Expression of defence-related genes in avocado fruit (cv. Fuerte) infected with Colletotrichum gloeosporioides

South African Journal of Botany 86 (2013) 92–100

Contents lists available at SciVerse ScienceDirect

South African Journal of Botany journal homepage: www.elsevier.com/locate/sajb

Expression of defence-related genes in avocado fruit (cv. Fuerte) infected with Colletotrichum gloeosporioides A.T. Djami-Tchatchou, F. Allie, C.J. Straker ⁎ School of Molecular and Cell Biology, University of the Witwatersrand, Private Bag 3, WITS 2050, Johannesburg, South Africa

a r t i c l e

i n f o

Article history: Received 28 November 2012 Received in revised form 11 February 2013 Accepted 11 February 2013 Available online 21 March 2013 Edited by E Balazs Keywords: Anthracnose Defence genes Persea americana 454 sequencing Real-time PCR

a b s t r a c t Anthracnose is the most severe post-harvest disease of many cultivars of avocado. Identification of avocado genes involved in the defence response against Colletotrichum gloeosporioides is a crucial step towards understanding the molecular basis of resistance in avocado fruit. Following 454 sequencing and analysis of the transcriptome of Fuerte avocado fruits infected with C. gloeosporioides, quantitative real-time PCR was employed to measure the expression of some candidate resistance and defence-related genes expressed during anthracnose disease. The selected genes included those coding for the endogenous control genes (actin and glyceraldehyde 3-phosphate dehydrogenase), salicylic acid binding protein 2 (SABP2), ethylene responsive element binding protein (EREBP), leucine rich protein (LRR), catalase, endochitinase, endo-1,4-D-glucanase and pathogenesis related proteins 5 (PR 5) and 6 (PR 6). The study identified many genes involved in key components of the resistance response including recognition, signalling, transcription, the oxidative burst, PR protein induction, R genes and the hypersensitive response. Expression profiles showed that selected genes were differentially expressed after infection when compared to the uninfected sample but that there is a modulation of the defence response, suggestive of a compatible-type interaction. This transcriptome analysis provides a first elucidation of the molecular networks involved in the resistance of avocado fruit to fungal parasitic infection and provides an important contribution to functional genomic approaches to understanding resistance in non-model crop plants. © 2013 SAAB. Published by Elsevier B.V. All rights reserved.

1. Introduction Next generation sequencing methods, such as Roche 454 pyrosequencing, Illumina Solexa and ABI SOLiD are now the most widely used technologies for analysing the transcriptomes of non-model but economically important plants (Rounsley et al., 2009; Sun et al., 2010; Wheeler et al., 2008). The genomic information from such studies provides an essential basis for functional genomics, comparative genomics and resistance breeding. Avocado (Persea americana Mill.) is an important agricultural fruit crop in many countries worldwide and its production is affected by a number of severe fungal pathogens, including Phytophthora cinnamomi Rands, which causes Phytophthora root rot and C. gloeosporioides (Penz.) Penz. and Sacc., which causes anthracnose, the most severe post-harvest disease of the fruit (Pernezny et al., 2000; Zentmyer, 1984). In South Africa, avocado is an important export crop (Donkin, 2007) and recent publications related to fungal diseases of avocado have used 454 sequencing to create cDNA libraries of differential gene expression. Mahomed and Van den Berg (2011) generated EST data containing 367 contigs novel to avocado rootstock infected with P. cinnamomi, and identified and quantified, by qRT-PCR, the expression

⁎ Corresponding author. Tel.: +27 11 717 6322; fax: +27 11 717 6351. E-mail address: [email protected] (C.J. Straker).

of nine defence-related genes differentially regulated in response to infection. Djami-Tchatchou et al. (2012) analysed the transcriptome of harvested and unharvested Fuerte avocado fruits at different time points after infection with C. gloeosporiodes and generated up to 2500 contigs in a single run which represented 639 plant genes most of which showed similarity to senescence-associated protein genes (56%) and cytochrome genes (18%). However, of the 218 genes shown to be induced after infection the largest proportion (24%) could be assigned towards defence with 15.6% showing similarity to genes coding for proteins involved in signal transduction and others showing homology to genes involved with the oxidative burst (7.8%), metabolism (6.4%), protein synthesis (6.4%), transcription factors (5.5%) and others controlling various aspects of metabolism. Notable amongst the induced genes involved with defence activation pathways were those coding for mitogen-activated protein kinase (MAPK), leucine rich repeat receptor-like protein kinase, salicylic acid binding protein, calcium dependent protein kinase, calcium ion binding protein, DnaK-like chaperone protein (heat shock protein 70), β 1,3-glucanase, catalase, endochitinase and endopeptidase (Djami-Tchatchou et al., 2012). By scoring the number of times the transcripts were expressed at each time point and with the use of hierarchical cluster analysis the authors were able to follow the regulation of important specific transcripts in response to infection in harvested and unharvested fruits and confirmed that the 454 sequences were those of avocado fruit by reverse transcription PCR.

0254-6299/$ – see front matter © 2013 SAAB. Published by Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.sajb.2013.02.166

A.T. Djami-Tchatchou et al. / South African Journal of Botany 86 (2013) 92–100

The study of Djami-Tchatchou et al. (2012) represents the first comprehensive survey of the biological response of avocado fruit to C. gloeosporiodes infection at the transcriptome and molecular level and demonstrates the complex molecular system of avocado for parasite recognition and activation of defence mechanisms. The aim of the present paper was to use real time PCR (qPCR) to quantify the expression of genes selected for their putative functions in the molecular networks involving the defence response, so as to construct a more complete model of the molecular basis of resistance/susceptibility in Fuerte avocado fruit in response to fungal parasitic attack.

93

Ltd. (Pretoria, South Africa). The primers pairs were evaluated for efficiency by performing a conventional PCR experiment using cDNA as template with 10 μM of specific primer. Total RNA (2 μg) was reversed transcribed using a RevertAid™ Premium First Strand cDNA Synthesis Kit (Fermentas), following the manufacturer's instructions The PCR reactions were carried out as follows: 1 cycle of 94 °C for 3 min (initial denaturation), 35 cycles of 94 °C for 30 s (denaturation), Tm of each primer for 1 min (annealing) and 72 °C for 2 min (elongation). Final elongation was achieved at 72 °C for 10 min. 2.2. Quantitative expression assays

2. Materials and methods Preparation of fungal inoculum and inoculation, plant material, experimental design, total RNA extraction, 454 library construction and 454 sequencing and transcript assembly and analysis, have all been previously described (Djami-Tchatchou and Straker, 2011; Djami-Tchatchou et al., 2012). 2.1. Primer design for real time PCR Ten primers were designed from sequences of cDNA obtained after 454 sequencing using the Integrated DNA Technologies's PrimerQuest Tool (http://eu.idtdna.com/Scitools/Applications/Primerquest/Default. aspx) which incorporates Primer 3 software. The selected genes included those coding for the endogenous control genes (actin and glyceraldehyde 3-phosphate dehydrogenase), salicylic acid binding protein 2 (SABP2), ethylene responsive element binding protein (EREBP), leucine rich protein (LRR), catalase, endochitinase, endo-1,4-D-glucanase, pathogenesis related protein 5 (PR 5) and 6 (PR 6) (Table 1). SABP2, EREBP, LRR, catalase and endochitinase are keys genes involved in the plant defence response (Barakat et al., 2009, 2012; Plymale et al., 2007; Zhang and Klessig, 2001) and LRR and PR 5 were also identified in avocado root in response to P. cinnamomi infection (Mahomed and Van den Berg, 2011). Endo-1,4-D-glucanase was selected because of the 100% sequence similarity to the same P. americana EST in the database. Moreover, sequence analysis had demonstrated the expression of all these genes in infected avocado fruit (Tables 2, 3; Djami-Tchatchou et al., 2012). The primer for the endogenous control genes, actin and glyceraldehyde 3-phosphate dehydrogenase, were designed from sequences obtained from NCBI data. The parameters chosen for each primer were as follows: short amplicons of less than 200 bp, and a Tm of 58.7– 60.2 °C. The specificity of the primers was first validated by BLASTN. The primers were synthesized by Inqaba Biotechnical Industries (Pty)

A real-time quantification PCR control experiment was performed to examine the linearity of amplification over the dynamic range. A serial dilution (undiluted, 1:10, 1:100, 1:1000, 1:10,000) on 5 μl of cDNA and each of the primers sets (10 μM of each primer) for the different genes were used to calculate the standard regression curves. Each dilution point on the standard curve was done in duplicate. The standard curve was calculated for each of the selected genes with the following formula: y = mx + b, where b = y-intercept of standard curve line (crossing point) and m = slope of the standard curve line (function of PCR efficiency). To generate a standard curve, Ct values/crossing points of different standard dilutions were plotted against the logarithm of input amount of standard material. The slope of a standard curve provided an indication of the efficiency of the real-time PCR; and from the slope (S), efficiency was calculated using the following  ð–1=SÞ PCR efficiency ð% Þ ¼ 100 10 –1 ðGinzinger; 2002Þ: The expression of the selected defence related genes were assessed by two independent biological replicates (cDNA from different fruits) and each biological replicate had its own replicates (technical replicates). The expression of the selected genes was assessed using the Roche Light Cycler 1.5 technology. Expression profiles were presented as a ratio for each gene fragment at EU (1 h, 4 h and 24 h), LU (3 d, 4 d, 5 d and 7 d), EH (1 h, 4 h and 24 h) and LH (3 d, 4 d, 5 d and 7 d) post infection in comparison with the expression of the gene fragments in the calibrator or uninfected control. Real-time PCR reactions were set up by combining 10 μl of Maxima™ SYBR Green/Fluorescein qPCR Master Mix, 1 μl each of the forward and reverse primers (10 μM), 1 μl of cDNA and nuclease-free water to give a total master mix volume of 20 μl per reaction. Reactions were added to glass capillaries tubes and placed into the LightCycler

Table 1 Base composition of primers designed for each different selected gene for qRT-PCR. Primer

Primer product size

Primer length

Direction

Primer sequence (5′–3′)

Primer TM (°C)

Actin

166

24

162

24

Chitinase

186

24

Endo-1,4-D-glucanase

121

24

AGCTCGCTTATGTGGCTCTTGACT TCTCATGGATTCCAGCAGCTTCCA TTTGAAGGCATGGATCACATCGGG CTCGAGGCTTCGCCATTAAGTTCT ATCACGTTGTGGCATGACGGTTTG AATACTACGGGCGTGGACCATTCA ACTCTTCCGGAGGACATGCTTTCATGTATGACATCTTGGCCGGGTTCT

60.0

Catalase

EREBP

96

24

GAPDH

186

24

LRR

136

24

PR 5

171

24

PR 6

158

24

SABP2

172

24

Forward Primer Reverse Primer Forward Primer Reverse Primer Forward Primer Reverse Primer Forward Primer Reverse Primer Forward Primer Reverse Primer Forward Primer Reverse Primer Forward Primer Reverse Primer Forward Primer Reverse Primer Forward Primer Reverse Primer Forward Primer Reverse Primer

TCAGGGTCTGGCTTGGAACCTTTA CACTTTGGCTTTCTTGCCACGGAT AGTGGAGGGTTTGATGACCACAGT ATTTAACGCAGGCAGCACTTTCCC GCAGCCATCCTTTGAAGAAAGCGT AACGTCCCGCTACTGACACTTGAA TGCAACAGTACTCGTCGGTCTTGA TATCGCTGGTGGACGGGTTTAACA TGCGCGGACTTACAATCAGA AGAGTCCAAAGTGTCGTTCAGCCT AGCGATACGAGGAGGCATTTCGTT TTCATCGAACGTGTGGAGATCCCT

59.4 58.7 60.1 59.9 59.9 60.0 59.8 60.1 59.9 60.1 60 60 59.7 60.0 56.3 59.9 60.2 59.6

94

A.T. Djami-Tchatchou et al. / South African Journal of Botany 86 (2013) 92–100

Table 2 Summary of genes expressed in unharvested avocado fruits during early and late response to C. gloeosporioides infection with their putative function. Name

Accession number of similar sequence

Similar sequence from database (BLASTX) (putative function)

Max identity %

Gene0018 Gene0019 Gene0020 Gene0021 Gene0022 Gene0023 Gene0024 Gene0025 Gene0026 Gene0027 Gene0029 Gene0028 Gene0004 Gene0030 Gene0005 Gene0031 Gene0032 Gene0034 Gene0087

XP_002531635.1 AAK15049.1 AEE78232.1 AAD30291.2 AAF61733.1 ABR19829.1 BAB64929.1 AAG51234.1 CAB01591.1 AEE84132.1 AAZ94162.1 ACE96388.1 NP_172244.2 AAF97315.1 AAF66615.1 AAM47598.1 ABA33845.1 ABF96384.1 CAD56217.1

Defence α-glucosidase, putative [Ricinus communis] Asparaginyl endopeptidase [Vigna radiata] Beta-D-glucan exohydrolase-like protein [Arabidopsis thaliana] Catalase 2 [Raphanus sativus] Catalase 3 [Helianthus annuus] Cysteine proteinase [Elaeis guineensis] Defensin-like protein [Pyrus pyrifolia] Disease resistance protein MLO, putative; 5304–2185 [Arabidopsis thaliana] Endochitinase [Persea americana] Enhanced disease resistance 2 protein [Arabidopsis thaliana] Enzymatic resistance protein [Glycine max] Esterase/lipase/thioesterase [Populus tremula] Leucine-rich repeat transmembrane protein kinase, putative [Arabidopsis thaliana] Lipoxygenase [Arabidopsis thaliana] LRR receptor-like protein kinase [Nicotiana tabacum] NBS/LRR resistance protein-like protein [Capsicum annuum] Pathogenesis-related protein 6 [Zea diploperennis] Serine carboxypeptidase family protein, expressed [Oryza sativa Japonica Group] Transcription factor EREBP-like protein [Cicer arietinum]

60 87 52 70 75 90 55 41 100 51 63 100 74 72 81 65 59 71 100

Gene0041 Gene0042 Gene0043 Gene0044 Gene0045 Gene0046 Gene0047 Gene0048 Gene0049 Gene0087

BAJ33502.1 BAC79443.1 AAF61733.1 XP 002332294.1 NP_567868.1 CAH59407.1 ABZ85667.1 NP_001154256.1 AAM47598.1 CAD56217.1

β-glucosidase like protein [Delphinium grandiflorum] Catalase [Acacia ampliceps] Catalase 3 [Helianthus annuus] CC-NBS resistance protein [Populus trichocarpa] Endonuclease V family protein [Arabidopsis thaliana] Endopeptidase 1 [Plantago major] LRR-like disease resistance protein [Brassica rapa subsp. pekinensis] Metalloendopeptidase [Arabidopsis thaliana] NBS/LRR resistance protein-like protein [Capsicum annuum] Transcription factor EREBP-like protein [Cicer arietinum]

61 98 75 58 80 65 76 54 65 100

Early unharvested

Late unharvested

rotor (Roche Diagnostics). No template control (NTC) reactions contained water as template was used as negative control and 1 μl of cDNA (1:10 dilution) was used as a positive control. The cycling conditions were as follows: initial denaturation for 10 min at 95 °C (hot start) followed by amplification and quantification cycle repeated 40 times each consisting of 15 s denaturing at 95 °C, 30 s annealing at primer specific temperatures, 30 s primer extension at 72 °C with a single fluorescence measurement. Then a melting curve cycle was obtained by heating to 65 °C for 15 s with a heating rate of 0.1°C per second and continuous fluorescence measurement, and finally a cooling step at 40 °C for 30 s. LightCycler software (Roche) was employed to calculate crossing points (Ct) for each transcript, Ct being the point at which the fluorescence rises appreciably above the background fluorescence (Pfaffl, 2001).

PCR data were statistically compared between treatments at each time point using one-way ANOVA (Kuznetsova et al., 2010). 2.4. Gel electrophoresis of the real time PCR products The products obtained from the real time PCR of each of the selected genes were separated by electrophoresis and visualised on 2% agarose/ TAE gels containing EtBr to ensure that single transcripts products were obtained, and to verify LightCycler melting curve analyses that indicated that real time PCR reactions were free of primer dimers. 3. Results 3.1. 454 sequencing

2.3. Data analysis The relative standard curve method was used to quantify the selected genes. Because quantitation should be normalized to an endogenous control, standard curves were prepared for both the target and the endogenous reference (actin and GADPH). For all experimental samples, the amount of target and reference in the samples of interest was calculated using their Ct values and the corresponding standard curve. Then the normalized expression value for each gene was calculated by dividing the average amount of target gene by the average amount of target reference gene. Finally, the relative expression level of the target gene in the samples of interest was determined by dividing the normalized target amounts by the value of the calibrator (or Control). The calibrator then became the 1X sample, and all other quantities were expressed as an n fold difference relative to the calibrator (Applied Biosystems, 2004). The average input of each treatment of the target gene and the reference control and the standard deviation were calculated prior to calculating the normalised values using the statistical analysis software GraphPad inStat 3. Real-time

The comparison between the healthy and infected transcriptomes enabled Djami-Tchatchou et al. (2012) to identify a large number of candidate pathogen response genes. Comparison of data from the 454 sequence reads of infected avocado fruit were made by these authors to BLASTX and when searched against the NCBI protein database allowed function assignment based on the similarities with known functions of plant protein sequences. Genes obtained from these 454 reads are considered to be expressed after C. gloeosporioides infection and many resistance genes were identified in both unharvested and harvested infected samples. Tables 2 and 3 represent 454 sequencing results not published elsewhere and indicate that catalases were expressed in all samples except early harvested, whereas chitinases were expressed in all samples except late unharvested. LRR-protein-like proteins were identified in all samples except early harvested whereas PR 5 and 6 were present in early harvested and unharvested fruits, respectively. Glucanases were identified in late harvested and early unharvested and SA kinases in late harvested samples. Transcription factor EREBP-like protein was expressed in all samples except late harvested and peroxidase and thaumatin-like proteins expressed only in early harvested fruits.

A.T. Djami-Tchatchou et al. / South African Journal of Botany 86 (2013) 92–100

95

Table 3 Summary of genes expressed in harvested avocado fruits during early and late response to C. gloeosporioides infection with their putative function. Name

Accession number of similar sequence

Similar sequence from database (BLASTX) (putative function)

Max identity %

ABZ02704.1 ABG37021.1 BAB62890.1 CAI39245.1 NP_191763.3 CAC81812.1 XP_002527223.1 ADP69173.1 ACE97327.1 AAL35364.1 ACG48882.1 NP_001154663.1 AAK59275.1 AAL15885.1 CAD56217.1 AAK58515.1 AEE78232.1 BAC79443.1 AAF61733.1 ADQ43720.1 CAB01591.1 ABY58190.1 NP_191415.2 CAH59407.1 ABZ85667.1 NP_001154256.1 XP_002519488.1 AAM47598.1 ACE97327.1 ABJ89812.1 BAC53772.1

Defence Accelerated cell death 1 [Arabidopsis thaliana] Aspartic protease [Nicotiana tabacum] Aspartic proteinase 1 [Glycine max] beta-Amylase [Glycine max] Catalytic/hydrolase [Arabidopsis thaliana] Chitinase, putative [Musa acuminata] Oligopeptidase A, putative [Ricinus communis] Pathogenesis related protein-5 [Populus tomentosa] Pectinesterase inhibitor [Populus tremula] Peroxidase [Capsicum annuum] Programmed cell death protein 5 [Zea mays] Ribonuclease III family protein [Arabidopsis thaliana] Thaumatin-like protein [Sambucus nigra] γ-Thionin putative [Castanea sativa] Transcription factor EREBP-like protein [Cicer arietinum] β-1,3-glucanase-like protein [Olea europaea] β-D-glucan exohydrolase-like protein [Arabidopsis thaliana] Catalase [Acacia ampliceps] Catalase 3 [Helianthus annuus] Chitinase I [Casuarina equisetifolia] Endochitinase [Persea americana] Endo-1,4-D-glucanase [Persea americana] Endonuclease/exonuclease/phosphatase family protein [Arabidopsis thaliana] Endopeptidase 1 [Plantago major] LRR-like disease resistance protein [Brassica rapa subsp. pekinensis] Metalloendopeptidase [Arabidopsis thaliana] Multidrug resistance protein 1, 2, putative [Ricinus communis] NBS/LRR resistance protein-like protein [Capsicum annuum] Pectinesterase inhibitor [Populus tremula] Salicylic acid-activated MAP kinase [Nicotiana attenuata] Salicylic acid-induced protein kinase [Nicotiana benthamiana]

60 70 70 74 70 86 66 86 69 70 83 79 86 50 100 75 52 98 75 82 100 100 81 65 76 54 81 65 69 84 84

Early harvested

Late harvested

Gene0065 Gene0066 Gene0067 Gene0068 Gene0069 Gene0070 Gene0072 Gene0073 Gene0074 Gene0075 Gene0076 Gene0033 Gene0077 Gene0071 Gene0087 Gene0091 Gene0092 Gene0093 Gene0094 Gene0095 Gene0096 Gene0097 Gene0098 Gene0099 Gene00100 Gene00101 Gene00102 Gene00103 Gene00104 Gene0081 Gene0082

3.2. Real time PCR An up regulation was observed in the expression of the catalase gene in unharvested avocado fruits infected with C. gloeosporioides, whereas in harvested fruits, an up regulation of catalase was observed only in the late response (Fig. 1A). Chitinase was down regulated in both unharvested and harvested during early response, but during late response an up regulation of chitinase expression was observed in both unharvested and harvested avocado fruits (Fig. 1B). The expression of EREBP was down regulated in the harvested samples but was up regulated during early response in unharvested fruits (Fig. 1C). The expressions of endo-1,4-glucanase and SABP2 were down regulated in all infected samples, as was that of LRR, especially in harvested fruits (Fig. 1D,E,F). PR 5 was down regulated in all the infected samples significantly so in unharvested fruits, whereas PR 6 expression was up regulated in harvested samples, especially in the late phase (Fig. 1G,H). The slope of all the standard curves was between −3.161 and −4.018 with most R2 values above 0.95. 3.3. Gel electrophoresis of the real time PCR products The real time PCR products obtained from the selected genes were separated by electrophoresis and visualised on 2% agarose/TAE gels containing EtBr. Each gene produced single bands of the desired size between 100 and 200 bp, depending on the primer sets used (Fig. 2). 4. Discussion The plenitude of functional genomic studies of recent years has improved our understanding of plant–pathogen interactions through the identification of endogenous resistance genes and analysis of signalling pathways leading to the hypersensitive response (HR) and systemic acquired resistance (SAR). This breakthrough has enabled more sophisticated breeding strategies in commercial cultivars to be employed using

marker-assisted breeding (Ayliffe and Lagudah, 2004). Within this context the present study was undertaken to understand the molecular basis of resistance and susceptibility in pre- and post-harvested avocado fruit during C. gloeosporioides infection by focussing on genes likely to be involved in pathways involving host defence. 4.1. Salicylic acid binding protein 2 (SABP2) The recognition of a pathogen by a plant triggers rapid defence responses by a number of signal transduction pathways (Barakat et al., 2009). In avocado fruits infected by C. gloeosporioides many genes were identified to be potentially involved in signal transduction and these include mitogen-activated protein kinases (MAPK), salicylic acid-induced protein kinase (SIPK), salicylic acid-activated MAP kinase, salicylic acid-binding protein 2 (SABP2), calcium-dependent protein kinase and leucine-rich repeat transmembrane protein kinase (Djami-Tchatchou et al., 2012). In particular, SABP2 was initially identified in harvested avocado fruit (Table 2; Djami-Tchatchou et al., 2012). Real time PCR revealed that the SABP2 gene, which is expressed in uninfected fruit, was also expressed, but down regulated, in all the infected samples during early and late response (Fig. 1D). Kumar and Klessig (2003) have shown that in tobacco, SABP2 is a salicylic acid (SA) receptor which displays SA-induced lipase activity in which state it signals for both local and SAR in the plant. However, Liu et al. (2011) have proposed that the induction of SAR in tobacco and Arabidopsis is a complex interplay between two mobile signals; lipids and methyl salicylate (MeSA). MeSA biosynthesis is needed in the primary infected tissue for the SAR signal to be produced. MeSA esterase activity is required in uninoculated systemic tissue where the SAR signal is perceived. MeSA itself does not induce the defence response but must be converted to SA by MeSA esterase activity which is regulated by SABP2 binding. However, the SABP2-induced MeSA esterase activity must be inhibited in the primary infected tissue (by SA binding to its active site) to promote the formation of high

96

A.T. Djami-Tchatchou et al. / South African Journal of Botany 86 (2013) 92–100

Fig. 1. Relative gene expression level in avocado fruit infected with C. gloeosporioides. Expression analysis was conducted during early response (pool of 1, 4 and 24 h in unharvested (EU) and harvested fruits (EH); during late response (pool of 3, 4, 5 and 7 d post infection) in unharvested (LU) and harvested fruits (LH) with 0 h being the uninfected control (C). The data was normalized using two reference genes actin and GADPH. Expression analysis was performed in duplicate on two biological replicates and each biological replicate has its own replicates (technical replicates). (A) Catalase, (B) chitinase, (C) EREBP, (D) SABP2, (E) LRR resistance protein-like protein, (F) endo-1,4-D-glucanase, (G) pathogenesis-related protein 5 (PR5), (H) pathogenesis-related protein 6 (PR6). Expression is given in terms of calibrator, with n=4 for each data point (±SD). Different letters represent significant differences between means of time points at pb 0.05.

enough levels of MeSA to signal SAR (Liu et al., 2011). Therefore, the down regulation of the SABP2 gene in infected avocado fruit may not necessarily reflect active suppression of resistance by C. gloeosporioides but the initiation of SAR. 4.2. Catalase and the oxidative burst Abiotic, and biotic stresses such as pathogen invasion, cause an enhanced production of active oxygen species (AOS) in plants which include H2O2, a highly toxic oxidant. Djami-Tchatchou et al. (2012)

showed that a number of enzymes involved with the oxidative burst are expressed in infected avocado fruit. The enzymes responsible for eliminating H2O2 to prevent oxidative damage to cells include peroxidases and catalases which degrade H2O2 into water and oxygen. However, the involvement of H2O2 and catalase in the defence response of plants to pathogen infection is multiple. In an incompatible interaction, high levels of H2O2 are toxic to both parasite and plant cells and in HR the killing of plant cells around the infection site inhibits spread of the pathogen (Van Breusegem et al., 2001), although Govrin and Levine (2000) have demonstrated that necrotrophic pathogens such as Botrytis

A.T. Djami-Tchatchou et al. / South African Journal of Botany 86 (2013) 92–100

97

Fig. 2. Real time PCR products amplified from avocado flesh cDNA using specific primers separated on 2% non-denaturing agarose gel containing EtBr and photographed under ultraviolet light. L, GeneRuler™ 100 bp DNA Ladder. Lane 1, SABP2 (172). Lane 2, EREBP (96). Lane 3, LRR (136). Lane 4, endo-1,4-D-glucanase (121 bp). Lane 5, pathogenesis-related protein 5 (171 bp). Lane 6, pathogenesis-related protein 6 (158 bp). Lane 7, chitinase (186 bp). In B=Late unharvested Lane 7, catalase (162 bp).

cinerea (and possibly hemibiotrophs such as C. gloeosporioides) actively exploit the dead tissue as a food source to enhance pathogenicity. Hydrogen peroxide also serves as a substrate in cross-linking reactions of lignin precursors and stimulates cross linking of cell wall proteins. Since the molecule is relatively stable and can diffuse across membranes it also acts as a signal molecule in stress responses (Van Breusegem et al., 2001). Chen et al. (1993) were first to identify catalase as an SA-binding receptor protein which becomes inactive after SA binding, leading to H2O2 accumulation, which acts as a secondary messenger inducing expression of PR genes. Thus, changes in H2O2 homeostasis can act as a trigger for a signal transduction cascade leading to local and systemic defence responses (Van Breusegem et al., 2001). It is catalase, together with ascorbate peroxidase, involved in the modulation of H2O2, which acts downstream of SA as a second messenger for the activation of plant defence responses (Clark et al., 2000) and plays an important role in the plant signal transduction pathway which leads to the development of SAR (Bagnoli et al., 2004). Monitoring of catalase gene expression, therefore, provides an indication of a plant's response to infection. In avocado fruit infected with C. gloeosporioides, there was a slight up regulation in unharvested fruits and a high up regulation in late harvested fruit (Fig. 1A). In unharvested fruits, symptom development was slow, probably due to high levels of anti-fungal dienes and trienes in the fruit (Djami-Tchatchou et al., 2012; Marimani, 2011) so the slight up regulation of the catalase gene may represent a localized stress response in the fruits. In late harvested fruit, however, significant tissue damage had been caused by the fungus ((Djami-Tchatchou et al., 2012) so the induction of catalase activity might represent a heightened stress response in the cells on the periphery of the advancing lesion and/or delayed downstream induction of other defence-related genes. 4.3. Transcription factor ethylene-responsive element binding protein (EREBP) Plant ethylene seems to play a crucial role in different plant disease resistance pathways. It has been shown that during plant–pathogen interactions the rate of the biosynthesis of ethylene increases rapidly and afterward ethylene induces transcription of some defence related

genes such as β-1,3-glucanase and chitinase class I (Vögeli et al., 1988; Wang et al., 2002). It appears that ethylene biosynthesis is induced by that of H2O2 but precedes that of SA so that H2O2 acts an intermediate signal upstream of ethylene and SA in a plant's stress response (Chamnongpol et al., 1998). The ethylene-responsive element known as the GCC box (AGCCGCC) is commonly found in the promoter region of ethylene-inducible pathogenesis-related protein genes. EREBP was identified in all but late harvested avocado fruits (Tables 2, 3). Real time PCR showed that EREBP was up regulated in early unharvested fruit and down regulated in the harvested infected fruits (Fig. 1C). This pattern suggests a fairly rapid induction of ethylene biosynthesis in the unharvested fruit but a repression of synthesis in the harvested fruits and confirms the likely involvement of ethylene as a signalling molecule in the stress response of avocado fruit caused by C. gloeosporioides. 4.4. Pathogenesis-related (PR) proteins PR proteins are widespread in the plant kingdom and represent a diverse group of proteins which are induced downstream of R gene activation and induction of signal pathways, and accumulate both locally around infection sites and systemically (Kombrink and Somssich, 1997). Some of these gene products are involved in SAR, an important broad-spectrum, long-lasting plant defence response that protects the whole plant against subsequent infection. We have demonstrated transcription of the following PR genes in infected avocado fruit: pathogenesis-related proteins PR 5 and PR 6, β-1,3-glucanases and chitinases (Plymale et al., 2007), genes encoding cysteine-rich proteins related to thaumatin (Linthorst, 1991), defensin (PR 12) (Tiryaki and Tunaz, 2004), ribonuclease III family protein (PR 10), γ-thionin (PR 13) and peroxidase (PR 9) (Van Loon and Van Strien, 1999). It has been demonstrated that an increase in SA levels stimulates the expression of PR proteins (Uknes et al., 1992; Ward et al., 1991). Uknes et al. (1992) also showed that PR 5 and β-1,3-glucanase genes are regulated by SA. In avocado fruit, β-1,3-glucanases and chitinase would be a tool in weakening and decomposing C. gloeosporioides cell walls containing β-1,3-glucans and chitin (Kombrink and Somssich, 1997; Monteiro et al., 2003). By means of in vitro bioassays, Stintzi et al. (1993) have

98

A.T. Djami-Tchatchou et al. / South African Journal of Botany 86 (2013) 92–100

confirmed the synergistic effects of these two hydrolytic enzymes in tobacco challenged with the fungus Trichoderma viride. These enzymes are also able to partially degrade fungal cell walls to release oligosaccharides which may act as elicitors leading to the induction of further active defence response (Edreva, 2005; Stintzi et al., 1993). PR 5 type thaumatin, PR 12 type defensin, γ-thionin (PR 13) (Hammond-Kosack and Jones, 2000) have been shown to exhibit antifungal and antibacterial activities, exerting their action at the level of the plasma membrane of the target pathogen. Their plasma membrane-permeabilizing ability leads to the plasmolysis and damage of fungal or bacterial pathogens by inhibiting their growth and development (Broekaert et al., 1997). Likewise, Lagrimini et al. (1987) reported that the peroxidase activity of PR 9 could participate in an ultra-fortification and rigidification of plant cell walls in response to pathogen infection, but these enzymes are also involved in wide range of physiological and biochemical processes, many associated with host defence (Kombrink and Somssich, 1997). Of the PR genes expressed in avocado fruit in response to infection by C. gloeosporioides, we selected pathogenesis-related protein 5 and 6 (initially identified in early harvested and early unharvested fruits, respectively) and endochitinase (initially identified in early unharvested and all harvested samples) for further quantification (Table 2). Real-time PCR showed that PR 5 protein, present in unininfected fruit, was down regulated in all samples, especially unharvested, whereas PR 6 protein was up regulated in harvested fruits (Fig. 1). Endochitinase was up regulated in both unharvested and harvested fruits during late response to C. gloeosporioides. Some of these patterns are counter-intuitive to the accepted understanding of PR proteins as being induced exclusively after infection, usually downstream of initial recognition and signal transduction events (Van Loon and Van Strien, 1999), and require further deliberation. Since PR 5 is a thaumatin-like protein, the results suggest that thaumatin is present constitutively in healthy avocado fruit and infection by C. gloeosporioides initiates a rapid down regulation of its transcription. In contrast, Hu and Reddy (1997) have shown that thaumatin is induced by the presence of fungi and pathogenic moulds and Mahomed and Van den Berg (2011) demonstrated a significant up regulation of the gene at 48 h in avocado root in response to P. cinnamomi infection. Thaumatins have been shown to be expressed constitutively in healthy grapevine plants, but only in plants cultured in vitro (Monteiro et al., 2003). The regulation pattern of genes coding for these proteins in avocado fruit suggests that infection by C. gloeosporiodes represses induction, as in a susceptible response. In the case of endochitinase and PR 6 (a proteinase inhibitor), gene expression patterns suggest an induction of these proteins in response to C. gloeosporioides attack, but a delayed induction, probably also indicative of a compatible interaction. Aspartic proteinases, also identified in infected avocado fruits (Table 2), belong to the class of endopeptidases that exhibit antimicrobial activity and are induced by both abiotic and biotic stress (Guevara et al., 2005) and have thus been involved in plant defence. In potato cultivars, aspartic proteinase is induced in response to Phytophthora infestans infection (Guevara et al., 2005). Plant cysteine proteases, identified in avocado fruits, are involved in signalling pathways and in the response to biotic and abiotic stresses (Grudkowska and Zagdańska, 2005; Salas et al., 2008), although in animals, and probably in plants, they are involved in programmed cell death (Coll et al., 2011). Pectin esterase inhibitor, identified in harvested avocado fruits during early response (Table 2), besides their role in the regulation of fruit growth and cell wall extension, is probably involved in the fruit defence mechanism against pathogens by inhibiting microbial pathogen pectin esterase/pectin methyl esterases (Camardella et al., 2001). In unharvested avocado fruits during early response (Table 2), sequence analysis also revealed the expression of lipoxygenase which has been reported in several species to be induced during plant–pathogen interactions (Porta and Rocha-Sosa, 2002). Its function in plant defence system seems to be related to the synthesis of a number of compounds involved in signalling functions (Creelman and Mullet, 1997), with antimicrobial activity (Weber et al., 2007), or to the development of the HR (Rustérucci et al., 1999).

Lipoxygenase also mediates the metabolism of the antifungal diene and triene compounds present in the skin and flesh of Fuerte avocado fruits (Djami-Tchatchou et al., 2012; Marimani, 2011). 4.5. Resistance (R) genes and the hypersensitive response (HR) Tables 2 and 3 show the expression of genes with similarity to genes that encode NBS-LRR resistance protein-like proteins which constitute the largest and most diverse family of resistance genes in plants (Wroblewski et al., 2007). This family of plant resistance genes functions in a classical gene-for-gene interaction in which pathogen elicitors are recognised by the C-terminal LRR receptor region and a hypersensitivity response involving race-specific resistance is activated (Dangl and Jones, 2001; Nimchuk et al., 2003). For example, lettuce contains such a gene, Dm3, which determines resistance to specific isolates of the oomycete pathogen, Bremia lactucae carrying the corresponding avirulence gene, Avr3 (Wroblewski et al., 2007). Real-time PCR analysis showed a down regulation of such a gene (LRR) in all infected samples, particularly in the harvested samples (Fig. 1). This pattern suggests, firstly, the absence of the corresponding avirulence gene in the fungus and, secondly, the presence of the fungus causing repression of the R gene which would ultimately result in non-transcription of receptor proteins, leading to the inability of the host to induce HR. Clearly, the repression effect is most pronounced in harvested fruits in which C. gloeosporiodes is no longer quiescent and is actively colonising host tissue. Mahomed and Van den Berg (2011) found no changes in NBS-LRR-protein gene expression in avocado rootstocks infected with P. cinnamomi. In this study, accelerated cell death 1 and programmed cell death protein 5 were expressed in infected harvested avocado fruits during early response (Table 2). These genes are known to be involved in HR (Kotb et al., 2005; Tanaka et al., 2003). The early step in the HR is the ion fluxes manifested by an increase in cytosolic calcium which precedes and seems necessary for hypersensitive cell death induced by rust fungi (Xu and Heath, 1998). The presence of calcium-dependent protein kinase and calcium ion binding protein in the infected harvested avocado fruits during early response (Djami-Tchatchou et al., 2012) may imply HR activation, but the gene expression data do not support the likelihood of a true HR response. This conclusion is supported by the situation in unharvested fruit, where the infection is quiescent and may suggest the host's ability to mount a HR, but the fungus can form appressoria, infection pegs, and hyphae under the cuticle which remain dormant until ripening when changes in host physiological status and the decline in concentrations of anti-fungal dienes and trienes allows fungal growth to resume (Prusky and Plumbley, 1992). In contrast, features of an incompatible interaction between Colletotrichum and a host plant have been described for the C. lindemuthian–Phaseolus vulgaris association (Esquerré-Tugayé et al., 1992). These features include: early host cell death at the point of penetration; inhibition of parasite growth in the penetrated cells; instantaneous membrane depolarization which initiates a cascade of events such as protein kinase activation, Ca2+ induced protein phosphorylation and ethylene biosynthesis. The host produces high levels of polygaracturonase inhibitory proteins (PIGPs) and there is activation of the isoflavonoid pathway leading to phytoalexin production and the early induction of β-1,3-glucanases and chitinases. At the structural level, there is a rapid increase in the concentrations of hydroproline-rich glycoproteins (HRGPs) (Esquerré-Tugayé et al., 1992). In Fuerte avocado fruit there appears to be no genes expressed which are involved in pathways leading to PIGP, HRGP or phytoalexin production (Djami-Tchatchou, 2012; Djami-Tchatchou et al., 2012). 4.6. Endo-1,4-D-glucanase This gene was selected for RT-PCR quantification since it represents one of the few sequences for which there was an absolute match to an avocado EST in the NCBI database. Endo-1,4-D-glucanase is the enzyme

A.T. Djami-Tchatchou et al. / South African Journal of Botany 86 (2013) 92–100

which initiates the catalytic process leading to the breakdown of cellulose and it is unlikely to represent a PR protein. This glucanase gene was down regulated in all infected samples, which suggests that the enzyme may be active constitutively in uninfected fruit but that infection by C. gloeosporidiodes halts transcription. There is no information on the possible function of this gene in avocado, but Ferrándiz (2002) reports of bHLH transcription factors in Arabidopsis which initiate regulatory cascades leading to the expression of endo-1,4-glucanases (amongst other cell wall-degrading enzymes) involved in softening of the cell wall during fruit ripening and dehiscence. Without further experimental data we can only speculate on the dramatic down regulation of the gene in all infected avocado fruit, which may be a consequence of the cross-talking between different signalling pathways involving a hormone like ethylene and not an indication of a direct defence-related response. 5. Conclusions The data presented here and the genomic analysis of Djami-Tchatchou et al. (2012) demonstrate that the Fuerte avocado fruit manifests molecular networks which are components of both general and specific resistance and that the plant responds to C. gloeosporioides through a combination of structural and chemical defences. Although the study illuminates the resistance phenotype of avocado fruit, it is also apparent that in this particular host–parasite interaction there is a modulation of the defence response, more indicative of a compatible interaction. Further analysis of this modulated response could highlight the gene products whose synthesis the fungus is able to inhibit, and a future study might target the fungal gene products which facilitate repression of these specific host genes with a view to controlling synthesis of the fungal gene products. Further investigations could target the cascades involved in these mechanisms and the action of SA and ethylene in order to elucidate the signalling pathways. From the genetic database obtained, many primers of defence related genes could be designed and used to test the expression profiles of some key defence genes in other avocado cultivars and various cultivar–fungal disease combinations (Cercospora spot or Phytophthora). This research has opened the door for a multitude of future molecular investigations such as AFLP-based transcript profiling (cDNA–AFLP) and microarrays which could study in more detail the expression profiles of some target genes. In addition many molecular markers could be designed from the resistance genes and used via conventional breeding methods or genetic engineering to improve the resistance of avocado cultivars to anthracnose and other fungal diseases. Acknowledgments We acknowledge financial support from the National Research Foundation, South Africa (ICD2007052500003: 2008–2011), the University of the Witwatersrand Postgraduate Merit Award, the Bradlow Award and the Oppenheimer Memorial Trust. We thank Mr. Don Taylor, the owner of Roodewal farm, and Mr. Musa Marimani for the technical assistance. References Applied Biosystems, 2004. Guide to performing relative quantitation of gene expression using Real–Time Quantitative PCR. Ayliffe, M.A., Lagudah, S.S., 2004. Molecular genetics of disease resistance in cereals. Annals of Botany 94, 765–773. Bagnoli, F., Danti, S., Magherini, V., Cozza, R., Innocenti, A.M., Racchi, M.L., 2004. Molecular cloning and characterisation and expression of two catalases from peach. Functional Plant Biology 31, 349–357. Barakat, A., DiLoreto, D.S., Zhang, Y., Smith, C., Baier, K., Powell, W.A., Wheeler, N., Sederoff, R., Carlson, J., 2009. Comparison of the transcriptomes of American chestnut (Castanea dentata) and Chinese chestnut (Castanea mollissima) in response to the chestnut blight infection. BMC Plant Biology 9, 51. Barakat, A., Staton, M., Cheng, C.-H., Park, J., Yassin, N.B.M., Ficklin, S., Yeh, C.-C., Hebard, F., Baier, K., Powell, W., Schuster, S.C., Wheeler, N., Abbott, A., Carlson, J.E., Sederoff, R.,

99

2012. Chestnut resistance to the blight disease: insights from transcriptome analysis. BMC Plant Biology 12, 38. Broekaert, W.F., Cammue, B.P.A., De Bolle, M.F.C., Thevissen, K., De Samblanx, G.W., Osborn, R.W., 1997. Antimicrobial peptides from plants. Critical Reviews in Plant Sciences 16, 297–323. Camardella, L., Carratore, V., Ciardiello, M., Servillo, L., Balestrieri, C., Giovane, A., 2001. Kiwi protein inhibitor of pectin methylesterase: amino-acid sequence and structural importance of two disulfide bridges. European Journal of Biochemistry 267, 4561–4565. Chamnongpol, S., Willekens, H., Moeder, W., Langebartels, C., Sandermann, H.J., Van Montagu, M., Inze, D., Van Camp, W., 1998. Defence activation and enhanced pathogen tolerance induced by H2O2 in transgenic tobacco. Proceedings of the National Academy of Sciences 95, 5818–5823. Chen, Z., Silva, H., Klessig, R.F., 1993. Active oxygen species in the induction of plant systemic acquired resistance by SA. Science 262, 1883–1886. Clark, D., Durner, J., Navarre, D.A., Klessig, D.F., 2000. Nitric oxide inhibition of tobacco catalase and ascorbate peroxidase. Molecular Plant-Microbe Interactions 13, 1380–1384. Coll, N.S., Epple, P., Dangl, J.L., 2011. Programmed cell death in the plant immune system. Cell Death and Differentiation 18, 1247–1256. Creelman, R.A., Mullet, J.E., 1997. Biosynthesis and action of jasmonates in plants. Annual Review of Plant Biology 48, 355–381. Dangl, J.L., Jones, J.D.G., 2001. Plant pathogens and integrated defence responses to infection. Nature 411, 826–833. Djami–Tchatchou, A.T., 2012. Analysis of genes differentially expressed in Fuerte avocado fruit in response to Colletotrichum gloeosporioides infection. PhD thesis, University of the Witwatersrand, Johannesburg. Djami–Tchatchou, A.T., Straker, C.J., 2011. The isolation of high quality RNA from avocado (Persea americana Mill.) fruit. South African Journal of Botany 78, 44–46. Djami–Tchatchou, A.T., Straker, C.J., Allie, F., 2012. 454 Sequencing for the identification of genes differentially expressed in avocado fruit (cv. Fuerte) infected by Colletotrichum gloeosporioides. Journal of Phytopathology 160, 449–460. Donkin, D.J., 2007. An overview of the South African avocado industry. South African Subtropical Growers' Association 1–5. Edreva, A., 2005. Pathogenesis-related proteins: research progress in the last 15 years. General and Applied Plant Physiology 31, 105–124. Esquerré-Tugayé, M.-T., Mazau, D., Barthe, J.-P., Lafitte, C., Touzé, A., 1992. Mechanisms of resistance to Colletotrichum species. In: Bailey, J.A., Jeger, M.J. (Eds.), Colletotrichum: biology pathology and control. C.A.B. International, Oxon, UK, pp. 121–133. Ferrándiz, C., 2002. Regulation of fruit dehiscence in Arabidopsis. Journal of Experimental Botany 53, 2031–2038. Govrin, E.M., Levine, A., 2000. The hypersensitive response facilitates plant infection by the necrotrophic pathogen Botrytis cinerea. Current Biology 10, 751–757. Grudkowska, M., Zagdańska, B., 2005. Multifunctional role of plant cysteine proteinases. Acta Biochimica Polonica 51, 609–624. Guevara, M.G., Almeida, C., Mendieta, J.R., Faro, C.J., Verissimo, P., Vieyras Pires, E., Daleo, G.R., 2005. Molecular cloning of a potato leaf cDNA encoding an aspartic protease (StAsp) and its expression after P. infestans infection. Plant Physiology and Biochemistry 43, 882–889. Hammond–Kosack, K.E., Jones, J.D.G., 2000. Responses to plant pathogens. In: Buchanan, W., Gruissem, W., Jones, R. (Eds.), Biochemistry and molecular biology of plants. American Society of Plant Physiology, pp. 1102–1156. Hu, X., Reddy, A.S.N., 1997. Cloning and expression of a PR5-like protein from Arabidopsis: inhibition of fungal growth by bacterially expressed protein. Plant Molecular Biology 34, 949–959. Kombrink, E., Somssich, I.E., 1997. Pathogenesis-related Proteins and Plant Defense. In: Esser, K., Lemke, P.A. (Eds.), The Mycota V: Plant Relationships Part A. Springer– Verlag, Berlin/Heidelberg/New York, pp. 107–128. Kotb, T., Li, K.G., Wei, C., Guang-Ming, H.E., Su, W., Yang, J.S., 2005. Overexpression of the OsPDCD5 gene induces programmed cell death in rice. Journal of Integrative Plant Biology 47, 1115–1122. Kumar, D., Klessig, D.F., 2003. High-affinity salicylic acid-binding protein 2 is required for plant innate immunity and has salicylic acid-stimulated lipase activity. Proceedings of the National Academy of Sciences 100, 16101–16106. Kuznetsova, E., Seddas–Dozolme, P.M.A., Arnould, C., Tollot, M., Van Tuinen, D., Borisov, A., Gianinazzi, S., 2010. Symbiosis-related pea genes modulate fungal and plant gene expression during the arbuscule stage of mycorrhiza with Glomus intraradices. Mycorrhiza 20, 427–443. Lagrimini, L.M., Burkhart, W., Moyer, M., Rothstein, S., 1987. Molecular cloning of complementary DNA encoding the lignin-forming peroxidase from tobacco: molecular analysis and tissue-specific expression. Proceedings of the National Academy of Sciences 84, 7542–7546. Linthorst, H., 1991. Pathogenesis-related proteins of plants. Critical Reviews in Plant Sciences 10, 23–150. Liu, P.-P., von Dahl, C.C., Park, S.-W., Klessig, D.F., 2011. Interconnections between methyl salicylate and lipid-based long-distance signalling during the development of systemic acquired resistance in Arabidopsis and tobacco. Plant Physiology 155, 1762–1768. Mahomed, W., Van den Berg, N., 2011. EST sequencing and gene expression profiling of defence-related genes from Persea americana infected with Phytophthora cinnamomi. BMC Plant Biology 11, 167. Marimani, M.D., 2011. Infection process and expression of anti-fungal compounds in avocado (Persea americana Mill.) fruit infected with Colletotrichum gloeosporioides (Penz.) Penz. & Sacc. and molecular identification of fungal pathogens of avocado. MSc dissertation, University of the Witwatersrand, Johannesburg. Monteiro, S., Barakat, M., Piçarra–Pereira, M.A., Teixeira, A.R., Ferreira, R.B., 2003. Osmotin and thaumatin from grape: a putative general defense mechanism against pathogenic fungi. Phytopathology 93, 1505–1512.

100

A.T. Djami-Tchatchou et al. / South African Journal of Botany 86 (2013) 92–100

Nimchuk, Z., Eulgem, T., Holt, I.B., Dangl, J.L., 2003. Recognition and response in the plant immune system. Annual Review of Genetics 37, 579–609. Pernezny, K., Belle, G., Marlatt, R.B., 2000. Diseases of Avocado in Florida. Plant Pathology Fact Sheet, p. 21. Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Research 29 (9), 2003–2007. Plymale, R.C., Felton, G.W., Hoover, K., 2007. Induction of systemic acquired resistance in cotton foliage does not adversely affect the performance of an entomopathogen. Journal of Chemical Ecology 33, 1570–1581. Porta, H., Rocha-Sosa, M., 2002. Plant lipoxygenases: physiological and molecular features. Plant Physiology 130, 15–21. Prusky, D., Plumbley, R.A., 1992. Quiescent infections of Colletotrichum in tropical and subtropical fruits. In: Bailey, J.A., Jeger, M.J. (Eds.), Colletotrichum: biology pathology and control. C.A.B. International, Oxon, pp. 289–307. Rounsley, S., Marri, P.R., Yu, Y., He, R., Sisneros, N., Goicoechea, J.L., 2009. De novo next generation sequencing of plant genomes. Rice 2, 35–43. Rustérucci, C., Montillet, J.L., Agnel, J.P., Battesti, C., Alonso, B., Knoll, A., Bessoule, J.J., Etienne, P., Suty, L., Blein, J.P., 1999. Involvement of lipoxygenase-dependent production of fatty acid hydroperoxides in the development of the hypersensitive cell death induced by cryptogein of tobacco leaves. Journal of Biological Chemistry 274, 36446–36455. Salas, C., Gomes, T.M.R., Hernandez, M., Lopes, M.T.P., 2008. Plant cysteine proteinases: evaluation of the pharmacological activity. Phytochemistry 69, 2263–2269. Stintzi, A., Heitz, T., Prasad, V., Wiedemann-Merdinoglu, S., Kauffmann, S., Geoffroy, P., Legrand, M., Fritig, B., 1993. Plants pathogenesis-related proteins and their role in defense against pathogens. Biochimie 75, 687–706. Sun, C., Li, Y., Wu, Q., Luo, H., Sun, Y., Song, J., Lui, E.M.K., Chen, S., 2010. De novo sequencing and analysis of the American ginseng root transcriptome using a GS FLX Titanium platform to discover putative genes involved in ginsenoside biosynthesis. BMC Genomics 11, 262. Tanaka, R., Hirashima, M., Satoh, S., Tanaka, A., 2003. The Arabidopsis-accelerated cell death Gene ACD1 is involved in oxygenation of pheophorbide a: inhibition of the pheophorbide a oxygenase activity does not lead to the “Stay-Green” phenotype in Arabidopsis. Plant & Cell Physiology 44, 1266–1274.

Tiryaki, I., Tunaz, H., 2004. Systemic acquired resistance: characterization of genes associated with plant defence response. Journal of Cell Molecular Biology 3, 9–14. Uknes, S., Mauch-Mani, B., Moyer, M., Potter, S., Williams, S., 1992. Acquired resistance in Arabidopsis. The Plant Cell 4, 645–656. Van Breusegem, F., Vranová, E., Dat, J.F., Inzé, D., 2001. The role of active oxygen species in plant signal transduction. Plant Science 161, 405–414. Van Loon, L.C., Van Strien, E.A., 1999. The families of pathogenesis-related proteins, their activities, and comparative analysis of PR-1 type proteins. Physiological and Molecular Plant Pathology 55, 85–97. Vögeli, U., Meins Jr., F., Boller, T., 1988. Co-ordinated regulation of chitinase and β-1,3glucanase in bean leaves. Planta 174, 364–372. Wang, K.L.C., Li, H., Ecker, J.R., 2002. Ethylene biosynthesis and signalling networks. The Plant Cell 14, 131–151. Ward, E.R., Uknes, S.J., Williams, S.C., Dincher, S.S., Wiederhold, D.L., 1991. Coordinated gene activity in response to agents that induce systemic acquired resistance. The Plant Cell 3, 1085–1094. Weber, A.P., Weber, K.L., Carr, K., Wilkerson, C., Ohlrogge, J.B., 2007. Sampling the Arabidopsis transcriptome with massively parallel pyrosequencing. Plant Physiology 144, 32–42. Wheeler, D.A., Srinivasan, M., Egholm, M., Shen, Y., Chen, L., McGuire, A., et al., 2008. The complete genome of an individual by massively parallel DNA sequencing. Nature 452 (7189), 872–876. Wroblewski, T., Piskurewicz, U., Tomczak, A., Ochoa, O., Michelmore, R.W., 2007. Silencing of the major family of NBS-LRR-encoding genes in lettuce results in the loss of multiple resistance specificities. The Plant Journal 51, 803–818. Xu, H., Heath, M.C., 1998. Role of calcium in signal transduction during the hypersensitive response caused by basidiospore derived infection of the cowpea rust fungus. The Plant Cell 10, 585–597. Zentmyer, G.A., 1984. Avocado Diseases. Tropical Pest Management 30, 388–400. Zhang, S., Klessig, D.F., 2001. MAPK cascades in plant defense signalling. Trends in Plant Science 6, 520–527.