Disintegrin ADAM13

Developmental Biology 227, 197–210 (2000) doi:10.1006/dbio.2000.9871, available online at http://www.idealibrary.com on

PACSIN2 Is a Regulator of the Metalloprotease/ Disintegrin ADAM13 He´le`ne Cousin, Alban Gaultier, Christian Bleux, Thierry Darribe`re, and Dominique Alfandari Equipe Adhesion et Migration Cellulaires, Unite´ Mixte de Recherche 7622 UPMC/CNRS, BatC 7e`me etage, 9 Quai St. Bernard, 75005 Paris, France

ADAM13 is a cell surface metalloprotease expressed in cephalic neural crest cells during early Xenopus development. The cytoplasmic domain of ADAM13 contains three potential SH3 (Src homology type 3) binding sites, suggesting that this region may support interactions with intracellular proteins. In this report we describe the identification, by a new strategy, of three proteins that bind the ADAM13 cytoplasmic domain in vitro: X-Src1, X-An4, and X-PACSIN2. We focused our study on X-PACSIN2 protein because it colocalizes with ADAM13 in migrating neural crest cells during embryonic development. Using pull-down experiments we show that X-PACSIN2 binds to ADAM13 in vitro. Using Xenopus XTC cells, we demonstrate that ADAM13 and X-PACSIN2 colocalize to membrane ruffles and cytoplasmic vesicles. We also show that X-PACSIN2 overexpression can rescue developmental alterations induced by overexpression of ADAM13, suggesting that both proteins interact in vivo. Finally, our results suggest that X-PACSIN2 overexpression reduces endogenous ADAM13 function while a truncated X-PACSIN2 (⌬SH3) increases this activity in cephalic neural crest cells. We propose that X-PACSIN2 may regulate ADAM13 activity by influencing either its subcellular localization or its catalytic activity. In agreement with this model, elimination of the ADAM13 cytoplasmic domain increased developmental alterations attributable to ADAM13 proteolytic activity. © 2000 Academic Press Key Words: ADAM; development; PACSIN; SH3; Xenopus; neural crest.

INTRODUCTION ADAMs are multifunctional transmembrane glycoproteins with a disintegrin and a metalloprotease domain (Wolfsberg et al., 1995). They all display a common domain organization with four potential functions, proteolysis, adhesion, signaling, and fusion. ADAM metalloproteases are synthesized as inactive proforms, which are then cleaved to generate shorter active proteases (Van Wart and BirkedalHansen, 1990). Removal of the pro domain is generally achieved by a furin-like convertase in the trans-Golgi network (Loechel et al., 1998). ADAMs are involved in a number of biological processes, including fertilization, neural specification, and muscle differentiation (Black and White, 1998; Blobel, 1997). To date, functional analyses of ADAM proteins suggest that they can be subdivided into two major classes that include counterreceptor for integrins and sheddases (Schlondorff and Blobel, 1999). Among the first class of ADAMs, the best characterized are the fertilins ␣ and ␤, also known as ADAM1 and 2 (Primakoff et al., 1987; Blobel et al., 1992; Myles et al., 1994). They form heterodimers on the spermatozoa surface and bind to the 0012-1606/00 $35.00 Copyright © 2000 by Academic Press All rights of reproduction in any form reserved.

␣6␤1 integrin on the egg during fertilization. This interaction is mediated by the disintegrin domain of ADAM2 (Almeida et al., 1995; Chen et al., 1999). As expected, the inactivation of ADAM2 in mice leads to male infertility (Cho et al., 1998), in part due to decreased sperm– egg binding. Additionally, ADAM2 elimination also decreases spermatozoid migration from the uterus to the oviduct, suggesting that ADAM2 is involved in more than just the binding of sperm to the oolemma. ADAM15 also interact with the integrins ␣v␤3 and ␣5␤1 on hematopoietic cells, but the role of this interaction is not yet known (Nath et al., 1999). Among the sheddases, ADAM10 and 17 are the best characterized. ADAM10, also known as Kuzbanian, is involved in neural fate specification in Drosophila and possibly in vertebrates (Fambrough et al., 1996; Rooke et al., 1996). By cleaving Notch or its ligand Delta, ADAM10 triggers a signaling cascade resulting in neural inhibition (Pan and Rubin, 1997; Qi et al., 1999). This signaling prevents ectodermal cells from becoming neuronal precursors. ADAM10 and ADAM17 share a high degree of sequence similarity and can both cleave the transmembrane precursor of tumor necrosis factor ␣ (TNF␣) to release the

197

198

Cousin et al.

active cytokine from the cell surface (Moss et al., 1997; Black et al., 1997). Mice lacking ADAM17 die between day E17.5 and birth. The observed phenotype indicates that ADAM17 may be involved in the shedding of additional biologically active peptides including TNF␣ (Peschon et al., 1998). ADAM cytoplasmic domains may activate specific signaling cascades. For example, the cytoplasmic domain of human ADAM9 binds to the Src SH3 domain in vitro but does not interact with the Abl SH3 domain (Weskamp et al., 1996). Other ADAM family members may also interact with SH3 domain-containing proteins. For example, mouse ADAM12 (Yagami-Hiromasa et al., 1995) and Xenopus ADAM13 (Alfandari et al., 1997) possess the proline-rich repeats thought to support SH3 binding (Feng et al., 1994; Lim et al., 1994). In addition, the mouse ADAM9 cytoplasmic domain interacts with protein kinase C␦ (PKC␦) in a yeast two-hybrid screen (Izumi et al., 1998). This interaction induces phosphorylation of ADAM9, which then cleaves the pro-HB-EGF from the cell surface, indicating that molecular interactions with cytoplasmic domains can influence extracellular domain function. Recently, two new SH3-containing partners of human ADAM9 and ADAM15 have been identified in yeast two-hybrid screens. These proteins (endophilin I and SH3PX1) are thought to play a role in intracellular sorting, but their functions as ADAM partners are still unknown (Howard et al., 1999). We previously cloned Xenopus ADAM13 and showed that it is expressed in cephalic neural crest cells, somitic mesoderm, and specific regions of the central nervous system during early embryonic development (Alfandari et al., 1997). We recently demonstrated that overexpression of wild-type ADAM13 in Xenopus embryos leads to abnormal positioning of both cranial and trunk neural crest cells (Alfandari et al., submitted for publication). A proteasedefective ADAM13 point mutant (E/A) does not cause these anomalies but does decrease the extent of cephalic neural crest cell migration. The ADAM13 cytoplasmic domain is relatively long (197 aa) in comparison to that of other ADAMs and contains three proline-rich repeats, typical of SH3 docking sequences. In this study, we report the identification of three putative cytoplasmic partners of ADAM13. We have focused our study on one of these proteins, M7, which is the Xenopus homologue of mammalian PACSIN2. We demonstrate that X-PACSIN2 SH3 domain binds to ADAM13 in vitro. We also show that both proteins colocalize in XTC cells. Finally, X-PACSIN2 mRNA injections rescue cement gland expansion induced by ADAM13 overexpression, suggesting that X-PACSIN2 protein interacts with ADAM13 in vivo.

MATERIAL AND METHODS Eggs and Embryos Eggs were obtained from adult Xenopus laevis, fertilized, and cultured as described previously (Alfandari et al., 1997). Embryos were staged according to Nieuwkoop and Faber (1967).

RNA Extraction and Degenerate PCR Total RNA from stage 20 embryos was purified using guanidine isothiocyanate as described in Alfandari et al. (1995). Poly(A) RNAs were purified using an Oligotex RNA kit (Qiagen) and reverse transcription was carried out as previously described (Alfandari et al., 1997). cDNA was separated in two aliquots; one was used to produce a Lambda ZAP II cDNA library following the manufacturer’s instructions (Stratagene), while the other aliquot was used in PCR amplification with degenerate oligonucleotides corresponding to SH3 conserved sequences designed by Giachino et al. (1997). Additional restriction sites were added to the degenerated primers to clone PCR fragments directly in frame with the glutathione S-transferase of the pGEX-KG vector (Guan and Dixon, 1991). SH3 forward is CCGGGATCCKWIRWIGCICTITWYGAYTWY with a BamHI site, and SH3 reverse is GGAATTCACRWARTTISHIGGIAWVHAICC with an EcoRI site. PCR was done using the following conditions: initial denaturation step of 3 min at 94°C followed by 35 cycles of 15 s at 94°C, 1 min at 50°C, 30 s at 72°C, and a final 10-min elongation step at 72°C. All PCRs were carried out in 100 ␮l with 200 ng of primers, 2.5 Units of Taq polymerase (Cetus, Perkin–Elmer), 100 ␮M dNTP (Boehringer Mannheim) in buffer containing 50 mM KCl, 10 mM Tris, pH 8.3, 1.5 mM MgCl 2, and 0.001% gelatin. PCR products were separated on a 2% agarose gel, purified with GeneClean (BIO101), digested overnight with 20 Units of BamHI and EcoRI at 37°C, and cloned into pGEX-KG.

Cytoplasmic-Domain Partner Screen Biotinylation of FP3H fusion protein. The cDNA encoding the 123 C-terminal amino acid residues of the ADAM13 cytoplasmic domain was cloned previously into the pET30 vector (Alfandari et al., 1997). Large-scale production and purification of the histidinetagged fusion protein, called FP3H, were carried out according to the QIAexpressionist handbook (Qiagen). After the fusion protein was bound to nickel (Ni-NTA)-agarose (Qiagen), the beads were successively washed in sonication buffer (50 mM Na-phosphate, pH 7.8, 300 mM NaCl), wash buffer (50 mM Na-phosphate, pH 6.0, 300 mM NaCl, 10% glycerol), and PBS. Bound proteins were incubated with 5 ml (1 mg/ml) of NHS-LC-biotin (Pierce Chemical Co.) for 1 h at room temperature and then successively washed in PBS, wash buffer, and 10 mM imidazole in wash buffer. The biotinylated fusion protein was then eluted with 100 mM imidazole in wash buffer, dialyzed against PBS. Protein quantity was estimated by Coomassie blue staining following SDS–PAGE. Far-Western screen of SH3-containing fusion proteins. Aliquots of overnight cultures grown from single colonies were diluted to 1/10 in LBA and grown for 1 h at 37°C. Induction was performed with 2 mM IPTG for 3 h. Bacteria were pelleted and directly lysed in Laemmli buffer. Proteins were separated by 12% SDS–PAGE, transferred to nitrocellulose, and blocked for 1 h in TBST (TBS with 0.1% Tween) with 5% nonfat dry milk. Biotinylated FP3H fusion protein was added at 1 ␮g/ml for 1 h at 20°C. Blots were washed three times with TBST, incubated with 0.2 ␮g/ml HRP–streptavidin (Pierce) in TBST, and developed using the ECL chemiluminescence system (Amersham) and Kodak Biomax films. Pull-down screen of SH3-containing fusion proteins. Positive colonies identified in the primary screen were grown in LBA overnight. Aliquots were diluted (1/10) and stimulated as described above. Proteins were extracted in TBSTx100 (TBS with 1% Triton X-100 and 2 mM PMSF) in the presence of FP3H fusion protein and were incubated 1 h at 20°C with glutathione-agarose beads. Bound proteins were washed three times in TBSTx100, separated on 12%

Copyright © 2000 by Academic Press. All rights of reproduction in any form reserved.

199

PACSIN2 Regulates ADAM13

SDS–PAGE, and blotted with 6615F antiserum diluted 1/5000 in TBST. This antibody was produced against a GST–ADAM13 cytoplasmic domain fusion protein (Alfandari et al., 1997); therefore, it recognizes both GST and FP3H fusion proteins. Detection was performed using secondary HRP-conjugated anti-rabbit antibody at 0.2 ␮g/ml (Biosys) followed by ECL treatment (Fig. 1).

Library Screening and Sequence Analysis cDNA fragments encoding the SH3 domain of M7 (165 bp) obtained by homologous PCR were used to screen the X. laevis stage 20 cDNA library described above. Hybridization was carried out under high-stringency conditions as described by Hens and DeSimone (1995). Deduced amino acid sequences were aligned using the ClustalW program (Thompson et al., 1994).

RT-PCR RT-PCR was performed as described in Alfandari et al. (1997) at various stages of development. PCR was carried out using 100 ng of each of the appropriate oligodeoxynucleotides, integrin ␤1 forward, GTCCTGAGGGAGGCTTTGAT; integrin ␤1 reverse, TGCCGCCTAATTTTCCGTCT; M7 forward, CGGACACGGACAGGGAGGTTC; M7 reverse, CATCATCGGCTTCTTTGGTCT; and 0.1 mM dNTP and 2.5 U of HiTaq polymerase (Bioprobe) in standard Mg 2⫹ buffer for 30 cycles.

Antibody Preparation Histidine-tagged fusion proteins corresponding to X-Src1 amino acids 269 to 453 and M7 189 to 477 were produced in the pET30 cloning vector (Novagen). Fusion proteins were purified as described above for FP3H and injected intraperitoneally into Balb/c mice. Polyclonal antisera were collected from mice injected with the X-Src1 fusion protein, and monoclonal antibody anti M7 (Ig-␬␥1; 3D8) was obtained using standard techniques (Harlow and Lane, 1988). Controls for specificity include Western blotting on bacterial fusion protein as well as immunofluorescence and immunoblots with nontransfected and transfected XTC cells.

Whole-Mount in Situ Hybridization and Immunostaining Whole-mount in situ hybridization was carried out as described by Harland (1991) with slight modifications; wild-type embryos were used and proteinase K treatment was omitted. After being processed for in situ hybridization, embryos were immunostained using the anti-myc-tag 9E10 antibody (Santa Cruz Biotechnology) at 10 ␮g/ml, as described by Hens and DeSimone (1995), with secondary anti-mouse HRP-conjugated IgG (5 ␮g/ml) and DAB staining. Embryos were then cleared in 1% H 2O 2 and 0.5% formamide overnight, dehydrated in 100% methanol, and mounted in benzyl benzoate/benzyl alcohol (2/1 vol/vol). Photographs were taken using a Leica M7Z stereomicroscope. The cDNA templates used to generate probes were generously provided by the following investigators: X-CG (Hazel Sive; Sive et al., 1989) and Xslug (Roberto Mayor; Mayor et al., 1995).

XTC Cell Transfection and Staining Xenopus XTC cells were grown in 60% L15 complemented with 10% fetal bovine serum, penicillin (10 U/ml), and streptomycin

(100 ␮g/ml) (Gibco BRL). Cells were seeded on fibronectin-coated glass coverslips. Transfection was done on adherent cells using the Fugene 6 reagent (Boehringer Mannheim) according to the manufacturer’s instructions. XTC cells were fixed with 4% formaldehyde in 1⫻ MBS, permeabilized with 0.5% Triton X-100 in PBS, and stained with mAb 3D8 (1/200 ascite fluid) or pAb 6615F (1/500 serum) in PBS containing 1% BSA. Secondary FITC–anti-mouse IgG (Jackson Laboratories) or Texas red-anti-rabbit (Amersham) antibodies were used at 10 ␮g/ml in 1% BSA/PBS. Observations were made with a Leica DMRXE confocal microscope (Leica TCS SP, 488/568 nm). Projection of serial optical sections was performed using NIH Image software. Cell surface labeling of XTC cells was done using EZ-Link sulfo-NHS-biotin (Pierce) in MBS at 1 mg/ml on live adherent cells for 20 min at room temperature. Biotinylated cells were washed with MBS containing 100 mM glycine, pH 7.5, and extracted in TBS, 1% Triton X-100, 2 mM PMSF with 5 mM EDTA. Cellular debris were centrifuged at 13,000 rpm at 4°C for 15 min. Immunoprecipitations were done as described in Alfandari et al. (1995), using the 9E10 monoclonal antibody (Santa Cruz Laboratories) coupled to protein G-agarose (Boehringer Mannheim). Biotinylated proteins were detected using HRP-conjugated streptavidin (Pierce) at 0.2 ␮g/ml in TBS 0.1% Tween, followed by ECL treatment as described above.

Embryo Sectioning and Staining Embryos were fixed in 4% formaldehyde, washed in methanol, and embedded in polyethylene glycol 400-distearate (Aldrich). Serial 10-␮m sections and immunostainings were performed as described in Alfandari et al. (1995), using mAb 3D8 ascites fluid at a 1/100 dilution. Observations were made with a Leica DMRXE confocal microscope (Leica TCS SP, 508 –527 nm). Cell surface biotinylation of embryonic cells was performed as described in Alfandari et al. (1995) using EZ-Link sulfo-NHS-biotin (Pierce).

Microinjection Experiments Full length An4, Src1, M7, M7⌬SH3, and ⌬cyto ADAM13 were amplified using Pfu polymerase (Stratagene) and cloned into pCS2 or pCS2-MT (Turner and Weintraub, 1994). The human myc epitope from pCS2-MT is upstream (N-ter) in the M7 construct and downstream (C-ter) in all other constructs. All mRNAs were transcribed using SP6 polymerase following linearization of plasmids with NotI. Transcripts were desalted on G-50 Nick columns (Pharmacia), extracted with phenol/chloroform, and ethanol precipitated. Transcripts were quantified by absorbance at 260 nm and resuspended at 0.2 ␮g/␮l in DEPC-treated H 2O. Transcripts (0.5 or 1 ng total) were injected close to the animal pole region of one blastomere at the two-cell stage. The uninjected half of each embryo served as a control in all experiments. Synthesis of proteins following transcript injection was confirmed by Western blotting and whole-mount immunostaining using the 9E10 antibody.

Protein Extraction and Analysis Proteins were extracted from 10 frozen embryo pools using 200 ␮l of extraction buffer (ESB; 50 mM Tris, pH 8.0, 100 mM NaCl, 1% NP-40, 5 mM EDTA, 2 mM PMSF) on ice for 15 min. Yolk was pelleted at 13,000g for 30 min at 4°C. Supernatant was directly added to an equal volume of 2⫻ Laemmli buffer containing 2% ␤-mercaptoethanol and boiled for 3 min. Total protein corresponding to a single embryo was loaded onto a 10% SDS–PAGE gel and transferred to a nitrocellulose membrane (Amersham). Proteins

Copyright © 2000 by Academic Press. All rights of reproduction in any form reserved.

200

Cousin et al.

were visualized using 0.2% Ponceau-S in 3% TCA prior to Western blotting. Membranes were blocked with 5% nonfat milk in TBST. Immune sera, monoclonal ascites, and HRP-conjugated secondary antibody were diluted in TBST. Detection was performed as mentioned above.

Pull-Down Experiments Fusion proteins (histidine-tagged or GST-tagged) were produced as described. The amount of protein obtained was estimated by SDS–PAGE and Coomassie blue staining. Proteins were coupled to glutathione-agarose beads (Sigma) for GST-tagged proteins and Ni-NTA beads (Qiagen) for histidine-tagged proteins in TBSTx100 overnight at 4°C. Proteins corresponding to 10 embryos or to a 70% confluent 60-mm dish of XTC cells were extracted as described above in 500 ␮l of ESB containing Triton X-100 instead of NP-40. After cellular debris was pelleted, the supernatants were precleared using uncoupled agarose beads for 1 h at 20°C. Supernatants were then incubated overnight at 4°C with agarose beads coupled to the fusion proteins described above. Bound proteins were washed three times with TBSTx100 and once with TBS, prior to elution in 2⫻ Laemmli buffer under reducing conditions, followed by Western blot analysis.

RESULTS ADAM13 Cytoplasmic Domain Binds to SH3 Domains The ADAM13 cytoplasmic domain contains three proline-rich repeats with SH3 docking site consensus sequences, suggesting that it may interact with intracellular proteins. To investigate if the ADAM13 cytoplasmic domain can bind to SH3 containing proteins, we have used glutathione S-transferase–SH3 (GST-SH3) fusion proteins corresponding to human Src and Abl (Weskamp et al., 1996) in a pull-down assay. In this assay purified GST-SH3 fusion proteins bound to an histidine-tagged ADAM13 cytoplasmic domain fusion protein (FP3H) while GST alone did not (Fig. 1). This result suggests that the ADAM13 SH3-docking sites are functional. To selectively identify embryonic SH3containing proteins from embryos with affinity for the ADAM13 cytoplasmic domain, we designed a novel PCRbased screen. Degenerate primers that amplify SH3 consensus sequences were used to generate DNA fragments from stage 20 embryo cDNA. Amplified SH3-containing DNAfragments were then cloned in frame with GST (⬎700 colonies) to generate a “library” of Xenopus SH3-containing fusion proteins. In a primary screen, individual colonies were selected and grown, and fusion protein-containing bacterial extracts were tested by Far-Western blot using biotinylated FP3H fusion protein as probe. In all experiments, GST was used as negative control and GST-SH3 fusion proteins from human Src and Abl as positive controls. Of 138 colonies tested, 68 were positive in this assay and subjected to a second screen (pull down, Fig. 1). After the second round, 28 positive clones were sequenced. These clones were subdivided into three classes that include M6 (1 clone), M7 (14 clones), and L2-8 (12 clones). Database comparisons of these sequences showed that M6 corre-

FIG. 1. Strategy of SH3 partners identification. SH3-degenerate primers were designed according to Giachino et al. (1997) and used in PCR amplification of stage 20 embryonic cDNA. Restriction sites engineered on the 5⬘ ends of each primer were used to clone directly in frame with GST using the pGexKG vector. GST-SH3 fusion proteins immobilized on GST-agarose were directly tested for their ability to retain ADAM13 cytoplasmic domain fusion protein FP3H (affinity check). The agarose matrix was washed and the various proteins eluted in Laemmli were analyzed by Western blotting using the 6615F antiserum, which recognizes both GST (29 kDa) and FP3H (15 kDa). Fusion proteins containing human Src or Abl SH3 domains were used as positive controls while GST was used as negative control. Results of these positive and negative control pull-down experiments are given (right). Positive clones were sequenced and analyzed.

sponds to Xenopus Src1 (Steele, 1985; GenBank No. M24704), L2-8 is identical to Xenopus animal 4 (Reddy et al., 1992; GenBank No. M94969), and M7 is similar to mammalian PACSIN2 (Ritter et al., 1999).

M7 Putative Partner Is the Homologue of Mammalian PACSIN2 To further investigate the binding of the proteins identified in our screen, we have isolated full-length cDNA clones corresponding to Xenopus animal 4 and Xenopus Src1 using PCR. In order to clone the coding sequence of M7, we generated and screened a stage 20 Lambda ZAP II cDNA library. Two identical clones of 2089 bp were obtained. The longest open reading frame is predicted to encode a protein of 477 amino acids with a calculated molecular weight of 55 kDa. The open reading frame starts at nucleotide 199 (ATG) and extends to a TGA termination codon at position 1630. Stop codons are present in all three reading frames preceding the ATG and following the TGA. The 5⬘ untranslated region fulfills Kozak’s criteria for a translation initiation site (Kozak, 1991). Based on an apparent single mRNA size of 3.3 kb, defined by Northern blot analysis (data not shown), we are missing about 1200 bp of

Copyright © 2000 by Academic Press. All rights of reproduction in any form reserved.

201

PACSIN2 Regulates ADAM13

TABLE 1 M7 Amino Acid Identity to Other Known Proteins Name

Species

Identity (%)

Ref./Accession No.

PACSIN2 FAP52 PACSIN2 PACSIN1 SYNDAPIN EM13 EG13

Mouse Chick Human Mouse Rat Tapeworm Tapeworm

79 78 77 61 61 34 34

(Ritter et al., 1999; AF128535) (Merila¨inen et al., 1997; Z50798) (Ritter et al., 1999; AF128535) (Plomann et al., 1998; X85124), (Qualmann et al., 1999; AF104402) (A48580) (B48580)

untranslated sequence. Lack of a polyadenylation signal sequence and poly(A) ⫹ tail in our cDNA is consistent with this interpretation and indicates that we are missing a portion of the 3⬘ and, possibly, 5⬘ ends of the PACSIN2 transcript. Amino acid comparisons of M7 with similar proteins are shown in Table 1. A sequence comparison between M7 protein and mouse PACSIN1 and 2 is presented in Fig. 2. The three proteins contain an N-terminal Cdc15 domain including a putative coiled-coil domain and a C-terminal SH3 domain. While all members of the PACSIN family encode two clathrin-mediated endocytosis NPF motifs, M7 and PACSIN2 contain a specific insertion, which encodes one additional NPF. This strong conservation between M7 and mouse and human PACSIN2 suggests that M7 is the Xenopus ortholog. Therefore, we refer to M7 as X-PACSIN2. Potential posttranslational modifications of X-PACSIN2 are indicated in Fig. 2. As for FAP52 and PACSIN, the predicted protein contains several potential phosphorylation sites for casein kinase 2 and PKC. To date the functions of PACSIN family members are unknown; however, the presence of domains involved in protein– protein interaction (coiled-coil and SH3 domains) and three binding motifs for EH domains (NPF) suggest a role for these proteins in endocytic processes (Tan et al., 1996; Nakashima et al., 1999). The sequence of X-PACSIN2 has been submitted to the EMBL database under Accession No. AJ277159.

X-PACSIN2 Is Expressed Ubiquitously during Embryonic Development To investigate X-PACSIN2 mRNA and protein expression during early Xenopus development, we have used RT-PCR, Western blot, and immunostaining of embryo sections. RT-PCR reveals a single 495-bp (predicted) band at all stages tested (Fig. 3A). Western blot analysis using the mAb 3D8 confirms that X-PACSIN2 protein is also detected at these stages (Fig. 3B). mAb 3D8 recognizes a doublet of 65/72 kDa at each stage tested (Fig. 3B). The major X-PACSIN2 protein detected in embryos is the 72kDa form. In XTC cells a slightly higher form is detected at about 76 kDa. The specificity of mAb 3D8 was confirmed by an increase in the 72 kDa protein noted in embryos injected with full-length X-PACSIN2 mRNA or in XTC

cells transfected with the same construct (XTC-M7; Fig. 3B). The addition of six myc-tag epitopes at the N-terminus of X-PACSIN2 (X-PACSIN2-myc) results in a increase of the apparent size by about 10 kDa. The protein expressed following transfection can be detected as a doublet either with mAb 3D8 or the anti-myc mAb 9E10 (data not shown). These results suggest that X-PACSIN2 can exist in at least three different forms in various cell types. We are currently analyzing the molecular mechanisms responsible for these different forms in embryos and XTC cells. The various possibilities are discussed below. Immunostaining of sectioned embryos reveals that X-PACSIN2 is detected in all cells but with varying intensity and cellular distributions (Figs. 3C–3H). At gastrulation the protein is detected in the three germ layers (Fig. 3C). This distribution is confirmed by Western blot of dissected animal cap (ectoderm), marginal zone (mesoderm), and vegetal region (endoderm) (data not shown). On sections, the fluorescence is more intense in animal cap cells and in the dorsal marginal zone than in the large endodermal cells. Plasma membrane staining is detected at the site of involution (Fig. 3C, arrowhead). In the endoderm, X-PACSIN2 appears in dots which colocalize with nuclei. This nuclear staining was not seen in other cells, suggesting that it is either tissue specific or artifactual. From neurula to tail bud stage, immunofluorescence is more intense in ectodermalderived tissues (epiderm, neuroderm) and dorsal mesodermderived structures (notochord, somites) (Figs. 3D–3F). Interestingly, the migrating cephalic neural crest cells also expressed high level of X-PACSIN2 (Figs. 3E and 3F) as had been previously reported for ADAM13 (Alfandari et al., 1997). During organogenesis, the lens and pronephros are also intensely stained by mAb 3D8. Taken together, these results show that X-PACSIN2 and ADAM13 have overlapping expression in a number of tissues in which they could interact.

ADAM13 Binds to X-Src1 and X-PACSIN2 SH3 Domains To analyze potential interactions of ADAM13 cytoplasmic domain with X-Src1 and X-PACSIN2 we have used the GST-SH3 fusion proteins. Full-length ADAM13 mRNA was injected into embryos at the two-cell stage. Proteins

Copyright © 2000 by Academic Press. All rights of reproduction in any form reserved.

202

Cousin et al.

FIG. 2. Sequence comparison of Xenopus M7, mouse PACSIN2, and mouse PACSIN1. Amino acid sequences deduced from cDNA are indicated with single-letter code. Identical amino acids are represented with dashes. Gray boxes indicate sequences with similarity to Cdc15, and the position of the putative coiled-coiled domain is indicated with a heavy black line. SH3 domain is boxed in black. Putative protein kinase C phosphorylation sites are indicated with an asterisk (*). The insertion present in M7 and mPACSIN2 is represented by a dotted line.

were extracted 48 h later at stage 18 and added either to concanavalin A beads (ConA) or to the various GST fusion proteins immobilized on glutathione-agarose. Both M6 (XSrc-SH3) and M7 (X-PACSIN2-SH3) did retain ADAM13 protein while GST alone did not (Fig. 4A). While we did not see the proform retained in this assay, the lack of signal may be due to the relatively low abundance of this form compared to the mature ADAM13 protein. We then investigated whether endogenous X-PACSIN2 and X-Src1 could bind to ADAM13 cytoplasmic domain. Protein extract from stage 22 Xenopus embryos was incubated in the presence of immobilized FP3H. Bound proteins were analyzed by Western blotting using the 3D8 (anti-X-PACSIN2) and mn13D (anti-X-Src1) antibodies. Our result shows that endogenous X-PACSIN2 and a protein of the Src family (60 kDa) bind to

FP3H (Fig. 4B). This result suggests that both Src and X-PACSIN2 proteins are present in embryonic cells and competent to bind to the ADAM13 cytoplasmic domain. To demonstrate that the interaction of X-PACSIN2 with ADAM13 was mediated through the SH3 domains, we then used Xenopus XTC cells to overexpress various myc-tagged mutants of X-PACSIN2. This cell line was chosen over the commonly used Cos-7 cells for two reasons: first it is of the same species and grows at the same temperature as Xenopus embryos (20°C), and second XTC cells express endogenous ADAM13 and X-PACSIN2 (Fig. 5). Protein from XTC cells transfected with either full-length X-PACSIN2-myc or the X-PACSIN2⌬SH3-myc was extracted in nonionic detergent buffer. Following transfection, both myc-tagged proteins were clearly expressed as shown by immunoprecipi-

Copyright © 2000 by Academic Press. All rights of reproduction in any form reserved.

203

PACSIN2 Regulates ADAM13

tation with the mAb 9E10 (Fig. 4C). These extracts were added to FP3H immobilized on Ni-NTA agarose beads. In these experiments, only wild-type X-PACSIN2, and not the truncated protein lacking the SH3 domain, was retained (Fig. 4C). In this assay, myc-tagged Xenopus animal 4 did not bind to ADAM13 cytoplasmic domain fusion protein (data not shown), suggesting that in the entire protein the SH3 domain is not accessible.

Endogenous ADAM13 and X-PACSIN2 Colocalize in XTC Cells In XTC cells cultured on fibronectin, endogenous ADAM13 protein is localized to the perinuclear region, in cytoplasmic vesicles, and at particular regions of the cell membrane (Fig. 5A). X-PACSIN2, on the other hand, has a more widespread distribution with diffuse staining throughout the entire cell. Despite the absence of a signal peptide, X-PACSIN2 also localizes near the same vesicles and cell membrane structures as ADAM13 (Fig. 5B). The overlapping images of ADAM13 and X-PACSIN2 are presented in Figs. 5C and 5D. Interestingly, neither ADAM13 nor X-PACSIN2 is enriched at points of cell– cell contact (arrowhead) but they clearly colocalize to specific cell membrane ruffles.

X-PACSIN2 Rescues Phenotypes Induced by ADAM13 Overexpression Overexpression of full-length ADAM13 by transcript injection at the two-cell stage results in the dorsal expansion of the cement gland, ectodermal blistering, and slight shortening of the anteroposterior axis (Figs. 6A and 7B). The expansion of the cement gland is highly reproducible and depends on ADAM13 metalloprotease activity because it is never observed when a mutant form of ADAM13, lacking metalloprotease activity, is injected (data not shown). It is also specific to ADAM13, because embryos injected with other members of the ADAM family do not show this FIG. 3. M7/X-PACSIN2 is expressed maternally and ubiquitously. (A) Total RNA from 10 embryos was purified and reverse transcribed in the absence (⫺) or presence of MMLV polymerase. For XTC cells, 10 ␮g of total RNA was used. cDNA underwent PCR amplification using X-PACSIN2 and integrin ␤1-specific oligodeoxynucleotides as described under Material and Methods. X-PACSIN2-specific amplification product appears as a single band at every stage tested as well as in XTC cells. (B) Western blot using mAb 3D8 with total protein extracts. M7/X-PACSIN2 protein is expressed in two-cell (stage 2), early blastula (stage 7), early gastrula (stage 10.5), early neurula (stage 15), and early and late tail bud (stage 22 and 32) stages. The upper form (72 kDa) is expressed in XTC cells and is increased following transfection with a full-length M7-X-PACSIN2 cDNA clone. (C–H) Immunolocalization of M7/XPACSIN2 on 10-␮m sections using mAb 3D8. (C) Sagittal section of early gastrula (stage 10 –11). The protein is present in the three germ layers (ectoderm, mesoderm, and endoderm). General fluorescence appears stronger within the ectoderm and the dorsal marginal zone. Membrane staining is visible near the site of involution

(D) Transverse section of early neurula stage embryo. Staining is still present in each cell with a stronger signal in the ectoderm, the neurectoderm, and the dorsal mesoderm layers. The early notochord (n) and somites (s) are labeled. (E and F) Transverse section of early tail bud stage embryo. (E) The anterior section reveals more intense staining of the epidermis and neurectodermal derivatives. In particular in the neural tube (nt), the otic vesicle (ot), and the cephalic neural crest cells (nc). (F) More posteriorly, cephalic crest migrating within the posterior branchial arch is also stained with mAb 3D8. (G and H) Transverse section through a late tail bud stage embryo. (G) Section through the head reveals the most intense staining within the lens and the mandibular cartilage condensation. (H) In more posterior sections of the same embryo, the pronephretic duct and the dorsal part of the somite both present a more intense staining.

Copyright © 2000 by Academic Press. All rights of reproduction in any form reserved.

204

Cousin et al.

phenotype (e.g., ADAM9 and 10, Alfandari, Blobel, and DeSimone, unpublished). While about 40% (n ⫽ 150) of embryos injected with ADAM13 possess extended cement glands, overexpression of the same amount of ADAM13

FIG. 4. Biochemical interactions of ADAM13 cytoplasmic domain. (A) Xenopus embryos (two-cell stage) were injected with myc-tagged ADAM13. Proteins were extracted in ESB containing 1% Triton and incubated with glutathione-agarose beads bound to GST, M6 (X-Src-SH3), or M7 (X-PACSIN2-SH3). As a positive control, ConA-agarose was used to pull down glycosylated ADAM13. SH3 domains of both proteins bind to the mature (M) form of ADAM13. (B) Protein extracts from 10 embryos (stage 22) were incubated with FP3H fusion protein coupled to Ni-NTA agarose beads (lane 1) or with Ni-NTA beads alone (lane 2). Bound proteins were subjected to SDS–PAGE and Western blot using mAb 3D8 (X-PACSIN2) or the polyclonal serum mn13D directed against Xenopus Src1 fusion protein. The major 72-kDa form of endogenous X-PACSIN2 is retained only by the FP3H-bound Ni-NTA. Similarly, a 60-kDa protein recognized by mn13D interacts with the ADAM13 cytoplasmic domain. (C) Protein extracts from XTC cells transfected either with myc-tagged M7/PACSIN2 or with the construct lacking the SH3 domain (⌬SH3) were incubated with agarose beads coupled to ADAM13 cytoplasmic domain or the myc mAb 9E10. After washes, bound proteins were analyzed by Western blotting using mAb 9E10. Only full-length X-PACSIN2 protein interacts with ADAM13 cytoplasmic domain, while both proteins are efficiently translated in XTC cells.

FIG. 5. ADAM13 and X-PACSIN2 colocalize in Xenopus XTC cells. XTC cells were seeded on glass coverslips coated with fibronectin. After 48 h they were fixed in formaldehyde, permeabilized with 0.5% Triton X-100 and immunostained with the polyclonal antibody 6615F, which recognizes the ADAM13 cytoplasmic domain (A), and the monoclonal antibody 3D8 directed against X-PACSIN2 (B). Secondary FITC–anti-mouse and Texas red–antirabbit were used. Superposition of ADAM13 and X-PACSIN2 staining is presented in C. Area where both protein are detected with similar intensity appears in D. Overlapping staining shows that ADAM13 and X-PACSIN2 colocalize at specific areas of cell membrane as well as in some cytoplasmic vesicles (D, arrow). Both proteins are absent from areas of cell– cell contact (arrowhead).

with X-PACSIN2 significantly reduces the number of embryos with cement gland defect to less than 9% (n ⫽ 139) (Fig. 6B). To demonstrate the specificity of SH3-domain interaction, we overexpressed ADAM13 with X-PACSIN2 lacking the SH3 domain (⌬SH3). This construct has no effect on the ability of ADAM13 to perturb cement gland formation (Fig. 6C). This suggests that rescue of ADAM13 alteration is specifically mediated by X-PACSIN2 SH3 domains. Neither wild-type nor truncated X-PACSIN2 has any effect on cement gland development when injected alone (Figs. 6D and 6E). Results from four independent experiments are plotted in Fig. 6F. These results support our

Copyright © 2000 by Academic Press. All rights of reproduction in any form reserved.

205

PACSIN2 Regulates ADAM13

FIG. 6. X-PACSIN2 rescue of alterations caused by ADAM13 overexpression. In situ hybridization of tail bud stage embryos with the cement gland-specific marker X-CG. Embryos were injected in one cell at the two-cell stage, grown up to tail bud stage (stage 22), and fixed and processed for in situ hybridization. The injected protein is localized by whole-mount immunostaining. Embryos are viewed from the injected side with the anterior to the left. (A) Embryo injected with 0.5 ng of wild-type ADAM13 shows extended cement gland (arrowhead). (B) Co-injection of 0.5 ng of wild-type PACSIN2 with 0.5 ng of ADAM13 abolishes this phenotype. (C) Co-injection of 0.5 ng of the mutant PACSIN2 lacking the SH3 domain has no effect on ADAM13-induced extension of the cement gland. Neither X-PACSIN2 (D) nor the ⌬SH3 (E) mutant alters X-CG expression. (F) Histogram of the rescue data. Numbers from four independent experiments are presented. Percentages of altered cement gland obtained with ADAM13 (lane 1), ADAM13 plus X-PACSIN2 (lane 2), ADAM13 plus ⌬SH3 X-PACSIN2 (lane 3), X-PACSIN2 (lane 4), or the ⌬SH3 mutant alone (lane 5) are plotted. Error bars represent standard deviations.

data suggesting that ADAM13 and X-PACSIN2 interact in vivo and further indicate that X-PACSIN2 may down regulate ADAM13 activity.

Deletion of ADAM13 Cytoplasmic Domain Increases Developmental Alteration To confirm that the ADAM13 cytoplasmic domain controls protein function, we generated a construct lacking the sequence encoding this domain (⌬cyto). This protein is predicted not to bind to X-PACSIN2 and, therefore, to be more “potent.” Synthetic transcripts encoding either wildtype or the truncated (⌬cyto) ADAM13 were injected in one cell of two-cell stage embryos. In contrast to the wild-type protein, overexpression of the truncated ADAM13 results in much more severe developmental defects. These alterations include cement gland expansions, severe anteroposterior axis truncation, and large ectodermal blistering (compare Figs. 7B and 7C). Dilution of the mRNA encoding the truncated ⌬cyto ADAM13 resulted in progressively milder defects in injected embryos (Figs. 7D and 7E). Accordingly, injection of equal amount of truncated ADAM13 mRNA resulted in significantly more cement gland expansion (61%, n ⫽ 39) than with wild-type ADAM13 mRNA. Together these results indicate that removal of the ADAM13 cytoplasmic domain results in more severe developmental alterations. They are consistent with a role for the cytoplasmic domain in the negative regulation of ADAM13 protein function, possibly through binding to X-PACSIN2.

X-PACSIN2 Overexpression Affects Cephalic Neural Crest Cell Development Because ADAM13 is expressed in cephalic neural crest cells during migration we have analyzed the effects of X-PACSIN2 overexpression on the behavior of these cells. Embryos at the two-cell stage were injected in one blastomere with synthetic mRNA encoding either wild-type X-PACSIN2 or X-PACSIN2-⌬SH3. At tail bud stage (stage 22–24), embryos were fixed and processed for in situ hybridization with the neural crest cell marker Xslug. Our results show that overexpression of wild-type X-PACSIN2 causes a slight shortening of the two most posterior neural crest segments (Fig. 8A). This mild phenotype is similar to the one induced by the overexpression of a putative dominant negative form of ADAM13 (Alfandari et al., submitted for publication). In contrast, overexpression of the truncated X-PACSIN2 (⌬SH3), which does not bind to ADAM13, dramatically alters the cephalic neural crest appearance (Fig. 8B). Changes include an apparent increase of Xslug signal and a fusion of the three cephalic neural crest cell segments. Interestingly, overexpression of wild-type ADAM13 causes similar phenotype (Alfandari et al., submitted for publication). These results suggest that X-PACSIN2 overexpression can interfere with endogenous ADAM13 function in the cephalic neural crest cells. They also suggest that overexpression of the truncated X-PACSIN2 in these cells may interfere with the endogenous X-PACSIN2 function (see Discussion).

Copyright © 2000 by Academic Press. All rights of reproduction in any form reserved.

206

Cousin et al.

X-PACSIN2 Does Not Change ADAM13 Cell Surface Expression Because X-PACSIN2 possesses three putative internalization motifs (NPF) we have analyzed ADAM13 cell surface expression in embryos overexpressing both proteins. Dissociated cells from embryos injected with myc-tagged ADAM13 mRNA alone or together with untagged X-PACSIN2 were cell surface biotinylated. ADAM13 protein was immunoprecipitated with the mAb 9E10 and probed with HRP–streptavidin. Surprisingly, both protein level and cell surface expression of ADAM13 were unaffected by X-PACSIN2 overexpression (Fig. 9). Therefore, the absence of cement gland expansion in the embryo overexpressing the two proteins cannot be attributed to the modification of ADAM13 expression.

DISCUSSION In the present study we provide evidence that the ADAM13 cytoplasmic domain is essential for regulation of protein function. To gain insight regarding the function of the ADAM13 cytoplasmic domain, we have identified three SH3-containing proteins that can bind to this domain in vitro. Further analysis of one of these proteins, X-PACSIN2, indicates that it colocalizes with ADAM13 in embryos and XTC cells. Finally, X-PACSIN2 overexpression can rescue cement gland expansion induced by ADAM13 overexpression, indicating that it may be involved in regulating ADAM13 functional activity.

X-PACSIN2 Binding to ADAM13 Cytoplasmic Domain

FIG. 7. Wild-type and ⌬cyto ADAM13 perturb cement gland development. In situ hybridization of tail bud stage embryo using the cement gland marker X-CG. (A) Lateral representation of a tail bud stage Xenopus embryo. The anterior is to the left and the cement gland is indicated with an arrowhead. The same orientation and arrowhead were used for all images. Embryos were injected in one cell at the two-cell stage either with wild-type ADAM13 (0.5 ng, B) or with the truncated ⌬cyto (0.5 ng, C; 0.25 ng, D; 0.125 ng, E) mRNA. (B) Overexpression of WT ADAM13 produced embryos with cement glands extending dorsally from their normal position. (C) Similarly, ⌬cyto overexpression leads to extension of the cement gland as well as extensive epidermal blistering (arrow) and anteroposterior axis shortening. (D and E) Lower doses of mRNA injection correlate with the disappearance of axis and cement gland alterations.

In this study we focused on X-PACSIN2 because very little is known about its function in any biological system. This protein is related to PACSIN1 and FAP52, which have been previously cloned in mouse and chicken (Plomann et al., 1998; Merila¨inen et al., 1997). Interestingly, Howard et al. (1999) identified a homologue of FAP52 as a partner of the ADAM15 but not the ADAM9 cytoplasmic domain by yeast two-hybrid assay. While FAP52 localizes to the focal adhesion contacts, X-PACSIN2 does not. Instead, our data show that X-PACSIN2 colocalizes with ADAM13 at specific membrane ruffles as well as at cytoplasmic vesicles. X-PACSIN2 is predicted to be a 55-kDa protein; however, Western blot analysis indicates an apparent molecular weight of 65/72 kDa. This large difference cannot be due to nonspecific recognition by the antibody or alternative splicing, because tagged full-length constructs for X-PACSIN2 also reveal a similar difference in size. Similarly, FAP52 has a 63-kDa apparent molecular weight that is significantly larger than that predicted by the sequence (52 kDa), suggesting that proteins of this family undergo posttranslational modifications. Indeed, previous studies of FAP52 and PACSIN1 have shown that these proteins are phosphorylated on serine and threonine residues (Merila¨inen et al., 1997; Plomann et al., 1998). Similarly, X-PACSIN2 exhibits

Copyright © 2000 by Academic Press. All rights of reproduction in any form reserved.

207

PACSIN2 Regulates ADAM13

X-PACSIN2 increases following phorbol ester treatment of XTC cells (Cousin and Alfandari, unpublished). Alternatively, it is also possible that the abnormal electrophoretic behavior of X-PACSIN2 is due to the high acidic residue content of the protein, as was previously shown for the protein Caldesmon (Graceffa et al., 1992). We have shown that ADAM13 is processed into a shorter mature form before it reaches the cell surface (this study; Alfandari et al., submitted for publication). Our results indicate that X-Src1 and X-PACSIN2 both bind to the mature and possibly to the proform of ADAM13 protein. This observation suggests that both SH3-containing proteins may interact with ADAM13 either during transit to the plasma membrane or at the cell surface. Interestingly, two previously characterized partners for ADAM cytoplasmic domains, SH3PX1 and endophilin I, preferentially bind to the proforms of ADAM9 and ADAM15. This observation raises the possibility that they are involved in the export rather than in the control of endocytosis or extracellular function of these ADAMs (Howard et al., 1999).

Specificity of X-PACSIN2 Interaction with ADAM13 X-PACSIN2 is also present in cells that do not express ADAM13 during embryonic development, notably in the endoderm. This suggests that, in these cells, X-PACSIN2 may interact with other proteins. Interestingly, two other ADAMs (ADAM9 and 10) expressed during early Xenopus development also possess SH3-docking sequences (Smith, FIG. 8. Overexpression of X-PACSIN2 alters neural crest cell positioning. Embryos were injected into one blastomere at the two-cell stage with 1 ng of wild-type (A) or the truncated (B) X-PACSIN2 (⌬SH3) transcripts. Injected embryos were cultured to tail bud stages and processed for Xslug in situ hybridization. The red arrowheads point to the injected side of each embryo. In these dorsal views, the positions of the three cephalic neural crest segments are indicated by white lines (mandibular (m), hyoid (h), and branchial (b)). X-PACSIN2 overexpression does not alter the cephalic crest segregation but appears to shorten both the hyoid and the branchial neural crest segments (A, red lines). In contrast, the cephalic neural crest cells appear as a single mass on the side injected with the truncated X-PACSIN2 transcript (B, right). (C) Schematic representation of the regulation of ADAM13 by X-PACSIN2. ADAM13 is in gray, the plasma membrane in yellow, and X-PACSIN2 in brown. In this model, X-PACSIN2 binds to the ADAM13 cytoplasmic domain through its SH3 domain and to a putative repressor (green) with its coiled-coil domain. In this conformation, ADAM13 is kept inactive. Removal of the ADAM13 cytoplasmic domain results in a constitutively active form of the protein. Deletion of X-PACSIN2 SH3 domains could block the repressor, resulting in the activation of wild-type ADAM13.

consensus sequence for PKC phosphorylation, suggesting that PACSIN family members could be regulated through phosphorylation. This hypothesis is further supported by preliminary experiments showing that the apparent size of

FIG. 9. ADAM13 expression in embryos overexpressing X-PACSIN2. Immunoprecipitation of myc-tagged ADAM13 using mAb 9E10. Two-cell stage embryos were injected in one blastomere with 0.5 ng of ADAM13 mRNA alone (lane 1) or in combination with 0.5 ng of X-PACSIN2 mRNA (lane 2). Injected embryos were raised to stage 22 and their cells were isolated and surface biotinylated in calcium/magnesium-free medium. Immunoprecipitated proteins were first detected using streptavidin–HRP (left) to detect ADAM13 expressed at the cell surface and then blotted with 9E10 (right). Results show that total ADAM13 protein level and cell surface expression are similar in embryos injected with ADAM13 mRNA (lane 1) or co-injected with X-PACSIN2 mRNA (lane 2). Comparison of total (right) with surface labeled (left) ADAM13 protein shows that only the mature form (M) and not the proform (P) is expressed at the cell surface.

Copyright © 2000 by Academic Press. All rights of reproduction in any form reserved.

208

Cousin et al.

Alfandari, and DeSimone, unpublished; Cai et al., 1998). In pull down experiments, human ADAM9 cytoplasmic domain binds to Src but not Abl SH3 domains (Weskamp et al., 1996). Preliminary pull-down experiments suggest that X-PACSIN2 also interact with Xenopus ADAM10 (Cousin, Smith, Alfandari, and DeSimone, unpublished). Altogether, these data suggest that multiple ADAMs, expressed during early Xenopus development in a variety of tissues, may interact with X-PACSIN2. Our data also show that the ADAM13 cytoplasmic domain does not bind to Xenopus animal 4 in vitro, suggesting that the SH3 domains might not be accessible in the context of the entire protein. The ADAM9 results suggest that SH3-docking sequences present in ADAM cytoplasmic domains are specific to limited numbers of SH3-containing proteins (Src versus Abl). In addition, our results suggest that X-PACSIN2 may regulate distinct ADAM proteins. Further work will focus on possible interactions of X-PACSIN2 with Xenopus ADAMs 9 and 10 during early development. In particular, it will be interesting to determine whether ADAM9, which does not bind to human PACSIN1, can interact with PACSIN2 in Xenopus.

X-PACSIN2 Antagonizes ADAM13 in Vivo Our result shows specific alteration of cement gland development associated with ADAM13 over expression. The cement gland is a small adhesive organ derived from the anterior epidermis (Sive and Bradley, 1996). This alteration is dependent upon the metalloprotease activity of ADAM13, as a point mutant (E/A) lacking a functional active site does not induce this phenotype. We have used this robust phenotype as an assay to study ADAM13/ PACSIN2 interactions in living embryos. Our results show that X-PACSIN2, but not the mutant lacking the SH3 domain (⌬SH3), significantly reduces ADAM13-dependent cement gland expansion. This result indicates that X-PACSIN2 can down regulate ADAM13 activity in vivo. This is, to our knowledge, the first example of negative regulation of any ADAM by a cytoplasmic partner. Several mechanisms of regulation can be proposed. First, X-PACSIN2 could prevent ADAM13 from reaching the cell surface. This hypothesis does not fit our observation that X-PACSIN2 binds to the mature form (which is present at the cell surface). Second, X-PACSIN2 could induce ADAM13 endocytosis and thereby increase protein turnover. This hypothesis is supported by the observation that there are three clathrin-dependent NPF endocytosis motifs within the X-PACSIN2 (Tan et al., 1996). However, our data suggest that X-PACSIN2 co-injection does not affect ADAM13 protein levels or cell surface expression in injected embryos. Finally, X-PACSIN2 could regulate negatively ADAM13 proteolytic activity through conformational changes and/or phosphorylation of its cytoplasmic domain. In support of this hypothesis are results showing that ADAM9 phosphorylation by PKC␦ induces the proteolytic processing of pro-HB-EGF (Izumi et al., 1998). It is therefore possible that other phosphorylation or dephos-

phorylation events could regulate both positively and negatively ADAM13 function. It will be of interest, therefore, to correlate ADAM13 function with its phosphorylation state. Interestingly, CD2BP1 is a protein with structure similar to that of X-PACSIN2. Its function as an adapter is to bring together the cytosolic protein tyrosine phosphatase (PTP)PEST and the CD2 cytoplasmic domain, resulting in the inhibition of CD2/CD58 extracellular binding (Li et al., 1998). Additional experiments are needed to understand how X-PACSIN2 may fit into such a pathway and regulate ADAM13 protein function.

ADAM13 Protein Function in the Absence of the Cytoplasmic Domain Our results show that the ADAM13 cytoplasmic domain binds to X-PACSIN2 and that this interaction significantly reduces ADAM13-induced expansion of the cement gland. This suggests that X-PACSIN2 and, therefore, the ADAM13 cytoplasmic domain function as a negative regulator of ADAM13 function. Interestingly, while ADAM13 overexpression in developing embryos induces subtle defects, overexpression of a mutant protein lacking the cytoplasmic domain results in dramatic developmental alterations. While much more pronounced, the phenotypes observed with the truncated protein are reminiscent of those induced by wild-type ADAM13. In particular the dorsal expansion of the cement gland, the epidermal blistering, and the truncation of the anteroposterior axis are observed in both cases. All of the above phenotypes are directly attributable to the metalloprotease activity of ADAM13 because a mutation within the active site (E/A) results in overall normal development (Alfandari et al., submitted for publication). These results are consistent with a model in which the cytoplasmic domain of ADAM13 negatively regulates protein function. Interestingly, the truncated ADAM13, like the wildtype protein, is cleaved into a mature form before it reaches the cell surface (data not shown), indicating that the cytoplasmic domain does not control processing or cell surface export. In contrast, the metalloprotease activity and/or the turnover rate of the truncated ADAM13 protein might be affected. Both of these effects are consistent with our proposed role for X-PACSIN2 function in controlling the metalloprotease activity of ADAM13.

A Model for X-PACSIN2 Regulation of ADAM13 Our results suggest that overexpression of X-PACSIN2 in the cephalic neural crest cells can inhibit endogenous ADAM13 function. Interestingly, in the same cells, overexpression of the truncated X-PACSIN2 lacking the SH3 domain appears to increase endogenous ADAM13 activity. This result suggests that the truncated protein may act as a dominant negative form of X-PACSIN2. One possible function for X-PACSIN2 could be to bring together ADAM13, via the SH3 domain, and another protein or protein complex required for the inhibition of ADAM13 metalloprotease activity (Fig. 8C). In this case, the truncated

Copyright © 2000 by Academic Press. All rights of reproduction in any form reserved.

209

PACSIN2 Regulates ADAM13

X-PACSIN2 would still associate with this other protein or complex without associating with ADAM13. This simple competition would leave more endogenous active ADAM13 protein in the cephalic neural crest cells, resulting in the “ADAM13 gain-of-function” phenotype. While our data concerning X-PACSIN2 and the truncated ADAM13 protein lacking a cytoplasmic domain point to an overall negative role for this domain, it is also possible that various regions of the ADAM13 cytoplasmic domain bind to an activator(s). Similarly, activators and inhibitors may compete for identical binding sites within the ADAM13 cytoplasmic domain and tightly regulate protein function. This balance between activator and inhibitor could determine whether a cell expressing ADAM13 stays within the epithelium or migrates to another location. In particular, this ratio of positive and negative regulators could define the exact timing of neural crest cell migration in the embryo and regulate other epithelial-to-mesenchymal transitions. Future work will investigate how overexpression of X-PACSIN2 or X-Src1 in the neural crest cells may change their migratory behavior. In particular, X-PACSIN2 mutants, overexpressed in cells that produce endogenous ADAM13, can clearly be a very powerful tool to analyze ADAM13 function in vivo.

ACKNOWLEDGMENTS We thank D. W. DeSimone, J. M. White, D. Dunon, C. Pujades, and C. A. Whittaker for valuable discussion and advice. Human SH3-domain fusion proteins were a generous gift from C. P. Blobel. H. Cousin and A. Gaultier are financed by a grant from the MERT (97-256, 99-750). We thank the CNRS, the MERT (Ministere de la Recherche et de la Technologie), the LNCC (Ligue Nationale Contre le Cancer), the FRM (Fondation pour la Recherche Medicale), and the IUF (Institut Universitaire de France) for financial support. This work was also supported in part by a grant from the USPHS (HD26402), which made possible visits by D. Alfandari and H. Cousin to the DeSimone laboratory in order to undertake some of the initial cDNA cloning and characterization of the SH3containing proteins described in this study.

REFERENCES Alfandari, D., Whittaker, C. A., DeSimone, D. W., and Darribe`re, T. (1995). Integrin alpha v subunit is expressed on mesodermal cell surfaces during amphibian gastrulation. Dev. Biol. 170, 249 –261. Alfandari, D., Wolfsberg, T. G., White, J. M., and DeSimone, D. W. (1997). ADAM 13: A novel ADAM expressed in somitic mesoderm and neural crest cells during Xenopus laevis development. Dev. Biol. 182, 314 –330. Almeida, E. A., Huovila, A. P., Sutherland, A. E., Stephens, L. E., Calarco, P. G., Shaw, L. M., Mercurio, A. M., Sonnenberg, A., Primakoff, P., Myles, D. G., et al. (1995). Mouse egg integrin alpha 6 beta 1 functions as a sperm receptor. Cell 81, 1095–1104. Black, R. A., Rauch, C. T., Kozlosky, C. J., Peschon, J. J., Slack, J. L., Wolfson, M. F., Castner, B. J., Stocking, K. L., Reddy, P., Srinivasan, S., Nelson, N., Boiani, N., Schooley, K. A., Gerhart, M., Davis, R., Fitzner, J. N., Johnson, R. S., Paxton, R. J., March, C. J., and Cerretti, D. P. (1997). A metalloproteinase disintegrin that

releases tumour-necrosis factor-alpha from cells. Nature 385, 729 –733. Black, R. A., and White, J. M. (1998). ADAMs: Focus on the protease domain. Curr. Opin. Cell Biol. 10, 654 – 659. Blobel, C. P. (1997). Metalloprotease-disintegrins: Links to cell adhesion and cleavage of TNF alpha and Notch. Cell 90, 589 – 592. Blobel, C. P., Wolfsberg, T. G., Turck, C. W., Myles, D. G., Primakoff, P., and White, J. M. (1992). A potential fusion peptide and an integrin ligand domain in a protein active in sperm– egg fusion. Nature 356, 248 –252. Cai, H., Kratzschmar, J., Alfandari, D., Hunnicutt, G., and Blobel, C. P. (1998). Neural crest-specific and general expression of distinct metalloprotease-disintegrins in early Xenopus laevis development. Dev. Biol. 204, 508 –524. Chen, M. S., Almeida, E. A., Huovila, A., Takahashi, Y., Shaw, L. M., Mercurio, A. M., and White, J. M. (1999). Evidence that distinct states of the integrin alpha6beta1 interact with laminin and an ADAM. J. Cell. Biol. 144, 549 –561. Cho, C., Bunch, D. O., Faure, J. E., Goulding, E. H., Eddy, E. M., Primakoff, P., and Myles, D. G. (1998). Fertilization defects in sperm from mice lacking fertilin beta. Science 281, 1857–1859. Fambrough, D., Pan, D., Rubin, G. M., and Goodman, C. S. (1996). The cell surface metalloprotease/disintegrin Kuzbanian is required for axonal extension in Drosophila. Proc. Natl. Acad. Sci. USA 93, 13233–13238. Feng, S., Chen, J. K., Yu, H., Simon, J. A., and Schreiber, S. L. (1994). Two binding orientations for peptides to the Src SH3 domain: Development of a general model for SH3–ligand interactions. Science 266, 1241–1247. Giachino, C., Lantelme, E., Lanzetti, L., Saccone, S., Bella Valle, G., and Migone, N. (1997). A novel SH3-containing human gene family preferentially expressed in the central nervous system. Genomics 41, 427– 434. Graceffa, P., Jancso, A., and Mabuchi, K. (1992). Modification of acidic residues normalizes sodium dodecyl sulfate– polyacrylamide gel electrophoresis of caldesmon and other proteins that migrate anomalously. Arch. Biochem. Biophys. 297, 46 –51. Guan, K. L., and Dixon, J. E. (1991). Eukaryotic proteins expressed in Escherichia coli: An improved thrombin cleavage and purification procedure of fusion proteins with glutathione S-transferase. Anal. Biochem. 192, 262–267. Harland, R. M. (1991). In situ hybridization: An improved wholemount method for Xenopus embryos. Methods Cell Biol. 36, 685– 695. Harlow, E., and Lane, D. (1988). “Antibodies: A Laboratory Manual.” Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Hens, M. D., and DeSimone, D. W. (1995). Molecular analysis and developmental expression of the focal adhesion kinase pp125FAK in Xenopus laevis. Dev. Biol. 170, 274 –288. Howard, L., Nelson, K. K., Maciewicz, R. A., and Blobel, C. P. (1999). Interaction of the metalloprotease disintegrins MDC9 and MDC15 with two SH3 domain-containing proteins, endophilin I and SH3PX1. J. Biol. Chem. 274, 31693–31699. Izumi, Y., Hirata, M., Hasuwa, H., Iwamoto, R., Umata, T., Miyado, K., Tamai, Y., Kurisaki, T., Sehara-Fujisawa, A., Ohno, S., and Mekada, E. (1998). A metalloprotease-disintegrin, MDC9/ meltrin-gamma/ADAM9 and PKC delta are involved in TPAinduced ectodomain shedding of membrane-anchored heparinbinding EGF-like growth factor. EMBO J. 17, 7260 –7272.

Copyright © 2000 by Academic Press. All rights of reproduction in any form reserved.

210

Cousin et al.

Kozak, M. (1991). An analysis of vertebrate mRNA sequences: Intimations of translational control. J. Cell. Biol. 115, 887–903. Li, J., Nishizawa, K., An, W., Hussey, R. E., Lialios, F. E., Salgia, R., Sunder-Plassmann, R., and Reinherz, E. L. (1998). A cdc15-like adaptor protein (CD2BP1) interacts with the CD2 cytoplasmic domain and regulates CD2-triggered adhesion. EMBO J. 17, 7320 –7336. Lim, W. A., Richards, F. M., and Fox, R. O. (1994). Structural determinants of peptide-binding orientation and of sequence specificity in SH3 domains. Nature 372, 375–379. Loechel, F., Gilpin, B. J., Engvall, E., Albrechtsen, R., and Wewer, U. M. (1998). Human ADAM 12 (meltrin alpha) is an active metalloprotease. J. Biol. Chem. 273, 16993–16997. Mayor, R., Morgan, R., and Sargent, M. (1995). Induction of the prospective neural crest of Xenopus. Development Suppl. 121, 767–777. Merila¨inen, J., Lehto, V. P., and Wasenius, V. M. (1997). FAP52, a novel, SH3 domain-containing focal adhesion protein. J. Biol. Chem. 272, 23278 –23284. Moss, M. L., Jin, S. L., Milla, M. E., Burkhart, W., Carter, H. L., Chen, W. J., Clay, W. C., Didsbury, J. R., Hassler, D., Hoffman, C. R., Kost, T. A., Lambert, M. H., Leesnitzer, M. A., McCauley, P., McGeehan, G., Mitchell, J., Moyer, M., Pahel, G., Rocque, W., Overton, L. K., Schoenen, F., Seaton, T., Su, J. L., Warner, J., and Becherer, J. D. (1997). Cloning of a disintegrin metalloproteinase that processes precursor tumour-necrosis factor-alpha. Nature 385, 733–736. Myles, D. G., Kimmel, L. H., Blobel, C. P., White, J. M., and Primakoff, P. (1994). Identification of a binding site in the disintegrin domain of fertilin required for sperm– egg fusion. Proc. Natl. Acad. Sci. USA 91, 4195– 4198. Nakashima, S., Morinaka, K., Koyama, S., Ikeda, M., Kishida, M., Okawa, K., Iwamatsu, A., Kishida, S., and Kikuchi, A. (1999). Small G protein Ral and its downstream molecules regulate endocytosis of EGF and insulin receptors. EMBO J. 18, 3629 – 3642. Nath, D., Slocombe, P. M., Stephens, P. E., Warn, A., Hutchinson, G. R., Yamada, K. M., Docherty, A. J., and Murphy, G. (1999). Interaction of metargidin (ADAM-15) with alphavbeta3 and alpha5beta1 integrins on different haemopoietic cells. J. Cell Sci. 112, 579 –587. Nieuwkoop, P. D., and Faber, J. (1967). “Normal Table of Xenopus laevis (Daudin),” 2nd ed. North-Holland, Amsterdam. Pan, D., and Rubin, G. M. (1997). Kuzbanian controls proteolytic processing of Notch and mediates lateral inhibition during Drosophila and vertebrate neurogenesis. Cell 90, 271–280. Peschon, J. J., Slack, J. L., Reddy, P., Stocking, K. L., Sunnarborg, S. W., Lee, D. C., Russell, W. E., Castner, B. J., Johnson, R. S., Fitzner, J. N., Boyce, R. W., Nelson, N., Kozlosky, C. J., Wolfson, M. F., Rauch, C. T., Cerretti, D. P., Paxton, R. J., March, C. J., and Black, R. A. (1998). An essential role for ectodomain shedding in mammalian development. Science 282, 1281–1284. Plomann, M., Lange, R., Vopper, G., Cremer, H., Heinlein, U. A., Scheff, S., Baldwin, S. A., Leitges, M., Cramer, M., Paulsson, M., and Barthels, D. (1998). PACSIN, a brain protein that is upregulated upon differentiation into neuronal cells. Eur. J. Biochem. 256, 201–211. Primakoff, P., Hyatt, H., and Tredick-Kline, J. (1987). Identification and purification of a sperm surface protein with a potential role in sperm– egg membrane fusion. J. Cell. Biol. 104, 141–149.

Qi, H., Rand, M. D., Wu, X., Sestan, N., Wang, W., Rakic, P., Xu, T., and Artavanis-Tsakonas, S. (1999). Processing of the notch ligand delta by the metalloprotease Kuzbanian. Science 283, 91–94. Qualmann, B., Roos, J., DiGregorio, P. J., and Kelly, R. B. (1999). Syndapin I, a synaptic dynamin-binding protein that associates with the neural Wiskott–Aldrich syndrome protein. Mol. Biol. Cell. 10, 501–513. Reddy, B. A., Kloc, M., and Etkin, L. D. (1992). The cloning and characterization of a localized maternal transcript in Xenopus laevis whose zygotic counterpart is detected in the CNS. Mech. Dev. 39, 143–150. Ritter, B., Modregger, J., Paulsson, M., and Plomann, M. (1999). PACSIN 2, a novel member of the PACSIN family of cytoplasmic adapter proteins. FEBS Lett. 454, 356 –362. Rooke, J., Pan, D., Xu, T., and Rubin, G. M. (1996). KUZ, a conserved metalloprotease-disintegrin protein with two roles in Drosophila neurogenesis. Science 273, 1227–1231. Schlondorff, J., and Blobel, C. P. (1999). Metalloprotease-disintegrins: Modular proteins capable of promoting cell– cell interactions and triggering signals by protein-ectodomain shedding. J. Cell Sci. 112, 3603–3617. Sive, H., and Bradley, L. (1996). A sticky problem: The Xenopus cement gland as a paradigm for anteroposterior patterning. Dev. Dyn. 205, 265–280. Sive, H. L., Hattori, K., and Weintraub, H. (1989). Progressive determination during formation of the anteroposterior axis in Xenopus laevis. Cell 58, 171–180. Steele, R. E. (1985). Two divergent cellular src genes are expressed in Xenopus laevis. Nucleic Acids Res. 13, 1747–1761. Tan, P. K., Howard, J. P., and Payne, G. S. (1996). The sequence NPFXD defines a new class of endocytosis signal in Saccharomyces cerevisiae. J. Cell Biol. 135, 1789 –1800. Thompson, J. D., Higgins, D. G., and Gibson, T. J. (1994). CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positionspecific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673– 4680. Turner, D. L., and Weintraub, H. (1994). Expression of achaetescute homolog 3 in Xenopus embryos converts ectodermal cells to a neural fate. Genes Dev. 8, 1434 –1447. Van Wart, H. E., and Birkedal-Hansen, H. (1990). The cysteine switch: A principle of regulation of metalloproteinase activity with potential applicability to the entire matrix metalloproteinase gene family. Proc. Natl. Acad. Sci. USA 87, 5578 –5582. Weskamp, G., Kratzschmar, J., Reid, M. S., and Blobel, C. P. (1996). MDC9, a widely expressed cellular disintegrin containing cytoplasmic SH3 ligand domains. J. Cell Biol. 132, 717–726. Wolfsberg, T. G., Primakoff, P., Myles, D. G., and White, J. M. (1995). ADAM, a novel family of membrane proteins containing a disintegrin and metalloprotease domain: Multipotential functions in cell– cell and cell–matrix interactions. J. Cell Biol. 131, 275–278. Yagami-Hiromasa, T., Sato, T., Kurisaki, T., Kamijo, K., Nabeshima, Y., and Fujisawa-Sehara, A. (1995). A metalloprotease-disintegrin participating in myoblast fusion. Nature 377, 652– 656. Received for publication May 17, Revised July 11, Accepted July 13, Published online October 2,

Copyright © 2000 by Academic Press. All rights of reproduction in any form reserved.

2000 2000 2000 2000