Gender differences in detoxification metabolism of polycyclic aromatic hydrocarbon (chrysene) in scallop Chlamys farreri during the reproduction period

Comparative Biochemistry and Physiology, Part C 170 (2015) 50–59

Contents lists available at ScienceDirect

Comparative Biochemistry and Physiology, Part C journal homepage: www.elsevier.com/locate/cbpc

Gender differences in detoxification metabolism of polycyclic aromatic hydrocarbon (chrysene) in scallop Chlamys farreri during the reproduction period Meng Xiu, Luqing Pan ⁎, Qian Jin, Jingjing Miao The Key Laboratory of Mariculture, Ministry of Education, Ocean University of China, Qingdao 266003, PR China

a r t i c l e

i n f o

Article history: Received 24 December 2014 Received in revised form 2 February 2015 Accepted 19 February 2015 Available online 26 February 2015 Keywords: Chrysene Chlamys farreri CYP1A1 EROD GST P-gp Bioaccumulation

a b s t r a c t This study aims to investigate the effects of chrysene (CHR) on biotransformation and detoxification responses of mature scallop Chlamys farreri during the reproduction period. Scallops were exposed to 0.2, 0.8 and 3.2 μg/L CHR for 21 days; at day 10 scallops were induced to spawn. At days 1, 3, 6, 10, 11, 15 and 21, enzymatic activities of 7ethoxyresorufin O-deethylase (EROD) and glutathione-s-transferase (GST), related mRNA expression levels of CYP1A1, GST-pi and P-glycoprotein (P-gp) in digestive glands and CHR bioaccumulation in tissues were examined by separately analyzing male and female scallops. During the pre-spawn period, CHR concentrations of the treated groups in tissues except the hemolymph increased rapidly. Levels of enzymatic activities and related gene expressions were all induced by the exposure to CHR for females and males. GST activity and GST-pi mRNA expression showed a good time- and dose-dependent relationship only in males, and P-gp mRNA expression exhibited a dose-dependent manner in both sexes. During the post-spawn period, spawning caused significant reductions of bioaccumulation in tissues but the gill and hemolymph. Enzymatic activities and related gene expressions were for females significantly depressed at day 21 at 0.8 or 3.2 μg/L CHR. Overall, females accumulated more CHR than males, while males were more sensitive than females to CHR exposure in gene expressions and enzyme activities. P-gp mRNA expression seemed to be a potential biomarker for PAH exposure. These results will offer the information on CHR biotransformation in this species, and ensure the influence of gender and reproductive status on PAH detoxification metabolism. © 2015 Elsevier Inc. All rights reserved.

1. Introduction Polycyclic aromatic hydrocarbons (PAHs) are a large group of compounds composed of two or more fused aromatic rings. They originate mainly from the anthropogenic combustion, industrial and urban runoff, and spills of petroleum, with the highest concentrations found in marine coastal areas (Lüchmann et al., 2014). In 2008 the European Food Safety Authority (EFSA) introduced a system of four specific PAHs, namely, benzo[a]anthracene (BaA), benzo[a]pyrene (BaP), benzo[b]fluoranthene (BbF) and chrysene (CHR), assessing that the sum of the four PAH compounds was the most suitable indicator for PAHs in food (EFSA, 2008). Of these four PAHs, CHR occured at the highest level in bivalve mollusks and other aquatic organisms from polluted waters (Guillen et al., 1997; Phillips, 1999), and also a very high level of CHR is found in the air environment (Biswas and Ghosh, 2014). CHR, a symmetrical PAH consisting of four condensed benzene rings, has two highly reactive Bay-regions where the main carcinogenic

⁎ Corresponding author at: Fisheries College, Ocean University of China, Yushan Road 5, 266003 Qingdao, China. Tel./fax: +86 532 82032963. E-mail address: [email protected] (L. Pan).

http://dx.doi.org/10.1016/j.cbpc.2015.02.003 1532-0456/© 2015 Elsevier Inc. All rights reserved.

species can be formed. In spite of not acting as a complete carcinogen, CHR could cause increased incidence of liver tumors in mice (Levin et al., 1978). Besides, several hydroxylated CHR metabolites were found to be estrogenic (Fertuck et al., 2001) or anti-estrogenic (Tran et al., 1996). In an aquatic environment, PAHs are readily bioavailable to organisms as waterborne compounds, from contaminated sediments or through the food chain, exhibiting a large bioaccumulation factor (Perugini et al., 2007), in particular for marine bivalves, which is a drawback in the consumption of polluted bivalves as food. Owing to their high lipophilic nature, PAHs can easily penetrate biological membranes, and thus bioaccumulation tends to be rapid (Oliva et al., 2010). In fact, the uptake of waterborne PAHs depends not only on their bioavailability, but also on the physiology of the organisms (Meador et al., 1995). Earlier results have proved that lipid contents are always directly related with the bioaccumulation of hydrophobic substances (Lee et al., 1996; Antunes et al., 2007), and age is considered a more important factor than body size in the accumulation process (Muir et al., 2003). Bodiguel et al. (2009) reported that older European hake Merluccius merluccius, L. accumulated more organochlorine compounds. Also, only a few of the studies considered the impact of intrinsic parameters such as sex (Chu et al., 2003). In addition, feeding behaviors, length, state of health and reproductive

M. Xiu et al. / Comparative Biochemistry and Physiology, Part C 170 (2015) 50–59

cycle of animals all can influence the accumulation pattern (Paterson et al., 2003; Di Bella et al., 2006; Bodin et al., 2007). However, although some researchers have noticed that PAH concentrations in mussels are more prone to quick changes in the spawning season (Cáceres-Martínez and Figueras, 1998; Ruiz et al., 2011), few references exist on the relationship between PAH exposure and reproductive output in bivalves. PAHs induce the toxic effects in the organism following biotransformation to toxic metabolites (Stein et al., 1992). The transformation processes are generally divided into three types: Phase I, Phase II and Phase III reactions. The digestive gland is often used in mollusk toxicology because it is the main organ of metabolism of organic compounds and the main site of biotransformation activities (Livingstone, 1998). The Phase I enzymes, Cytochrome P4501A (CYP1A) is responsible for the biotransformation of xenobiotics (Hahn, 1998). Presently, enhanced 7Ethoxyresorufin-O-deethylase (EROD) activity, which is one of the specific enzymes encoded by CYP1A, has been and is still extensively used as a sensitive indicator for the evaluation of PAH exposure in bivalves (Nahrgang et al., 2013; Liu et al., 2014a). BaP, a five-ring PAH, has been shown to be a potent EROD inducer (Liu et al., 2014a; Ren et al., 2014), while some low molecular weight PAHs have been shown to inhibit EROD activity (Willett et al., 2001; Pathiratne and Hemachandra, 2010). In this regard, sound scientific evidence is unavailable as to CHR. The Phase II enzymes, glutathione S-transferases (GSTs), provide cellular protection against the toxic effects of a variety of endogenous and environmental chemicals (Doyen et al., 2008). GST is shown to be effective catalysts of PAH detoxification in bivalves (Banni et al., 2010). Several studies have demonstrated that the expression of the GST in clams seems to be regulated by inducing BaP (Hoarau et al., 2002). In the Phase III, PAHs can be directly pumped out of the cells by multixenobiotic resistance related protein (MXRP) such as Pglycoprotein (P-gp). The induction of P-gp-like genes and/or proteins has also been found in different tissues of bivalves living in polluted environments (Medeiros et al., 2008). Unfortunately, studies on CHR detoxification in invertebrates are strongly limited. The scallop Chlamys farreri is an economically and ecologically important bivalve species in the China Seas, which can be recommended as an appropriate sentinel to assess the toxicity and bioavailability of PAHs. This is the first study to elucidate the CHR biotransformation in bivalves during the reproduction period by analyzing CHR bioaccumulation in various tissues of sexually mature female and male scallops. Moreover, the experiment was conducted to investigate the response of the detoxification systems including Phase I metabolism enzymes (EROD) and Phase II metabolism enzymatic (GST) in the digestive gland of females and males, C. farreri exposed to CHR, as well as the expression levels of the counterpart genes such as CYP1A1, GST and Pgp. This study may offer the information on CHR biotransformation in C. farreri, and ensure the influence of gender and reproductive status on PAH detoxification metabolism. 2. Materials and methods 2.1. Chemicals CHR (chrysene, CAS#218-01-9) was purchased from Supelco (Bellefonte, PA, USA). All chemicals for sample preparation and High Performance Liquid Chromatography (HPLC) detection were of chromatogram grade and obtained from Sigma-Aldrich (St. Louis, USA) and E. Merck (Darmstadt, Germany). In addition, biochemicals for toxic effects were of analytical grade. 2.2. Animals and treatments Healthy sexually mature scallops C. farreri, aged 2 years, were collected from the Shazikou shellfish farm (Yellow Sea, Qingdao, China). Only scallops with the similar shell lengths (6.19 ± 0.60 cm) were selected for experiments. They were held in laboratory tanks at ambient

51

seawater temperature (18–20 °C) for one week before the exposure test. The seawater was continuously aerated, and salinity, temperature and pH were, respectively, maintained at 31‰, 19(± 1)°C and 8.1. The water was renewed completely every 24 h. The scallops were fed daily with dried powder of Spirulina platensis (30 mg for each individual). The background concentration of CHR in seawater from Taiping Bay was analyzed by HPLC before the experiment, and the concentration was 0.126 ng/L. In treatment aquaria, scallops were exposed to 0.2, 0.8 and 3.2 μg/L CHR, which are relevant with the environmental concentrations, to mimic the natural contaminant concentrations of CHR. One group served as the control without any pollutant additive. There were triplicates for each level and 90 scallops in each aquarium. CHR was first dissolved in acetone. The final acetone concentration was 0.001% in all tanks including the control ones (the acetone test has been done in a preliminary experiment with the result that there was no influence of acetone on scallops). Experimental conditions (salinity, pH, temperature, scallop density and feeding) were the same as those used for acclimation, and the exposure media were renewed daily. We determined the CHR concentration of exposure groups every day before renewing the water during the experiment. The analysis of CHR concentration was as below, CHR: 0.17 ± 0.06 μg/L, 0.71 ± 0.04 μg/L, and 2.97 ± 0.08 μg/L. The exposure experiment lasted for 21 days, including 10 days for pre-spawn experiment and 11 days for post-spawn experiment. After sampling of day 10, scallops from each group were immediately induced to spawn, by increasing temperature and strong fluid flow (Yang and Sun, 1981). During the experimental period, there was no mortality of scallops at any concentrations of CHR and the control groups. Scallops were sampled 1, 3, 6, 10, 11, 15 and 21 days after the end of the acclimatization period. Ten scallops were sampled for each day and concentration, including controls. Hemolymph (at least 1.5 mL/scallop) was individually collected from the adductor muscle with a 5-mL plastic syringe and placed in 10 mL Eppendorf tubes in ice. The whole soft tissue, gill, digestive gland, adductor muscle and gonad of scallops were excised and frozen immediately at −80 °C for subsequent examination.

2.3. Chemical analysis The analysis of CHR was conducted according to standard method procedures (USEPA, 1996) with some modifications. About 1.5 g of freeze-dried scallop tissue sample was Soxhlet extracted with 60 mL of an acetone/dichloromethane mixture (1:1) for at least 16 h, and triplicate extracts for each of the scallop tissues were prepared. The concentrated extracts were diluted by adding 10 mL of hexane and then concentrated to about 2 mL. The chromatography column that was used for contaminant separation was packed sequentially with glass wool, 8 g of activated silica gel, and 2 g of anhydrous sodium sulfate (Wei et al., 2006). The column was eluted with 20 mL dichloromethane and hexane mixture (1:4) and the collected extracts were concentrated to 1 mL. The hexanic phase was dried using anhydrous sodium sulfate, and concentrated by a rotary evaporator and finally recovered with 5 mL acetonitrile. The CHR quantification was analyzed with a Shimadzu HPLC (Shimadzu, Japan), which was equipped with two pumps, an autosampler, and a diode array detector, using a reverse-phase C18 column (ZORBAX Eclipse PAH, 4.6 × 250 mm, 5 μm) and a gradient elution program with a flow rate of 1 mL/min. The initial mobile phase was 50% acetonitrile for 20 min, which was then gradiently changed to 100% acetonitrile in 20 min, held at 100% for 15 min, then decreased to initial phase in 10 min. The sample injection volume was 10 μL. This method was tested with 1 mL of CHR standard spiked in unpolluted scallop tissues, obtaining a recovery of up to 83%. The detection limit for individual CHR was 0.01 μg/g d.w. CHR was quantified by comparing peak areas of individual compound with a reference standard.

52

M. Xiu et al. / Comparative Biochemistry and Physiology, Part C 170 (2015) 50–59

2.4. Enzyme extraction and measurements The digestive glands of scallops were homogenized in an ice-cold buffer containing 20 mM Tris–HCl, 1.5 mM EDTA, 1.0 mM dithiothreitol, and 10% glycerol (v:v) (pH 7.6) at 0 °C. Samples were centrifuged for 3 min at 4 °C, 12,000 rpm to remove tissue debris firstly, then the obtained supernatants were centrifuged again for 25 min at 4 °C, 3000 rpm. The supernatants were collected for analyzing the activity of EROD, GST and the contents of protein. EROD activity was measured according to the modified method of Pohl and Fouts (1980). The reaction mixture contained 100 μL supernatant, 10 μL 0.2 mM O7-Ethylresorufin, 10 μL 6 mM NADPH and 1.88 mL phosphate buffer (0.125 M, pH 7.7, containing Na2EDTA, 0.05 M, 2–4 °C), allowed to proceed for 10 min at RT, and stopped by the addition of 0.5 mL carbinol. Incubation vials were centrifuged to remove precipitated microsomal protein, and supernatants were transferred to vials for the measurement of resorufin concentrations in a luminescence spectrometer (Model LS55, Perkin-Elmer of U.K.) at an excitation wavelength of 560 nm and an emission wavelength of 580 nm. Resorufin was identified and concentrations were calculated by comparison to retention times and responses of resorufin standards. Blanks corresponded to t = 0 min and quantification was achieved with standard additions of resorufin. EROD activity was expressed as nmol resorufin/min/mg microsomal protein. GST activity was determined following the method described by Habig et al. (1974). The reaction mixture contained 200 μL supernatant, 2 mL phosphate buffer (0.125 M, pH 7.7, containing Na2EDTA 0.05 M, 4 °C), 400 μL H2O, 200 μL 15 mM CDNB dissolved in 95% ethanol and 200 μL 15 mM of GSH. GST activity was determined following the conjugation of GSH with CDNB at 340 nm (a = 9.6 mM−1). A unit of GST activity was defined as the amount of glutathione conjugate formed using 1 nM GSH and CDNB/min per mg protein (nM 2,4-dinitrophenyl glutathione/mg protein/min). Soluble protein in enzyme extracts was quantified with a commercial kit (BioRad) based on Coomassie blue, using bovine serum albumin standards (Bradford, 1976). 2.5. Metabolism-related gene expression assay Primer pairs for real-time PCR analysis were designed using Primer 5.0 and shown in Table 1. Trizol Reagent was used to isolate total RNA from digestive glands according to the manufacturer's instructions (Invitrogen, USA). The RNA sample was reverse-transcribed using PrimeScript RT-PCR Kit (TaKaRa, China). The housekeeping gene β-actin gene was used as a reference control. The qRT-PCR was performed using 2× SYBR Green master mix (TaKaRa, China) on the Real-Time Thermal Cycler 5100 (Thermo scientific, Finland). The reaction was performed using the following conditions: denaturation at 95 °C for 3 min, followed by 40 cycles of amplification (95 °C for 10 s, 58 °C for 20 s, and 72 °C for 30 s). The thermo-conditions for the selected genes were optimized in a preliminary experiment with the result that there was no difference between genders. Dissociation curve analysis of amplification products was performed at the end of each PCR reaction to confirm that only

Table 1 Oligonucleotide primers of scallop Chlamys farreri used in this study. Primer name

Accession no.

Forward and reverse primers (5′–3′)

Product

β-Actin-qF β-Actin-qR CYP1A1-qF CYP1A1-qR GST-pi-qF GST-pi-qR P-gp-qF P-gp-qR

AY335441

CTCCCTCACGCTATCCTCCG CTGGGCACCTGAACCTTTCG GCAAGGGAGGACAAGCAACTA GGCGTAAGGAATGCCATGAAG GTTCAAAAAGTGGGGGACAG ATGCTTTGATGGTCGGTAAT GGTCAGCCAGGAACCAATACT CTGTTTCTGTCCACCTGAGAGTT

177 bp

SRP018007 FJ588638 ACL80139

113 bp 130 bp 199 bp

one PCR product was amplified and detected. A control lacking cDNA template was included in qPCR analysis to determine the specificity of target cDNA amplification. The amplification efficiency of each primer pair was calculated using a dilution series of cDNA. All amplification efficiencies were between 94% and 98%. The relative expression levels of the target genes were calculated with the 2−ΔΔCt method (Livak and Schmittgen, 2001) and normalized with β-actin. 2.6. Statistical analysis All data presented are the mean values of three independent sets of experiments. Each value was presented as means ± standard deviation (S. D.). Statistical analysis was carried out by one-way ANOVA using Dunnett's test to evaluate whether the means were significantly different. Data were tested using SPSS®17.0 for Windows. 3. Results 3.1. Gene expression and enzyme activities CYP1A1 mRNA expression and EROD enzymatic activity in digestive gland were significantly (p b 0.05) influenced by CHR concentration and sampling time (Fig. 1). Before the scallops spawned, levels of CYP1A1 mRNA expression and EROD activity for females and males were induced from day 1 or day 3 (p b 0.05) and exhibited a time-dependent increase in the lowest dose (0.2 μg/L), whist in the middle and highest doses, they increased at day 3 or day 1 and then reduced at day 10 (p b 0.05). Compared to females, CYP1A1 mRNA expression and EROD activity in males were more responsive to CHR exposure. After the scallops spawned, CYP1A1 mRNA expression and EROD activity in treated groups of females just reduced from day 11, and in the lowest dose arrived at the control level at day 21, but in the middle and highest doses were inhibited (p b 0.05) at day 21 (Fig. 1A, C). However, for males, CYP1A1 mRNA expression and EROD activity decreased obviously and became stable at day 15, and in the lowest dose returned to the control level, but in the middle and highest doses were significantly higher (p b 0.05) than the control group (Fig. 1B, D). Under the exposure to CHR, CYP1A1 gene and EROD enzyme in digestive gland presented a remarkable sexual difference. During the pre-spawn period, the level of GST-pi mRNA expression and GST enzymatic activity for females increased gradually (p b 0.05) until day 6 at the lowest and middle doses. With the highest concentration, GST-pi mRNA expression and GST activity for females reached the maximum at day 6, and then GST-pi mRNA expression decreased to the control level at day 10, but GST activity remained higher than the control (p b 0.05) (Fig. 2A, C). The GST-pi mRNA level in females showed a positive correlation with CHR concentrations at days 3 and 6 (Fig. 2A). By contrast, a good time- and dose-dependent increase of GST-pi mRNA expression for males was observed (Fig. 2B), and this pattern was apparent for GST activity of males (Fig. 2D). During the post-spawn period, for both females and males, GST-pi mRNA expression in all treated groups decreased with the increase of exposure time. At the end of the experiment, the expression level of GST-pi mRNA in females recovered to initial levels, with the exception of inhibition at the lowest dose (Fig. 2A), whereas the expression level in males remained at a high level above that of controls (Fig. 2B). A similar trend was also observed for GST enzymatic activity (Fig. 2C, D). Before the scallops spawned, the expression of P-gp mRNA for females was induced significantly (p b 0.05) at day 1 and peaked at day 6, with a small decrease thereafter (Fig. 3A), whist P-gp mRNA expression for males showed an increasing trend associated with the exposure concentration significantly (Fig. 3B). P-gp mRNA expressions, however, showed a dose-dependent manner for both sexes. After the scallops spawned, P-gp mRNA expression for females decreased from day 11, and finally returned to the control level at the lowest dose, but was inhibited (p b 0.05) at the middle and highest doses (Fig. 3B).

M. Xiu et al. / Comparative Biochemistry and Physiology, Part C 170 (2015) 50–59

53

Fig. 1. CYP1A1 mRNA relative expressions for females (A) and males (B), and EROD activities for females (C) and males (D) in the digestive glands of Chlamys farreri exposed to 0, 0.2, 0.8 and 3.2 μg/L chrysene (CHR) during pre- and post-spawn periods. Significant differences from control in the same time of sampling are indicated with an asterisk at p b 0.05, and with two asterisks at p b 0.01.

Regarding males, P-gp mRNA expression remained unchanged and higher than the control group from day 15 (p b 0.05), after a gradual reduction (Fig. 3B).

females accumulated more CHR in above tissues than males except for adductor muscle and gonads with little difference between gender. 4. Discussion

3.2. Bioaccumulation CHR concentrations in the gills, hemolymph, digestive glands, adductor muscles, gonads and soft tissues of male and female scallops during the pre- and post-spawn periods are presented in Figs. 4 and 5. During the pre-spawn period, CHR concentrations of all the treated groups in the gills, digestive glands, adductor muscles, gonads and soft tissues increased rapidly after the start of the exposure and peaked at day 10. However, CHR concentrations in the hemolymph all rose fast within 1 day and then leveled off at about 2.1 μg/L, and no clear difference was observed among treated groups. The sequence of CHR contents at day 10 was gill N gonad N digestive gland N soft tissue N adductor muscle, and notably, bioaccumulation of CHR in the gills, gonads, digestive glands and soft tissues of females was higher than that of males. During the postspawn period, CHR concentrations in the gills of all the treated groups kept rising, while the contents in adductor muscles decreased rapidly shortly after day 11, but remained higher than the control group at the end of the experiment. The contents in the digestive glands all dropped until day 15 and then inclined at day 21 with the level lower than day 10. The contents in both gonads and soft tissues showed marked decreases after the spawning, and then recovered but remained lower than those at day 10. As to the hemolymph, the CHR concentrations of all the treated groups clearly increased to around 2.9 μg/L at day 11 and became stable. The sequence of CHR contents at day 21 was gill N digestive gland N gonad N soft tissue N adductor muscle, and

EROD activity and CYP1A1 mRNA transcription are extensively considered as valuable indicators for the evaluation of PAH exposure on aquatic organisms (Gagnon and Holloway, 2000; Nahrgang et al., 2009; Liang et al., 2013). Previous studies demonstrated that the presence of BaP regulated the increase of AhR mRNA, CYP1A1 transcript and EROD activity in bivalves (Tian et al., 2013; Liu et al., 2014a,b), although limited evidence suggested that some low molecular weight PAHs might inhibit EROD activity, such as fluoranthene (Willett et al., 2001). The expression of CYP genes can be initiated through binding of xenobiotics with the intracellular aryl hydrocarbon receptor (AhR), which in turn activates protein synthesis and relevant enzyme activity in vertebrates (Marionnet et al., 1997; Sarkar et al., 2006). In the present study, CYP1A1 mRNA expressions closely correlated with levels of EROD activity for both females and males, before scallops spawned. A similar significant relationship between CYP1A1 mRNA and EROD activity in the gills and hepatopancreas has been reported for juvenile white shrimp Litopenaeus vannamei (Ren et al., 2014). There could be some involvement of AhR action in invertebrates CYP regulation according to the similar expression pattern among them (Tian et al., 2013). However CYP1A1 mRNA expressions associated with EROD activity presented higher sensitivity in males than females. The data shown here are comparable to recent findings of gender differences in CYP1A mRNA expression and EROD activity in swordtail fish (Xiphophorus helleri) exposed to triclosan (Liang et al., 2013). Förlin and Haux (1990) recorded ethoxycoumarin-O-deethylase (ECOD), AHH (aryl hydrocarbon hydroxylase) and ethylmorphine-N-

54

M. Xiu et al. / Comparative Biochemistry and Physiology, Part C 170 (2015) 50–59

Fig. 2. GST-pi mRNA relative expressions for females (A) and males (B), and GST activities for females (C) and males (D) in the digestive glands of Chlamys farreri exposed to 0, 0.2, 0.8 and 3.2 μg/L chrysene (CHR) during pre- and post-spawn periods. Significant differences from control in the same time of sampling are indicated with an asterisk at p b 0.05, and with two asterisks at p b 0.01.

demethylase activities, which are essential components of Phase I metabolic enzymes, were also higher in rainbow trout (Oncorhynchus mykiss) males than in females. Kirby et al. (2007) observed that Estradiol (E2) showed an ability to suppress PAH-mediated EROD induction in flounder (Platichthys flesusat) at a lower concentration after mixture of several waterborne EROD inducers and E2 exposure. Some authors reported that E2 might have some effects on CYP1A through mediation of the estrogen receptor (ER) (Navas and Segner, 2000), whereby effects on genetic transcription (Stegeman and Hahn, 1994) or effects on estrogen-responsive genes/receptors (Arukwe et al., 1997). Other studies suggested however that E2 or other estrogens could cause a decline in mixed function oxygenase (MFO) activity and P450 levels in sexually

mature individuals (Forlin et al., 1984; Elskus et al., 1992; Navas and Segner, 2000; Solé et al., 2000). Anyway these results presented above demonstrate the necessity to take into account sexes when these biomarker responses are applied for the biomonitoring of PAH pollution. It is worth noting that, during the post-spawn period, the decrease in CYP1A1 mRNA levels and EROD activities in females at the end of CHR exposure could have been a response to oxidative stress. ROS and in particular hydrogen peroxide (H2O2) are known to down-regulate CYP1A mRNA expression acting in the signaling pathway through the stress response transcription factor (Morel and Barouki, 1999; Barouki and Morel, 2001). Previous research reported that CYP1A activity itself could generate the production of ROS (Benedetti et al., 2007). In addition,

Fig. 3. P-gp relative expressions for females (A) and males (B) in the digestive glands of Chlamys farreri exposed to 0, 0.2, 0.8 and 3.2 μg/L chrysene (CHR) during pre- and post-spawn periods. Significant differences from control in the same time of sampling are indicated with an asterisk at p b 0.05, and with two asterisks at p b 0.01.

M. Xiu et al. / Comparative Biochemistry and Physiology, Part C 170 (2015) 50–59

55

Fig. 4. Chrysene (CHR) concentrations in the gills, hemolymph and digestive glands of Chlamys farreri exposed to 0, 0.2, 0.8 and 3.2 μg/L CHR during pre- and post-spawn periods. Values are presented as the mean ± SD (n = 3).

the reproductive behavior for scallops is identified as a sort of inner stress, producing excessive ROS as well (Callard et al., 1993; Wood and Van der Kraak, 2001), because scallops consume tremendous energy on reproductive process, such as emissions of ripe gametes (Barber and Blake, 1991). From a reproductive point of view, our results of the gender differences in CYP1A1 mRNA levels and EROD activities implied that female scallops suffered more from the damage of oxidative stress after spawning. GST plays a critical role in the cellular detoxification of various xenobiotic chemicals (Doyen et al., 2008), which has been elucidated in many organisms, including bivalves. The pi-class GST is the isoform exhibiting the highest expression level from several different classes in bivalves, which was described in the clam Ruditapes philipparum (EF520700) and in four mussel species: Corbicula fluminea (AY885667), Mytilus edulis (AY557404), Mytilus galloprovincialis (AF527010) and Unio tumidus (AY885666) (Doyen et al., 2008). Previous research demonstrated that GST-pi mRNA expression could be induced by exposure either

to individual PAH or PAH mixtures (Xu et al., 2010; Garner and Di Giulio, 2012; Liu et al., 2014b), which was consistent with ours. Liu et al. (2014b) and Xu et al. (2010) reported that GST-pi presented a good time- and dose-dependent pattern with the BaP exposure, while this relationship was only observed in male groups during the pre-spawn period in our study. Furthermore, a similar tendency existed in GST activities. This suggested that males in GST-pi mRNA and GST enzyme were more sensitive than females to CHR exposure, which is in accordance with the response of CYP1A1 mRNA and EROD enzyme mentioned above. We however noted increases in GST activity for both female and male scallops. The elevated GST activity level could contribute to neutralizing the toxicant and rendering the product more water-soluble. P-gp has widely been used as a potential biomarker of exposure to xenobiotics (Albertus and Laine, 2001; Liang et al., 2013). Prior research considered that P-gp was induced in vitro by CYP1A inducers in the presence of BaP as a substrate in mammals (Gant et al., 1991). This

56

M. Xiu et al. / Comparative Biochemistry and Physiology, Part C 170 (2015) 50–59

Fig. 5. Chrysene (CHR) concentrations in the adductor muscles, gonads and soft tissues of Chlamys farreri exposed to 0, 0.2, 0.8 and 3.2 μg/L CHR during pre- and post-spawn periods. Values are presented as the mean ± SD (n = 3).

pattern was, however, not apparent in our study. Additionally, it was reported that a compound inducible to several CYP subfamilies might also induce P-gp (Tateishi et al., 1999), so the increased PAH may possibly contribute to the high P-gp expression. In the present study, the P-gp gene expression was significantly induced and exhibited a good dose-pattern, which was comparable to the results of clams R. philipparum exposed to BaP for 21 days (Liu et al., 2014b). Hence the P-gp gene mRNA expression could be selected as a potential molecular biomarker for PAH exposure. Bard et al. (2002) pointed out that P-gp and CYP1A in intertidal fish Anoplarchus purpurescens might play a complementary role in the cellular detoxification to protect organisms from the accumulation of moderately hydrophobic xenobiotics. By contrast, no obvious relationships between P-gp and CYP1A1 was observed in ours. This would require more experiments to explore a relationship between P-gp and CYP subfamilies in

invertebrates. We also noticed that P-gp gene transcription was suppressed in females at day 21, which was thought to be a physical decline due to a dual stress from high levels of CHR and reproduction. CHR concentration results in tissues show that CHR could be well absorbed and rapidly accumulated in scallops during the pre-spawn period, because CHR has an octanol/water partition coefficient (Kow) favoring solubility in lipid-rich tissues over solubility in water. A plateau level is not reached after 10 days of exposure, which is in accordance with the result of juvenile scallops C. farreri exposed to the same CHR doses in our prior study (Xiu et al., 2014). This result confirms the ability of scallops to bioconcentrate CHR. Organic pollutants got into mollusks primarily through the epidermal cells of the gill from polluted water, while other organs or tissues are compartments of distribution through the digestive and circulating systems (Muncaster et al.,

M. Xiu et al. / Comparative Biochemistry and Physiology, Part C 170 (2015) 50–59

1990; Frouin et al., 2007). In this study, the bioaccumulation patterns of CHR for female and male C. farreri at day 10 following the sequence: gill N gonad N digestive gland N soft tissue N adductor muscle. Generally, tissues with higher lipid content accumulate PAHs to a greater extent (Lee et al., 1996). Because the gonad contains abundant reproductive cells with highest lipid content, and because there are no removal mechanisms (Negro et al., 2012), thus there is a relatively higher concentration of CHR. This result is in agreement with the earlier study that observed increased levels of PCB in oysters Crassostrea virginica fed a contaminated algal diet (Chu et al., 2003). And yet the highest level of CHR in our study was found in the gill. The main reason is that the gill is the first organ to be in contact with CHR in water continuously, and another factor is a binding protein existing in some organs of organisms, such as the gill and digestive gland, which played a major role in explaining the persistence of contaminant in these organs (Brown et al., 1997). In spite of the binding protein, the digestive gland is the main organ of metabolism of organic compounds, as well as the main site of biotransformation activities (Livingstone, 1998; Banni et al., 2010), as a result that CHR concentration in the digestive gland was much lower than that in the gill and gonad. The adductor muscle had the lowest concentration of CHR, which is due to the fact that the adductor muscle is low in lipids and it is not an active site for the detoxification and therefore transport of CHR from other tissues to the muscle. Nevertheless the accumulation pattern of xenobiotic for C. farreri in our laboratory study is not consistent with the results in some field studies and some in situ studies. For instance, Monosson et al. (2003) found that the highest levels of PCB in mummichog Fundulus heteroclitus were recorded in the gonad, while Bodiguel et al. (2009) described that liver tissues of hake M. merluccius, L. had the highest contents of 15 PCB congeners and p,p′-DDE, rather than the gonad. The bioaccumulation of compounds however depends not only on the physico-chemical characteristics of compounds, but also on ecological and biological factors such as feeding behaviors, habitat, age, sex or state of health of organisms (Paterson et al., 2003; Di Bella et al., 2006; Bodin et al., 2007). Interestingly, female scallops showed a higher contamination level in the gill, gonad, digestive gland and soft tissue than male scallops. Similarly, Ji et al. (2006) identified that female clams R. philippinarum showed significantly higher Mn and Zn concentrations than males. As described by Vuorinen et al. (2006) for fish, this gender-related difference on bioaccumulation is attributed to sex hormone specific differences in PAH metabolism. Bioaccumulation of xenobiotic is an overall combination of uptake, metabolism and excretion processes (Livingstone, 1998). PAHs are metabolized through the MFO system (Stegeman and Hahn, 1994), but the presence of estrogens could indeed suppress the MFO system (Stegeman et al., 1982; Vuorinen et al., 2006; Tairova et al., 2012). In our study, CYP1A1 gene and EROD enzyme presented a remarkable sexual difference. CYP1A1 is the terminal component of MFO with EROD activity being CYP1A-dependent (Stagg et al., 2000). Therefore gender could be an important factor affecting PAH accumulation in tissues due to impacts of estrogens on the MFO system. As regards the hemolymph, a probable explanation of CHR concentrations with no obvious variation among treated groups is that CHR in the hemolymph might approximate or achieve the level of saturation. Female and male gonads showed a significant reduction of CHR concentrations after the release of ripe gametes. Our results indicate that lipophilic contaminants that accumulated in gametes could be expelled at the spawning stage, thus resulting in their sharp loss. A similar phenomenon has also been reported in field samplings (Cáceres-Martínez and Figueras, 1998; Piccardo et al., 2001; Ruiz et al., 2011; Viñas et al., 2012), they described that post-spawn bivalves showed a significant reduction in the body burden of contaminants. The reproductive process has been also reported to lessen the biological accumulation of persistent pollutants in various animals. The elimination of contaminants through spawning also occurs in other mollusks (Hummel et al., 1989; Ji et al., 2006; Ruiz et al., 2011), crustaceans (Mcmanus et al., 1983; Bodin et al., 2007), and fish (Loizeau et al., 2001;

57

Bodiguel et al., 2009). Spawning serves as an important mechanism for the elimination of pollutants in the body. Considering the generous transformation of PAH to gametes, we deduce that there may be harmful consequences for the offspring, e.g., the toxicity on embryos. Earlier research has shown that gametogenesis needs a lot of energy, when both maintenance costs and the cost of gamete synthesis are obtained directly from the food supply or from storage organs, like the digestive gland and adductor muscle (Luna-Gonzalez et al., 2000; Frouin et al., 2007). Based on the CHR changes in tissues during the post-spawn period, it is therefore safe to conclude that stored reserves along with the contaminant transported from storage organs to gonads via the hemolymph, after the gonad tissue was depleted. Biotransformation and detoxification of chemicals are dependent on Phase I, Phase II and Phase III reactions. When there is an increase in CYP 450 enzyme activity, it is requisite for organisms to increase Phase II enzyme activity for coping with the production of CYP 450 system and preventing cell damage (Marionnet et al., 1997). Compared to GST-pi mRNA and GST activity, CYP1A1 mRNA and EROD responded more quickly to xenobiotics for female and male scallops in the current study. However, males were more sensitive than females to CHR exposure in gene expressions and enzyme activities, except P-gp mRNA expressions. Stegeman et al. (1982) attributed the gender differences to estrogens that could suppress the MFO system via genetic transcription or estrogen-responsive genes/receptors (Arukwe et al., 1997; Navas and Segner, 2000). This hypothesis was supported by previous observations on Zoarces viviparus, showing that male fish contained higher concentrations of PAH metabolites than females (Tairova et al., 2012). Unfortunately, CHR metabolites were not taken into consideration in the present experiment. Moreover, van Lipzig et al. (2005) proved that several hydroxylated metabolites of CHR exhibited estrogenic activity, which may aggravate sexual differences. With increasing exposure time, there also exist gender differences in the bioaccumulation, which in return can affect the detoxification metabolism in organisms. Additional studies are necessary to elucidate the role of gender during the accumulative process of xenobiotics.

5. Conclusion The results presented here confirm that CHR could be metabolized and accumulated in mature scallop C. farreri, subsequently resulting in changes of metabolic enzyme activities and related gene expression in the digestive gland. The variations of CHR accumulation in the gill, digestive gland, adductor muscle, gonad and hemolymph of male and female scallops C. farreri reflect the pathway of CHR transformation during the reproductive process. Observed CHR concentrations appeared higher in females than in males, and males were more sensitive than females to CHR exposure in gene expressions and enzyme activities. Among the parameters, the mRNA expression of P-gp seems to be a potential indicator for PAH exposure in bivalves. The sexual differences might be linked to hormones. A reduction in bioaccumulation of CHR at the spawning stage suggests that the spawning behavior serves as an important mechanism for the elimination of persistent lipophilic organic pollutants. Additionally, the results highlight the influence of gender and reproductive status on levels and kinetic of pollutants in organisms due to sexual differences in detoxification metabolism. Therefore sexes and reproductive status should be taken into account when assessing pollution profiles in sentinel organisms and applying biological indicators for the long-term biomonitoring.

Acknowledgments This work was supported by the State Oceanic Administration specific public project of China (201405010). We thank the staff at the Laboratory of Physiology for the help with sampling and taking care of the scallops.

58

M. Xiu et al. / Comparative Biochemistry and Physiology, Part C 170 (2015) 50–59

References Albertus, J.A., Laine, R.O., 2001. Enhanced xenobiotic transporter expression in normal teleost hepatocytes: response to environmental and chemotherapeutic toxins. J. Exp. Biol. 204, 217–227. Antunes, P., Amado, J., Vale, C., Odete, G., 2007. Influence of the chemical structure on mobility of PCB congeners in female and male sardine (Sardina pilchardus) from Portuguese coast. Chemosphere 69, 395–402. Arukwe, A., Forlin, L., Goksoyr, A., 1997. Xenobiotic and steroid biotransformation enzymes in Atlantic salmon (Salmo salar) liver treated with an estrogenic compound, 4nonylphenol. Environ. Toxicol. Chem. 16 (12), 2576–2583. Banni, M., Negri, A., Dagnino, A., Jebali, J., Ameur, S., Boussetta, H., 2010. Acute effects of benzo[a]pyrene on digestive gland enzymatic biomarkers and DNA damage on mussel Mytilus galloprovincialis. Ecotoxicol. Environ. Saf. 73, 842–848. Barber, B.J., Blake, N.J., 1991. Reproductive physiology. In: Shumway, S.E., Parsons, J.G. (Eds.), Scallops: Biology, Ecology and Aquaculture. Elsevier Press, Amsterdam, Holland, pp. 377–428. Bard, S.M., Woodin, B.R., Stegeman, J.J., 2002. Expression of P-glycoprotein and cytochrome P450 1A in intertidal fish (Anoplarchus purpurescens) exposed to environmental contaminants. Aquat. Toxicol. 60, 17–32. Barouki, R., Morel, Y., 2001. Repression of cytochrome P450 1A1 gene expression by oxidative stress: mechanisms and biological implications. Biochem. Pharmacol. 61, 511–516. Benedetti, M., Martuccio, G., Fattorini, D., Canapa, A., Barucca, M., Nigro, M., Regoli, F., 2007. Oxidative and modulatory effects of trace metals on metabolism of polycyclic aromatic hydrocarbons in the Antarctic fish Trematomus bernacchiile. Aquat. Toxicol. 85, 167–175. Biswas, Ghosh, 2014. Reference Module in Biomedical Sciences, from Encyclopedia of Toxicology. Third Edition. pp. 959–962 (2014, Current as of 1 September 2014). Bodiguel, X., Loizeau, V., Le Guellec, A.M., Roupsard, F., Philippon, X., Mellon-Duval, C., 2009. Influence of sex, maturity and reproduction on PCB and p, p′-DDE concentrations and repartitions in the European hake (Merluccius merluccius, L.) from the Gulf of Lions (NW Mediterranean). Sci. Total Environ. 408 (2), 304–311. Bodin, N., Caisey, X., Abarnou, A., Loizeau, V., Latrouite, D., Le Guellec, A.M., 2007. Polychlorinated biphenyl contamination of the spider crab (Maja brachydactyla): influence of physiological and ecological processes. Environ. Toxicol. Chem. 26, 454–461. Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein–dye binding. Anal. Biochem. 72, 248–254. Brown, D., Clarke, G., Van Beneden, R., 1997. Halogenated aromatic hydrocarbonbinding proteins identified in several invertebrate marine species. Aquat. Toxicol. 37, 71–78. Cáceres-Martínez, J., Figueras, A., 1998. Long-term survey on wild and cultured mussels (Mytilus galloprovincialis Lmk) reproductive cycles in the Ria de Vigo (NW Spain). Aquaculture 162 (1–2), 141–156. Callard, G.V., Drygas, M., Gelinas, D., 1993. Molecular and cellular physiology of aromatase in the brain and retina. J. Steroid Biochem. Mol. Biol. 44 (4), 541–547. Chu, F.L.E., Soudant, P., Hale, R.C., 2003. Relationship between PCB accumulation and reproductive output in conditioned oysters Crassostrea virginica fed a contaminated algal diet. Aquat. Toxicol. 65 (3), 293–307. Di Bella, G., Licata, P., Bruzzese, A., Naccari, C., Trombetta, D., Lo Turco, V., Naccari, F., 2006. Levels and congener pattern of polychlorinated biphenyl and organochlorine pesticide residues in bluefin tuna (Thunnus thynnus) from the Straits of Messina (Sicily, Italy). Environ. Int. 32, 705–710. Doyen, P., Bigot, A., Vasseur, P., Rodius, F., 2008. Molecular cloning and expression study of pi-class glutathione-S-transferase (pi-GST) and selenium-dependent glutathione peroxidase (Se-GPx) transcripts in the freshwater bivalve Dreissena polymorpha. Comp. Biochem. Physiol. C: Pharmacol. Toxicol. 147 (1), 69–77. EFSA, 2008. Scientific opinion of the panel on contaminants in the food chain on a request from the European Commission on Polycyclic Aromatic Hydrocarbons in Food. EFSA J. 724, 1–114. Elskus, A.A., Richard, R., Stegeman, J.J., 1992. Endogenous-mediated, pre-translational suppression of cytochrome P4501A in PCB-contaminated flounder. Mar. Environ. Res. 34, 97–101. Fertuck, K.C., Kumar, S., Sikka, H.C., Matthews, J.B., Zacharewski, T.R., 2001. Interaction of PAH-related compounds with the alpha and beta isoforms of the estrogen receptor. Toxicol. Lett. 121 (3), 167–177. Förlin, L., Haux, C., 1990. Sex difference in hepatic cytochrome P-450 monooxygenase activities in rainbow trout during annual reproductive cycle. J. Endocrinol. 124, 207–213. Forlin, L., Andersson, T., Koivusaari, U., Hansson, T., 1984. Influence of biological and environmental factors on hepatic steroid and xenobiotic metabolism in fish: interaction with PCB and -naphthoflavone. Mar. Environ. Res. 14, 47–58. Frouin, H., Pellerin, J., Fournier, M., Pelletier, E., Richard, P., Pichaud, N., Garnerot, F., 2007. Physiological effects of polycyclic aromatic hydrocarbons on soft-shell clam Mya arenaria. Aquat. Toxicol. 82 (2), 120–134. Gagnon, M.M., Holloway, D.A., 2000. EROD induction and biliary metabolites excretion following exposure to the water accommodated fraction of crude oil and to chemically dispersed crude oil. Arch. Environ. Contam. Toxicol. 38, 70–77. Gant, T.W., Silverman, J.A., Bisgaard, H.C., Burt, R.K., Marino, P.A., Thorgeirsson, S.S., 1991. Regulation of 2-acetylaminofluorene mediated and 3-methylcholanthrene mediated induction of multidrug resistance and cytochrome-P450 a gene family expression in primary hepatocyte cultures and rat-liver. Mol. Carcinog. 4, 499–509. Garner, L.V., Di Giulio, R.T., 2012. Glutathione transferase pi class 2 (GSTp2) protects against the cardiac deformities caused by exposure to PAHs but not PCB-126 in zebrafish embryos. Comp. Biochem. Physiol. C: Pharmacol. Toxicol. 155 (4), 573–579.

Guillen, M.D., Sopelana, P., Partearroyo, M.A., 1997. Food as a source of polycyclic aromatic carcinogens. Rev. Environ. Health 12, 133–146. Habig, W.H., Pabst, M.J., Jakoby, W.B., 1974. Glutathione S-transferases. The first enzymatic step in mercapturic acid formation. J. Biol. Chem. 249, 7130–7139. Hahn, M.E., 1998. The aryl hydrocarbon receptor: a comparative perspective. Comp. Biochem. Physiol. C: Pharmacol. Toxicol. 121, 23–53. Hoarau, P., Garello, G., Gnassia-Barelli, M., Romeo, M., Girard, J.P., 2002. Purification and partial characterization of seven glutathione S-transferase isoforms from the clam Ruditapes decussatus. Eur. J. Biochem. 269, 4359–4366. Hummel, H., UitOudeGroeneveld, J.P., Nieuwenhuize, J., van Liere, J.M., Bogaards, R.H., De Wolf, L., 1989. Relationship between PCB concentrations and reproduction in mussels Mytilus edulis. Mar. Environ. Res. 28, 489–493. Ji, J., Choi, H.J., Ahn, I.Y., 2006. Evaluation of Manila clam Ruditapes philippinarum as a sentinel species for metal pollution monitoring in estuarine tidal flats of Korea: effects of size, sex, and spawning on baseline accumulation. Mar. Pollut. Bull. 52 (4), 447–453. Kirby, M.F., Smith, A.J., Rooke, J., Neall, P., Scott, A.P., Katsiadaki, I., 2007. Ethoxyresorufin-Odeethylase (EROD) and vitellogenin (VTG) in flounder (Platichthys flesus): system interaction, crosstalk and implications for monitoring. Aquat. Toxicol. 81 (3), 233–244. Lee, K.M., Kruse, H., Wassermann, O., 1996. Seasonal fluctuation of organochlorines in Mytilus edulis L. from the south west Baltic Sea. Chemosphere 32, 1883–1895. Levin, W., Wood, A.W., Chang, R.L., Yagi, H., Mah, H.D., Jerina, D.M., Conney, A.H., 1978. Evidence for bay region activation of chrysene 1,2-dihydrodiol to an ultimate carcinogen. Cancer Res. 38 (6), 1831–1834. Liang, X., Nie, X., Ying, G., An, T., Li, K., 2013. Assessment of toxic effects of triclosan on the swordtail fish (Xiphophorus helleri) by a multi-biomarker approach. Chemosphere 90 (3), 1281–1288. Liu, D., Pan, L., Cai, Y., Li, Z., Miao, J., 2014a. Response of detoxification gene mRNA expression and selection of molecular biomarkers in the clam Ruditapes philippinarum exposed to benzo [a] pyrene. Environ. Pollut. 189, 1–8. Liu, D., Pan, L., Li, Z., Cai, Y.F., Miao, J., 2014b. Metabolites analysis, metabolic enzyme activities and bioaccumulation in the clam Ruditapes philippinarum exposed to benzo[a] pyrene. Ecotoxicol. Environ. Saf. 107, 251–259. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25, 402–408. Livingstone, D.R., 1998. The fate of organic xenobiotics in aquatic ecosystems: quantitative and qualitative differences in biotransformation by invertebrates and fish. Comp. Biochem. Physiol. Part C. 143 (4), 363–381. Loizeau, V., Abarnou, A., Menesguen, A., 2001. A model of PCB bioaccumulation in the sea bass (Dicentrarchus labrax) food web from the Seine Estuary (Eastern English Channel). Mar. Pollut. Bull. 43, 242–255. Lüchmann, K.H., Dafre, A.L., Trevisan, R., Craft, J.A., Meng, X., Mattos, J.J., Zacchi, F.L., Dorrington, T.S., Schroeder, D.C., Bainy, A.C., 2014. A light in the darkness: new biotransformation genes, antioxidant parameters and tissue-specific responses in oysters exposed to phenanthrene. Aquat. Toxicol. 152, 324–334. Luna-Gonzalez, A., Caceres-Martinez, C., Zuniga-Pacheco, C., Lopez-Lopez, S., Ceballos-Vazquez, B.P., 2000. Reproductive cycle of Argopecten ventricosus (Sowerby 1842)(Bivalvia: Pectinidae) in the Rada del Puerto de Pichilingue, BCS, Mexico and its relation to temperature, salinity, and food. J. Shellfish Res. 19 (1), 107–112. Marionnet, D., Taysse, L., Chambras, C., Deschaux, P., 1997. 3-Methylcholanthrene-induced EROD activity and cytochrome P-450 in immune organs of carp (Cyprinus carpio). Comp. Biochem. Physiol. 118, 165–170. McManus, G.B., Wyman, K.T., Peterson, W.T., Wurster, C.F., 1983. Factors affecting the elimination of PCBs in the marine copepod Acartia tonsa. Estuar. Coast. Shelf Sci. 17, 421–430. Meador, J.P., Stein, J.E., Reichert, W.L., Varanasi, U., 1995. Bioaccumulation of polycyclic aromatic hydrocarbons by marine organisms. Rev. Environ. Contam. Toxicol. 143, 79–165. Medeiros, I.D., Siebert, M.N., Toledo-Silva, G., Rodrigues, T.B., Marques, M.R.F., Bainy, A.C.D., 2008. Induced gene expression in oyster Crassostrea gigas exposed to sewage. Environ. Toxicol. Pharmacol. 26, 362–365. Monosson, E., Ashley, J.T.F., McElroy, A.E., Woltering, D., Elskus, A.A., 2003. PCB congener distributions in muscle, liver and gonad of Fundulus heteroclitus from the lower Hudson River Estuary and Newark Bay. Chemosphere 52 (4), 777–787. Morel, Y., Barouki, R., 1999. Repression of gene expression by oxidative stress. Biochem. J. 342, 481–496. Muir, D., Savinova, T., Savinov, V., Alexeeva, L., Potelov, V., Svetochev, V., 2003. Bioaccumulation of PCBs and chlorinated pesticides in seals, fishes and invertebrates from the White Sea, Russia. Sci. Total Environ. 306, 111–131. Muncaster, B.W., Hebert, P.D.N., Lazar, R., 1990. Biological and physical factors affecting the body burden of organic contaminants in freshwater mussels. Arch. Environ. Contam. Toxicol. 19, 25–34. Nahrgang, J., Camus, L., Gonzalez, P., Goksøyr, A., Christiansen, J.S., Hop, H., 2009. PAH biomarker responses in polar cod (Boreogadus saida) exposed to benzo (a) pyrene. Aquat. Toxicol. 94 (4), 309–319. Nahrgang, J., Brooks, S.J., Evenset, A., Camus, L., Jonsson, M., Smith, T.J., Renaud, P.E., 2013. Seasonal variation in biomarkers in blue mussel (Mytilus edulis), Icelandic scallop (Chlamys islandica) and Atlantic cod (Gadus morhua)—implications for environmental monitoring in the Barents Sea. Aquat. Toxicol. 127, 21–35. Navas, J.M., Segner, H., 2000. Modulation of trout 7-ethoxyresurufin-o-deethylase (EROD) activity by estradiol and octylphenol. Mar. Environ. Res. 50, 157–162. Negro, C.L., Senkman, L.E., Vierling, J., Repetti, M.R., García, S.R., Collins, P., 2012. Bioaccumulation in freshwater crabs. Endosulfan accumulation in different tissues of Zilchiopsis collastinensis P. (Decapoda: Trichodactylidae). Bull. Environ. Contam. Toxicol. 89 (5), 1000–1003. Oliva, M., González de Canales, M.L., Gravato, C., Guilhermino, L., Perales, J.A., 2010. Biochemical effects and polycyclic aromatic hydrocarbons (PAHs) in senegal sole

M. Xiu et al. / Comparative Biochemistry and Physiology, Part C 170 (2015) 50–59 (Solea senegalensis) from a Huelva estuary (SW Spain). Ecotoxicol. Environ. Saf. 73 (8), 1842–1851. Paterson, G., Drouillard, K.G., Hagen, H.J., Haffner, G.D., 2003. Persistent organic pollutants in forage fish and their relation to age, size, and diet. Global Threats to Large Lakes: Managing in an Environment of Instability and Unpredictabilityp. 122. Pathiratne, A., Hemachandra, C.K., 2010. Modulation of ethoxyresorufin O-deethylase and glutathione S-transferase activities in Nile tilapia (Oreochromis niloticus) by polycyclic aromatic hydrocarbons containing two to four rings: implications in biomonitoring aquatic pollution. Ecotoxicology 19, 1012–1018. Perugini, M., Visciano, P., Giammarino, A., Manera, M., Di Nardo, W., Amorena, M., 2007. Polycyclic aromatic hydrocarbons in marine organisms from the Adriatic Sea, Italy. Chemosphere 66 (10), 1904–1910. Phillips, D.H., 1999. Polycyclic aromatic hydrocarbons in the diet. Mutat. Res. 443, 139–147. Piccardo, M.T., Coradeghini, R., Valerio, F., 2001. Polycyclic aromatic hydrocarbon pollution in native and caged mussels. Mar. Pollut. Bull. 42 (10), 951–956. Pohl, R.J., Fouts, J.R., 1980. A rapid method for assaying the metabolism of 7-ethoxyresorufin by microsomal subcellular fractions. Anal. Biochem. 107, 150–155. Ren, X., Pan, L., Wang, L., 2014. Metabolic enzyme activities, metabolism-related genes expression and bioaccumulation in juvenile white shrimp Litopenaeus vannamei exposed to benzo[a]pyrene. Ecotoxicol. Environ. Saf. 104, 79–86. Ruiz, Y., Suarez, P., Alonso, A., Longo, E., Villaverde, A., San Juan, F., 2011. Environmental quality of mussel farms in the Vigo estuary: pollution by PAHs, origin and effects on reproduction. Environ. Pollut. 159 (1), 250–265. Sarkar, A., Ray, D., Shrivastave, A.N., Sarker, S., 2006. Molecular biomarkers: their significance and application in marine pollution monitoring. Ecotoxicology 15, 333–340. Solé, M., Porte, C., Barceló, D., 2000. Vitellogenin induction and other biochemical responses in carp (Cyprinus carpio) after experimental injection with 17ß-ethynyloestradiol. Arch. Environ. Contam. Toxicol. 38, 494–500. Stagg, R.M., Rusin, J., McPhail, M.E., McIntosh, A.D., Moffat, C.F., Craft, J.A., 2000. Effects of polycyclic aromatic hydrocarbons on expression of CYP1A in salmon (Salmo salar) following experimental exposure and after the Braer oil spill. Environ. Toxicol. Chem. 19, 2797–2805. Stegeman, J.J., Hahn, M.E., 1994. Biochemistry and molecular biology of monoxygenases: current perspectives on forms, functions and regulation of cytochrome P450 in aquatic species. In: Malins, D.C., Ostrander, G.K. (Eds.), Aquat. Toxicol: Molecular, Biochemical and Cellular Perspectives. Lewis Publishers, Boca Raton, FL, pp. 87–204. Stegeman, J.J., Pajor, A.M., Thomas, P., 1982. Influence of estradiol and testosterone on cytochrome P-450 and monooxygenase activity in immature brook trout, Salvelinus fontinalis. Biochem. Pharmacol. 31, 3979–3989. Stein, J.E., Collier, T.K., Reicert, W.L., Casillas, E., Hom, T., Varanasi, U., 1992. Tairova, Z.M., Strand, J., Chevalier, J., Andersen, O., 2012. PAH biomarkers in common eelpout (Zoarces viviparus) from Danish waters. Mar. Environ. Res. 75, 45–53.

59

Tateishi, T., Nakura, H., Asoh, M., Watanabe, M., Tanaka, M., Kumai, T., Kobayashi, S., 1999. Multiple cytochrome P-450 subfamilies are co-induced with P-glycoprotein by both phenothiazine and 2-acetylaminofluorene in rats. Cancer Lett. 138, 73–79. Tian, S., Pan, L., Sun, X., 2013. An investigation of endocrine disrupting effects and toxic mechanisms modulated by benzo[a]pyrene in female scallop Chlamys farreri. Aquat. Toxicol. 144, 162–171. Tran, D.Q., Ide, C.F., McLachlan, J.A., Arnold, S.F., 1996. The anti-estrogenic activity of selected polynuclear aromatic hydrocarbons in yeast expressing human estrogen receptor. Biochem. Biophys. Res. Commun. 229 (1), 101–108. US Environmental Protection Agency (EPA), 1996. Method 3540C, Rev. 3, Soxhlet Extraction (1996); Compendium Method TO-13: the determination of benzo[a]pyrene (B[a]P) and other polynuclear aromatic hydrocarbons (PAHs) in ambient air using gas chromatographic (GC) and high performance liquid chromatographic (HPLC) analysis. Compendium of Methods for the Determination of Toxic Organic Compounds in Ambient Air. Centre for Environmental Research Information. US Environmental Protection Agency, OH, USA (EPA/600/4-89-018, Available from: http://www.epa.gov/epahome/index). van Lipzig, M.M., Vermeulen, N.P., Gusinu, R., Legler, J., Frank, H., Seidel, A., Meerman, J.H., 2005. Formation of estrogenic metabolites of benzo [a] pyrene and chrysene by cytochrome P450 activity and their combined and supra-maximal estrogenic activity. Environ. Toxicol. Pharmacol. 19 (1), 41–55. Viñas, L., Franco, A., Blanco, X., Bargiela, J., Soriano, J.A., Perez-Fernandez, B., Gonzalez, J.J., 2012. Temporal and spatial changes of PAH concentrations in Mytilus galloprovincialis from Ria de Vigo (NW Spain). Environ. Sci. Pollut. Res. 19 (2), 529–539. Vuorinen, P.J., Keinänen, M., Vuontisjärvi, H., Baršienė, J., Broeg, K., Förlin, L., Schiedek, D., 2006. Use of biliary PAH metabolites as a biomarker of pollution in fish from the Baltic Sea. Mar. Pollut. Bull. 53 (8), 479–487. Wei, S., Lau, R.K.F., Fung, C.N., Zheng, G.J., Lam, J.C.W., Connell, D.W., 2006. Trace organic contamination in biota collected from the Pearl River Estuary, China: a preliminary risk assessment. Mar. Pollut. Bull. 52 (16), 82–94. Willett, K.L., Wassenberg, D., Lienesch, L., Reichert, W., Di Giulio, R.T., 2001. In vivo and in vitro inhibition of CYP1A-dependent activity in Fundulus heteroclitus by the polynuclear aromatic hydrocarbon fluoranthene. Toxicol. Appl. Pharmacol. 177, 264–271. Wood, A.W., Van Der Kraak, G.J., 2001. Apoptosis and ovarian function: novel perspectives from the teleosts. Biol. Reprod. 64 (1), 264–271. Xiu, M., Pan, L., Jin, Q., 2014. Bioaccumulation and oxidative damage in juvenile scallop Chlamys farreri exposed to benzo [a] pyrene, benzo [b] fluoranthene and chrysene. Ecotoxicol. Environ. Saf. 107, 103–110. Xu, C.Q., Pan, L.Q., Liu, N., Wang, L., Miao, J.J., 2010. Molecular cloning, characterization, tissue distribution and the response of glutathione S-transferase gene from the Manila clam Ruditapes philippinarum to Benzo[a]pyrene exposure. Comp. Biochem. Physiol. C 152, 160–166. Yang, X., Sun, C., 1981. A study of the artificial rearing of (Chlamys farreri) spats (in Chinese). Trans. Oceanol. Limnol. 1, 64–69.