAT5A and 4ICDΔ116, with a deletion of 4ICD TAD2, resulted in an insignificant increase in luciferase gene activation indicating that 4ICD TAD2 directly contributes to STAT5A TA (Fig. 5B). Cotransfection of STAT5A with 4ICDΔ286, lacking both 4ICD TADs, resulted in a small additional decrease in luciferase activity when compared to STAT5A cotransfected with 4ICDΔ116 (Fig. 5B). Taken together our results indicate that the 4ICD TADs play an essential role in STAT5A TA and, although maximal STAT5A TA of the β-casein promoter requires both 4ICD TADs, TAD2 appears to have the greatest impact on STAT5A TA while the contribution of TAD1 seems negligible. 3.6. Conclusions In conclusion, we demonstrate for the first time that the obligate STAT5A nuclear chaperone, 4ICD, harbors two functionally independent TADs within its carboxyl-terminus. We further show that each 4ICD TAD contributes additively to STAT5A TA and, significantly, the ability of STAT5A to transactivate the β-casein promoter requires intact 4ICD TADs. Taken together, published data and our current results demonstrate that STAT5A regulated gene expression requires two novel and independent 4ICD activities. Accordingly, we have previously shown that 4ICD directly interacts with STAT5A and functions as a STAT5A nuclear chaperone (Williams et al., 2004; Han et al., 2016). Furthermore, 4ICD associates with STAT5A at target gene promoters (Williams et al., 2004) and our current results indicate that the additive effects of two 4ICD intrinsic TADs are required for STAT5A activation of gene expression. Taken together, our results provide a mechanistic basis for coupled

Fig. 5. Intrinsic 4ICD transactivation domains are required for STAT5A TA of the β-casein promoter. (A) Schematic of 4ICD truncations eliminating TAD1 (4ICDΔ116) or both TAD1 and TAD2 (4ICDΔ286). (B) MCF-7B cells were transfected with the indicated 4ICD constructs, STAT5A, and a β-casein promoter luciferase reporter. Cell lysates were prepared at 2 days post-transfection and luciferase activity was determined. Data represents mean ± SE of luciferase activity relative to vector control. Each complete experiment was independently repeated four times and asterisks indicate sample significantly greater than vector control as determined by Student's t-test (p b 0.02).

HER4 and STAT5A signaling essential for mammary epithelial differentiation and milk-gene expression during lactation. Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.gene.2016.07.071. Acknowledgements We thank members of the Jones lab for helpful discussions. This work was supported by NIH/NCI grants RO1CA095783 (FEJ) and RO1CA096717 (FEJ), Tulane University Office of Research Bridge Funding (FEJ), and the Gerald and Flora Jo Mansfield Piltz Professorship in Cancer Research (FEJ). References Allison, J.G., Das, P.M., Ma, J., Inglis, F.M., Jones, F.E., 2011. The ERBB4 intracellular domain (4ICD) regulates NRG1-induced gene expression in hippocampal neurons. Neurosci. Res. 70, 155–163. Carraway III, K.L., Sweeney, C., 2001. Localization and modulation of ErbB receptor tyrosine kinases. Curr. Opin. Cell Biol. 13, 125–130. Chuu, C.P., Chen, R.Y., Barkinge, J.L., Ciaccio, M.F., Jones, R.B., 2008. Systems-level analysis of ErbB4 signaling in breast cancer: a laboratory to clinical perspective. Mol. Cancer Res. 6, 885–891.

226

W. Han et al. / Gene 592 (2016) 221–226

Clark, D.E., Williams, C.C., Duplessis, T.T., Moring, K.L., Notwick, A.R., Lane, W.S., Beuvink, I., Hynes, N.E., Jones, F.E., 2005. ERBB4/HER4 potentiates STAT5A transcriptional activity by regulating novel STAT5A serine phosphorylation events. J. Biol. Chem. 280, 24175–24180. Forster, N., Saladi, S.V., van Bragt, M., Sfondouris, M.E., Jones, F.E., Li, Z., Ellisen, L.W., 2014. Basal cell signaling by p63 controls luminal progenitor function and lactation via NRG1. Dev. Cell 28, 147–160. Garcia, R.A.G., Vasudevan, K., Buonanno, A., 2000. The neuregulin receptor ErbB-4 interacts with PDZ-containing proteins at neuronal synapses. Proc. Natl. Acad. Sci. U. S. A. 97, 3596–3601. Han, W., Jones, F.E., 2014. HER4 selectively coregulates estrogen stimulated genes associated with breast tumor cell proliferation. Biochem. Biophys. Res. Commun. 443, 458–463. Han, W., Sfondouris, M.E., Jones, F.E., 2016. Direct coupling of HER4 intracellular domain (4ICD) and STAT5A signaling is required to induce mammary epithelial cell differentiation. Biochem. Biophys. Rep. 7, 323–327. Haskins, J.W., Nguyen, D.X., Stern, D.F., 2014. Neuregulin 1-activated ERBB4 interacts with YAP to induce Hippo pathway target genes and promote cell migration. Sci. Signal. 7, ra116. Huynh, F.C., Jones, F.E., 2014. MicroRNA-7 inhibits multiple oncogenic pathways to suppress HER2Δ16 mediated breast tumorigenesis and reverse trastuzumab resistance. PLoS One 9, e114419. Jones, F.E., 2008. HER4 intracellular domain (4ICD) activity in the developing mammary gland and breast cancer. J. Mammary Gland Biol. Neoplasia 13, 247–258. Jones, F.E., Welte, T., Fu, X.-Y., Stern, D.F., 1999. ErbB4 signaling in the mammary gland is required for lobuloalveolar development and Stat5 activation during lactation. J. Cell Biol. 147, 77–87. Kaushansky, A., Gordus, A., Budnik, B.A., Lane, W.S., Rush, J., Macbeath, G., 2008. Systemwide investigation of ErbB4 reveals 19 sites of Tyr phosphorylation that are unusually selective in their recruitment properties. Chem. Biol. 15, 808–817. Li, L., Cleary, S., Long, W., Mandarano, M.A., Birchmeier, C., Jones, F.E., 2002. The breast proto-oncogene, HRGα regulates epithelial proliferation and lobuloalveolar development in the mouse mammary gland. Oncogene 21, 4900–4907. Liu, X., Robinson, G.W., Wagner, K.-U., Garrett, L., Wynshaw-Boris, A., Hennighausen, L., 1997. Stat5a is mandatory for adult mammary gland development and lactogenesis. Genes Dev. 11, 179–186. Liu, W., Purevdorj, E., Zscheppang, K., von Mayersbach, D., Behrens, J., Brinkhaus, M.J., Nielsen, H.C., Schmiedl, A., Dammann, C.E., 2010. ErbB4 regulates the timely progression of late fetal lung development. Biochim. Biophys. Acta 1803, 832–839. Long, W., Wagner, K.-U., Lloyd, K.C.K., Binart, N., Shillingford, J.M., Hennighausen, L., Jones, F.E., 2003. Impaired differentiation and lactational failure in ErbB4-deficient mammary glands identify ERBB4 as an obligate mediator of Stat5. Development 130, 5257–5268. Miyoshi, K., Shillingford, J.M., Smith, G.H., Grimm, S.L., Wagner, K.U., Oka, T., Rosen, J.M., Robinson, G.W., Hennighausen, L., 2001. Signal transducer and activator of transcription (Stat) 5 controls the proliferation and differentiation of mammary alveolar epithelium. J. Cell Biol. 155, 531–542.

Muraoka-Cook, R.S., Sandahl, M., Husted, C., Hunter, D., Miraglia, L., Feng, S.M., Elenius, K., Earp III, H.S., 2006. The intracellular domain of ErbB4 induces differentiation of mammary epithelial cells. Mol. Biol. Cell 17, 4118–4129. Muraoka-Cook, R.S., Sandahl, M., Hunter, D., Miraglia, L., Earp III, H.S., 2008. Prolactin and ErbB4/HER4 signaling interact via Janus kinase 2 to induce mammary epithelial cell gene expression differentiation. Mol. Endocrinol. 22, 2307–2321. Ni, C.Y., Yuan, H., Carpenter, G., 2003. Role of the ErbB-4 Carboxyl Terminus in gamma Secretase Cleavage. J. Biol. Chem. 278, 4561–4565. Plowman, G.D., Culouscou, J.-M., Whitney, G.S., Green, J.M., Carlton, G.W., Foy, L., Neubauer, M.G., Shoyab, M., 1993. Ligand-specific activation of HER4/p180erbB4, a fourth member of the epidermal growth factor receptor family. Proc. Natl. Acad. Sci. U. S. A. 90, 1746–1750. Rokicki, J., Das, P.M., Giltnane, J.M., Wansbury, O., Rimm, D.L., Howard, B.A., Jones, F.E., 2010. The ERα coactivator, HER4/4ICD, regulates progesterone receptor expression in normal and malignant breast epithelium. Mol. Cancer 9, 150. Schuchardt, B.J., Bhat, V., Mikles, D.C., McDonald, C.B., Sudol, M., Farooq, A., 2013. Molecular origin of the binding of WWOX tumor suppressor to ErbB4 receptor tyrosine kinase. Biochemistry 52, 9223–9236. Schuchardt, B.J., Bhat, V., Mikles, D.C., McDonald, C.B., Sudol, M., Farooq, A., 2014. Molecular basis of the binding of YAP transcriptional regulator to the ErbB4 receptor tyrosine kinase. Biochimie 101, 192–202. Schulze, W.X., Deng, L., Mann, M., 2005. Phosphotyrosine interactome of the ErbB-receptor kinase family. Mol. Syst. Biol. 1 (2005), 0008. Sheng, M., Sala, C., 2001. PDZ domains and the organization of supramolecular complexes. Annu. Rev. Neurosci. 24, 1–29. Tidcombe, H., Jackson-Fisher, A., Mathers, K., Stern, D.F., Gassmann, M., Golding, J.P., 2003. Neural and mammary gland defects in ErbB4 knockout mice genetically rescued from embryonic lethality. Proc. Natl. Acad. Sci. U. S. A. 100, 8281–8286. Wang, Y.N., Yamaguchi, H., Hsu, J.M., Hung, M.C., 2010. Nuclear trafficking of the epidermal growth factor receptor family membrane proteins. Oncogene 29, 3997–4006. Williams, C.C., Allison, J.G., Vidal, G.A., Burow, M.E., Beckman, B.S., Marrero, L., Jones, F.E., 2004. The ERBB4/HER4 receptor tyrosine kinase regulates gene expression by functioning as a STAT5A nuclear chaperone. J. Cell Biol. 167, 469–478. Yamaji, D., Na, R., Feuermann, Y., Pechhold, S., Chen, W., Robinson, G.W., Hennighausen, L., 2009. Development of mammary luminal progenitor cells is controlled by the transcription factor STAT5A. Genes Dev. 23, 2382–2387. Zhu, Y., Sullivan, L.L., Nair, S.S., Williams, C.C., Pandey, A., Marrero, L., Vadlamudi, R.K., Jones, F.E., 2006. Coregulation of estrogen receptor by estrogen-inducible ERBB4/ HER4 establishes a growth promoting autocrine signal in breast cancer. Cancer Res. 66, 7991–7998. Zscheppang, K., Dork, T., Schmiedl, A., Jones, F.E., Dammann, C.E., 2011. Neuregulin receptor ErbB4 functions as a transcriptional cofactor for Sftpb expression the fetal lung. Am. J. Respir. Cell Mol. Biol. 45, 761–767.