Expression of sweet potato cysteine protease SPCP2 altered developmental characteristics and stress responses in transgenic Arabidopsis plants

ARTICLE IN PRESS Journal of Plant Physiology 167 (2010) 838–847

Contents lists available at ScienceDirect

Journal of Plant Physiology journal homepage: www.elsevier.de/jplph

Expression of sweet potato cysteine protease SPCP2 altered developmental characteristics and stress responses in transgenic Arabidopsis plants Hsien-Jung Chen a,nn, Cheng-Ting Su b,1, Chia-Hung Lin a,1, Guan-Jhong Huang c,1, Yaw-Huei Lin d,n a

Department of Biological Sciences, National Sun Yat-sen University, 804 Kaohsiung, Taiwan Graduate Institute of Biotechnology, Chinese Culture University, 111 Taipei, Taiwan c Graduate Institute of Chinese Pharmaceutical Sciences, China Medical University, 404 Taichung, Taiwan d Institute of Plant and Microbial Biology, Academia Sinica, Nankang, 115 Taipei, Taiwan b

a r t i c l e in f o

a b s t r a c t

Article history: Received 12 October 2009 Received in revised form 26 December 2009 Accepted 12 January 2010

In this report a full-length cDNA, SPCP2, which encoded a putative papain-like cysteine protease was isolated from senescent leaves of sweet potato (Ipomoea batatas). SPCP2 contained 1101 nucleotides (366 amino acids) in its open reading frame, and exhibited high amino acid sequence identities (ca. 68% to 83%) with plant cysteine proteases, including Actinidia deliciosa, Arabidopsis thaliana, Brassica oleracea, Phaseolus vulgaris, Pisum sativa, Vicia faba, Vicia sativa and Vigna mungo. RT-PCR analysis showed that SPCP2 gene expression was enhanced significantly in natural senescent leaves and in dark-, abscisic acid- (ABA-), jasmonic acid- (JA-) and ethephon-induced senescent leaves, but was almost not detected in mature green leaves, stems, and roots. Transgenic Arabidopsis with constitutive SPCP2 expression exhibited earlier floral transition from vegetative to reproductive growth, higher percentage of incompletely developed siliques per plant, reduced average fresh weight and lower germination percentage of seed, and higher salt and drought stress tolerance compared to those of control. Based on these results we conclude that sweet potato papain-like cysteine protease, SPCP2, is a functional senescence-associated gene, and its expression causes altered developmental characteristics and stress responses in transgenic Arabidopsis plants. & 2010 Elsevier GmbH. All rights reserved.

Keywords: Cysteine protease Drought Leaf senescence Sweet potato Transgenic Arabidopsis

Introduction Sweet potato (Ipomoea batatas) is an allohexaploid dicot and belongs to the order of Polemoniales and the family Convolvulaceae (Sihachakr et al., 1997). It contains plenty of vitamin B complex, vitamin C, b-carotenoids, multiple minerals and high potassium and calcium (Hattori et al., 1985). Several medicative effects of sweet potato trypsin inhibitor, which is the major storage root proteins, have been reported, including antioxidant activity (Hou et al., 2001, Huang et al., 2007a, 2007b), inhibition of angiotensin converting enzyme activity (Hou et al., 2003; Huang et al., 2006), and growth inhibition and induction of apoptosis in NB4 promyelocytic leukemia cells (Huang et al., 2007c).

Abbreviations: ABA, abscisic acid; JA, jasmonic acid; MES, 3 mM 2-(N-morpholino) ethanesulphonic acid; RT-PCR, reverse transcription-polymerase chain reaction n Corresponding author. Tel.: + 886 2 27871172; fax: + 886 2 27827954. nn Corresponding author: Tel.: + 886 7 5252000x3630; fax: 886 7 5253630. E-mail addresses: [email protected] (H.-J. Chen), [email protected] (Y.-H. Lin). 1 Equal contribution 0176-1617/$ - see front matter & 2010 Elsevier GmbH. All rights reserved. doi:10.1016/j.jplph.2010.01.005

Leaf is in general the location of photosynthesis and acts as a source of carbohydrate for sink nutrients to support growth in sink organs of plants. The longevity and senescence of leaf thus affect the efficiency of photosynthesis and yield of crops. Leaf senescence is influenced by endogenous and exogenous factors, including plant growth regulators (abscisic acid, cytokinin, ethylene, salicylic acid, etc.), sucrose starvation, dark, cold, heat, drought, salt, wound, pathogen infection (bacteria, fungi, virus), and insect attack (Yoshida, 2003; Lim et al., 2007). Leaf senescence is the final stage of leaf development and has been considered as a type of programmed cell death. It is not only a degenerative process, but also a recycling one in which nutrients are translocated from the senescent cells to young leaves, developing seeds, or storage tissues (Buchanan-Wollaston, 1997; Quirino et al., 2000). Leaf cells undergo highly coordinated changes in structure, metabolism, and gene expression during senescence in a defined order. The earliest and most significant change in cell structure is the breakdown of the chloroplast, which contains up to 70% of the leaf proteins and constitutes a large portion of cellular nitrogen (Makino and Osmond, 1991). Proteases can be classified into cysteine protease, serine protease, aspartic protease, and metalloprotease according to the amino acids in association with their catalytic sites or metal

ARTICLE IN PRESS H.-J. Chen et al. / Journal of Plant Physiology 167 (2010) 838–847

requirement during proteolysis. For cysteine proteases, a subgroup with similar amino acid sequences, including Actinidia deliciosa CP3, Arabidopsis thaliana RD19, Brassica oleracea BoCP4, Phaseolus vulgaris CP2, Solanum melongena SmCP, Vicia sativa CPR2, and Vigna mungo SH-EP has been cloned. Some has been demonstrated to play diverse physiological functions and roles in cope with developmental and environmental cues. In Arabidopsis thaliana, a dehydration-responsive cysteine protease RD19 was cloned and its expression was strongly induced under high-salt and osmotic stress conditions, which suggests a possible physiological role of cysteine protease RD19 in association with the osmotic potential of plant cells (Koizumi et al., 1993; Xiong et al., 2002). Broccoli florets showed water loss during post-harvest senescence. Papain-like cysteine proteases BoCP4, which exhibited high amino acid sequence identity to Arabidopsis RD19, was cloned, and its expression was also dehydration-responsive and repressed by water and sucrose (Coupe et al., 2003). In Solanum melongena (brinjal), a cysteine protease SmCP was cloned and expressed during leaf senescence, fruit senescence, xylogenesis, nucellar cell degeneration and anther senescence (Xu and Chye, 1999). In Vigna mungo, the vacuolar papain-like cysteine protease, designated SH-EP, is synthesized in cotyledons of germinated Vigna mungo seeds and is responsible for degradation of the seed globulin storage proteins accumulated in protein bodies. In Vicia faba (vetch), globulins such as legumin and vicillin are major seed storage proteins present in the protein bodies of cotyledom, radicle, axis, and shoots. Cysteine protease such as papain-like CPR2 and CPR4 are found in cotyledon and axis of dry and imbibed seeds. Gene expression studies concluded that storage globulin mobilization in germinating vetch seeds is started by the stored cysteine proteases (CPRs), however, the bulk globulin mobilization is mediated by de novo synthesized CPRs (Schlereth et al., 2000, 2001; Tiedemann et al., 2001). In this report, a full-length cDNA, SPCP2, was isolated from senescent leaves of sweet potato, and exhibited high amino acid sequence identities with those plant cysteine proteases mentioned above, including Arabidopsis thaliana RD19, Brassica oleracea BoCP4, Vicia sativa CPR2 and Vigna mungo SH-EP. Molecular characterization and transgenic expression of sweet potato SPCP2 were performed in order to explore its possible physiological role and function.

Materials and methods Plant materials and sweet potato SPCP2 The storage roots of sweet potato (Ipomoea batatas (L.) Lam.) were grown in the greenhouse at 28 1C/16 h day and 23 1C/8 h night cycle. Plantlets sprouted from the storage roots provided detached mature green leaves for gene cloning and leaf treatment experiments at 28 1C/16 h and 23 1C/8 h cycle in the dark. For dark-induced senescence, detached mature green leaves were placed on wet paper towels containing 3 mM 2-(N-morpholino) ethanesulphonic acid (MES) buffer pH 7.0 in a tray, then kept in the dark for 0, 3, 6, 9 and 12 days, respectively. For 1 mM ethephon, 100 mM ABA, or 2 mM JA treatment, the detached mature green leaves were also placed on wet paper towels containing 3 mM MES (pH 7.0) plus different plant growth regulator in a tray, then kept in the dark for 0, 1, 2 and 3 days, respectively. Leaves were collected individually for quantitative pigment analysis and also for RT-PCR as described below. Arabidopsis thaliana ecotype Columbia was grown under 22 1C/16 h day and 18 1C/8 h night cycle until flowering, and the inflorescences were used as the plant material for

839

Agrobacterium-mediated floret dip transformation. The full-length cDNA of sweet potato SPCP2 (GenBank accession no. AF242373), which encoded a putative papain-like cysteine protease, was isolated and constructed in the T-DNA portion of pBI121 vector (Clontech) under the control of CaMV 35S promoter, then used for Agrobacterium-mediated floral dip transformation of Arabidopsis (Clough and Bent, 1998). The nontransformant wild type was used as the control. PCR-based subtractive hybridization and RACE PCR Total RNAs were separately isolated from sweet potato mature green leaves and senescing leaves basically according to the method of Sambrook et al. (1989). The mRNAs were purified with the PolyTract mRNA isolation System IV (Promega Cat. No. Z5310) and used for the differentially expressed first strand cDNA synthesis with a PCR-selective cDNA kit (Clontech Cat. No. 637401) following the protocols supplied by the manufacturer. The double-strand cDNAs of senescing leaves after subtraction were cloned, sequenced, and analyzed according to the report of Chen et al. (2000). In order to clone the 50 and 30 missing ends, DNA sequence obtained was used for RACE PCR with a Smart RACE cDNA Amplification kit (Clontech Cat. No. 634923) following the protocols supplied by the manufacturer. RT-PCR of full-length SPCP2 cDNA Total RNA was isolated from (a) different tissues including roots, stems, mature green leaves and senescing leaves, and (b) dark-treated, 100 mM ABA-treated, 1 mM ethephon-treated or 2 mM JA-treated mature green leaves of sweet potato using the method described above. The primer pair (50 : ATGGCTTTCCGTTTCTCTCTCCTC and 30 : ATGAATACACTTGCATAGTGTGTTG) was used to amplify the full-length SPCP2 cDNAs from different samples according to the report of Chen et al. (2003). The RTPCR condition was 94 1C 3 min for 1 cycle; 94 1C 1 min, 55 1C 45 s, 72 1C 90 s for 30 cycle; then, 72 1C 7 min for 1 cycle. Measurement of pigments For quantitative analysis of pigment contents, leaf samples from (a) mature green leaves (S0) and senescing leaves (S1 and S2), and (b) leaves treated with ethephon, ABA, JA and dark, respectively, were collected separately and extracted with 80% acetone (pH 7.8) buffered with 2.5 mM sodium phosphate according to the method of Chen et al. (2000). The absorbance of extracts was measured at wavelengths of 663.8, 646.8 and 470 nm, respectively. Quantitative values of pigments for aqueous 80% acetone extracts were calculated from the absorbance data according to the report of Lichtenthaler (1987). Agrobacterium-mediated floral dip transformation of Arabidopsis The full-length SPCP2 cDNA in recombinant pGEM-T easy vector was amplified with the following 50 and 30 primers containing an introduced SmaI (CCCGGG) restriction enzyme cutting site. The primer pair for SPCP2 (50 primer: TGCGCCCGG GATGGCTTTCCG TTTCTCTCT and 30 primer: ATCGCCCGGGCTAGTCTGAAG TGGTGG TGT) was used to amplify the full-length SPCP2 cDNA. Construction of recombinant pBI121 and its transformation into Agrobacterium tumefaciens LBA4404 competent cells (Clontech) with electroporation were basically according to the protocol supplied by the manufacturer (BIO-RAD). Transformed Agrobacterium tumefaciens cells were utilized for Arabidopsis transformation with floral dip method (Clough and Bent, 1998). After transformation,

ARTICLE IN PRESS 840

H.-J. Chen et al. / Journal of Plant Physiology 167 (2010) 838–847

the Arabidopsis plant was allowed to grow until seed set. These seeds were assigned as T0 seeds and collected for screening of transgenic T0 Arabidopsis seedlings.

Identification and characterization of transgenic Arabidopsis plants Transgenic T0 seedlings were identified and isolated after seed germination on half-strength MS salt medium containing 1% sucrose, 500 mg/mL cefotaxine, and 50 mg/mL kanamycin under regime of 22 1C day/18 1C night, 16 h light/8 h dark. The leaves of seedlings with kanamycin-sensitive phenotype turned white on kanamycin-containing medium. However, leaves of seedlings with kanamycin-resistant phenotype stayed green and were identified as putative transgenic T0 plants. These plants were then transferred to soil and grown in the growth chamber until flowering and T1 seed set. T1 seeds were collected and germinated on half-strength MS salt medium with the same conditions as T0 seedlings. The T1 seedlings with kanamycinresistant and kanamycin-sensitive phenotypes were identified and recorded as putative transgenic and nontransgenic progenies, respectively, and used for w2 analysis and molecular and morphological characterization as described below. Putative transgenic T1 Arabidopsis seedlings grown on kanamycin-containing medium for 2 to 3 weeks after germination were transferred to soil and grown in a growth chamber under the same conditions. Leaf tissues were collected from seedlings

ca. 4 weeks after germination for genomic PCR analysis and RTPCR amplification. About 0.5 g samples of putative transgenic T1 Arabidopsis and control plants were collected individually for genomic DNA isolation with CTAB method (Chen et al., 2008). About 5 mg of purified genomic DNAs were used for PCR amplification with the following primer pair (50 primer: ATGGCTTTCCG TTTCTCT CTCCTC and 30 primer: CTAGTCTGAAGTGGTGGTGCTA ACA) in order to confirm the existence of full-length SPCP2 cDNA in putative transgenic Arabidopsis plants. The genomic PCR condition was 94 1C 3 min for 1 cycle; 94 1C 1 min, 55 1C 45 s, 72 1C 90 s for 36 cycle; 72 1C 7 min for 1 cycle. Transgenic T1 seedlings containing SPCP2 cDNAs were further analyzed. About 0.3 g leaf tissues of transgenic T1 Arabidopsis and control plants were collected individually for total RNA isolation according to supplier’s protocol (Promega), and ca. 5 mg total RNA of each sample was used for RT-PCR to detect the presence or absence of full-length SPCP2 cDNA in transgenic Arabidopsis plants as described above.

Analysis of developmental characteristics Several developmental characteristics were observed and qualitatively and quantitatively compared between transgenic and control plants. Seeds of transgenic T1 and control plants were germinated and grown directly in soil under the same environmental conditions described above in a growth chamber.

Fig. 1. The deoxynucleotide sequence and the deduced amino acid sequence of the full-length cDNA of sweet potato papain-like cysteine protease SPCP2 isolated from sweet potato senescent leaves. ATG (underlined) and TAG (underlined) represent the start codon and the stop codon, respectively. The Gln (Q), Cys (C), His (H) and Asn (N) printed in white on black represent the conserved catalytic amino acid residues. The arrow (m) represents the possible cleavage site of N-terminus of the SPCP2-encoded protein precursor.

ARTICLE IN PRESS H.-J. Chen et al. / Journal of Plant Physiology 167 (2010) 838–847

841

The transition time from vegetative to reproductive growth was compared and recorded according to the number of rosette leaves when the inflorescence was formed. Also the time of the first flower opening on the inflorescence were recorded and compared. After flowering, the silique and seed development were also examined. Arabidopsis siliques were arbitrarily classified into four types (1 to 4) according to their morphologies and seed number per silique after maturation. The morphology of different silique type, the seed number per silique of different type, and the percentage of incompletely developed silique per plant were all compared and recorded among transgenic lines and the control. For average fresh weight per seed and germination percentage of T1 and T2 seeds, about 0.1 mg of seeds were germinated with a sowing seed density of ca. 1.57  10  5 g/cm2 on half-strength MS medium plus 1% sucrose. Total seed and seedling numbers two to four weeks after germination were recorded individually and used for calculation of germination percentage and average fresh weight per seed of transgenic lines and controls.

Salt and drought stress analysis For salt stress analysis, seeds of transgenic T1 (AT-11, AT-18, AT-19 and AT-21) and control plants were germinated on halfstrength MS medium plus 3% sucrose and different NaCl concentrations of 0, 30, 60, 90, 120, 150, 180, and 210 mM, respectively, for ca. 2 weeks. Relative germination percentages were recoded and compared among control and transgenic lines. For drought stress analysis, seeds of transgenic T1 (AT-11, AT-18, AT-19 and AT-21) and control plants were grown in soil under the same environmental conditions as described above in a growth chamber. There were ca. 5 plants per treatment used for experiments. About 30 days after germination, plants of different transgenic lines and control with similar sizes were used for drought tolerance analysis within a period of 14 days. After treatment, plants were rewatered for recovery. Therefore, the Fv/Fm values were measured, recorded and compared among control and transgenic lines during salt and drought treatments with WALZ JUNIOR-PAM Chlorophyll Fluorometer.

Results Deoxynucleotide sequence and deduced amino acid sequence of SPCP2 cDNA With PCR-based subtractive hybridization and RACE PCR techniques, a full-length cDNA, Y166 (GenBank accession no. AF242373) was cloned from senescent leaves and renamed as SPCP2. There were 1101 nucleotides (366 amino acids) in its open reading frame (Fig. 1). GCG/fasta comparison showed that SPCP2 exhibited high amino acid sequence identities with plant vacuolar cysteine proteases, including Arabidopsis thaliana RD19 (AY080598; 73.1%), Brassica oleracea BoCP4 (AF454959; 74%), Phaseolus vulgaris CP2 (CAB17075; 75%), Solanum melongena SmCP (AF082181; 73%), Vicia sativa CPR2 (CAA82995; 73%), and Vigna mungo SH-EP (AB038598; 75%). Sequence alignment comparison of SPCP2 with other plant cysteine proteases revealed that the first 132 amino acids of the N-terminus of putative SPCP2 protein precursor were cleaved off. Thus, the predicted mature SPCP2 protein likely contained 234 amino acid residues starting from the 133rd to the 366th amino acid residues, within which the conserved catalytic residues was observed and printed in white on black (Fig. 1). These data suggest that SPCP2 encodes a putative vacuolar papain-like cysteine protease.

Fig. 2. Gene expression of sweet potato SPCP2 was analyzed in natural and induced senescence with semi-quantitative RT-PCR. The amplified full-lengths of SPCP2 RTPCR products were detected with ethidium bromide staining. (A) Temporal and spatial gene expression of SPCP2. (B) Effects of dark on SPCP2 gene expression in detached mature green leaves within a 12-day period. (C) Effect of 100 mM abscisic acid treatment on SPCP2 gene expression in detached mature green leaf. (D) Effect of ethephon, an ethylene-releasing compound, on SPCP2 gene expression in detached mature green leaves within a 3-day period. (E) Effects of jasmonic acid on SPCP2 gene expression in detached mature green leaves within a 2-day period. S0, S1, and S2 represented mature green leaves (S0; chlorophyll content was assigned as 100%) and leaves with different senescent stages (S1 and S2; 33%, and 8% chlorophyll content, respectively). D, E, ABA, and JA denote dark, 1 mM ethephon, 100 mM abscisic acid, and 2 mM jasmonic acid, respectively. G14, which encoded a metallothionein-like protein and exhibited a constitutive expression pattern, was used as a control. The experiments were performed three times and a representative one was shown.

ARTICLE IN PRESS 842

H.-J. Chen et al. / Journal of Plant Physiology 167 (2010) 838–847

SPCP2 gene expression is enhanced in natural and induced senescent leaves The temporal and spatial expression of SPCP2 was significantly enhanced in sweet potato. The stages of leaf senescence were divided into S0, S1 and S2 according to cellular chlorophylls a+ b content. S0 is the mature green leaf and its chlorophylls a+ b content is assigned as 100% (641 mg/g leaf fresh weight). S1 and S2 have 33% (243 mg/g leaf fresh weight) and 8% (51 mg/g leaf fresh weight) chlorophylls a+ b contents, respectively. The amplified PCR products were remarkably increased from S0 to S1 and S2 stages. The amount in mature green leaves (S0 stage), root, and stem was much less than that of senescent leaves (S1 and S2 stages). A metallothionein-like protein gene G14, which was isolated previously from sweet potato leaves and exhibited constitutive expression pattern in all tissues assayed (Chen et al., 2003), was used as a control. No significant variation of G14 gene expression level was found among tissues and stages analyzed (Fig. 2A). These data suggest that SPCP2 is likely a senescence-associated gene and exhibits an enhanced expression pattern during natural leaf senescence. SPCP2 gene expression was also enhanced in induced detached leaves. For dark treatment, amount of chlorophylls a+b decreased gradually and was about 36% that of day 0 (362 mg/g leaf fresh weight) at day 12 (130 mg/g leaf fresh weight). Gene expression of SPCP2 detected by ethidium bromide staining was not significantly increased from day 0 to day 6; however, it was remarkably enhanced from day 9 till day 12 after dark treatment (Fig. 2B). For 100 mM ABA treatment, loss of chlorophylls a+b from treated mature green leaves were much faster than that of the untreated dark control and the amount at day 3 was about 22% (111 mg/g leaf fresh weight) that of day 0 (503 mg/g leaf fresh weight). SPCP2 gene expression also increased from day 1 to day 3 in ABA-treated samples compared to that of untreated dark controls and was correlated with induced leaf senescence (Fig. 2C). For 1 mM ethephon treatment, loss of chlorophylls a+b from treated mature green leaves were also much faster than that of the untreated dark control and the amount at day 3 (135 mg/g leaf fresh weight) was about one-third that of day 0 (410 mg/g leaf fresh weight). SPCP2 gene expression significantly increased from day 2 to day 3 in ethephon-treated samples compared to untreated dark control (Fig. 2D). For 2 mM JA treatment, loss of chlorophylls a+b from

treated mature green leaves were slightly faster than that of the untreated dark control and the amount at day 2 was about 52% (320 mg/g leaf fresh weight) that of day 0 (616 mg/g leaf fresh weight). SPCP2 gene expression also increased from day 0 to day 2 in JA-treated samples compared to untreated dark control (Fig. 2E). For G14, no significant variation of RT-PCR products was found during the time intervals of dark, ABA, ethephon, and JA treatments, respectively (Fig. 2). These data clearly demonstrate that SPCP2 is a senescence-associated gene and its expression correlate well with natural and induced leaf senescence.

Transgenic T1 Arabidopsis plants expressing sweet potato SPCP2 exhibited earlier flowering There were ca. 27 out of 18700 seeds screened and identified as transgenic and named as AT-1 to AT-27. These transgenic T0 seedlings with kanamycin-resistant phenotype were grown until flowering and T1 seed set. w2 test of T1 seeds showed that most transgenic lines contained one copy of insert gene except lines 2, 4, 5 and 11, which likely have two or more copies of insert genes in their genomes (data not shown). Genomic PCR analysis showed that a band corresponding to sweet potato SPCP2 insert cDNA with molecular mass ca. 1.1 kb was found in all transgenic T1 seedlings, but not in the control (Fig. 3A). For RT-PCR analysis, a band corresponding to SPCP2 PCR product was also detected from samples of transgenic T1 Arabidopsis seedlings, but not from the sample of control (Fig. 3B). These data, thus, demonstrate the existence and expression of sweet potato SPCP2 in transgenic Arabidopsis plants. The relative earlier flowering time and numbers of rosette leaves were recorded and compared among control and transgenic T1 Arabidopsis plants when the first flower opening on the inflorescence was observed. Qualitative analysis showed that transgenic T1 Arabidopsis plants (AT-1, AT-7 and AT-10) exhibited earlier floral transition from vegetative growth to reproductive phase than the control observed from ca. 30 to 35 days after seed germination in soil (Fig. 4). Fig. 4A was the picture taken at day 30 after seed germination in soil when the first flower opening on the inflorescence of transgenic plants, but not the control, was observed. Fig. 4B was the picture taken at day 35 after seed germination in soil, and the siliques on the inflorescences of

Fig. 3. Genomic PCR analysis and RT-PCR amplification of sweet potato SPCP2 gene from putative transgenic T1 Arabidopsis plants. (A) Genomic PCR analysis. Total genomic DNA isolated from control and transgenic T1 Arabidopsis plants were analyzed for the presence of sweet potato SPCP2 gene. C and AT denote wild type control and 17 transgenic Arabidopsis plants, respectively. M and bp represent the molecular weight marker and base pair, respectively. (B) RT-PCR amplification. Sweet potato SPCP2 gene was amplified from total RNA isolated from wild type control and 14 transgenic T1 Arabidopsis plants. C and AT denote wild type control and transgenic Arabidopsis plants, respectively.

ARTICLE IN PRESS H.-J. Chen et al. / Journal of Plant Physiology 167 (2010) 838–847

843

contained slightly fewer rosette leaves than control plants (Fig. 4D). These data clearly demonstrate that expression of sweet potato SPCP2 in transgenic Arabidopsis plants may cause slightly earlier transition from vegetative to reproductive growth.

Relative earlier flowering time (days)

Transgenic T1 Arabidopsis plants contained higher incompletely developed siliques

12 10 8 6 4 2 0 Control AT-2

AT-7 AT-9 AT-10 AT-11 AT-12 AT-13 AT-18 AT-19 AT-21

Control and T1 transgenic plants

Number of rosette leaves

12 10

The silique morphology and seed number per silique were analyzed. Type 1 silique exhibited fully developed morphology with ca. 52 seeds per silique. Type 2 silique displayed a little bit shorter and thinner morphology with ca. 30 seeds per silique. Type 3 silique had incompletely developed morphology with drastically reduced size to about one half of type 1 silique and contained ca. 20 seeds per silique. Type 4 silique, similar to type 3 silique, showed highly incompletely developed morphology with more reduced size to about one third of type 1 silique with ca. 5 seeds per silique (Figs. 5A and B). Types 2, 3 and 4 were grouped together as the incompletely developed siliques, and its percentage was compared among transgenic T1 Arabidopsis plants and the control. Transgenic T1 Arabidopsis plants contained much higher incompletely developed silique percentages (ca. 33.06% to 44.45%) than that of control (ca. 7.51%) (Fig. 5C). In addition, the average fresh weight per seed was significantly reduced among T1 transgenic lines from 53% to 100% that of the control (average 23.8 mg per seed). Similar results were also found among T2 transgenic lines from 47% to 83% that of the control (average 27.5 mg per seed) (Fig. 6A). For germination percentage, it was also drastically decreased among T1 transgenic lines from 13% to 93% that of the control. Similar results were also found among T2 transgenic lines from 12% to 91% that of the control (Fig. 6B). The variation of reduced average fresh weight per seed and lower germination percentage are partly due to the differences of copy number of insert gene per genome and/or position effect of insert gene among transgenic lines. These data suggest that SPCP2 expression may influence seed and silique development, which in turn result in higher incompletely developed silique percentage per plant, reduced average fresh weight per seed, and lower seed germination percentage in transgenic Arabidopsis plants.

8 Transgenic T1 Arabidopsis plants exhibited higher salt and drought stress tolerance

6 4 2 0 Control AT-2

AT-7

AT-9 AT-10 AT-11 AT-12 AT-13 AT-18 AT-19 AT-21

Control and T1 transgenic plants Fig. 4. Comparison of relative earlier flowering time and numbers of rosette leaves during the first flower opening on the inflorescence between control and transgenic T1 Arabidopsis plants. (A) Transition from vegetative growth to flowering was observed and compared 30 days after seed germination. (B) The appearance and size of inflorescences and siliques were observed and compared 35 days after seed germination. (C) Relative earlier flowering time. Transition time from vegetative growth to flowering was observed and compared when the first flower on the inflorescence opened. (D) Number of rosette leaves. The numbers of rosette leaves were observed, recorded, and compared when the first flower on the inflorescence opened. Control and AT denote wild type and transgenic T1 Arabidopsis plants, respectively.

transgenic plants appeared, however, the control plants just began to flower. Quantitative data also showed that transgenic plants exhibited an relative earlier flowering time (Fig. 4C) and

Four transgenic lines were used to monitor the salt and drought stress tolerance. For salt stress analysis, control and transgenic lines showed similar relative germination percentage curves. However, seeds of transgenic lines exhibited higher relative germination percentages (ca. 11% to 65% higher) compared to control within NaCl concentrations from 0 to 180 mM analyzed. The difference of relative germination percentages among transgenic lines and control were significantly reduced to less than 15% at 210 mM NaCl concentration (Fig. 7A). For drought stress analysis, the Fv/Fm values of leaves among control and transgenic lines were not significantly varied within the first 10 days of drought treatment. However, they were drastically reduced for leaves of control plants compared to leaves of transgenic lines at day 14 (upper panel of Fig. 7B). The control plants also exhibited more severe wilt symptom, however, transgenic lines were much less affected at day 14 (lower panel of Fig. 7B). After rewatering, plants recovered gradually. The Fv/Fm of transgenic lines 11, 18 and 21 was comparable to the level of day 0 after rewatering for 10 days. However, Fv/Fm of transgenic line 19 and control was about 80% and 60% that of day 0, respectively, after rewatering for 10 days (upper panel

ARTICLE IN PRESS 844

H.-J. Chen et al. / Journal of Plant Physiology 167 (2010) 838–847

Number of seeds per silique

70 60 50 40 30 20 10 0 type1

type 2

type 3

type 4

Different types of siliques

50 developed silique (%)

Percentage of incompletely-

60

40

30

20

10

0 Control AT-1 AT-2 AT-4 AT-5 AT-7 AT-8 AT-9 AT-10 AT-11 AT-12 AT-13 AT-18 AT-19 AT-21

Control and T1 transgenic plants Fig. 5. The average seed number per silique of different types and the comparison of incompletely developed silique percentages among control and transgenic T1 plants. (A) Classification of siliques according to their morphology and seed number. There are four types of siliques (types 1, 2, 3 and 4) classified. (B) Average seed number per silique. C. Incompletely developed silique percentage. Control and AT denote wild type and transgenic T1 Arabidopsis plants, respectively. The data are from the average of 5 plants per transgenic line and shown as mean 7 S.E.

of Fig. 7B). These data clearly demonstrate that transgenic Arabidopsis expressing sweet potato cysteine protease SPCP2 display higher salt and drought stress tolerance than control.

Discussion Sweet potato SPCP2 encoded a putative papain-like cysteine protease (Fig. 1) and exhibited high amino acid sequence identities with vacuolar cysteine proteases including SH-EP and RD19. These data provide indirect evidence to support the intracellular localization of SPCP2 in vacuole. For SH-EP, a C-termal KDEL was proved to be associated with its vacuoletargeting (Okamoto et al., 2003). However, no significant

C-terminal KDEL sequence was found for SPCP2. For RD-19, a vacuolar localization was also suggested. However, it can be re-localized to nucleus in the presence of PopP2, an avirulent gene product of R. solanacearum (Bernoux et al., 2008; Poueymiro and Genin, 2009). Therefore, it is possible different vacuolar targeting mechanisms and signal peptides are involved and associated with different related cysteine protease genes. SPCP2 gene expression was enhanced in natural senescent leaves and can be induced by dark, ethephon, ABA and JA (Fig. 2). Buchanan-Wollaston et al. (2005) analyzed gene expression patterns and signal transduction pathways of senescence in Arabidopsis induced by different factors, including dark, starvation, ABA, ethylene, jasmonic acid, and salicylic acid. Transcriptome analysis revealed that pathways such as dark, ethylene, and

ARTICLE IN PRESS H.-J. Chen et al. / Journal of Plant Physiology 167 (2010) 838–847

25

T1 progeny T2 progeny

20 15 10 5 0 Control AT-1 AT-2 AT-4 AT-7 AT-9 AT-10 AT-11 AT-12 AT-13 AT-18 AT-19 AT-21

NaCl 120 Relative germination percentage (%)

Average fresh weight per seed (µg)

30

845

Control and transgenic Arabidopsis plants

100 80 60 Control AT-11 AT-18 AT-19 AT-21

40 20 0

0

30

60

110 90

T1 progeny T2 progeny

Drought 1.0

80 70

Dehydration

0.8

60

Rehydration

50 40

Fv/Fm

Germination percentage (%)

100

90 120 150 180 210 NaCl (mM)

30 20

0.6 Control AT-11 AT-18 AT-19 AT-21

0.4

10 0 Control AT-1 AT-2 AT-4 AT-7 AT-9 AT-10 AT-11 AT-12 AT-13 AT-18 AT-19 AT-21

0.2

Control and transgenic Arabidopsis plants Fig. 6. The relative average fresh weight and germination percentage of T1 and T2 progeny seeds of transgenic Arabidopsis plants. (A) Relative average fresh weight per seed. (B) Relative germination percentage. The data were the sum of total seedlings from 5 germination dishes per transgenic line of T1 and T2 progeny seeds. Control and AT denote wild type and transgenic Arabidopsis plants, respectively. Black and grey bars represent T1 and T2 progenies, respectively.

JA are all required for expression of many genes during developmental senescence. Genes associated with essential metabolic processes such as degradation of proteins and peptides and nitrogen mobilization can utilize alternative pathways for induction (Buchanan-Wollaston et al., 2005). Therefore, a possible explanation which is likely associated with multiple signal transduction pathways is suggested for the induction of sweet potato SPCP2 gene expression by different factors, including development, dark, ABA, ethephon and JA. Chlorophyll contents were used as a marker to indicate the effects of treatments such as dark, ethephon, ABA, and JA on senescence induction (Fig. 2). During senescence, cysteine protease SPCP2 expression was also induced and enhanced. However, the time of degradation and decrease of chlorophyll content was not correlated well with the induction and expression of SPCP2. The degradation and decrease of chlorophyll content was observed at the time earlier than the induction and expression of SPCP2 (Fig. 2). The possible function of SPCP2 is unclear and may not be in association with the initiation of chlorophyll degradation. Therefore, leaf senescence of transgenic Arabidopsis expressing SPCP2 was not significantly different from control plants. In tobacco, senescence-associated vacuoles contained soluble chloroplast stromal proteins, including Rubisco and glutamine synthase, but lacked the thylakoid proteins, such as D1 protein, LHCII of the PSII reaction center and PSII antenna.

0.0

0

2

4

6

8 10 12 14 16 18 20 22 24 Days after treatment

Drought stress at day 14 Fig. 7. Comparison of salt and drought stress tolerance among control and transgenic T1 Arabidopsis plants. (A) Salt. For salt treatment, seeds were germinated on half-strength MS medium plus 3% sucrose and different concentrations of NaCl for ca. 2 weeks, and the relative germination percentages were recorded and compared. (B) Drought. For drought treatment, upper panel of B is the Fv/Fm comparison among control and transgenic T1 Arabidopsis plants during dehydration and rehydration treatment. Lower panel of B is the morphological comparison among control and transgenic T1 Arabidopsis plant at day 14 after dehydration treatment. The data were the average of total 5 petri dishes for A or 5 seedlings per transgenic line for B, and shown as mean 7S.E. Control and AT-11/AT-18/AT-19/AT-21 denote wild type and transgenic T1 Arabidopsis plants, respectively. m indicates the time points of dehydration and rehydration.

ARTICLE IN PRESS 846

H.-J. Chen et al. / Journal of Plant Physiology 167 (2010) 838–847

The Rubisco levels decreased steadily in senescence-associated vacuoles incubated at 30 1C, and the decrease was completely abolished by addition of protease inhibitors (Martinez et al., 2008). These results support that plant vacuolar proteases may not be directly in association with the initiation of chlorophyll degradation and thylakoid protein breakdown during leaf senescence. Transgenic Arabidopsis plants expressing SPCP2 exhibited slightly earlier transition from vegetative to reproductive growth (Fig. 4). The reasons and mechanisms are not clear. However, Raper et al. (1988) and Rideout et al. (1992) hypothesized that floral transition is stimulated by an imbalance in the relative availability of carbohydrate and nitrogen in the shoot apical meristem. Barth et al. (2006) suggest that the flowering phenotype is likely linked to the endogenous ascorbic acid content. Degradation and removal of flowering repressor(s) by ectopic SPCP2 expression in transgenic Arabidopsis plants provides another possibility. Expression of sweet potato SPCP2 in transgenic Arabidopsis plants (Fig. 3B) also caused elevated number of incompletely developed silique (Fig. 5), and reduced average fresh weight per seed and lower germination percentage (Fig. 6). The reasons for the altered phenotypic characteristics in transgenic Arabidopsis by ectopic SPCP2 gene expression are not clear. However, SPCP2 exhibited high amino acid sequence identities with plant papainlike cysteine proteases, such as Phaseolus vulgaris CP2, Vicia sativa CPR2, and Vigna mungo SH-EP. These papain-like cysteine proteases together with vacuolar processing enzymes have been implicated in association with the degradation and mobilization of globulin storage proteins during seed germination and seedling growth in Phaseolus vulgaris (Senyuk et al., 1998), Vigna mungo (Okamoto et al., 1999), and Vicia sativa (Schlereth et al., 2000, 2001). In Vigna mungo, vacuolar processing enzyme VmPE-1 has been demonstrated to increase in the cotyledons of germinating seeds and was involved in the post-translational processing of a vacuolar cysteine endopeptidase, designated SH-EP (Okamoto and Minamikawa, 1995; Okamoto and Minamikawa, 1999). The activated SH-EP plays a major role in the degradation of seed storage proteins accumulated in cotyledon vacuoles of Vigna mungo seedlings (Mitsuhashi et al., 1986). During vetch seed germination and seedling growth, the legumain-like proteins, VsPB2 and proteinase B, together with additional papain-like cysteine proteinases such as CPR1, CPR2, and CPR4 are responsible for the bulk degradation and mobilization of seed globulin storage proteins (Schlereth et al., 2000). In our laboratory, sweet potato asparaginyl endopeptidase SPAE, which exhibited high amino acid sequence identity to VmPE-1 and proteinase B, has been cloned and expressed in transgenic Arabidopsis plants. Its expression also caused altered phenotypic characteristics, including earlier flowering, higher incompletely developed silique percentage, and less silique number per plant (Chen et al., 2004, 2008). These reports partly provide a possible explanation for the altered phenotypic characteristics observed in transgenic Arabidopsis plants, and suggest sweet potato SPCP2 with a enzymatic function similar to Vigna mungo SH-EP and Vicia sativa CPR2. In addition, degradation of silique storage proteins by ectopic SPCP2 expression leading to incomplete silique development was another possibility. Expression of sweet potato SPCP2 in transgenic Arabidopsis plants (Fig. 3B) exhibited higher salt and drought tolerance (Fig. 7). The reasons for the altered stress responses in transgenic Arabidopsis by ectopic SPCP2 gene expression are not clear. However, SPCP2 exhibited high amino acid sequence identities with plant cysteine proteases, such as Arabidopsis RD19 and broccoli Bocp4. Arabidopsis RD19 was a drought-inducible cysteine protease (Koizumi et al., 1993), and belonged to osmotic

stress-responsive genes (Xiong et al., 2002). Under osmotic stress such as high salinity (NaCl or PEG) and ABA treatments, RD19 mRNA transcript was significantly enhanced compared to untreated control (Xiong et al., 2002). Broccoli Bocp4 exhibited high sequence identity to dehydration-responsive Arabidopsis RD19, and was also significantly induced in broccoli florets, which were kept in air (dry situation) but not in water or 2% sucrose solution 12 h post-harvest (Coupe et al., 2003). Sweet potato cysteine protease SPCP2 was also inducible by ABA (Fig. 2C), and its ectopic expression in transgenic Arabidopsis caused higher salt and drought resistances (Fig. 7). Our results agree with these reports and suggest a possible role of sweet potato cysteine protease SPCP2 in osmotic stress response and salt/drought tolerance. Based on these results we conclude that sweet potato SPCP2 is a functional senescence-associated gene, and its expression causes altered developmental characteristics and stress responses in transgenic Arabidopsis plants. Whether sweet potato papain-like cysteine protease SPCP2 do play roles in association with bulk protein degradation and mobilization, and regulation of osmotic stress response and salt/drought tolerance during leaf senescence deserve further investigation.

Acknowledgements We would like to thank the financial support (NSC95-2313B-110-006-MY2) from the National Science Council, Taiwan.

Appendix A. Supplementary material Supplementary data associated with this article can be found in the online version at 10.1016/j.jplph.2010.01.005.

References Barth C, De Tullio M, Conklin PL. The role of ascorbic acid in the control of flowering time and the onset of senescence. J Exp Bot 2006;57:1657–65. Bernoux M, Timmers T, Jauneau A, Brie C, de Wit PJGM, Marco Y, et al. RD19, an Arabidopsis cysteine protease required for RRS1-R–mediated resistance, is relocalized to the nucleus by the Ralstonia solanacearum PopP2 effector. Plant Cell 2008;20:2252–64. Buchanan-Wollaston V. The molecular biology of leaf senescence. J Exp Bot 1997;48:181–99. Buchanan-Wollaston V, Page T, Harrison E, Breeze E, Lim PO. Comparative transcriptome analysis reveals significant differences in gene expression and signaling pathways between developmental and dark/starvation-induced senescence in Arabidopsis. Plant J 2005;42:567–85. Chen HJ, Hou WC, Jane WN, Lin YH. Isolation and characterization of an isocitrate lyase gene from senescent leaves of sweet potato (Ipomoea batatas cv. Tainong 57). J Plant Physiol 2000;157:669–76. Chen HJ, Hou WC, Yang CY, Huang DJ, Liu JS, Lin YH. Molecular cloning of two metallothionein-like protein genes with differential expression patterns from sweet potato (Ipomoea batatas (L.) Lam.) leaves. J Plant Physiol 2003;160: 547–55. Chen HJ, Hou WC, Liu JS, Yang CY, Huang DJ, Lin YH. Molecular cloning and characterization of a cDNA encoding asparaginyl endopeptidase from sweet potato (Ipomoea batatas (L.) Lam) senescent leaves. J Exp Bot 2004;55: 825–35. Chen HJ, Wen IC, Huang GJ, Hou WC, Lin YH. Expression of sweet potato asparaginyl endopeptidase caused altered phenotypic characteristics in transgenic Arabidopsis. Bot Stud 2008;49:109–17. Clough SJ, Bent AF. Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 1998;16:735–43. Coupe SA, Sinclair BK, Watson LM, Heyes JA, Eason JR. Identification of dehydration-responsive cysteine proteases during post-harvest senescence of broccoli florets. J Exp Bot 2003;54:1045–56. Hattori T, Nakagawa T, Maeshima M, Nakamura K, Asahi T. Molecular cloning and nucleotide sequence of cDNA for sporamin, the major soluble protein of sweet potato tuberous roots. Plant Mol Biol 1985;5:313–20. Hou WC, Chen YC, Chen HJ, Lin YH, Yang LL, Lee MH. Antioxidant activities of trypsin inhibitor, a 33 kDa root storage protein of sweet potato (Ipomoea batatas (L.) Lam. cv. Tainong 57). J Agri Food Chem 2001;49:2978–81.

ARTICLE IN PRESS H.-J. Chen et al. / Journal of Plant Physiology 167 (2010) 838–847

Hou WC, Chen HJ, Lin YH. Antioxidant peptides with angiotensin converting enzyme inhibitory activities and applications for angiotensin converting enzyme purification. J Agri Food Chem 2003;51:1706–9. Huang DJ, Hou WC, Chen HJ, Lin YH. Sweet potato (Ipomoea batatas [L.] Lam. ‘Tainong 57’) storage root mucilage exhibited angiotensin converting enzyme inhibitory activity in vitro. Bot Stud 2006;47:397–402. Huang GJ, Chen HJ, Chang YS, Shue MJ, Lin YH. Recombinant sporamin and its synthesized peptides with antioxidant activities in vitro. Bot Stud 2007a;48:133–40. Huang GJ, Sheu MJ, Chen HJ, Chang YS, Lin YH. Inhibition of reactive nitrogen species in vitro and ex vivo by trypsin inhibitor from sweet potato ‘Tainong 57’ storage roots. J Agri Food Chem 2007b;55:6000–6. Huang GJ, Sheu MJ, Chen HJ, Chang YS, Lin YH. Growth inhibition and induction of apoptosis in NB4 promyelocytic leukemia cells by trypsin inhibitor from sweet potato storage roots. J Agri Food Chem 2007c;55:2548–53. Koizumi M, Yamaguchi-Shinozaki K, Shinozaki K. Structure and expression of two genes that encode distinct drought-inducible cysteine proteinases in Arabidopsis thaliana. Gene 1993;129:175–82. Lichtenthaler HK. Chlorophylls and carotenoids: pigments of photosynthetic biomembranes. Meth Enzymol 1987;148:350–82. Lim PO, Kim HJ, Nam HG. Leaf senescence. Annu Rev Plant Biol 2007;58:115–36. Makino A, Osmond B. Effects of nitrogen nutrition on nitrogen partitioning between chloroplasts and mitochondria in pea and wheat. Plant Physiol 1991;96:355–62. Martinez DE, Costa ML, Gomez FM, Otegui MS, Guiamet JJ. ‘‘Senescence associated vacuoles’’ are involved in the degradation of chloroplast proteins in tobacco leaves. Plant J 2008;56:196–206. Mitsuhashi W, Koshiba T, Minamikawa T. Separation and characterization of two endopeptidases from cotyledons of germinating Vigna mungo seeds. Plant Physiol 1986;80:628–34. Okamoto T, Minamikawa T. Purification of a processing enzyme (VmPE-1) that is involved in post-translational processing of a plant cysteine endopeptidase (SH-EP). Eur J Biochem 1995;231:300–5. Okamoto T, Minamikawa T. Molecular cloning and characterization of Vigna mungo processing enzyme 1 (VmPE-1), an asparaginyl endopeptidase possibly involved in post-translational processing of a vacuolar cysteine endopeptidase (SH-EP). Plant Mol Biol 1999;39:63–73. Okamoto T, Yuki A, Mitsuhashi N, Mimamikawa T. Asparaginyl endopeptidase (VmPE-1) and autocatalytic processing synergistically activate the vacuolar cysteine proteinase (SH-EP). Eur J Biochem 1999;264:223–232. Okamoto T, Shimada T, Hara-Nishimura I, Nishimura M, Minamikawa T. C-terminal KDEL sequence of A KDEL-tailed cysteine proteinase (sulfhydryl-endopeptidase)

847

is involved in formation of KDEL vesicle and in efficient vacuolar transport of sulfhydryl-endopeptidase1. Plant Physiol 2003;132:1892–900. Poueymiro M, Genin SP. Secreted proteins from Ralstonia solanacearum: a hundred tricks to kill a plant. Curr Opin Microbiol 2009;12:44–52. Quirino BF, Noh YS, Himelblau E, Amasino RM. Molecular aspects of leaf senescence. Trends Plant Sci 2000;5:278–82. Raper CDJ, Thomas JF, Tolley-Henry L, Rideout JW. Assessment of an apparent relationship between availability of soluble carbohydrates and reduced nitrogen during floral initiation in tobacco. Bot Gaz 1988;149: 289–94. Rideout JW, Raper CD, Miner GS. Changes in ratio of soluble sugars and free amino nitrogen in the apical meristem during floral transition of tobacco. Int J Plant Sci 1992;153:78–88. Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning: A laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press; 1989. Schlereth A, Becker C, Horstmann C, Tiedemann J, Muntz K. Comparison of globulin mobilization and cysteine proteinases in embryonic axes and cotyledons during germination and seedling growth of vetch (Vicia sativa L.). J Exp Bot 2000;51:1423–33. Schlereth A, Standhardt D, Mock HP, Muntz K. Stored cysteine proteinases start globulin mobilization in protein bodies of embryonic axes and cotyledons during vetch (Vicia sativa L.) seed germination. Planta 2001;212:718–27. Senyuk V, Rotari V, Becker C, Zakharov A, Horstmann C, Muntz K, et al. Does an asparaginyl-specific cysteine endopeptidase trigger phaseolin degradation in cotyledons of kidney bean seedlings? Eur J Biochem 1998;258: 546–58. Sihachakr D, Haı¨cour R, Cavalcante Alves JM, Umboh I, Nzoghe´ D, Servaes A, et al. Plant regeneration in sweet potato (Ipomoea batatas L., Convolvulaceae). Euphytica 1997;96:143–52. ¨ Tiedemann J, Schlereth A, Muntz K. Differential tissue-specific expression of cysteine proteinases forms the basis for the fine-tuned mobilization of storage globulin during and after germination in legume seeds. Planta 2001;212:728–38. Xiong L, Lee H, Ishitani M, Zhu JK. Regulation of osmotic stress-responsive gene expression by the LOS6/ABA1 locus in Arabidopsis. J Biol Chem 2002;277:8588–96. Xu FX, Chye ML. Expression of cysteine proteinase during developmental events associated with programmed cell death in brinjal. Plant J 1999;17:321–7. Yoshida S. Molecular regulation of leaf senescence. Curr Opin Plant Biol 2003;6:79–84.