Epigenetic mechanisms silence a disintegrin and metalloprotease 33 expression in bronchial epithelial cells

Epigenetic mechanisms silence a disintegrin and metalloprotease 33 expression in bronchial epithelial cells Youwen Yang, PhD, Hans Michael Haitchi, MD, Julie Cakebread, PhD, David Sammut, MD, Anna Harvey, BSc, Robert M. Powell, PhD, John W. Holloway, PhD, Peter Howarth, MD, PhD, Stephen T. Holgate, MD, DSc, and Donna E. Davies, PhD Southampton, United Kingdom Background: A disintegrin and metalloprotease 33 (ADAM33) polymorphism is strongly associated with asthma and bronchial hyperresponsiveness. Although considered to be a mesenchymal cell–specific gene, recent reports have suggested epithelial expression of ADAM33 in patients with severe asthma. Objectives: Because dysregulated expression of ADAM33 can contribute to disease pathogenesis, we characterized the mechanism or mechanisms that control its transcription and investigated ADAM33 expression in bronchial biopsy specimens and brushings from healthy and asthmatic subjects. Methods: The ADAM33 promoter and CpG island methylation were analyzed by using bioinformatics, luciferase reporters, and bisulfite sequencing of genomic DNA. Epithelial-mesenchymal transition was induced by using TGF-b1. ADAM33 mRNA was scrutinized in bronchial biopsy specimens and brushings by using reverse transcriptase–quantitative polymerase chain reaction, melt-curve analysis, and direct sequencing. Results: The predicted ADAM33 promoter (2550 to 187) had promoter transcriptional activity. Bisulfite sequencing showed that the predicted promoter CpG island (2362 to 180) was hypermethylated in epithelial cells but hypomethylated in ADAM33-expressing fibroblasts. Treatment of epithelial cells with 5-aza-deoxycytidine caused demethylation of the CpG island and induced ADAM33 expression. In contrast, phenotypic transformation of epithelial cells through a TGF-b– induced epithelial-mesenchymal transition was insufficient to induce ADAM33 expression. ADAM33 mRNA was confirmed in bronchial biopsy specimens, but no validated signal was detected in bronchial brushings from healthy or asthmatic subjects. Conclusion: The ADAM33 gene contains a regulatory CpG island within its promoter, the methylation status of which tightly controls its expression in a cell type–specific manner. ADAM33 repression is a stable feature of airway epithelial cells, irrespective of disease. (J Allergy Clin Immunol 2008;121:1393-9.)

From the Brooke Laboratories, Division of Infection, Inflammation and Repair, School of Medicine, University of Southampton. Supported by the Rayne Foundation, United Kingdom; the Asthma, Allergy and Inflammation Research Charity; the Medical Research Council (United Kingdom); and the Wellcome Trust (United Kingdom). Disclosure of potential conflict of interest: The authors have declared that they have no conflict of interest. Received for publication July 19, 2007; revised February 25, 2008; accepted for publication February 26, 2008. Available online April 23, 2008. Reprint requests: Donna E. Davies, PhD, Allergy and Inflammation Research, Level F South Block (810), Southampton General Hospital, Southampton SO16 6YD, United Kingdom. E-mail: [email protected]. 0091-6749/$34.00 Ó 2008 American Academy of Allergy, Asthma & Immunology doi:10.1016/j.jaci.2008.02.031

Key words: Promoter, CpG island, methylation, expression, ADAM33, epithelial-mesenchymal transition

A disintegrin and metalloprotease 33 (ADAM33) was originally identified as an asthma-susceptibility gene by means of positional cloning.1 It is found on chromosome 20p13, and several single nucleotide polymorphisms (SNPs) in ADAM33 have been linked with the asthma subphenotype of bronchial hyperresponsiveness (BHR) and not atopy.1 A syntenic region on mouse chromosome 2 overlying an ortholog of ADAM33 that exhibits approximately 70% homology with its human counterpart is also linked to BHR.2 Recent studies have shown that SNPs in ADAM33 predict poor lung function in early childhood3 and a more rapid decrease in lung function in patients with chronic obstructive pulmonary disease and in a healthy population.4 Several ADAM33 protein isoforms occur in adult bronchial smooth muscle and in human embryonic lungs, where it is expressed in undifferentiated mesenchymal cells, strongly suggesting a role in smooth muscle development, function, or both.5 This might explain its genetic association with BHR and asthma.1 The ADAM family is defined by the presence of 7 functional domains: pro-domain, metalloprotease (MP) domain, disintegrin domain, cysteine-rich domain, epidermal growth factor (EGF) domain, transmembrane domain, and cytoplasmic tail domain.6 However, alternatively spliced variants lacking some of the domains have been identified.7 Initial reports demonstrated that ADAM33 is expressed in airway fibroblasts, myofibroblasts, and smooth muscle but not epithelial cells, T lymphocytes, or inflammatory cells that infiltrate the airway wall in asthma.1 However, 2 recent articles report expression of ADAM33 in the epithelium of subjects with severe asthma.8,9 Although the biochemical and molecular mechanisms underlying the contribution of ADAM33 to asthma pathogenesis are currently uncertain, its aberrant expression in epithelial cells might contribute to disease pathogenesis. Multiple mechanisms are responsible for regulation of gene expression. Among these, promoter DNA methylation is an epigenetic modification that can play an important role in gene silencing.10 Although not extensively studied as a regulatory mechanism for ADAM genes, hypermethylation of the promoter of a disintegrin and metalloprotease with thrombospondin type 1 motif (ADAMTS8), a protease with antiangiogenic properties, results in a reduction in the gene expression in neoplastic tissues,11 whereas hypomethylation of the ADAMTS4 promoter and induction of gene expression has been observed in late-stage osteoarthritis chondrocytes.12 Therefore we postulated that ADAM33 promoter methylation regulates the gene expression in bronchial fibroblasts and epithelial cells. Because aberrant expression of ADAM33 might help explain its contribution to asthma pathogenesis, we examined ADAM33 expression in 1393

1394 YANG ET AL

Abbreviations used ADAM33: A disintegrin and metalloprotease 33 ADAMTS8: A disintegrin and metalloprotease with thrombospondin type 1 motif aSMA: a-Smooth muscle actin 5-Aza-dC: 5-Aza-29-deoxycytidine BHR: Bronchial hyperresponsiveness Ct: Cycle threshold DMEM: Dulbecco’s modified Eagle’s medium DNMT: DNA methyltransferase EGF: Epidermal growth factor EMT: Epithelial-mesenchymal transition GAPDH: Glyceraldehyde-3-phosphate dehydrogenase MMP: Matrix metalloprotease MP: Metalloprotease PBEC: Primary bronchial epithelial cell PBF: Primary bronchial fibroblast RT-qPCR: Reverse transcriptase quantitative polymerase chain reaction SNP: Single nucleotide polymorphism UBC: Ubiquitin C

bronchial brushings from asthmatic subjects and explored whether the process of epithelial-mesenchymal transition (EMT)13 can result in induction of ADAM33 in epithelial cells.

METHODS Bronchoscopy, human primary bronchial cell culture, and cell lines Bronchial biopsy specimens and bronchial epithelial brushings were obtained by means of fiberoptic bronchoscopy in accordance with standard guidelines.14 The clinical characteristics of the volunteers are provided in Tables E1 through E3 (available in the Online Repository at www.jacionli ne.org). All procedures were performed after informed consent and approval by the Southampton and South West Hampshire Ethics Committee were obtained. The detailed methods for clinical characterization, growth of primary bronchial epithelial cell (PBEC) and fibroblast (PBF) cultures, and treatments of cell lines are described in the Methods section of the Online Repository at www.jacionline.org.

Extraction and purification of total RNA and RT–qPCR assays Total RNA was extracted from bronchial biopsy specimens, brushings, PBECs, PBFs, and H292, A549, and MRC5 cell lines by using the Trizol reagent kit (Invitrogen, Paisley, United Kingdom). RT–qPCR assays and sequence verification were undertaken as described in the Methods section of the Online Repository.

Assessment of promoter activity with a luciferase reporter assay A luciferase reporter plasmid was constructed by using the pGL3 basic vector (Promega, Southampton, United Kingdom). The 59 flanking region of human ADAM33, spanning 2550 to 187 and containing a putative promoter sequence, was obtained by means of PCR amplification.

Bioinformatic analyses The location of CpG islands in the ADAM33 promoter was determined by using the CpGPlot software (http://www.ebi.ac.uk/emboss/cpgplot), and putative transcription factor–binding sites were predicted by using the

J ALLERGY CLIN IMMUNOL JUNE 2008

Matlnspector software (http://www.genomatix.de/products/MatInspector/ index.html).

Analysis of DNA methylation Genomic DNA from PBFs, PBECs, and H292 and A549 cells was extracted by using the Wizard Genomic DNA purification kit (Promega, Southampton, United Kingdom). The DNA was digested with either BamHI (NEB, Herts, United Kingdom), which flanked the region to be analyzed by bisulfite sequencing,15 or with HpaII, which located the amplicon to be analyzed by means of methylation-sensitive PCR.15

Statistics Normally distributed data were analyzed by using the Student t test, whereas those that were not normally distributed were analyzed by using the Mann-Whitney U test. Details of all methods used can be found in the Methods section of the Online Repository.

RESULTS Because aberrant cellular localization can contribute to disease pathogenesis, we investigated the mechanism underlying the suppression of ADAM33 in epithelial cells. We first validated previous studies of ADAM33 expression by using RT-PCR primers (Fig 1, A) applied to a panel of human PBECs and PBFs, the H292 bronchial epithelial cell line, and MRC5 fibroblasts. No expression of ADAM33 was detected in PBECs from healthy or asthmatic subjects or the epithelial cell line H292, but expression was observed in PBFs from healthy or asthmatic subjects (Fig 1, B and C) and the embryonic fibroblast cell line MRC5 (Fig 1, B), which is consistent with previous published results.1,16 To confirm the transcriptional activity of the putative ADAM33 promoter, a 637-bp genomic sequence located 2550 to 187 relative to the transcriptional start site of the ADAM33 gene (GenBank accession no. NT_086908.1) was selected (Fig 1, A). This fragment contained 88 transcription factor–binding sites predicted with Matlnspector software (data not shown). This sequence was expected to include the basal promoter and was tested for its ability to drive transcription of plasmid-based luciferase reporter gene assays. The promoter region was PCR amplified and directionally cloned into a plasmid vector upstream of a luciferase reporter gene. The construct was cotransfected into MRC5 fibroblasts with a plasmid expressing Renilla luciferase to control for transfection efficiency. The results indicated that the selected DNA sequence at the 59 end of the ADAM33 gene did possess promoter activity (Fig 2, A), as evidenced by the increase in luciferase activity compared with that of an empty vector control. In mammals DNA methylation at CpG dinucleotides in the 59 region of genes is frequently associated with mechanisms that repress gene expression.17 Therefore we investigated whether any CpG islands lay within the ADAM33 promoter region and whether CpG island methylation might explain the silencing of ADAM33 expression in epithelial cells. Bioinformatic analysis of the ADAM33 promoter sequence showed that the region 2362 to 180 was a CpG island that contained 47 CpGs, 74% G1C content, and an observed/expected ratio of 0.79 (Fig 2, B). Thus we focused on methylation of this CpG island as a potential regulatory mechanism controlling ADAM33 expression.

J ALLERGY CLIN IMMUNOL VOLUME 121, NUMBER 6

FIG 1. Organization of the 59 region of the ADAM33 gene and analysis of its expression. A, The predicted promoter region, CpG island, Sp1-binding sites (boxed), RT-PCR primer location, and methylation sequence. B and C, ADAM33 expression in MRC5 and H292 cells, bronchial fibroblasts, and epithelial cells from healthy (Fig 1, B) or asthmatic (Fig 1, C) donors was assessed by means of RT-PCR, with GAPDH as a housekeeping gene.

Sodium bisulfite–treated genomic DNA from epithelial cells and fibroblasts was sequenced to assess ADAM33 promoter methylation. Treatment of DNA with the bisulfite reagent converts unmethylated cytosine residues to uracils that are amplified as thymine during subsequent PCR, whereas the methylated cytosine residues remain unconverted during bisulfite treatment and amplify as cytosines during subsequent PCR.18 The ADAM33 promoter region from bisulfite-treated DNA was amplified, and the PCR products cloned and sequences were analyzed. Comparison of clones from each of the epithelial cell and fibroblast DNA samples showed that the CpG dinucleotides were hypermethylated in the ADAM33 promoter of PBECs and H292 cells (Fig 3, A, upper panel, and Fig 4, B, left). In contrast, CpG dinucleotides were hypomethylated in this region of the ADAM33 promoter in PBFs (Fig 3, A, lower panel). Differential methylation of the ADAM33 promoter in asthma-derived PBECs and PBFs was confirmed by using a methylation-sensitive PCR assay that amplified a sequence across the ADAM33 promoter containing an HpaII recognition sequence. HpaII is a methylation-sensitive restriction endonuclease that cuts only unmethylated CCGG DNA sequences while leaving methylated DNA intact. Thus failure of the PCR to amplify the ADAM33 promoter sequence compared with the control sequence, as seen in the asthmatic fibroblast DNA compared with epithelial DNA (P < .001; Fig 3, B and C), is indicative of ADAM33 promoter hypomethylation in fibroblasts. To test whether methylation of the ADAM33 promoter in epithelial cells was responsible for silencing its expression, the demethylating agent 5-aza-29-deoxycytidine (5-aza-dC)19,20 was applied to H292 epithelial cells. As shown by means of RTPCR, expression of ADAM33 was not detected in H292 cells

YANG ET AL 1395

FIG 2. A, Promoter activity of ADAM33. The luciferase reporter plasmid was constructed by using a 637-bp 59 flanking fragment of the ADAM33 gene. Luciferase activity using the ADAM33 promoter in MRC5 fibroblasts was compared with that using the negative control (No insert) plasmid; activities were normalized by using Renilla luciferase activity. Data are from 3 independent experiments. B, Prediction of CpG islands between 21000 and 1400 of the ADAM33 gene by using CpGPlot software (http://www.ebi. ac.uk/emboss/cpgplot).

but could be clearly induced by 5-aza-dC treatment (Fig 4, A). Bisulfite sequencing confirmed that the ADAM33 promoter was demethylated in the 5-aza-dC–treated cells (Fig 4, B, right). Treatment of PBECs with 5-aza-dC also induced ADAM33 expression (Fig 4, C), and methylation-sensitive PCR showed that this was associated with demethylation of the ADAM33 promoter (Fig 4, D). These results strongly implicate hypermethylation of the promoter for the nonexpression of ADAM33 in epithelial cells. We further investigated the regulation of ADAM33 expression during the phenotypic change involved with EMT that has been linked to fibrosis in chronic inflammatory conditions. We selected the A549 cell line for study because it undergoes a well-characterized EMT in response to TGF-b.21 After 5 days of TGF-b1 treatment, loss of cell-cell contact and cellular elongation was observed (Fig 5, A), and there was reduced expression of the epithelial phenotypic marker E-cadherin (CDH1) and the mucin MUC2 and increased expression of mesenchymal markers, such as collagen I (COL1A1) and matrix metalloprotease (MMP) 2 (Fig 5, B). Even though there was a marked phenotypic change, the EMT did not induce expression of ADAM33 (Fig 5, B), and there was no change in the methylation status of the ADAM33 promoter (Fig 5, C). Extension of the treatment period to 17 days also failed to induce ADAM33 expression. Thus although TGF-b induced a phenotypic switch to a ‘‘fibroblastic’’ phenotype, the continued silencing of

1396 YANG ET AL

J ALLERGY CLIN IMMUNOL JUNE 2008

FIG 3. A, Cytosine methylation of the ADAM33 promoter from 3 normal PBECs and PBFs. Each row represents the methylation pattern for individual clones from bisulfite-treated DNA; unmethylated CpG sites (open circles) and methylated CpG sites (filled circles) are shown. B, Methylation-sensitive PCR with HpaII-digested genomic DNA from PBECs and PBFs from patients with asthma. C, Densitometric analysis of ADAM33 promoter methylation; peak intensity, a measure of uncut (ie, methylated) ADAM33 DNA, was normalized to control DNA. *P < .001).

ADAM33 expression suggests that the epithelial cells were not completely reprogrammed to mesenchymal cells in these experiments. Having obtained evidence that ADAM33 expression is consistently repressed in bronchial epithelial cells because of promoter methylation, we used 3 probe-based reverse transcriptase–quantitative polymerase chain reaction (RT-qPCR) assays for ADAM33 to evaluate mRNA in 14 individual bronchial brushing samples taken from 6 healthy subjects and 20 samples taken from 9 patients with severe asthma. These assays were validated by using recombinant HEK293 cells stably transfected with a cDNA encoding full-length ADAM33, where both the MP and EGF domain assays provided equivalent signals (see Fig E1, A, in the Online Repository at www.jacionline.org), but no signal was detectable in any of the epithelial samples (see Fig E2, A, in the Online Repository at www.jacionline.org). To determine whether the lack of consistency between our findings and those of Foley et al,9 who detected low levels of ADAM33 mRNA in PBECs, might be due to differences in the RT-qPCR primers used in our assays, we went on to evaluate the exact ADAM33 and S9 rRNA housekeeping gene assays used in the previous study. In these assays we detected a strong ADAM33 signal in recombinant ADAM33-expressing HEK cells and fibroblasts and lower levels of signal in

the bronchial brushings (see Figs E3 and E4 in the Online Repository at www.jacionline.org), which is consistent with the findings of Foley et al.9 Because the published protocol was a SYBR Green–based assay in which detection of the PCR product is monitored by measuring the increase in fluorescence caused by binding of SYBR Green to double-stranded DNA, we also performed melt-curve analysis to assess the homogeneity of the product formed. This analysis showed that the PCR products from epithelial cells were highly heterogeneous, suggesting mispriming rather than true amplification of ADAM33 cDNA (see Fig E5 in the Online Repository at www.jacionline.org). This conclusion was further supported by gel electrophoresis (see Fig E6 in the Online Repository at www.jacionline.org), cloning, and sequencing of the PCR products; no ADAM33 sequence was detectable in products derived from epithelial cells (see Table E4 in the Online Repository at www.jacionline.org). To further investigate whether ADAM33 expression is increased in patients with severe asthma, we used the 3 probe-based RT-qPCR assays for ADAM33 to evaluate mRNA in bronchial biopsy specimens from 15 patients with severe asthma and 8 healthy control subjects. Contrary to the recent report,9 we found no significant difference between ADAM33 expression in biopsy specimens from healthy subjects or patients with severe asthma

J ALLERGY CLIN IMMUNOL VOLUME 121, NUMBER 6

FIG 4. Induction of ADAM33 expression after 5-aza-dC treatment. After 7 days’ treatment with 5-aza-dC, expression of ADAM33 in H292 cells (A) or PBECs from asthmatic patients (C) was analyzed by means of RT-PCR (Fig 4, A) or RT-qPCR (Fig 4, C), with GAPDH as a housekeeping gene. Demethylation of the ADAM33 promoter by 5-aza-dC was confirmed in H292 cells by means of bisulphate sequencing (B) and in PBECs from asthmatic patients by means of methylation-sensitive PCR with HpaII-digested genomic DNA (D).

(Fig 6). This could not be accounted for by differences in smooth muscle content of the biopsy specimens because a-smooth muscle actin (aSMA) expression was similar in both groups (Fig 6). Comparable data were also obtained by using the SYBR Green assays (see Fig E7 in the Online Repository at www.jacionline.org).

DISCUSSION In this study we addressed the involvement of epigenetic mechanisms in the cell type–selective expression of ADAM33. We identified the ADAM33 basal promoter (2550 to 187 bp) and confirmed transcriptional activity using a luciferase reporter system. Because this region contains a predicted CpG island (2362 to 180), on the basis of its size, GC content, and CpG dinucleotide frequency,22,23 we hypothesized the possible role of methylation in silencing expression of ADAM33 in epithelial cells. In mammals DNA methylation at CpG dinucleotides in the 59 region of genes is a major epigenetic mechanism that regulates gene expression.17 Approximately 50% of mammalian gene promoters and first exons are associated with 1 or more CpG islands.24,25 The absence of methylation at CpG islands is indicative of the presence of transcriptionally active genes,15 whereas methylation of cytosines within the island results in gene silencing.26 Cytosine methylation has long been speculated to be involved in the establishment and maintenance of cell type–specific expression of regulated genes,27,28 and 5-methylcytosine is known to be involved in processes crucial to mammalian development, such as X-chromosome inactivation and gene imprinting.29-31 In a study of osteoarthritis, increased synthesis of several cartilage-degrading enzymes, including MMP-3, MMP-9, MMP-13, and ADAMTS4, was observed in late-stage osteoarthritis chondrocytes. This

YANG ET AL 1397

FIG 5. TGF-b–induced EMT does not affect ADAM33. A, The morphologic appearance of A549 cells after TGF-b–induced EMT. B, mRNA expression of EMT markers was quantified by using RT-qPCR. Data were normalized by using the DDCt method, taking the lower expression level for each gene as the normalizing value. Data are from 3 experiments. ND, Not detected. C, Methylation-sensitive PCR for ADAM33 by using HpaII-digested genomic DNA from control and TGF-b1–treated A549 cells.

was associated with hypomethylation of CpG sites in the promoter regions of these enzymes and was proposed to contribute to the development of osteoarthritis.12 In contrast, hypermethylation of the promoter of ADAMTS8, a protease with antiangiogenic properties,11 results in a reduction in its expression in neoplastic tissues, providing the tumor cells with a consequent growth advantage. Similarly, hypermethylation of the ADAM23 CpG-rich promoter leads to loss of this ADAM’s function and might be a factor in gastric carcinogenesis.32 By using bisulfite genomic DNA sequencing to detect the existence of methylation at the ADAM33 promoter region, our results indicated that low levels of methylation could be detected in fibroblasts that clearly express ADAM33. In contrast, epithelial cells that did not express ADAM33 showed a very high level of promoter methylation. The identified methylation sequence spans the transcriptional start site that usually overlaps the basic promoter, where complexes of universal transcriptional factors and RNA polymerases bind. The sequence contains several predicted cis-acting regulatory DNA elements for transcription factor binding, such as Sp1 sites (59-AGGCGG-39, 59-TGCAC-39, and 59GGGCGG-39; boxed in Fig 1, A; http://thr.cit.nih.gov/molbio/ signal/). It has recently been demonstrated that DNA methylation of the murine Abcc6 proximal promoter region inhibits Sp1dependent transactivation and controls tissue specific expression of Abcc6.33 Thus epigenetic mechanisms are also likely to be important for cell type–specific ADAM33 regulation. DNA methylation is a postsynthetic modification that normal DNA goes through after each replication. Of the 4 types of base pairs, only the CG base pair is methylated. Because DNA

1398 YANG ET AL

J ALLERGY CLIN IMMUNOL JUNE 2008

FIG 6. Quantitation of ADAM33 mRNA in bronchial biopsy specimens from healthy subjects and patients with severe asthma. Quantitative RT-PCR was performed by using primers and probes targeting the a (ADAM33-EGF-Alpha) and b (ADAM33-Beta) isoforms of ADAM33, as well as exons G and H in the metalloprotease domain (ADAM33-GH). For comparison, the levels of aSMA in each biopsy specimen are also provided. Data were analyzed by using the Mann-Whitney U test, and no significant differences were detected between the groups.

replication is semiconservative, one strand of the new DNA is already methylated, and the other strand remains to be methylated by DNA methyltransferases (DNMTs).34 DNMT1 is believed to perform most of the maintenance and de novo methylation activities that occur in somatic cells of mammals.35 Studies have shown that DNMT1 can also establish repression of transcription complexes consisting of DNMT1, histone deacetylase 2, and DNMT1-associated protein.36 DNMT1 is thought to directly target transcriptionally repressed chromatin during S-phase DNA replication. 5-Aza-dC induces selective degradation of DNMT1 and serves as a strong demethylating agent.19,20 Thus we used 5-aza-dC to assess whether the demethylating agent could restore ADAM33 expression in H292 epithelial cells. The RT-PCR results show that ADAM33 was derepressed by this procedure, thereby confirming that hypermethylation of the ADAM33 promoter is responsible repression of gene expression in epithelial cells. It has been proposed that EMT might contribute to idiopathic pulmonary fibrosis, which involves increased production of interstitial collagen in the lung parenchyma.13 Because asthma is characterized by deposition of interstitial collagen in the subepithelial basement membrane region, we considered whether epithelial expression of ADAM33 might be induced by an EMT and whether this might make a subsequent contribution to subepithelial fibrosis. Treatment of A549 lung epithelial cells with TGF-b induced a marked phenotypic transformation from a cobblestone epithelial morphology to a fibroblastic phenotype characterized by loss of cell-cell contact and cell spreading. Although we observed characteristic changes indicative of an EMT, such as increased expression of collagen I, ADAM33 mRNA expression was not induced. From our studies, we conclude that ADAM33 promoter methylation silences gene expression in epithelial cells, irrespective of disease status. Assuming that there are no differences in ADAM33 expression and regulation linked to ethnic background, our epigenetic findings, together with our mRNA data from bronchial brushings and PBECs, suggest that the low level of signal previously detected in PBECs by means of RT-qPCR9 might be artifactual. The fact that ADAM33 expression remains silenced

in epithelial cells also raises doubts over the specificity of the antibody used to detect ADAM33 in the study by Lee et al.8 In our own previous study we found some immunostaining of the epithelium; however, this could not be blocked by the immunizing peptide, suggesting a nonspecific interaction (eg, with epithelial cytokeratins).5 Similarly, we found nonspecific bands in Western blots of mock-transfected HEK293 cells, where no ADAM33 expression was detectable by means of RT-qPCR (see Fig E3). Even though Foley et al9 undertook their immunohistochemistry study with care and were able to block the majority of signal with the immunizing peptide, this does not eliminate the possibility that other tissue proteins might cross-react with the antisera.37 Where claims are made for epithelial expression of ADAM33, it will be important to demonstrate independently that the immunoreactivity detected in the epithelium is indeed ADAM33 (eg, by obtaining peptide sequence data for the immunoreactive protein by means of mass spectrometry). Because we failed to detect ADAM33 mRNA in bronchial brushings, we wished to confirm whether ADAM33 expression was increased in bronchial biopsy specimens from subjects with severe asthma, where the presence of ADAM33 would be due to its expression in bronchial smooth muscle and fibroblasts. However, we found no difference in expression levels compared with those of healthy subjects by using the 3 probe-based ADAM33 RT-qPCR assays, as well as the SYBR Green assay. Thus our comprehensive data are not consistent with the recent report by Foley et al,9 who found increased expression of ADAM33 in airway samples from severe asthmatic subjects. One possible explanation for the difference between the published data and our findings lies in biopsy sampling and tissue heterogeneity. Because ADAM33 is expressed in smooth muscle, the level of expression will reflect the proportion of smooth muscle in each biopsy specimen. In this and our previous study,5 we also analyzed aSMA expression as a marker of smooth muscle content and expressed ADAM33 mRNA relative to aSMA mRNA. Because Foley et al9 did not take this into account, the occurrence of more smooth muscle in their asthma samples would result in detection of a larger signal that might not reflect

YANG ET AL 1399

J ALLERGY CLIN IMMUNOL VOLUME 121, NUMBER 6

a true increase in transcription. Our findings suggest that ADAM33 expression is strictly silenced in epithelial cells regardless of asthma, supporting our previous conclusion that increased expression of ADAM33 in asthmatic airways is unlikely to account for its contribution to disease pathogenesis.5 This supposition is supported by genetic studies that have failed to show any genetic association of SNPs in the ADAM33 promoter with asthma or BHR.1 In conclusion, we have demonstrated that the cell type– selective expression of ADAM33 is epigenetically controlled by DNA methylation. Failure to induce ADAM33 during the phenotypic reprogramming that occurs during a TGF-b–induced EMT and lack of evidence of ADAM33 mRNA in any samples of bronchial epithelium strongly suggest that ADAM33 repression is a stable feature of airway epithelial cells. Furthermore, we could find no evidence of increased ADAM33 mRNA expression in severe asthma.

13. 14.

15. 16.

17. 18.

19.

20.

We thank Synairgen Research Ltd for provision of PBFs. 21.

Clinical implications: It is unlikely that dysregulated expression of ADAM33 in epithelial cells underlies its contribution to asthma pathogenesis. REFERENCES 1. Van Eerdewegh P, Little RD, Dupuis J, Del Mastro RG, Falls K, Simon J, et al. Association of the ADAM-33 gene with asthma and bronchial hyper-responsiveness. Nature 2002;418:426-30. 2. De Sanctis GT, Merchant M, Beier DR, Dredge RD, Grobholz JK, Martin TR, et al. Quantitative locus analysis of airway hyperresponsiveness in A/J and C57BL/6J mice. Nat Genet 1995;11:150-4. 3. Simpson A, Maniatis N, Jury F, Cakebread JA, Lowe LA, Holgate ST, et al. Polymorphisms in a disintegrin and metalloprotease 33 (ADAM33) predict impaired early-life lung function. Am J Respir Crit Care Med 2005;172:55-60. 4. van Diemen CC, Postma DS, Vonk JM, Bruinenberg M, Schouten JP, Boezen HM. A Disintegrin A Metalloprotease 33 polymorphisms and lung function decline in the general population. Am J Respir Crit Care Med 2005;172:329-33. 5. Haitchi HM, Powell RM, Shaw TJ, Howarth PH, Wilson SJ, Wilson DI, et al. ADAM33 expression in asthmatic airways and human embryonic lungs. Am J Respir Crit Care Med 2005;171:958-65. 6. Blobel CP. Remarkable roles of proteolysis on and beyond the cell surface. Curr Opin Cell Biol 2000;12:606-12. 7. Powell RM, Wicks J, Holloway JW, Holgate ST, Davies DE. The splicing and fate of ADAM33 transcripts in primary human airways fibroblasts. Am J Respir Cell Mol Biol 2004;31:13-21. 8. Lee JY, Park SW, Chang HK, Kim HY, Rhim T, Lee JH, et al. A disintegrin and metalloproteinase 33 protein in patients with asthma: relevance to airflow limitation. Am J Respir Crit Care Med 2006;173:729-35. 9. Foley SC, Mogas AK, Olivenstein R, Fiset PO, Chakir J, Bourbeau J, et al. Increased expression of ADAM33 and ADAM8 with disease progression in asthma. J Allergy Clin Immunol 2007;119:863-71. 10. Razin A, Kantor B. DNA methylation in epigenetic control of gene expression. Prog Mol Subcell Biol 2005;38:151-67. 11. Dunn JR, Reed JE, du Plessis DG, Shaw EJ, Reeves P, Gee AL, et al. Expression of ADAMTS-8, a secreted protease with antiangiogenic properties, is downregulated in brain tumours. Br J Cancer 2006;94:1186-93. 12. Roach HI, Yamada N, Cheung KS, Tilley S, Clarke NM, Oreffo RO, et al. Association between the abnormal expression of matrix-degrading enzymes by human

22. 23. 24. 25. 26.

27. 28.

29. 30. 31. 32.

33.

34. 35.

36. 37.

osteoarthritic chondrocytes and demethylation of specific CpG sites in the promoter regions. Arthritis Rheum 2005;52:3110-24. Willis BC, duBois RM, Borok Z. Epithelial origin of myofibroblasts during fibrosis in the lung. Proc Am Thorac Soc 2006;3:377-82. Hurd SZ. Workshop summary and guidelines: investigative use of bronchoscopy, lavage, and bronchial biopsies in asthma and other airway diseases. J Allergy Clin Immunol 1991;88:808-14. Clark SJ, Harrison J, Paul CL, Frommer M. High sensitivity mapping of methylated cytosines. Nucleic Acids Res 1994;22:2990-7. Umland SP, Garlisi CG, Shah H, Wan Y, Zou J, Devito KE, et al. Human ADAM33 mRNA expression profile and post-transcriptional regulation. Am J Respir Cell Mol Biol 2003;29:571-82. Bird A. The essentials of DNA methylation. Cell 1992;70:5-8. Frommer M, McDonald LE, Millar DS, Collis CM, Watt F, Grigg GW, et al. A genomic sequencing protocol that yields a positive display of 5-methylcytosine residues in individual DNA strands. Proc Natl Acad Sci U S A 1992;89: 1827-31. Ferguson AT, Evron E, Umbricht CB, Pandita TK, Chan TA, Hermeking H, et al. High frequency of hypermethylation at the 14-3-3 sigma locus leads to gene silencing in breast cancer. Proc Natl Acad Sci U S A 2000;97:6049-54. Ghoshal K, Datta J, Majumder S, Bai S, Kutay H, Motiwala T, et al. 5-Aza-deoxycytidine induces selective degradation of DNA methyltransferase 1 by a proteasomal pathway that requires the KEN box, bromo-adjacent homology domain, and nuclear localization signal. Mol Cell Biol 2005;25:4727-41. Kasai H, Allen JT, Mason RM, Kamimura T, Zhang Z. TGF-beta1 induces human alveolar epithelial to mesenchymal cell transition (EMT). Respir Res 2005;6:56. Gardiner-Garden M, Frommer M. CpG islands in vertebrate genomes. J Mol Biol 1987;196:261-82. Takai D, Jones PA. Comprehensive analysis of CpG islands in human chromosomes 21 and 22. Proc Natl Acad Sci U S A 2002;99:3740-5. Ioshikhes IP, Zhang MQ. Large-scale human promoter mapping using CpG islands. Nat Genet 2000;26:61-3. Larsen F, Gundersen G, Lopez R, Prydz H. CpG islands as gene markers in the human genome. Genomics 1992;13:1095-107. Roder K, Latasa MJ, Sul HS. Silencing of the mouse H-rev107 gene encoding a class II tumor suppressor by CpG methylation. J Biol Chem 2002;277: 30543-50. Holliday R, Pugh JE. DNA modification mechanisms and gene activity during development. Science 1975;187:226-32. Futscher BW, Oshiro MM, Wozniak RJ, Holtan N, Hanigan CL, Duan H, et al. Role for DNA methylation in the control of cell type specific maspin expression. Nat Genet 2002;31:175-9. Li E, Bestor TH, Jaenisch R. Targeted mutation of the DNA methyltransferase gene results in embryonic lethality. Cell 1992;69:915-26. Li E, Beard C, Jaenisch R. Role for DNA methylation in genomic imprinting. Nature 1993;366:362-5. Beard C, Li E, Jaenisch R. Loss of methylation activates Xist in somatic but not in embryonic cells. Genes Dev 1995;9:2325-34. Takada H, Imoto I, Tsuda H, Nakanishi Y, Ichikura T, Mochizuki H, et al. ADAM23, a possible tumor suppressor gene, is frequently silenced in gastric cancers by homozygous deletion or aberrant promoter hypermethylation. Oncogene 2005;24:8051-60. Douet V, Heller MB, Le SO. DNA methylation and Sp1 binding determine the tissue-specific transcriptional activity of the mouse Abcc6 promoter. Biochem Biophys Res Commun 2007;354:66-71. Goll MG, Bestor TH. Eukaryotic cytosine methyltransferases. Annu Rev Biochem 2005;74:481-514. Yen RW, Vertino PM, Nelkin BD, Yu JJ, el Deiry W, Cumaraswamy A, et al. Isolation and characterization of the cDNA encoding human DNA methyltransferase. Nucleic Acids Res 1992;20:2287-91. Rountree MR, Bachman KE, Baylin SB. DNMT1 binds HDAC2 and a new co-repressor, DMAP1, to form a complex at replication foci. Nat Genet 2000;25:269-77. Saper CB. An open letter to our readers on the use of antibodies. J Comp Neurol 2005;493:477-8.

1399.e1 YANG ET AL

METHODS Clinical characterization of subjects Subjects were characterized according to symptoms, lung function, medication, and skin prick test responses to common aeroallergens. Their clinical characteristics are summarized in Tables E1 through E3. Asthma severity was assessed according to the Global Initiative for Asthma guidelines.E1 All volunteers were nonsmokers and free from respiratory tract infections for a minimum of 4 weeks before inclusion into the study. Written informed consent was obtained from all volunteers before participation, and ethical approval for the study was obtained from the Joint Ethics Committee of Southampton University Hospital Trust.

Bronchoscopy, human primary bronchial cell culture, and cell lines All procedures were performed after informed consent and approval by the Southampton and South West Hampshire Ethics Committee. Fiberoptic bronchoscopy was performed according to current guidelines. Surface epithelial cells were obtained by means of gentle bronchial brushing, and bronchial biopsy specimens were taken from the subcarinae of the lower and middle lobes with alligator forceps. Cells from brushings and biopsy specimens were either homogenized immediately into TRIZOL reagent for RNA extraction or were used for primary cell culture. PBEC culture and characterization was performed as described previously.E2,E3 PBFs were obtained by outgrowth from bronchial biopsy specimens and cultured as previously described.E4,E5 PBEC and PBF cultures from 4 healthy and 12 asthmatic individuals were used in this study. H292 bronchial epithelial cells, A549 alveolar epithelial cells, and MRC5 fetal fibroblasts were routinely cultured in Dulbecco’s modified Eagle’s medium (DMEM) containing 10% heatinactivated FBS. Recombinant HEK293 cells were generated by means of lipid (Effectene) transfection with the pcDNA3 vector containing full-length ADAM33 cDNA or empty vector as a control. Stable transfectants were selected by using G418 and cell lines generated by 2 rounds of cloning by means of limiting dilution. HEK293 cells were routinely cultured in DMEM supplemented with 10% vol/vol FBS and antibiotics.

Treatment with 5-aza-dC H292 cells or PBECs were plated in DMEM/10% FBS or bronchial epithelial growth medium and treated with a freshly prepared solution of 2, 5, or 10 mmol/L 5-aza-dC (Sigma, Dorset, United Kingdom) for 7 days. The medium and the drug were replaced every 24 hours. At the end of the treatment period, the medium was removed, and then DNA and RNA were extracted for sodium bisulfite genomic DNA sequencing or methylation-sensitive PCR and RT-PCR, respectively.

J ALLERGY CLIN IMMUNOL JUNE 2008

electrophoresed on 2% agarose gel and visualized by using a GENE GENIUS Bio Imaging System. For quantitative analysis of ADAM33, the epithelial markers E-cadherin (CDH1) and MUC2, and the mesenchymal markers COL1A1 and MMP-2, real-time PCR was performed by using gene-specific primers with either a gene-specific fluorogenic probe or SYBR Green (if no probe sequence is indicated) with an Icycler (BioRad, Hercules, Calif), with GAPDH and ubiquitin C (UBC) as normalizing genes (kits obtained from PrimerDesign, Southampton, United Kingdom). Analysis of RT-qPCR data was performed by using the DDCt method. The primers sequences were as follows: ADAM33 EGF a (exons Q1R)—forward CTGCCACAGCCACGGGGTTTG, reverse TGTCCATGCTGCCACCAA, probe CCACCCTTCTGTGACAAGC CAGGCT; ADAM33 b (exons P1R)—forward ACCCAGTGTGGACCT AGAATGGTTTGCAAT, reverse TGTCCATGCTGCCACCAA, probe: CCACCCTTCTGTGACAAGCCAGGCT; ADAM33 MP (exons G1H)—forward CCTGGAACTGTACATTGTGGCA, reverse GTCCACGT AGTTGGCGACTTC, probe CCACACCCTGTTCTTGACTCGGCAC; AD AM33 a-isoform (Foley)—forward GACCTAGAATGGTGTGCCAGA, reverse AGCCTGGCTTGTCACAGAAG; rRNA S9 (Foley)—forward TGC TGACGCTTGATGAGAAG, reverse CGCAGAGAGAAGTCGATGTG; MU C2—forward CTGGATTCTGGAAAACCCAACTTT, reverse GGTGGCTC TGCAAGAGATGTT, probe CCAATCAATTCTGTGTCTCCACCTGGT; CD H1—forward CATGAGTGTCCCCCGGTATC, reverse CAGTATCAGCCG CTTTCAGA; MMP2—forward CCAAGTGGTCCGTGTGAAGT, reverse CATGGTGAACAGGGCTTCAT; COL1A1—forward AGACAGTGATTGA ATACAAAACCA, reverse GGAGTTTACAGGAAGCAGACA.

Assessment of promoter activity with a luciferase reporter assay A luciferase reporter plasmid was constructed by using the pGL3 basic vector (Promega). The 59 flanking region of human ADAM33, spanning 2550 to 187 and containing a putative promoter sequence, was PCR amplified by using the forward primer gcggtaccTGCTGCATCGCCTTTGCC and the reverse primer caagatctGCTGTGAGCTCCTCGGCCTCTAG. The reverse primer was adjacent to but did not include the translation start site. The forward primer was tagged with KpnI (59) and the reverse primer was tagged with BglII (39) restriction sites (lower case) for cloning into the vector. Resulting constructs were verified by means of sequencing. Transfections were performed with the Qiagen Effectene kit (Qiagen, Sussex, United Kingdom). MRC5 fetal lung fibroblasts were transfected according to the manufacturer’s protocol with 1 mg of reporter plasmid and 300 ng of Renilla luciferase (pRL; Promega) as an internal control for transfection efficiency. Cells were harvested 48 hours after transfection, and promoter activities were analyzed by using the Dual-luciferase Reporter assay system, according to the manufacturer’s instructions (Promega). Activities were normalized to Renilla luciferase activity. Experiments were performed in triplicate, and results presented are the mean of 3 independent experiments.

Epithelial mesenchymal transition A549 alveolar epithelial cells were seeded into 24-well plates at 40,000 cells per well and cultured for 48 hours in DMEM with 10% FBS. The cells were then exposed to 2.5 ng/mL TGF-b1 for up to 5 days.

Extraction and purification of total RNA and RT–PCR assay RNA was extracted according to the manufacturer’s protocol, and samples were treated with RNase-free DNase (Ambion, Huntingdon, United Kingdom) to eliminate contaminating genomic DNA. Total RNA (0.2 mg), random hexamers (100 ng), and M-MLV reverse transcriptase (120 U; Promega, Southampton, United Kingdom) were used for cDNA production. cDNA was amplified by means of standard PCR with primers detecting ADAM33 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The primer sequences were as follow: ADAM33: forward GTTGCTGCTGCTGCTACTACTG, reverse GGAGCTCCTGGCCTTCAG; GAPDH: forward GAAGGTGAAGGTCGGAGT, reverse GAAGATGGTGATGGGATTTC. The products were

Treatment of genomic DNA for analysis of methylation status Genomic DNA from PBFs, PBECs, and H292 cells was extracted by using the Wizard Genomic DNA purification kit (Promega) and digested with BamHI (NEB), which flanks the region analyzed by means of bisulfite sequencing, or HpaII, which locates the amplicon analyzed by means of methylation-sensitive PCR.E6 After BamH1 digestion, DNA was purified by means of phenol-chloroform extraction and resuspended in 50 mL of TE buffer. For bisulfite sequencing, 2 mg of digested genomic DNA was denatured in 20 mL of 0.3 M NaOH for 20 minutes at 378C and then placed on ice. A 220-mL aliquot of fresh 3.5 M sodium bisulfite with 1 mM hydroquinone was added, and the solution was covered with liquid wax. The solution was incubated at 08C overnight and then 508C for 8 hours in a water bath. The resulting bisulfitetreated DNA was purified with the QIAEX II Extraction Kit (Qiagen) and resuspended in 50 mL of water; 1 mL of this was used for each subsequent PCR analysis. For methylation-sensitive PCR analysis, 2 mg of genomic DNA was digested overnight at 378C with 5 units of HpaII (a methylation-sensitive

J ALLERGY CLIN IMMUNOL VOLUME 121, NUMBER 6

restriction enzyme that has a recognition site within the target sequence of the ADAM33 promoter) and PstI (NEB) in a total volume of 20 mL. PstI is a methylation-insensitive restriction enzyme that flanks the region to be analyzed by means of methylation-sensitive PCR and was used to digest the DNA to ensure that HpaII cleavage was efficient. The following morning, an additional 3 U of HpaII was added and incubated for a further hour. They were then diluted to a final concentration of 25 ng/mL for PCR analysis.

Cloning and sequencing of bisulfite-treated DNA The bisulfite-treated DNA was amplified by means of PCR with the primers GGTGGGAGGTGGGGGYGGGAAGGTT and ACCCATAACTATAAACTCCTCRACCTCTA, cloned, and sequenced to determine the methylation status of cytosines in the CpG island of the ADAM33 promoter. Each PCR was performed in 9 mL and covered with liquid wax. Reactions contained 40 ng of treated DNA, 0.1 mM of appropriate primers, 50 mM of deoxynucleoside triphosphate, and 0.4 U of Taq DNA Polymerase (NEB). PCR conditions were 958C for 1 minute, followed by 36 cycles of 958C for 20 seconds, 668C for 1 minute, and 728C for 30 seconds and finally 728C for 7 minutes. Before cloning, amplification was confirmed by running a portion of the PCR products on a 2% agarose gel with ethidium bromide to verify that products were of the expected size. Two independent PCRs from each sample were mixed together and cloned into the pCR 2.1-TOPO vector to decrease the chance of stochastically amplified PCR products, according to the manufacturer’s recommendation (Invitrogen). Ten clones were selected at random from each DNA sample; plasmid DNA was isolated by using the QIApre Spin Mini-prep kit (Qiagen) and sequenced with T7 primer by using an ABI 3730xl DNA Analyzer (Applied Biosystems, Foster City, Calif). Sequencing was done with Macrogen (Seoul, Korea). In the alignment process vector and primer sequences were removed, and cloned sequences were aligned. For methylation-sensitive PCR, the HpaII-cut DNA was amplified by using 2 pairs of primers: the first pair, GCGGTCCTCCAAGAACCTTCC and TGCGGCCCCTCGGATGAC, spanned an amplicon containing an HpaII recognition site in the ADAM33 promoter, and the second pair, TGAAACGCCTCTCTGAGGTT and GGCAAATAGACGGCACTCTC, amplified a sequence that did not contain an HpaII-cutting site and served as an internal control. Each PCR was performed in 20 mL containing 50 ng of digested DNA, 0.6 mM of appropriate primers, 200 mM of deoxynucleoside triphosphate, and 0.4 U of Taq DNA Polymerase (NEB). PCR conditions were 958C for 3 minutes, followed by 30 cycles of 958C for 30 seconds, 608C for 30 seconds, and 728C for 20 seconds and finally 728C for 7 minutes. PCR products were run on a 3% agarose gel with ethidium bromide.

Western blot analysis Lysates of HEK293 cells expressing recombinant ADAM33 or mocktransfected control cells were solubilized, separated by means of SDS gel electrophoresis, and Western blotted with an affinity-purified rabbit antibody raised against the cytoplasmic domain of ADAM33 (RP3; Triple Point Biologics, Inc, Forest Grove, Ore), as previously described.E7

RESULTS Validation of the ADAM33 qPCR assays We used 3 probe-based assays to quantify ADAM33 expression in our airway-derived samples. These assays allowed assessment of the a and b isoforms of ADAM33, which vary in the EGF domain (the b isoform lacks exon Q), whereas the third assay enabled quantitation of exons G and H, which lie in the ADAM33 metalloprotease domain. This region was targeted for study because we have previously shown that only approximately 5% to 10% of ADAM33 transcripts contain the MP domain.E4 We first validated these assays by using HEK293 cells, which were transfected with a cDNA encoding full-length ADAM33. This allowed us to show that the ADAM33 EGF a and MP domain assays were of comparable efficiency (Fig E1, A). We were unable to test

YANG ET AL 1399.e2

the ADAM33-EGF-b assay in the cells because the recombinant cells expressed only the full-length a isoform of ADAM33. However, the efficiency of this assay was 97.8%, and when tested with cDNA from human bronchial fibroblasts, this splice variant was relatively poorly expressed compared with the a isoform (Fig E1, B), as previously reported.E4 These assays were used to evaluate ADAM33 mRNA in 14 bronchial brushings from 6 healthy subjects and 16 bronchial brushings from 9 patients with severe asthma; however, no positive signal was detectable, even though a strong signal was detected by using fibroblasts as a positive control (Fig E2, A). Failure to detect a positive signal for ADAM33 mRNA was not due to poor quality or quantity of RNA extracted from the brushings because strong signals were detected for the housekeeping genes (average cycle threshold (Ct) values of 20 to 21) and the epithelial-specific gene MUC5AC, whereas low signals were detected for the myofibroblast marker aSMA (Fig E2, B). To determine whether the lack of consistency between our findings and those of Foley et alE8 might be due to differences in the RT-qPCR primers used in our assays, we went on to evaluate the exact ADAM33 and S9 rRNA housekeeping gene assays used in the previous study. These assays differed from our probe-based assays in that detection of the PCR product used SYBR Green. In these assays we detected a strong ADAM33 signal in recombinant ADAM33-expressing HEK cells and fibroblasts and lower levels of signal in mocked-transfected HEK293 cells and even less in RT minus and water controls (Fig E3, left panel). The S9 rRNA housekeeping gene assay gave strong signals for all samples except the RT minus and water controls. Because the published protocol used SYBR Green to detect the PCR product by measuring the increase in fluorescence caused by binding of SYBR Green to double-stranded DNA, this system will detect not only gene-specific product but also any products arising because of mispriming. This contrasts with probe-based assays, in which detection is dependent on the increase in fluorescence arising from cleavage of a quenched probe that is complementary to the target gene PCR product, resulting in a much higher level of specificity. Recognizing the limitations of the SYBR Green protocol, we also performed melt-curve analysis to assess the homogeneity of the product formed in every assay. For the HEK cells expressing recombinant ADAM33 and human bronchial fibroblasts, a homogeneous PCR product melting at 918C was detected (Fig E3, right panel). In contrast, cDNA from the mock-transfected HEK cells, which resulted in Ct values of 28 to 30, suggestive of low-level ADAM33 expression, yielded heterogeneous PCR products, as evidenced by the melting of multiple peaks over a range of temperatures, none of which occurred at 918C, indicating the absence of ADAM33 expression. Of interest, the antibody against the cytoplasmic tail of ADAM33 (RP3), which has previously been used to detect ADAM33 protein expression by immunostaining,E8,E9 recognized full-length ADAM33 in the transfected HEK293 cells as expected but also detected protein bands between 75 and 50 kd in mock-transfected cells that lacked ADAM33 expression (Fig E3, far right). This suggests that other tissue proteins might cross-react with the ADAM33 antibodies, as has been observed with other unrelated antibodies in studies using knockout mice.E10 Furthermore, it is unlikely that this antibody can detect epithelial deposition of secreted ADAM33 protein produced by smooth muscle and fibroblasts because it recognizes an epitope in the cytoplasmic domain of ADAM33.

1399.e3 YANG ET AL

When bronchial brushings from healthy or asthmatic volunteers were analyzed, the amplification curves for ADAM33 yielded Ct values in the region of 30 to 36 (Fig E4, left panel). Although many of the ADAM33 signals were earlier than the RT minus controls, melt-curve analysis (Fig E4, right panel) showed that the products of these reactions were heterogeneous, strongly suggesting that the PCR products formed were due to mispriming. In all cases the housekeeping gene produced strong signals, showing that the quantity of input cDNA was similar between groups (Fig E4, bottom panels). Fig E5 shows a summary of the data obtained for bronchial brushings and bronchial biopsy specimens from healthy subjects and patients with severe asthma. In all cases biopsy specimens resulted in a relatively homogeneous product consistent with the presence of ADAM33 in the samples. Analysis of these data revealed that there was no significant difference in ADAM33 expression in bronchial biopsy specimens from healthy subjects and patients with severe asthma (Fig E7). In contrast with the findings for the biopsy specimens, the data for the brushings were strongly suggestive that the majority of the signal detected in the samples was not due to the presence of an ADAM33-specific product. There was no difference in the quality or quantity of the signal obtained from brushings from healthy and asthmatic subjects. To confirm the findings of the melt-curve analysis on bronchial epithelial brushings, we further analyzed the PCR products dyed with SYBR Green by means of 4% agarose gel electrophoresis (Fig E6). This showed a single band at 160 bp for ADAM33-expressing HEK cells, fibroblasts, and biopsy specimens, whereas multiple bands were observed in products derived from bronchial brushings. Because some of these bands were of a similar size to the ADAM33 products, we wished to be absolutely certain that this was not due to very low levels of ADAM33 expression. Consequently, the bands were cut from the gel, cloned, and

J ALLERGY CLIN IMMUNOL JUNE 2008

sequenced. As shown in Table E4, this revealed that none of the bands from the bronchial brushings gave rise to clones containing any ADAM33 sequence. In contrast, PCR products from fibroblasts and biopsy specimens generated positive clones. Thus although some of the PCR products in the bronchial brushings had the anticipated size, this appeared to have arisen by chance because of mispriming during the PCR reaction. We therefore conclude that bronchial epithelial brushings do not express ADAM33. REFERENCES E1. Bousquet J. Global initiative for asthma (GINA) and its objectives. Clin Exp Allergy 2000;30(suppl 1):S2-5. E2. Bucchieri F, Puddicombe SM, Lordan JL, Richter A, Buchanan D, Wilson SJ, et al. Asthmatic bronchial epithelium is more susceptible to oxidant-induced apoptosis. Am J Respir Cell Mol Biol 2002;27:179-85. E3. Lordan JL, Bucchieri F, Richter A, Konstantinidis AK, Holloway JW, Puddicombe SM, et al. Co-operative effects of Th-2 cytokines and allergen on normal and asthmatic bronchial epithelial cells. J Immunol 2002;169:407-14. E4. Powell RM, Wicks J, Holloway JW, Holgate ST, Davies DE. The splicing and fate of ADAM33 transcripts in primary human airways fibroblasts. Am J Respir Cell Mol Biol 2004;31:13-21. E5. Richter A, Puddicombe SM, Lordan JL, Bucchieri F, Wilson SJ, Djukanovic R, et al. The contribution of interleukin (IL)-4 and IL-13 to the epithelial-mesenchymal trophic unit in asthma. Am J Respir Cell Mol Biol 2001;25:385-91. E6. Clark SJ, Harrison J, Paul CL, Frommer M. High sensitivity mapping of methylated cytosines. Nucleic Acids Res 1994;22:2990-7. E7. Powell RM, Wicks J, Holloway JW, Holgate ST, Davies DE. The splicing and fate of ADAM33 transcripts in primary human airways fibroblasts. Am J Respir Cell Mol Biol 2004;31:13-21. E8. Foley SC, Mogas AK, Olivenstein R, Fiset PO, Chakir J, Bourbeau J, et al. Increased expression of ADAM33 and ADAM8 with disease progression in asthma. J Allergy Clin Immunol 2007;119:863-71. E9. Haitchi HM, Powell RM, Shaw TJ, Howarth PH, Wilson SJ, Wilson DI, et al. ADAM33 expression in asthmatic airways and human embryonic lungs. Am J Respir Crit Care Med 2005;171:958-65. E10. Saper CB. An open letter to our readers on the use of antibodies. J Comp Neurol 2005;493:477-8.

J ALLERGY CLIN IMMUNOL VOLUME 121, NUMBER 6

YANG ET AL 1399.e4

FIG E1. A, Validation of probe-based qPCR assays for ADAM33. cDNA from HEK293 cells expressing recombinant ADAM33 cells was tested for equivalence by using primers in the EGF domain (ADAM33-EGF-a) and the metalloprotease domain (ADAM33-GH); mock-transfected cells were used as control. B, Comparison of the ADAM33-EGF-a, ADAM33-b, and ADAM33-GH assays by using cDNA from PBFs. Data are presented as means 6 SDs.

1399.e5 YANG ET AL

J ALLERGY CLIN IMMUNOL JUNE 2008

FIG E2. A, Analysis of ADAM33 expression in bronchial brushings. cDNA from bronchial epithelial brushings was tested for ADAM33 expression by using the 3 validated probe-based assays, with fibroblast cDNA being used as a positive control. B, The quantity and quality of the RNA from bronchial brushings was assessed by using primers to MUC5AC, with aSMA to control for the signal from fibroblasts. Data are presented as means 6 SDs.

J ALLERGY CLIN IMMUNOL VOLUME 121, NUMBER 6

YANG ET AL 1399.e6

FIG E3. Validation of the SYBR Green assays for the ADAM33-a isoform and S9 rRNA. The upper 2 plots in the left panel show amplification curves for ADAM33 expression in HEK293 cells expressing recombinant ADAM33 (red) and mock-transfected cells (orange; upper panel) and fibroblasts (green) and RT2 (purple) and water (blue) controls (lower panel). The lower 2 plots show amplification curves for S9 rRNA by using the same samples as used for ADAM33. The right panel shows the corresponding melt curves for each sample, and on the far right, a Western blot using an anti-ADAM33 antibody against cell lysates prepared from ADAM33-transfected or mock-transfected HEK293 cells is shown.

1399.e7 YANG ET AL

J ALLERGY CLIN IMMUNOL JUNE 2008

FIG E4. Analysis of mRNA in bronchial epithelial brushings by using the SYBR Green assays for ADAM33-a isoform and S9 rRNA. The left panel shows (in descending order) the amplification curves obtained for ADAM33 expression in bronchial brushings from healthy control volunteers (green), patients with severe asthma (red), and the RT minus and water controls (purple and blue). The bottom plots shows curves for S9 rRNA. The right panel shows the corresponding melt curves for each sample.

J ALLERGY CLIN IMMUNOL VOLUME 121, NUMBER 6

YANG ET AL 1399.e8

FIG E5. Melt curve analysis of PCR products obtained in assays of bronchial epithelial brushings and bronchial biopsy specimens by using the SYBR Green assays for the ADAM33-a isoform. The upper 2 panels show melt curves obtained for PCR products from bronchial brushings (upper panels) and bronchial biopsy specimens (lower panels) from healthy subjects (left) and asthmatic patients (right). The bottom 2 panels are the same on both the left and right and show control data for comparison. These comparative data are melt curves obtained for PCR products from expression fibroblasts (green), the RT minus and water controls (purple and blue), and HEK293 cells expressing ADAM33-transfected (red) or mock-transfected cells (yellow).

1399.e9 YANG ET AL

J ALLERGY CLIN IMMUNOL JUNE 2008

FIG E6. Agarose gel electrophoresis of PCR products from the SYBR Green assays for the ADAM33-a isoform. The plate shows a typical gel for the PCR products from bronchial brushings (B), fibroblasts (F), HEK293 cells expressing ADAM33 (H1), and the RT minus control. The region of the gel that was selected for excision and cloning of the PCR products is indicated.

J ALLERGY CLIN IMMUNOL VOLUME 121, NUMBER 6

YANG ET AL 1399.e10

FIG E7. Quantitation of ADAM33 expression in bronchial biopsy specimens from healthy subjects and patients with severe asthma by using the SYBR Green assays for the ADAM33-a isoform. cDNA from the biopsy specimens used in the probe-based ADAM33 assays was reanalyzed by using the SYBR Green assay. The data were normalized by using S9 rRNA, as described by Foley et al.9 Data were analyzed by using the Mann-Whitney U test; no significant differences were detected between the groups.

1399.e11 YANG ET AL

J ALLERGY CLIN IMMUNOL JUNE 2008

TABLE E1. Bronchial brushing subject characteristics

No. of subjects No. of BBRs/mean per subject Sex (F/M) Age (y), mean (range) FEV1 (% predicted), range Atopy (yes/no) ICS (BDP equivalent, mg/d) LABA (yes/no)

Control subjects

Subjects with severe asthma

6 14/2.3 1/5 42 (19-64) 106 (90-134) 3/3 0 0

9 16/1.8 6/3 47 (17-63) 64 (30-119)* 5/4 2000 (50-4000) 9/0

BBR, Bronchial brushing; F, female; M, male; ICS, inhaled corticosteroids; BDP, beclomethasone dipropionate; LABA, long-acting b-agonists. *Significant difference (P < .05).

YANG ET AL 1399.e12

J ALLERGY CLIN IMMUNOL VOLUME 121, NUMBER 6

TABLE E2. Bronchial biopsy specimen subject characteristics

No. of subjects No. of BBXs/mean per subject Sex (F/M) Age (y), mean (range) FEV1 (% predicted), range Atopy (yes/no) ICS (BDP equivalent, mg/d) LABA (yes/no)

Control subjects

Subjects with severe asthma

8 15/1.9 3/5 41 (19-64) 105 (90-134) 5/3 0 0

15 23/1.5 11/4 44 (17-71) 70 (30-125)* 9/6 2000 (500-4000) 15/0

BBX, Bronchial biopsy specimens; F, female; M, male; ICS, inhaled corticosteroids; BDP, beclomethasone dipropionate; LABA, long-acting b-agonists. *Significant difference (P < .05).

1399.e13 YANG ET AL

J ALLERGY CLIN IMMUNOL JUNE 2008

TABLE E3. Primary epithelial cell fibroblast subject characteristics

No. of subjects Sex (F/M) Age (y), mean (range) FEV1 (% predicted), range Atopy (yes/no) ICS (BDP equivalent, mg/d) LABA (yes/no)

Control subjects

Subjects with mild/moderate asthma

Subjects with severe asthma

4 0/4 34 (21-64) 101 (91-112) 0/4 0 0

6 5/1 32 (18-59) 102 (92-103) 6/0 470 (200-2000) 0

6 5/1 52 (31-64) 71 (39-89)* 4/2 980 (200-2000) 5/1

F, Female; M, male; ICS, inhaled corticosteroids; BDP, beclomethasone dipropionate; LABA, long-acting b-agonists. *Significant difference (P < .05).

YANG ET AL 1399.e14

J ALLERGY CLIN IMMUNOL VOLUME 121, NUMBER 6

TABLE E4. Aligned sequences determined from clones derived from bands cut from agarose gels of PCR products from fibroblasts, bronchial brushings, bronchial biopsy specimens, HEK293 mock-transfected cells, and negative water controls Source of RT-qPCR product

Aligned sequence

Fibroblasts BBX

Homo sapiens ADAM33 ADAM33 Homo sapiens damage-specific DNA binding protein 1 (DDB1)

BBR

Homo sapiens lymphocyte cytosolic protein 1 (LCP1) Homo sapiens chromosome 19 genomic contig Homo sapiens adducing 1 (a) (ADD1) Homo sapiens AHNAK nucleoprotein (desmoyokin) (AHNAK) Homo sapiens chromosome 17 genomic contig Homo sapiens procollagen-proline, 2-oxoglutarate 4-diocygenase (praline 4-hydroxylase), a polypeptide II (P4HA2)

HEK293-mock Water

Non-cDNA sequence LCP1 DDB1 Non-cDNA sequence

BBX, Bronchial biopsy specimens; BBR, bronchial brushings; HEK293-Mock, mocktransfected HEK293 cells; Water, negative control.