- Email: [email protected]
Generation of gene-corrected iPSC line, KIOMi002-A, from Parkinson's disease patient iPSC with LRRK2 G2019S mutation using BAC-based homologous recombination
Stem Cell Research 41 (2019) 101649
Contents lists available at ScienceDirect
Stem Cell Research journal homepage: www.elsevier.com/locate/scr
Generation of gene-corrected iPSC line, KIOMi002-A, from Parkinson's disease patient iPSC with LRRK2 G2019S mutation using BAC-based homologous recombination Lee Seo-Youngb, Chung Sun-Kua, a b
T
⁎
Division of Clinical Medicine, Korea Institute of Oriental Medicine, 1672 Yuseong-daero, Yuseong-gu, Daejeon 34054, South Korea Division of Herbal Medicine Research, Korea Institute of Oriental Medicine, 1672 Yuseong-daero, Yuseong-gu, Daejeon 34054, South Korea
A B S T R A C T
Mutations in leucine-rich repeat kinase 2 (LRRK2) gene (LRRK2 G2019S) is a representative autosomal dominant mutation that can cause Parkinson's disease (PD). A bacterial artificial chromosome-based homologous recombination (BAC-based HR) system was utilized for gene therapy of LRRK2 G2019S-mutant induced pluripotent stem cells (iPSCs) produced by reprogramming episomal vectors. The gene-corrected iPSCs retained typical pluripotency required for their spontaneous differentiation into differentiated cells. The iPSCs had a normal karyotype and were confirmed to have no off-target sites by melting curve analysis.
Resource Table
Unique stem cell line identifier Alternative name(s) of stem cell line Institution Contact information of distributor Type of cell line Origin Additional origin info
Cell Source Clonality Method of reprogramming
Genetic Modification Type of Modification Associated disease Gene/locus Method of modification Name of transgene or resistance Inducible/constitutive system
⁎
KIOMi002-A SK-C-LRRK2-iPSC Korea Institute of Oriental Medicine, Daejeon, South Korea Sun-Ku Chung, [email protected] iPSC Human Age: 34 Sex: Male Ethnicity if known: Unknown Lymphoblastoid cell line Clonal Episomal plasmids - pCXLE-hOCT3/4-shp53 (OCT3/4, shp53) - pCXLE-hUL (L-MYC, LIN28) - pCXLE-hSK (SOX2, KLF4) YES Gene Correction Parkinson's disease LRRK2/chromosome 12q12 Bacterial Artificial Chromosome (BAC) DNA Neomycin/puromycin N/A
Date archived/stock da- Sep 16th 2018 te Cell line repository/bank Deposited in the Korea Institute of Oriental Medicine http://kiom.re.kr Ethical approval This study was approved from Institution Review Board at Korea Institute of Oriental Medicine. IRB approval number: I-1409/008–001.
1. Resource utility The BAC-based HR system, representing a non-programmable nuclease mode, was used to treat LRRK2 G2019S at a genetic level. These cells as an isogenic line could be utilized for drug screening as well as mechanistic studies. 2. Resource details Generation of LRRK2 gene-corrected line has provided a useful resource for validation of the cellular phenotypes such as the decreases in the length and branching of neurites of dopaminergic neuron, as well as a defect in the nuclear-architecture of the neural stem cells due to the mutation (Liu et al., 2012; Qing et al., 2017). Likewise, to treat LRRK2 gene mutation, BAC-based HR system has been applied to iPSCs with LRRK2 G2019S mutation (Son et al., 2017). Because the long homology arm of BAC DNA determines gene targeting efficiency (Lee et al., 2019), the BAC DNA used as the gene replacement tool was composed of about 190 kb that completely covered the entire LRRK2 gene region (Fig. 1A). To select the neomycin resistant clones, the target BAC DNA was
Corresponding authors. E-mail address: [email protected] (S.-K. Chung).
https://doi.org/10.1016/j.scr.2019.101649 Received 8 October 2019; Received in revised form 30 October 2019; Accepted 5 November 2019 Available online 06 November 2019 1873-5061/ © 2019 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Stem Cell Research 41 (2019) 101649
S.-Y. Lee and S.-K. Chung
Fig. 1. Characterization of KIOMi002-A line.
(Fig. 1A). When the mutant allele having no BceAI endonuclease site was replaced with normal BAC DNA in which the endonuclease site is present, both alleles were recognized by the BceAI enzyme. One of the 11 clones, the PCR amplicon, was completely digested by the BceAI
modified by inserting a selectable marker into intron 41 of the LRRK2 gene through recombination (Fig. 1A). A total of 11 clones were analyzed by restriction fragment length polymorphism (RFLP) assay, having PCR amplicons amplified by a pair of P4 and P5 primers 2
Stem Cell Research 41 (2019) 101649
S.-Y. Lee and S.-K. Chung
Table 1 Characterization and validation. Classification
Test
Result
Data
Morphology Phenotype
Photography Qualitative analysis Immunocytochemistry
Fig. 1 panel D Fig. 1 panel D
Neural stem cell differentiation (Immunocytochemistry) HIV 1 + 2 Hepatitis B, Hepatitis C Blood group genotyping
Normal Positive for pluripotency markers: OCT4, SSEA4, Alkaline phosphatase Positive for pluripotency markers: OCT4, NANOG, DNMT3B 46XY, Resolution 550 Bands N/A 15 locus tested, 100% match heterozygous, type of mutation/homozygous, type of correction Not performed Mycoplasma testing by RT-PCR/Negative Positive for ectodermal (TUBULIN β-III), mesodermal (αSMA), endodermal (SOX17) markers Positive for ectodermal (SOX1), mesodermal (T), endodermal (GATA4) markers Positive for neural stem cell markers (NESTIN, PAX6, SOX1). N/A N/A
HLA tissue typing
N/A
N/A
Quantitative analysis RT-qPCR Genotype Identity Mutation analysis (IF APPLICABLE)
Microbiology and virology Differentiation potential
Donor screening (OPTIONAL) Genotype additional info (OPTIONAL)
Karyotype (G-banding) and resolution Microsatellite PCR (mPCR) OR STR analysis Sequencing Southern Blot OR WGS Mycoplasma Plated embryoid body culture (Immunocytochemistry) Plated embryoid body culture (RT-qPCR)
Fig. 1 panel E Fig. 1 panel F N/A Available with the authors Fig. 1 panel C N/A Supplementary Figure 2 Fig. 1 panel D Fig. 1 panel E Fig. 1 panel D N/A N/A
under the condition 250 V and 200 µF with a Gene Pulser Xcell Electroporation System (Bio-Rad).
endonuclease, demonstrating that the BAC DNA was precisely targeted to the mutant allele (Supplementary Fig. S1A). The selection marker of the clone was removed by FLP expression, and identified using the P1 + P2 + P3 primer mixtures (Fig. 1B). To confirm on-target recombination, we investigated changes in the balanced allelic compositions of the mutation site and five heterozygous single-nucleotidepolymorphism (SNP) sites surrounding the mutation site. Both the mutation site and one downstream SNP (rs10459265) site clearly exhibited changes from heterozygous to homozygous states due to the replacement with BAC DNA. These changes were observed without increasing the dose of the BAC DNA allele. It means that none of the SNP sites showed changes in allelic composition, representing off-target integration (Supplementary Fig. S1B). We confirmed the replacement of this gene by sequencing analysis (Fig. 1C). The gene-corrected iPSCs (cLRRK2-iPSCs), representing a typical morphology, showed alkaline phosphatase activity as well as stained by representative pluripotency specific markers, such as OCT4 or SSEA4 (Fig. 1D). In addition, the additional pluripotency marker genes, including OCT4, NANOG, and DNMT3B, were positively expressed in these cells (Fig. 1E). We differentiated the iPSCs toward embryoid bodies and confirmed the differentiation ability of gene-corrected iPSCs by staining and subsequent identification of the expression of three representative germ layer markers, including TUBULIN β-III or SOX1 (ectoderm), SOX17 or GATA4 (endoderm), and α-SMA or T (mesoderm) (Fig. 1D and E). In addition, neural stem cell differentiation associated with the target disease was confirmed with NESTIN, PAX6, and SOX1 markers (Fig. 1D). The gene corrected iPSCs showed a normal karyotype (Fig. 1F). Short tandem repeat (STR) analysis of 15 loci revealed a 100% match of mycoplasma-free cLRRK1-iPSCs and parental (Supplementary Fig. S2).
3.2. Construction of BAC-based targeting vectors BAC clone (RP11-965H7) including the human LRRK2 gene was purchased from Empire Genomics. To select the BAC DNA-targeted hiPSC clones, the 4.3 kb selection cassette (FRT-flanked CAG promoterneomycin/puromycin resistance genes) was inserted into intron 41 of the LRRK2 gene, modifying with recombineering as previously described (Lee et al., 2018). 3.3. Screening and genotyping To perform the RFLP assay, genomic DNA from candidate clones was extracted using an AllPrep DNA/RNA Mini Kit (QIAGEN) according to the manufacturer's instructions. PCR was performed for 37 cycles at 95 °C for 1 min, 60 °C for 1 min, and 72 °C for 1 min in a C1000 Touch Thermal cycler (Bio-Rad). PCR amplicons were amplified using the primer pairs listed inTable 2 and using SolgTM h-Taq DNA polymerase (SolGent, Daejeon, Korea). 3.4. Melting curve analysis Melting Curve Analysis was performed as previously described (Lee et al., 2018). Small DNA fragment spanning each of subjected SNP sites (rs11175784, rs7979341, rs17443815, rs7302841, rs34637584 (mutation site) and rs10459265) was PCR amplified using the genomic DNAs isolated from cells before and after the targeted recombination, and the BAC DNA as templates. Primers and oligonucleotide probes are listed in Table 2.
3. Materials and methods 3.5. Alkaline phosphatase staining 3.1. Cell culture and transfection The cLRRK2-iPSCs were stained using the Leukocyte Alkaline Phosphatase Kit (Sigma-Aldrich) according to the manufacturer's instructions.
Human iPSCs were cultured in mTeSR1 medium (STEMCELL Technologies) on an STO feeder layer (ATCC) or on Matrigel (Corning)coated plates, replacing with a new culture medium daily at 37 °C in 5% CO2 incubator. Cells were subcultured or split in a 1:4 ratio every three days, and gently dissociating with ReLeSR™ reagent (STEMCELL Technologies). For BAC DNA-mediated gene targeting, The BAC DNA was introduced into hiPSCs as previously described (Lee et al., 2018)
3.6. Immunocytochemistry The immunocytochemistry was performed as previously described (Lee et al., 2018). The antibodies are listed in Table 2. 3
Stem Cell Research 41 (2019) 101649
S.-Y. Lee and S.-K. Chung
Table 2 Reagents details. Antibodies used for immunocytochemistry/flow-cytometry
Pluripotency Markers
Differentiation Markers
Secondary antibodies
Antibody Rabbit anti-OCT3/4
Dilution 1:300
Company Cat # and RRID Santa-Cruz Biotechnology, Cat# sc-9081, RRID: AB_2,167,703 Millipore, Cat# MAB4304, RRID: AB_177,629 BioLegend, Cat# 801,201, RRID: AB_2,313,773 R&D Systems, Cat# AF1924, RRID: AB_355,060 Sigma-Aldrich, Cat# A5228, RRID: AB_262,054 Millipore, Cat# ABD69, PRID: AB_2,744,681 Abcam, Cat# ab5790. PRID: AB_305,110 Millipore, Cat# AB15766, PRID: AB_870,981 Thermo Fisher Scientific, Cat# A-11,001, RRID: AB_2,534,069 Thermo Fisher Scientific, Cat# A241467, PRID: AB_10,055,703 Thermo Fisher Scientific, Cat# A21044, PRID: AB_2,535,713 Thermo Fisher Scientific, Cat# A21442, PRID: AB_2,535,860
Mouse anti-SSEA4
1:500
Mouse anti-TUBULIN β3 Goat anti-SOX17
1:500
Mouse anti-ACTIN, alpha-Smooth Muscle Rabbit anti-NESTIN
1:500
Rabbit anti-PAX6
1:500
Rabbit anti-SOX1
1:500
Anti-mouse-Alexa488
1:2000
Anti-goat-Alexa488
1:2000
Anti-mouse-Alexa594
1:2000
Anti-rabbit-Alexa594
1:2000
Target OCT4 NANOG DNMT3B SOX1 T GATA4 GAPDH P1/P2/P3 (P1/P2: 260 bp P1/P3: 330 bp) P4/P5 (320 bp) G2019S locus rs11175784
Forward/Reverse primer (5′−3′) GGGAGGAGCTAGGGAAAGAAAA/ATTGAACTTCACCTTCCCTCCA TTAATAACCTTGGCTGCCGTCT/AATAAGCAAAGCCTCCCAATCC TCTCACGGTTCCTGGAGTGTAA/GTAGGTTGCCCCAGAAGTATCG AAAAGTCAAAACGAGGCGAGAG/TGCTTGGACCTGCCTTACTACA CCAGATCATGCTGAACTCCTTG/GGGTTCCTCCATCATCTCTTTG GATCCAAACCAGAAAACGGAAG/CAGACATCGCACTGACTGAGAA CCTCAACGACCACTTTGTCAAG/TCTTCCTCTTGTGCTCTTGCTG GTCTCATAATTCTATCTTCAGG/CTCCTCTTCAGACCTGAAGTTCC/ GCCTCACAAGTGCCAACAAT
1:200
1:500
Primers Pluripotency Markers (qPCR)
Differentiation markers (qPCR)
House-Keeping Genes (qPCR) Genotyping
Targeted mutation sequencing Melting curve analysis (Forward/ Reverse primer/Probe in cases (5′−3′))
rs7979341 rs17443815 rs7302841 rs34637584
TTTCACACTGTATCCCAATGCTG/ATTCAGTTTTTGCCCTGAAAAAT TTCTGGCAGATACCTCCACT TCTGAGGACAAGGAAAATCAAAA/GCTGTTTTGGTTACTGTAGCTTTG/ CCACGCTACCTGACTTCAAACTATACTACAAAGCT AGGAAAATTCCTTCCACAAAC/TCTTGAAACAGGAAACCCATTT/ TATTCTCTATTAATTATCTAGCACTGTGCGCTGC GCTCTCTGAAAATTGACTTTGCT/ATGATATCTTCTTTGGCTTTCAA/ TTTGGCTTTCAAAACTATTTTGATCTGTAGCACA ACTCTTGATGTCCCCTCTGC/GCTGTGAAATGAGAGAGGAAGAA/ AGGAATGTAAGGTGACTCTCAGGTGTAACAGG AGACCTGAAACCCCACAATG/GGTGTGCCCTCTGATGTTTT/ AATGCCGTAGTCAGCAATCTTTGCAATGATGG
rs10459265
3.7. Embryoid body (EB) formation and in vitro differentiation
3.9. Karyotyping
hiPSCs were dissociated with Accutase (Thermo Fisher Scientific), and 1 × 106 cells were seeded into an AggreWell™400 plate (STEMCELL Technologies) in Aggrewell™ EB Formation Medium (STEMCELL Technologies) for 10 days according to manufaturer's instructions. The EBs were attached on 0.1% gelatin-coated tissue culture plates and differentiated in DMEM containing 10% fetal bovine serum for 12 days spontaneously.
After fifteen passages, G-banding analysis of 20 metaphase spreads was performed at GenDix.
3.10. Mycoplasma test Mycoplasma test was performed using PCR method (Lee et al., 2018)
3.8. Quantitative-PCR 3.11. STR analysis The WT-iPSCs were previously reported and served as a positive control for analyzing pluripotent gene expression (Lee et al., 2019). Cellular RNA was prepared using the RNeasy Mini Kit (QIAGEN) according to the manufacturer's instructions. The quantitative-PCR was performed as previously described (Lee et al., 2019). The sequences of primers are listed in Table 2.
STR were determined at the Korea Genome Information Institute. PCR products, amplifying by AmpFLSTR™ Identifiler™ Kit (Applied Biosystems®), were analysed with Genetic Analyzer (Applied Biosystems®).
4
Stem Cell Research 41 (2019) 101649
S.-Y. Lee and S.-K. Chung
Declaration of Competing Interest
Zhang., W., Ren., B., Wagner., U., Kim., A., Li., Y., Goebl., A., Kim., J., Soligalla., R.D., dubova., I., Thompson., J., Yates III., J., Esteban., C.R., Sancho-Martinez., I., Belmonte., J.C.I., 2012. Progressive degeneration of human neural stem cells caused by pathogenic LRRK2. Nature 491, 603–607. Qing., X., Walter., J., Jarazo., J., Arias-Fuenzalida., J., Hillje., A.L., Schwamborn., J., 2017. CRISPR/Cas9 and piggyBac-mediated footprint-free LRRK2-G2019S knock-in reveals neuronal complexity phenotypes and α-Synuclein modulation in dopaminergic neurons. Stem. Cell Res. 24, 44–50. Son., M.Y., Sim., H., Son., Y.S., Jung., K.B., Lee., M.O., Oh., J.H., Chung., S.K., Jung., C.R., Kim., J., 2017. Distinctive genomic signature of neural and intestinal organoids from familial Parkinson's disease patient-derived induced pluripotent stem cells. Neuropathol. Appl. Neurobiol. 43, 584–603. Lee., S.Y., Park., J.H., Jeong., S., Kim., B.Y., Kang., Y.K., Xu., Y., Chung., S.K., 2019. K120R mutation inactivates p53 by creating an aberrant splice site leading to nonsense-mediated mRNA decay. Oncogene 38, 1597–1610. Lee., S.Y., Jeong., S., Kim., J., Chung., S.K., 2018. Generation of gene-corrected iPSC line from Parkinson's disease patient iPSC line with alpha-SNCA A53T mutation. Stem. Cell Res. 30, 145–149.
The authors declare no conflict of interest. Acknowledgment This research was supported in part by the National Research Foundation of Korea Grants (NRF-2013M3A9B4076487) and Korea Institute of Oriental Medicine Grants (KSN1621131). Supplementary materials Supplementary material associated with this article can be found, in the online version, at doi:10.1016/j.scr.2019.101649. References Liu., G.H., Qu., J., Suzuki., K., Nivet., E., Li., M., Montserrat., N., Yi., F., Xu., X., Ruiz., S.,
5
Contents lists available at ScienceDirect
Stem Cell Research journal homepage: www.elsevier.com/locate/scr
Generation of gene-corrected iPSC line, KIOMi002-A, from Parkinson's disease patient iPSC with LRRK2 G2019S mutation using BAC-based homologous recombination Lee Seo-Youngb, Chung Sun-Kua, a b
T
⁎
Division of Clinical Medicine, Korea Institute of Oriental Medicine, 1672 Yuseong-daero, Yuseong-gu, Daejeon 34054, South Korea Division of Herbal Medicine Research, Korea Institute of Oriental Medicine, 1672 Yuseong-daero, Yuseong-gu, Daejeon 34054, South Korea
A B S T R A C T
Mutations in leucine-rich repeat kinase 2 (LRRK2) gene (LRRK2 G2019S) is a representative autosomal dominant mutation that can cause Parkinson's disease (PD). A bacterial artificial chromosome-based homologous recombination (BAC-based HR) system was utilized for gene therapy of LRRK2 G2019S-mutant induced pluripotent stem cells (iPSCs) produced by reprogramming episomal vectors. The gene-corrected iPSCs retained typical pluripotency required for their spontaneous differentiation into differentiated cells. The iPSCs had a normal karyotype and were confirmed to have no off-target sites by melting curve analysis.
Resource Table
Unique stem cell line identifier Alternative name(s) of stem cell line Institution Contact information of distributor Type of cell line Origin Additional origin info
Cell Source Clonality Method of reprogramming
Genetic Modification Type of Modification Associated disease Gene/locus Method of modification Name of transgene or resistance Inducible/constitutive system
⁎
KIOMi002-A SK-C-LRRK2-iPSC Korea Institute of Oriental Medicine, Daejeon, South Korea Sun-Ku Chung, [email protected] iPSC Human Age: 34 Sex: Male Ethnicity if known: Unknown Lymphoblastoid cell line Clonal Episomal plasmids - pCXLE-hOCT3/4-shp53 (OCT3/4, shp53) - pCXLE-hUL (L-MYC, LIN28) - pCXLE-hSK (SOX2, KLF4) YES Gene Correction Parkinson's disease LRRK2/chromosome 12q12 Bacterial Artificial Chromosome (BAC) DNA Neomycin/puromycin N/A
Date archived/stock da- Sep 16th 2018 te Cell line repository/bank Deposited in the Korea Institute of Oriental Medicine http://kiom.re.kr Ethical approval This study was approved from Institution Review Board at Korea Institute of Oriental Medicine. IRB approval number: I-1409/008–001.
1. Resource utility The BAC-based HR system, representing a non-programmable nuclease mode, was used to treat LRRK2 G2019S at a genetic level. These cells as an isogenic line could be utilized for drug screening as well as mechanistic studies. 2. Resource details Generation of LRRK2 gene-corrected line has provided a useful resource for validation of the cellular phenotypes such as the decreases in the length and branching of neurites of dopaminergic neuron, as well as a defect in the nuclear-architecture of the neural stem cells due to the mutation (Liu et al., 2012; Qing et al., 2017). Likewise, to treat LRRK2 gene mutation, BAC-based HR system has been applied to iPSCs with LRRK2 G2019S mutation (Son et al., 2017). Because the long homology arm of BAC DNA determines gene targeting efficiency (Lee et al., 2019), the BAC DNA used as the gene replacement tool was composed of about 190 kb that completely covered the entire LRRK2 gene region (Fig. 1A). To select the neomycin resistant clones, the target BAC DNA was
Corresponding authors. E-mail address: [email protected] (S.-K. Chung).
https://doi.org/10.1016/j.scr.2019.101649 Received 8 October 2019; Received in revised form 30 October 2019; Accepted 5 November 2019 Available online 06 November 2019 1873-5061/ © 2019 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Stem Cell Research 41 (2019) 101649
S.-Y. Lee and S.-K. Chung
Fig. 1. Characterization of KIOMi002-A line.
(Fig. 1A). When the mutant allele having no BceAI endonuclease site was replaced with normal BAC DNA in which the endonuclease site is present, both alleles were recognized by the BceAI enzyme. One of the 11 clones, the PCR amplicon, was completely digested by the BceAI
modified by inserting a selectable marker into intron 41 of the LRRK2 gene through recombination (Fig. 1A). A total of 11 clones were analyzed by restriction fragment length polymorphism (RFLP) assay, having PCR amplicons amplified by a pair of P4 and P5 primers 2
Stem Cell Research 41 (2019) 101649
S.-Y. Lee and S.-K. Chung
Table 1 Characterization and validation. Classification
Test
Result
Data
Morphology Phenotype
Photography Qualitative analysis Immunocytochemistry
Fig. 1 panel D Fig. 1 panel D
Neural stem cell differentiation (Immunocytochemistry) HIV 1 + 2 Hepatitis B, Hepatitis C Blood group genotyping
Normal Positive for pluripotency markers: OCT4, SSEA4, Alkaline phosphatase Positive for pluripotency markers: OCT4, NANOG, DNMT3B 46XY, Resolution 550 Bands N/A 15 locus tested, 100% match heterozygous, type of mutation/homozygous, type of correction Not performed Mycoplasma testing by RT-PCR/Negative Positive for ectodermal (TUBULIN β-III), mesodermal (αSMA), endodermal (SOX17) markers Positive for ectodermal (SOX1), mesodermal (T), endodermal (GATA4) markers Positive for neural stem cell markers (NESTIN, PAX6, SOX1). N/A N/A
HLA tissue typing
N/A
N/A
Quantitative analysis RT-qPCR Genotype Identity Mutation analysis (IF APPLICABLE)
Microbiology and virology Differentiation potential
Donor screening (OPTIONAL) Genotype additional info (OPTIONAL)
Karyotype (G-banding) and resolution Microsatellite PCR (mPCR) OR STR analysis Sequencing Southern Blot OR WGS Mycoplasma Plated embryoid body culture (Immunocytochemistry) Plated embryoid body culture (RT-qPCR)
Fig. 1 panel E Fig. 1 panel F N/A Available with the authors Fig. 1 panel C N/A Supplementary Figure 2 Fig. 1 panel D Fig. 1 panel E Fig. 1 panel D N/A N/A
under the condition 250 V and 200 µF with a Gene Pulser Xcell Electroporation System (Bio-Rad).
endonuclease, demonstrating that the BAC DNA was precisely targeted to the mutant allele (Supplementary Fig. S1A). The selection marker of the clone was removed by FLP expression, and identified using the P1 + P2 + P3 primer mixtures (Fig. 1B). To confirm on-target recombination, we investigated changes in the balanced allelic compositions of the mutation site and five heterozygous single-nucleotidepolymorphism (SNP) sites surrounding the mutation site. Both the mutation site and one downstream SNP (rs10459265) site clearly exhibited changes from heterozygous to homozygous states due to the replacement with BAC DNA. These changes were observed without increasing the dose of the BAC DNA allele. It means that none of the SNP sites showed changes in allelic composition, representing off-target integration (Supplementary Fig. S1B). We confirmed the replacement of this gene by sequencing analysis (Fig. 1C). The gene-corrected iPSCs (cLRRK2-iPSCs), representing a typical morphology, showed alkaline phosphatase activity as well as stained by representative pluripotency specific markers, such as OCT4 or SSEA4 (Fig. 1D). In addition, the additional pluripotency marker genes, including OCT4, NANOG, and DNMT3B, were positively expressed in these cells (Fig. 1E). We differentiated the iPSCs toward embryoid bodies and confirmed the differentiation ability of gene-corrected iPSCs by staining and subsequent identification of the expression of three representative germ layer markers, including TUBULIN β-III or SOX1 (ectoderm), SOX17 or GATA4 (endoderm), and α-SMA or T (mesoderm) (Fig. 1D and E). In addition, neural stem cell differentiation associated with the target disease was confirmed with NESTIN, PAX6, and SOX1 markers (Fig. 1D). The gene corrected iPSCs showed a normal karyotype (Fig. 1F). Short tandem repeat (STR) analysis of 15 loci revealed a 100% match of mycoplasma-free cLRRK1-iPSCs and parental (Supplementary Fig. S2).
3.2. Construction of BAC-based targeting vectors BAC clone (RP11-965H7) including the human LRRK2 gene was purchased from Empire Genomics. To select the BAC DNA-targeted hiPSC clones, the 4.3 kb selection cassette (FRT-flanked CAG promoterneomycin/puromycin resistance genes) was inserted into intron 41 of the LRRK2 gene, modifying with recombineering as previously described (Lee et al., 2018). 3.3. Screening and genotyping To perform the RFLP assay, genomic DNA from candidate clones was extracted using an AllPrep DNA/RNA Mini Kit (QIAGEN) according to the manufacturer's instructions. PCR was performed for 37 cycles at 95 °C for 1 min, 60 °C for 1 min, and 72 °C for 1 min in a C1000 Touch Thermal cycler (Bio-Rad). PCR amplicons were amplified using the primer pairs listed inTable 2 and using SolgTM h-Taq DNA polymerase (SolGent, Daejeon, Korea). 3.4. Melting curve analysis Melting Curve Analysis was performed as previously described (Lee et al., 2018). Small DNA fragment spanning each of subjected SNP sites (rs11175784, rs7979341, rs17443815, rs7302841, rs34637584 (mutation site) and rs10459265) was PCR amplified using the genomic DNAs isolated from cells before and after the targeted recombination, and the BAC DNA as templates. Primers and oligonucleotide probes are listed in Table 2.
3. Materials and methods 3.5. Alkaline phosphatase staining 3.1. Cell culture and transfection The cLRRK2-iPSCs were stained using the Leukocyte Alkaline Phosphatase Kit (Sigma-Aldrich) according to the manufacturer's instructions.
Human iPSCs were cultured in mTeSR1 medium (STEMCELL Technologies) on an STO feeder layer (ATCC) or on Matrigel (Corning)coated plates, replacing with a new culture medium daily at 37 °C in 5% CO2 incubator. Cells were subcultured or split in a 1:4 ratio every three days, and gently dissociating with ReLeSR™ reagent (STEMCELL Technologies). For BAC DNA-mediated gene targeting, The BAC DNA was introduced into hiPSCs as previously described (Lee et al., 2018)
3.6. Immunocytochemistry The immunocytochemistry was performed as previously described (Lee et al., 2018). The antibodies are listed in Table 2. 3
Stem Cell Research 41 (2019) 101649
S.-Y. Lee and S.-K. Chung
Table 2 Reagents details. Antibodies used for immunocytochemistry/flow-cytometry
Pluripotency Markers
Differentiation Markers
Secondary antibodies
Antibody Rabbit anti-OCT3/4
Dilution 1:300
Company Cat # and RRID Santa-Cruz Biotechnology, Cat# sc-9081, RRID: AB_2,167,703 Millipore, Cat# MAB4304, RRID: AB_177,629 BioLegend, Cat# 801,201, RRID: AB_2,313,773 R&D Systems, Cat# AF1924, RRID: AB_355,060 Sigma-Aldrich, Cat# A5228, RRID: AB_262,054 Millipore, Cat# ABD69, PRID: AB_2,744,681 Abcam, Cat# ab5790. PRID: AB_305,110 Millipore, Cat# AB15766, PRID: AB_870,981 Thermo Fisher Scientific, Cat# A-11,001, RRID: AB_2,534,069 Thermo Fisher Scientific, Cat# A241467, PRID: AB_10,055,703 Thermo Fisher Scientific, Cat# A21044, PRID: AB_2,535,713 Thermo Fisher Scientific, Cat# A21442, PRID: AB_2,535,860
Mouse anti-SSEA4
1:500
Mouse anti-TUBULIN β3 Goat anti-SOX17
1:500
Mouse anti-ACTIN, alpha-Smooth Muscle Rabbit anti-NESTIN
1:500
Rabbit anti-PAX6
1:500
Rabbit anti-SOX1
1:500
Anti-mouse-Alexa488
1:2000
Anti-goat-Alexa488
1:2000
Anti-mouse-Alexa594
1:2000
Anti-rabbit-Alexa594
1:2000
Target OCT4 NANOG DNMT3B SOX1 T GATA4 GAPDH P1/P2/P3 (P1/P2: 260 bp P1/P3: 330 bp) P4/P5 (320 bp) G2019S locus rs11175784
Forward/Reverse primer (5′−3′) GGGAGGAGCTAGGGAAAGAAAA/ATTGAACTTCACCTTCCCTCCA TTAATAACCTTGGCTGCCGTCT/AATAAGCAAAGCCTCCCAATCC TCTCACGGTTCCTGGAGTGTAA/GTAGGTTGCCCCAGAAGTATCG AAAAGTCAAAACGAGGCGAGAG/TGCTTGGACCTGCCTTACTACA CCAGATCATGCTGAACTCCTTG/GGGTTCCTCCATCATCTCTTTG GATCCAAACCAGAAAACGGAAG/CAGACATCGCACTGACTGAGAA CCTCAACGACCACTTTGTCAAG/TCTTCCTCTTGTGCTCTTGCTG GTCTCATAATTCTATCTTCAGG/CTCCTCTTCAGACCTGAAGTTCC/ GCCTCACAAGTGCCAACAAT
1:200
1:500
Primers Pluripotency Markers (qPCR)
Differentiation markers (qPCR)
House-Keeping Genes (qPCR) Genotyping
Targeted mutation sequencing Melting curve analysis (Forward/ Reverse primer/Probe in cases (5′−3′))
rs7979341 rs17443815 rs7302841 rs34637584
TTTCACACTGTATCCCAATGCTG/ATTCAGTTTTTGCCCTGAAAAAT TTCTGGCAGATACCTCCACT TCTGAGGACAAGGAAAATCAAAA/GCTGTTTTGGTTACTGTAGCTTTG/ CCACGCTACCTGACTTCAAACTATACTACAAAGCT AGGAAAATTCCTTCCACAAAC/TCTTGAAACAGGAAACCCATTT/ TATTCTCTATTAATTATCTAGCACTGTGCGCTGC GCTCTCTGAAAATTGACTTTGCT/ATGATATCTTCTTTGGCTTTCAA/ TTTGGCTTTCAAAACTATTTTGATCTGTAGCACA ACTCTTGATGTCCCCTCTGC/GCTGTGAAATGAGAGAGGAAGAA/ AGGAATGTAAGGTGACTCTCAGGTGTAACAGG AGACCTGAAACCCCACAATG/GGTGTGCCCTCTGATGTTTT/ AATGCCGTAGTCAGCAATCTTTGCAATGATGG
rs10459265
3.7. Embryoid body (EB) formation and in vitro differentiation
3.9. Karyotyping
hiPSCs were dissociated with Accutase (Thermo Fisher Scientific), and 1 × 106 cells were seeded into an AggreWell™400 plate (STEMCELL Technologies) in Aggrewell™ EB Formation Medium (STEMCELL Technologies) for 10 days according to manufaturer's instructions. The EBs were attached on 0.1% gelatin-coated tissue culture plates and differentiated in DMEM containing 10% fetal bovine serum for 12 days spontaneously.
After fifteen passages, G-banding analysis of 20 metaphase spreads was performed at GenDix.
3.10. Mycoplasma test Mycoplasma test was performed using PCR method (Lee et al., 2018)
3.8. Quantitative-PCR 3.11. STR analysis The WT-iPSCs were previously reported and served as a positive control for analyzing pluripotent gene expression (Lee et al., 2019). Cellular RNA was prepared using the RNeasy Mini Kit (QIAGEN) according to the manufacturer's instructions. The quantitative-PCR was performed as previously described (Lee et al., 2019). The sequences of primers are listed in Table 2.
STR were determined at the Korea Genome Information Institute. PCR products, amplifying by AmpFLSTR™ Identifiler™ Kit (Applied Biosystems®), were analysed with Genetic Analyzer (Applied Biosystems®).
4
Stem Cell Research 41 (2019) 101649
S.-Y. Lee and S.-K. Chung
Declaration of Competing Interest
Zhang., W., Ren., B., Wagner., U., Kim., A., Li., Y., Goebl., A., Kim., J., Soligalla., R.D., dubova., I., Thompson., J., Yates III., J., Esteban., C.R., Sancho-Martinez., I., Belmonte., J.C.I., 2012. Progressive degeneration of human neural stem cells caused by pathogenic LRRK2. Nature 491, 603–607. Qing., X., Walter., J., Jarazo., J., Arias-Fuenzalida., J., Hillje., A.L., Schwamborn., J., 2017. CRISPR/Cas9 and piggyBac-mediated footprint-free LRRK2-G2019S knock-in reveals neuronal complexity phenotypes and α-Synuclein modulation in dopaminergic neurons. Stem. Cell Res. 24, 44–50. Son., M.Y., Sim., H., Son., Y.S., Jung., K.B., Lee., M.O., Oh., J.H., Chung., S.K., Jung., C.R., Kim., J., 2017. Distinctive genomic signature of neural and intestinal organoids from familial Parkinson's disease patient-derived induced pluripotent stem cells. Neuropathol. Appl. Neurobiol. 43, 584–603. Lee., S.Y., Park., J.H., Jeong., S., Kim., B.Y., Kang., Y.K., Xu., Y., Chung., S.K., 2019. K120R mutation inactivates p53 by creating an aberrant splice site leading to nonsense-mediated mRNA decay. Oncogene 38, 1597–1610. Lee., S.Y., Jeong., S., Kim., J., Chung., S.K., 2018. Generation of gene-corrected iPSC line from Parkinson's disease patient iPSC line with alpha-SNCA A53T mutation. Stem. Cell Res. 30, 145–149.
The authors declare no conflict of interest. Acknowledgment This research was supported in part by the National Research Foundation of Korea Grants (NRF-2013M3A9B4076487) and Korea Institute of Oriental Medicine Grants (KSN1621131). Supplementary materials Supplementary material associated with this article can be found, in the online version, at doi:10.1016/j.scr.2019.101649. References Liu., G.H., Qu., J., Suzuki., K., Nivet., E., Li., M., Montserrat., N., Yi., F., Xu., X., Ruiz., S.,
5