High selenium diet protects against TNBS-induced acute inflammation, mitochondrial dysfunction, and secondary necrosis in rat colon

Nutrition 23 (2007) 878 – 886 www.elsevier.com/locate/nut

Basic nutritional investigation

High selenium diet protects against TNBS-induced acute inflammation, mitochondrial dysfunction, and secondary necrosis in rat colon Oren Tirosh, Ph.D., Eran Levy, M.Sc., and Ram Reifen, M.D., M.Sc.* The School of Nutritional Sciences, Institute of Biochemistry, Food Science and Nutrition, Faculty of Agricultural, Food and Environmental Quality Sciences, The Hebrew University of Jerusalem, Rehovot, Israel Manuscript received May 15, 2007; accepted August 31, 2007.

Abstract

Objective: We studied the protective effects of selenium in a rat model of 2,4,6-trinitrobenzene sulfonic acid (TNBS)–induced colitis to elucidate a possible mechanism of action. Method: Rats were supplemented with sodium selenite for 21 d with a normal selenium diet (0.02 ␮g/g body weight), an intermediate selenium diet (ISD; 0.3 ␮g/g body weight), or a high selenium diet (HSD; 2 ␮g/g body weight). On day 22, colitis was induced with TNBS. Rats were sacrificed after 24 h and colonic tissue was removed for evaluation. Results: Selenium supplementation (HSD) resulted in a significant increase in selenium in colonic tissue. Morphologically, the HSD resulted in the preservation of tissue architecture and attenuated neutrophil infiltration; no vasculitis or necrosis was detected. Biochemically, the HSD decreased tissue myeloperoxidase activity and protected the mitochondria in the colon of TNBS-treated animals as evaluated by preserving tissue oxygen consumption, mitochondrial DNA, and expression of cytochrome c. The HSD increased levels of nuclear respiratory factor-1 and mitochondrial transcription factor-A in normal colon tissue and under inflammatory conditions. The ISD resulted in only a minor protective effect. Conclusion: The results indicate that tissue damage in TNBS-induced colitis is accompanied by the arrest of mitochondrial respiration, loss of mitochondrial DNA, and the expression of nuclearencoded mitochondrial proteins. Selenium effectively protects colon mitochondria by upregulation of the expression of mitochondrial transcription factors nuclear respiratory factor-1 and mitochondrial transcription factor-A. Selenium prevented inflammatory and necrotic changes after induction of colitis. Selenium in a high dose is therefore a potential therapeutic agent in inflammatory bowel disease. © 2007 Elsevier Inc. All rights reserved.

Keywords:

Selenium; Inflammation; Colitis; Mitochondria; Necrosis

Introduction Inflammatory bowel disease (IBD) is a group of digestive disorders of complex pathogenesis [1,2] that is characterized by relapses and spontaneous or therapy-induced remissions. The disease may lead to serious gastrointestinal and extraintestinal complications, involving, e.g., the hepatobiliary, cardiovascular, and neural systems [3,4]. The worldwide prevalence of IBD is on the rise, especially in the

This work was supported in part by a research grant from the Israel Ministry of Health to Ram Reifen and Oren Tirosh. * Corresponding author. Tel.: ⫹972-8-9489020; fax: ⫹972-8-9363208. E-mail address: [email protected] (R. Reifen). 0899-9007/07/$ – see front matter © 2007 Elsevier Inc. All rights reserved. doi:10.1016/j.nut.2007.08.019

West. Today, more than 1 million people in the United States and an additional 1 million in Europe have IBD and its symptoms include diarrhea, loss of appetite, joint pain, sores in the anal area, rectal bleeding, and fistulas (Crohn’s and Colitis Foundation of America, 1999). Although its cause is unknown, infection and immunogenic agents have been implicated in the disease process. In active IBD, there is increased local production of proinflammatory cytokines, synthesis of eicosanoids, and recruitment of immunologically specific and non-specific inflammatory cells from the circulation [5]. Selenium is a component of a number of antioxidant enzymes, e.g., glutathione peroxidase and thioredoxin reductase [6,7]. Selenium levels have been reported to be

O. Tirosh et al / Nutrition 23 (2007) 878 – 886

lower in patients with IBD [8,9]. However, there is no hard evidence of significant improvement using nutritional levels of this antioxidant as therapeutic agents in this disease. We previously reported that a diet that is high in selenium can affect liver mitochondrial parameters in vivo as a possible mechanism for its chemoprotective effects [10]. More than 90% of oxygen consumption in tissues is attributed to mitochondrial respiration. Mitochondria are pivotal organelles in controlling necrotic and apoptotic cell deaths in tissues. Loss of mitochondrial integrity is a critical event in cell-death processes [11], and protecting the mitochondria may prevent tissue damage during inflammation. Reported findings have suggested that mitochondrial proteins, such as uncoupling protein-2, play a role in immunity [12]. In addition, manganese superoxide dismutase is known to be regulated by inflammatory cytokines [13–16]. However, the role of the mitochondrion as a pivotal cellular organelle has not been studied in association with inflammation. The pathway by which tissue inflammation deteriorates into tissue necrosis is still unknown. The main objective of this study was to explore the hypothesis that inflammation can lead to mitochondrial damage that in turn will impair the tissue’s oxygen-utilization capacity, thereby facilitating necrosis, and to elucidate whether selenium can prevent such changes by a direct effect on mitochondrial biogenesis. In this study, we elucidated the role of the mitochondria in an in vivo inflammatory model of colitis and studied the interaction of selenium with mitochondrial transcription factors nuclear respiratory factor-1 (NRF1), mitochondrial transcription factor-A (mtTFA), mitochondrial DNA and cytochrome c.

879

Health toxicologic report (TOX-38, Toxicity Studies of Sodium Selenate and Sodium Selenite [CAS nos. 1341001-0 and 10102-18-8] Administered in Drinking Water to F344/N Rats and B6C3F1 Mice). Thirteen weeks of supplementation with 16 ppm of sodium selenite in the drinking water had no negative effect on growth and survival. Induction of colitis Colitis was induced by administering 0.5 mL of 2,4,6trinitrobenzene sulfonic acid (TNBS; 100 mg/mL dissolved in 50% ethanol) through the anal canal for a distance of 8 cm into the colon, just proximal to the splenic flexure. Animals were sacrificed 24 h after induction and the colon was removed [18]. This time frame was chosen because 72 h after induction already reflects a beginning of spontaneous remission in this model. Tissue inflammation/myeloperoxidase activity

Materials and methods

Colonic tissue samples (⬃100 –120 mg) were collected 4 cm proximal to the anus. Each piece of tissue was homogenized in a solution containing 0.5% hexa-decyl-trimethylammonium bromide (HTAB; Sigma) buffer (0.5% [w/v], HTAB in 50 mM phosphate buffer, pH 6.0). Tissue was minced in a test tube containing 1 mL of HTAB buffer on ice and homogenized in a polytron. The pooled homogenate and washes were sonicated in water for 20 s. After three freeze-thaw cycles, the samples were centrifuged in the cold for 15 min at 40 000g. Myeloperoxidase (MPO) activity was assayed in the supernatant by adding O-dianisidine-HCl (Sigma-Aldrich, Rehovot, Israel) and 0.15% (v/v) H2O2 as a substrate for MPO. The rate of change in absorbance was measured spectrophotometrically at 460 nm [19].

Animals

Western blot analysis of cytochrome c

Male Sprague-Dawley rats (weighing approximately 150 g each) were provided with food and water ad libitum. They were kept in plastic cages with wire tops in a lightcontrolled room. All animals were cared for under the guidelines set forth by the animal care committee of the Hebrew University of Jerusalem, Israel.

Colon samples were boiled and kept in sample buffer (Sigma-Aldrich) immediately after isolation. The samples were boiled again after being thawed and were subjected to sodium dodecylsulfate polyacrylamide gel electrophoresis followed by western blot analysis. Briefly separated proteins were transferred electrophoretically from the gel to a nitrocellulose membrane (Amersham International plc, Buckinghamshire, United Kingdom). The membrane was blocked in Tris buffered saline (0.15 M NaCl/10 mM Tris/ HCl, pH 7.4) containing 5% (v/v) skim milk (Blotto) and then incubated overnight with the primary antibody (diluted 1/1000 in Blotto, mouse immunoglobulin G 556433, BD, Lapidot, Haifa, Israel) at 4°C. After washing six times in Tris buffered saline containing 0.05% (v/v) Tween 20, the membrane was incubated for 2 h at room temperature with the secondary antibody (diluted 1/1000 in Blotto). Immunoreactive bands were detected with enhanced chemoluminescence western blotting detection reagents and developed on film [10].

In vivo selenium supplementation The rats were supplemented for 21 d with the following diets: a normal selenium diet (NSD) providing approximately 2 ␮g/g of sodium selenite daily per animal, which is considered an acceptable excess supplementation level for this element [10,17]. The rationale for the use of a high selenium diet (HSD) in the form of 16 ppm of sodium selenite in the drinking water of rats was that such a diet should provide around 0.75 mg/kg of selenium per day (around 2 mg/kg of sodium selenite per day), according to a National Institutes of

880

O. Tirosh et al / Nutrition 23 (2007) 878 – 886

Table I Primers Gene

Rat cytochrome c Rat NRF1 Rat mtTFA 18S GAPDH

Primer sequencing Forward (product size)

Reverse

5=-GGA GGC AAG CAT AAG ACT GG-3= (212 bp) 5=-ACC TTT GGA GAA TGT GGT GC-3= (461 bp) 5=-GGA AGA GCA AAT GGC TGA AG-3= (417 bp) 5=-CGG CTA CCA CAT CCA AGG AA-3= (196 bp) 5=-GCC ATC AAC GAC CCC TTC AT-3= (314 bp)

5=-GTC TGC CCT TTC TCC CTT CT-3= 5=-GTG ATG GTA CGA GAT GGG CT-3= 5=-AGA ACT TCA CAA ACC CGC AC-3= 5=-CGC TAT TGG AGC TGG AAT TAC C-3= 5=-TTC ACA CCC ATC ACA AAC AT-3=

GAPDH, glyceraldehyde-3-phosphate dehydrogenase; mtTFA, mitochondrial transcription factor-A; NRF1, nuclear respiratory factor-1

Mitochondrial DNA analysis in the colon Tissue content of mitochondrial DNA was determined using specific primers for the D-loop region in mitochondrial DNA. The DNA was amplified by polymerase chain reaction (PCR): 20 cycles were used for the amplification with 25 ng of total tissue DNA as a template. Saturation of PCR product intensity was observed after 24 cycles. The primers were 5= GGTTCTTACTTCAGGGGCCATC 3= (left) and 5= GTGGAATTTTCTGAGGGTAGGC 3= (right), with a PCR product of 520 bp. Mitochondrial respiration activity in colon tissue Colonic tissue samples (5–10 mm wide) were incubated at ambient temperature in phosphate buffered saline supplemented with 5 mM glucose. Oxygen consumption was measured polarographically using a computerized Clark-type oxygen electrode. Rotenone, a complex 1 inhibitor, was used to confirm that most of the oxygen consumption was related to mitochondrial activity. Measurement of selenium incorporation into the colon by an inductively coupled plasma method Samples were prepared for analysis by microwaveassisted digestion using an MLS 1200 mega-microwave digestion unit (Milestone Sorisole [BG], Italy). At the end of the digestion period, the vessels were allowed to cool to room temperature and were uncapped. Liquid residue was taken up in water, transferred to 25-mL calibrated flasks, and brought up to volume with water. Analyses were conducted on portions of these solutions, versus multielement standards from Merck, in the same solvent. Selenium was determined by inductively coupled plasma/atomic emission spectrometry at 196.090 nm. An inductively coupled plasma/atomic emission spectrometric system (Spectroflame Modula E, Spectro Kleve, Germany) was used with a cross-flow nebulizer. The power level was 1.2 kW, coolant flow was 15 L/min, auxiliary flow was 0.5 L/min, and nebulizer flow was 0.5 L/min. Observation height was 10 mm above the coil.

mtTFA, NRF1, and cytochrome c mRNA levels (reverse transcriptase PCR analysis) Total RNA was extracted from 50 to 100 mg of tissue using 1 mL of Tri Reagent (Sigma-Aldrich) according to the manufacturer’s instructions. cDNA synthesis Reverse-iTTM First Strand Synthesis from Advanced Biotechnologies (ABgene, Tamar, Jerusalem, Israel) was used according to the manufacturer’s instructions. PCR amplification To each tube we added 37 ng of cDNA from cytochrome c, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), or 18S, 3 ␮L of primers, 12.5 ␮L of readyMix, and 6.5 ␮L of water diethylpyrocarbonate (for a total 25 ␮l in each tube). Linear PCR responses were observed at 24 cycles for GAPDH and 19 cycles for 18S (Table 1). The PCR for cytochrome c, NRF1, and mtTFA was run at 95°C for 5 min, 94°C for 30 s, 56°C for 2 min, 72°C for 1 min, and back to stage 2 for 22, 26, and 24 cycles, respectively, 72°C for 10 min, and 4°C. The PCR products were separated on a 1% agarose gel in Tris Acetate-EDTA buffer with ethidium bromide. The electrophoresis took place in a BioRad device in 1⫻ Tris Acetate-EDTA buffer at 95 V for about 50 min (maximum milliampere). The size of the cDNA was determined by a 100-bp marker. Statistical analysis Data were analyzed by one-way analysis of variance. Differences were considered statistically significant at P ⬍ 0.05 using Fisher’s protected least-significant difference method or Dunnett’s t test. SPSS 11 (SPSS, Inc., Chicago, IL, USA) was used for all analyses.

Results Selenium levels in colonic tissue The rats were treated with the NSD or HSD for a period of 3 wk as described in MATERIALS AND METHODS. In response

O. Tirosh et al / Nutrition 23 (2007) 878 – 886

881

Selenium as an anti-inflammatory agent/MPO activity To study the level of colon inflammation, we evaluated neutrophil infiltration into the tissue by measuring MPO activity. A 26-fold increase in tissue MPO activity was observed 24 h after the induction of colitis by TNBS in the NSD group (Fig. 1A). The HSD afforded significant protection against TNBS-induced colitis compared with NSDtreated animals. In healthy HSD-treated animals (no colitis), MPO levels were similar to those of the control group (Fig. 1A). However, the intermediate selenium diet did not prevent the increase in MPO activity induced by the TNBS treatment (Fig. 1B). Microscopic changes

Fig. 1. Tissue inflammatory status. MPO activity in the colon of animals (n ⫽ 5–10 in each group) with or without colitis. Values are mean ⫾ SD. Means followed by different letters differ statistically (P ⬍ 0.05, Fisher’s protected least-significant difference test). A and B represent independent experiments. (B) The effect of an ISD was evaluated. HSD, high selenium diet; ISD, intermediate selenium diet; NSD, normal selenium diet; TNBS, 2,4,6-trinitrobenzene sulfonic acid; MPO, myeloperoxidase.

to the HSD, tissue selenium levels in the colon increased by 41% from 2.49 ⫾ 0.44 mg of selenium per kilogram of colonic tissue to 3.52 ⫾ 0.65 compared with the control group (P ⬍ 0.01).

Morphologic analysis of colon tissue after induction of inflammation by TNBS in selenium-supplemented animals was performed. Microscopic pictures after histologic hematoxylin and eosin staining showed mucosal necrosis with fresh hemorrhage in NSD animals treated for colitis. The muscularis externa showed a heavy, diffuse, neutrophilic infiltrate. There was perivascular and vascular neutrophilic infiltration with evidence of vascular necrosis (within the areas of mucosal necrosis). HSD prevented the colitisinduced damage. The architecture was preserved. The mucosal epithelium had areas of attenuation and erosion. There was mild propria edema and blood vessels appeared to be normal (Fig. 2 and Table 2). Figure 2A shows normal architecture of control tissue. The mucosal epithelium is intact. Blood vessels are normal. There are no significant pathologic findings. Figure 2B shows a representative colon section of TNBS-treated animals. There is mucosal necrosis with fresh hemorrhaging. The muscularis externa has a heavy diffuse neutrophilic infiltrate. There is perivascular and vascular neutrophilic infiltration with evidence of vascular necrosis (within the areas of mucosal necrosis). Figure 2C shows representative colon section of TNBS-treated animals after supplementation with an intermediate selenium diet. Minor protection by the intermediate selenium diet is observed. Figure 2D shows a representative colon section of TNBS-treated animals supplemented with HSD.

Fig. 2. Morphologic analysis of colon tissue after induction of inflammation by 2,4,6-trinitrobenzene sulfonic acid (TNBS) in selenium-supplemented animals. Microscopic images show histologic hematoxylin and eosin staining. (A) control, (B) TNBS (colitis), (C) TNBS ⫹ ISD, and (D) TNBS ⫹ HSD. Magnification 20⫻. HSD, high selenium diet; ISD, intermediate selenium diet.

882

O. Tirosh et al / Nutrition 23 (2007) 878 – 886

Table II Hematoxylin and eosin staining and findings of histologic analysis* Control TNBS 24 h

Comments

NSD

HSD

Architecture loss

0

5 (⫹⫹)

0

Epithelium necrosis Mucosal necrosis Neutrophil infiltration Blood vessel necrosis

0 0 0 0

5 (⫹⫹⫹) 5 (⫹⫹⫹) 5 (⫹⫹⫹) 5 (⫹⫹)

4 (⫹) 2 (⫹⫹) 5 (⫹) 1 (⫹)

Poorly preserved: 2 NSD animals

⫹, mild; ⫹⫹, moderate; ⫹⫹⫹, heavy or severe; HSD, high selenium diet; NSD, normal selenium diet; TNBS, 2,4,6-trinitrobenzene sulfonic acid * Selenium-deficient rats were divided into groups of five animals. Each group was supplemented with a different selenium diet (NSD or HSD) as described in MATERIALS AND METHODS. Histologic analysis indicated a protective effect of the HSD. Numbers represent animals.

The architecture is preserved. The mucosal epithelium has areas of attenuation and erosion. There is mild propria edema. Blood vessels are normal. Treatment has prevented the development of colitis as appears in the histologic pictures representing the TNBS-induced colitis; an increase in crypt number is observed in the HSD group. This effect is pathognomonic to mucosal repair, presumably secondary to damage caused by TNBS

could be assumed that this was a reflection of the occurrence, by tagging, of protein degradation or chemical modification, e.g., cytochrome c nitration due to increased activity inducible nitric oxide synthase in the inflamed tissue. This effect of colitis was completely abrogated by the HSD. Colitis induction promoted a loss of tissue mitochondrial DNA (D-loop region), as shown by PCR analysis; in the animals with colitis, the mitochondrial DNA D-loop region was lost, whereas in the HSD-treated group, protection was observed (Fig. 5). Analysis of the promoters of the cytochrome c gene and other proteins that are part of the mitochondrial electrontransfer chain identified a regulatory molecule that serves as an integrative function in controlling nuclear and mitochondrial genes and was designated NRF1 [20]. The HSD increased the level of NRF1 in the colon, indicating this element’s direct effect on mitochondrial biogenesis in the tissue (Fig. 6). Moreover, NRF1 regulates the expression of mtTFA, which is required for mitochondrial DNA replication. As expected, the HSD elevated the level of colon mtTFA that is under the control of NRF1 (Fig. 6) [20].

Mitochondrial changes Interaction between the mitochondria and selenium was raised as a possible protective mechanism. The mitochondrion is a major organelle that regulates necrotic and apoptotic cell deaths and tissue respiration. Most oxygen consumption in the colon was found to be directly associated with mitochondrial respiration because rotenone, a mitochondrial electron-transport chain inhibitor, significantly decreased tissue respiration (Fig. 3A). We evaluated oxygen consumption in the animal’s colon after selenium supplementation with and without colitis. Colitis significantly decreased oxygen consumption rate in the colon, whereas the HSD provided significant protection against this TNBS-induced respiration arrest (Fig. 3B). To elucidate the direct effects of colitis and of HSD on proteins of the mitochondrial electron-transfer chain, colonic cytochrome c levels were measured. Reverse transcriptase PCR analysis of cytochrome c mRNA revealed that TNBS-induced colitis significantly attenuated tissue mRNA levels (Fig. 4A). No effect was observed with 18S rRNA levels or cytosolic GAPDH transcription. TNBSinduced colitis significantly decreased protein cytochrome c levels, as analyzed by western blotting (Fig. 4B). Interestingly, post-translational modifications in mature cytochrome c were also observed in the colitic animals. An addition of 2–5 kD to the protein was detected. This unique effect indicates the production of aberrant cytochrome c, possibly due to cytosolic accumulation of the protein. It

Fig. 3. Oxygen consumption in colon tissue. (A) Respiration was arrested by 20 ␮g/mL of rotenone, indicating that most of the tissue respiration is due to mitochondrial activity. (B) Respiration was arrested by TNBSinduced colitis. In selenium-supplemented animals, tissue respiration was partly recovered (n ⫽ 7). Values are mean ⫾ SD. Means followed by different letters differ statistically (P ⬍ 0.05, Fisher’s protected least-significant difference test). HSD, high selenium diet; TNBS, 2,4,6-trinitrobenzene sulfonic acid.

O. Tirosh et al / Nutrition 23 (2007) 878 – 886

883

status and overproduction of reactive oxygen species [11,21–24]. However, in tissues loss of tissue oxygenation is the most important factor in tissue necrosis. High-dose selenium protected the colon mitochondria. A direct effect of selenium was observed after the analysis of the mitochondria transcription factors NRF1 and mtTFA. Mitochondrial role in inflammation

Fig. 4. Expression of cytochrome c in the colon. (A) Reverse transcriptase polymerase chain reaction analysis of an RNA mix from six animals shows that TNBS-induced colitis decreased the tissue’s level of cytochrome c. This phenomenon was prevented by selenium supplementation. (B) Western blot analysis shows that TNBS-induced colitis in rats (n ⫽ 6) decreased tissue levels of cytochrome c, whereas selenium supplementation prevented this effect. Values are mean ⫾ SD. *Statistically different from control (P ⬍ 0.05, Fisher’s protected least-significant difference test). GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HSD, high selenium diet; TNBS, 2,4,6-trinitrobenzene sulfonic acid.

Little information is available on the involvement of mitochondria in inflammation. Studies in animals and patients with IBD have shown that the first enzyme of the mitochondrial electron-transport chain (complex 1) is altered in peripheral blood mononuclear cells and muscle. In patients with IBD, complex 1 activity is lower than that observed in healthy subjects. In another study, rectal biopsy specimens from control subjects and from patients with non-rectal Crohn’s disease and acute ulcerative colitis showed evidence of mitochondrial damage [25,26]. These results indicate that selective and specific alterations in the mitochondria may be involved in IBD. We show in this study that the induction of colitis affects mitochondrial biogenesis. TNBS may promote mitochondrial damage directly. However, the later inflammatory process is probably the main reason for the mitochondrial damage. Expression of cytochrome c, a nucleus-encoded protein that has to be imported into the mitochondria, was dramatically downregulated in the colitic colon. Decreased expression of message cannot explain the similar level expression of protein, even in different molecular weight (aberrant cytochrome c). However, a possible explanation for this result is a rather long turnover of the cytochrome c protein. Therefore, the decrease in mRNA levels will not facilitate an immediate

Discussion Effects of selenium on inflammation The severe inflammatory and necrotic condition of the colon 24 h after exposure to TNBS in the control (NSD) group was completely prevented by HSD supplementation. The effect of the HSD was also expressed in a reduction in MPO activity, an indicator of inflammatory status. The fact that the HSD prevented necrosis and inflammation suggests a direct effect on tissue oxygen-utilization capacity. Therefore, mitochondria have been hypothesized to be pivotal players in this process. Mitochondria are known to regulate cell viability and necrotic and apoptotic cell deaths. Four inter-related mitochondrial pathways have been suggested to facilitate cell death: 1) mitochondrial permeability transition and the release of apoptotic cell death–promoting factors; 2) cytochrome c release by proapoptotic members of the BCL-2 family of proteins; 3) disruption of adenosine triphosphate production, and 4) alteration of the cell’s redox

Fig. 5. Tissue levels of mitochondrial DNA. TNBS-induced colitis decreased mtDNA (D-loop region) in animals in which tissue damage was prominent. Se supplementation protected the tissue and the mtDNA recovered to normal levels. Values are mean ⫾ SD, n ⫽ 5. *Statistically different from control (P ⬍ 0.05, Fisher’s protected least-significant difference test). con, control; HSD, high selenium diet; mtDNA, mitochondrial DNA; Se, selenium; TNBS, 2,4,6-trinitrobenzene sulfonic acid.

884

O. Tirosh et al / Nutrition 23 (2007) 878 – 886

Taken together, the outcome was a significant decrease in tissue respiration, indicating dysfunctional tissue mitochondria. The decrease in mitochondrial activity could be the main cause for loss of tissue oxygenation and the development of inflammatory/necrotic conditions (Fig. 7). Selenium and mitochondrial interactions

Fig. 6. Expression of mitochondrial transcription factors mtTFA and NRF1 in the colon. Reverse transcriptase polymerase chain reaction analysis of mRNA (n ⫽ 5 animals) shows that the high Se diet upregulated the expression of these transcription factors and that TNBS treatment (colitis) decreased NRF1 and mtTFA levels in the tissue. The high Se diet protected against the TNBS effect. *Statistically different from control (P ⬍ 0.05, Fisher’s protected least-significant difference test). GAPDH, glyceraldehyde-3-phosphate dehydrogenase; mtTFA, mitochondrial transcription factor-A; NRF1, nuclear respiratory factor-1; Se, selenium; TNBS, 2,4,6trinitrobenzene sulfonic acid.

decrease in protein levels. Yet, this may promote modification of the protein, which is more likely to have happened in this situation. In addition, mitochondrial DNA levels were much lower. It has been demonstrated that DNA damage to cells in culture may alter and deplete mitochondrial DNA with little effect on genomic DNA. This effect is used in cellular manipulations to prepare mitochondrial DNA-deficient cells, e.g., Rho0 cells [27,28]. We were able to show that tissue mitochondrial DNA in vivo is highly susceptible and responds to inflammatory damage in a fashion similar to cells exposed to ethidium bromide in vitro. Depletion of mitochondrial DNA could therefore serve as a major target for tissue damage in progressive inflammatory diseases.

Selenium may interact with the mitochondria in in vivo supplementation trials because subcellular distribution analysis of selenium in human liver samples showed that it is mainly concentrated in the mitochondria and nuclei [29]. The mechanism by which selenium serves as a protective agent in inflammation is not clear. Here we show one mechanism by which selenium can decrease colonic tissue damage in inflammation by a direct interaction with the mitochondria. Several studies have shown that selenium can induce mitochondrial dysfunction [10,28,30]. However, the in vivo concentrations of free selenium are probably low, and most of the selenium is protein bound. In our previous publication [10] we found that supplementation with an HSD may potentiate mitochondrial permeability transition pore opening only after loading the mitochondria with calcium ex vivo. Based on this we believe that selenium concentrations may potentiate apoptosis in vivo in already damaged cells while supporting the mitochondria in non-damaged cells. Downregulation of NRF1 and mtTFA is not a marker for mitochondrial damage. However, this may indicate that mitochondrial biogenesis is impaired. Upregulation of the expression of mitochondrial transcription factor NRF1, which regulates the expression of the mitochondrial electrontransfer chain protein cytochrome c [20], could explain how an HSD protects the levels of cytochrome c during colitis. Indeed, the inflammatory process depleted NRF1 and cytochrome c from the colon. There was no correlation in tissue levels between upregulation of NRF1 and mtTFA and their gene products, cytochrome c, or its mRNA levels. One possible explanation could be that in the normal colon tissue selenium, which upregulates the levels of the transcription factor, cannot stimulate mitochondrial biogenesis beyond the normal levels. Therefore, the stimulation of NRF1 and mtTFA will not result in further biogenesis of mitochondria. Indeed, in most cases the correlation is for the impairment of mitochondrial biogenesis in disease conditions [31]. HSD treatment also resulted in increased expression of mtTFA, which regulates transcription, maintenance, and replication of the mitochondrial genome. A single major non-coding region, called the D-loop region, contains the main regulatory sequences for transcription and replication initiation [32]. Moreover, mtTFA plays a protective role because it is highly abundant and can wrap the mitochondrial DNA. It has been suggested that mitochondrial DNA is actually packed with mtTFA [33–35]. During inflammation (colitis), mtTFA is depleted and as a result the colonic tissue has low levels of the D-loop region. HSD treatment increases the levels of NRF1 and mtTFA; this

O. Tirosh et al / Nutrition 23 (2007) 878 – 886

885

Fig. 7. Suggested mechanism by which inflammation can lead to tissue necrosis through the mitochondrial pathway, suggesting a novel protective mechanism involving selenium. HSD, high selenium diet; mtTFA, mitochondrial transcription factor-A; NRF1, nuclear respiratory factor-1.

effect was observed in healthy animals and after induction of colon inflammation, indicating a protective mechanism that involves a direct effect on the mitochondrial transcription factors NRF1 and mtTFA. The effect of the HSD to upregulate these transcription factors in healthy animals is strong evidence that selenium targets the mitochondria to protect the tissue during inflammation. The HSD treatment resulted in preventing a loss of mitochondrial respiration, suggesting a protective effect on the fully assembled mitochondrial organelle. Therefore, colonic tissue oxygen utilization for energy purposes is preserved and necrotic damage is attenuated (Fig. 7). The HSD treatment did not enhance mitochondrial activity, i.e., respiration rate, beyond that found in the control animals. Indeed, mitochondrial activity as a whole is not elevated in NRF1 transgenic animals [36]. Therefore, increased expression of this transcription factor may not necessarily result in increased mitochondrial activity beyond that needed for the energy requirements of the tissue. Nevertheless, depletion will culminate in loss of tissue mitochondrial function and oxygen utilization leading to necrosis. High-dose selenium supplementation and tissue enrichment Selenium-dependent glutathione peroxidases and other selenoproteins provide the molecular basis for selenium’s antioxidant activity [6,7]. However, high levels of selenium supplementation can be expected to affect other functions related to inflammation, tumorigenesis, carcinogen metabolism, immune function, cell-cycle regulation, and apoptosis. To date, supplementation with selenium has been associated with the prevention of selenium deficiency using the recommended daily allowance as a guideline. However, the therapeutic effect of selenium could be enhanced by using a tissue-enrichment strategy involving a short-term supplementation or supplementation in intervals to avoid toxic effects of HSD. HSDs have also been used previously in animal models in an attempt to prevent or treat tumors [37]. Little information on the effect of selenium tissue-enrichment

strategies on inflammatory conditions, and more specifically on IBD, is available. Our results show that colon tissue can be enriched with selenium. However, high doses are needed to elevate tissue selenium content in a reasonable period. Our results suggest that, for the prevention (elongation of remission) and/or treatment of IBD in humans, milligram doses of selenium for a relatively short time are needed, rather than the current recommended daily allowance of micrograms. In conclusion, 1) mitochondria were found to play a pivotal role in a TNBS-induced inflammatory process; 2) mitochondria are involved in necrosis and tissue damage during or secondary to inflammation; and 3) a high dose of selenium may serve as an anti-inflammatory/anti-necrotic agent by preserving mitochondrial tissue function. References [1] Podolsky D. Pride and prejudice: inflammatory bowel disease models and drug development. Curr Opin Gastroenterol 2000;16:295– 6. [2] Podolsky DK. Going the distance—the case for true colorectal-cancer screening. N Engl J Med 2000;343:207– 8. [3] Lossos A, River Y, Eliakim A, Steiner I. Neurologic aspects of inflammatory bowel disease. Neurology 1995;45(Pt 1):416 –21. [4] Wewer V, Gluud C, Schlichting P, Burcharth F, Binder V. Prevalence of hepatobiliary dysfunction in a regional group of patients with chronic inflammatory bowel disease. Scand J Gastroenterol 1991;26: 97–102. [5] Nicholls RJ. Review article: ulcerative colitis—surgical indications and treatment. Aliment Pharmacol Ther 2002;16(suppl 4):25– 8. [6] Brigelius-Flohe R, Maurer S, Lotzer K, Bol G, Kallionpaa H, Lehtolainen P, et al. Overexpression of PHGPx inhibits hydroperoxideinduced oxidation, NFkappaB activation and apoptosis and affects oxLDL-mediated proliferation of rabbit aortic smooth muscle cells. Atherosclerosis 2000;152:307–16. [7] Arner ES, Holmgren A. Physiological functions of thioredoxin and thioredoxin reductase. Eur J Biochem 2000;267:6102–9. [8] Ringstad J, Kildebo S, Thomassen Y. Serum selenium, copper, and zinc concentrations in Crohn’s disease and ulcerative colitis. Scand J Gastroenterol 1993;28:605– 8. [9] Geerling BJ, Badart-Smook A, Stockbrugger RW, Brummer RJ. Comprehensive nutritional status in recently diagnosed patients with inflammatory bowel disease compared with population controls. Eur J Clin Nutr 2000;54:514 –21.

886

O. Tirosh et al / Nutrition 23 (2007) 878 – 886

[10] Shilo S, Aronis A, Komarnitsky R, Tirosh O. Selenite sensitizes mitochondrial permeability transition pore opening in vitro and in vivo: a possible mechanism for chemo-protection. Biochem J 2003; 370(Pt 1):283–90. [11] Hirsch T, Susin SA, Marzo I, Marchetti P, Zamzami N, Kroemer G. Mitochondrial permeability transition in apoptosis and necrosis. Cell Biol Toxicol 1998;14:141–5. [12] Arsenijevic D, Onuma H, Pecqueur C, Raimbault S, Manning BS, Miroux B, et al. Disruption of the uncoupling protein-2 gene in mice reveals a role in immunity and reactive oxygen species production. Nat Genet 2000;26:435–9. [13] Daosukho C, Kiningham K, Kasarskis EJ, Ittarat W, St Clair DK. Tamoxifen enhancement of TNF-alpha induced MnSOD expression: modulation of NF-kappaB dimerization. Oncogene 2002;21:3603–10. [14] St Clair DK, Porntadavity S, Xu Y, Kiningham K. Transcription regulation of human manganese superoxide dismutase gene. Methods Enzymol 2002;349:306 –12. [15] Xu Y, Porntadavity S, St Clair DK. Transcriptional regulation of the human manganese superoxide dismutase gene: the role of specificity protein 1 (Sp1) and activating protein-2 (AP-2). Biochem J 2002; 362(Pt 2):401–12. [16] Zhu C, Huang Y, Weydert CJ, Oberley LW, Domann FE. Constitutive activation of transcription factor AP-2 is associated with decreased MnSOD expression in transformed human lung fibroblasts. Antioxid Redox Signal 2001;3:387–95. [17] Davis CD, Brooks L, Calisi C, Bennett BJ, McElroy DM. Beneficial effect of selenium supplementation during murine infection with Trypanosoma cruzi. J Parasitol 1998;84:1274 –7. [18] Reifen R, Matas Z, Zeidel L, Berkovitch Z, Bujanover Y. Iron supplementation may aggravate inflammatory status of colitis in a rat model. Dig Dis Sci 2000;45:394 –7. [19] Krawisz JE, Sharon P, Stenson WF. Quantitative assay for acute intestinal inflammation based on myeloperoxidase activity. Assessment of inflammation in rat and hamster models. Gastroenterology 1984;87:1344 –50. [20] Scarpulla RC. Nuclear control of respiratory chain expression in mammalian cells. J Bioenerg Biomembr 1997;29:109 –19. [21] Kroemer G, Zamzami N, Susin SA. Mitochondrial control of apoptosis. Immunol Today 1997;18:44 –51. [22] Korsmeyer SJ, Wei MC, Saito M, Weiler S, Oh KJ, Schlesinger PH. Pro-apoptotic cascade activates BID, which oligomerizes BAK or BAX into pores that result in the release of cytochrome c. Cell Death Differ 2000;7:1166 –73. [23] Kroemer G, Dallaporta B, Resche-Rigon M. The mitochondrial death/ life regulator in apoptosis and necrosis. Annu Rev Physiol 1998;60: 619 – 42.

[24] Green DR, Reed JC. Mitochondria and apoptosis. Science 1998;281: 1309 –12. [25] Briet F, Twomey C, Jeejeebhoy KN. Effect of malnutrition and short-term refeeding on peripheral blood mononuclear cell mitochondrial complex I activity in humans. Am J Clin Nutr 2003;77:1304 –11. [26] Delpre G, Avidor I, Steinherz R, Kadish U, Ben-Bassat M. Ultrastructural abnormalities in endoscopically and histologically normal and involved colon in ulcerative colitis. Am J Gastroenterol 1989;84: 1038 – 46. [27] Inoue K, Ito S, Takai D, Soejima A, Shisa H, LePecq JB, et al. Isolation of mitochondrial DNA-less mouse cell lines and their application for trapping mouse synaptosomal mitochondrial DNA with deletion mutations. J Biol Chem 1997;272:15510 –5. [28] King MP, Attardi G. Human cells lacking mtDNA: repopulation with exogenous mitochondria by complementation. Science 1989; 246:500 –3. [29] Chen C, Zhang P, Hou X, Chai Z. Investigation of selenium distribution in subcellular fractions of human liver by neutron activation analysis. Biol Trace Elem Res 1999;71–2:131– 8. [30] Kim TS, Jeong DW, Yun BY, Kim IY. Dysfunction of rat liver mitochondria by selenite: induction of mitochondrial permeability transition through thiol-oxidation. Biochem Biophys Res Commun 2002;294:1130 –7. [31] Nisoli E, Clementi E, Carruba MO, Moncada S. Defective mitochondrial biogenesis: a hallmark of the high cardiovascular risk in the metabolic syndrome? Circ Res 2007;100:795– 806. [32] Fernandez-Silva P, Enriquez JA, Montoya J. Replication and transcription of mammalian mitochondrial DNA. Exp Physiol 2003;88: 41–56. [33] Takamatsu C, Umeda S, Ohsato T, Ohno T, Abe Y, Fukuoh A, et al. Regulation of mitochondrial D-loops by transcription factor A and single-stranded DNA-binding protein. EMBO Rep 2002;3:451– 6. [34] Kang D, Hamasaki N. Maintenance of mitochondrial DNA integrity: repair and degradation. Curr Genet 2002;41:311–22. [35] Alam TI, Kanki T, Muta T, Ukaji K, Abe Y, Nakayama H, et al. Human mitochondrial DNA is packaged with TFAM. Nucleic Acids Res 2003;31:1640 –5. [36] Baar K, Song Z, Semenkovich CF, Jones TE, Han DH, Nolte LA, et al. Skeletal muscle overexpression of nuclear respiratory factor 1 increases glucose transport capacity. FASEB J 2003;17:1666 –73. [37] Thirunavukkarasu C, Sakthisekaran D. Influence of sodium selenite on glycoprotein contents in normal and N-nitrosodiethylamine initiated and phenobarbital promoted rat liver tumors. Pharmacol Res 2003;48:167–73.