- Email: [email protected]
Identification and modulation of expression of a TNF receptor superfamily member 25 homologue in grass carp (Ctenopharyngodon idella)
Aquaculture and Fisheries xxx (xxxx) xxx–xxx
Contents lists available at ScienceDirect
Aquaculture and Fisheries journal homepage: http://www.keaipublishing.com/en/journals/ aquaculture-and-fisheries
Identification and modulation of expression of a TNF receptor superfamily member 25 homologue in grass carp (Ctenopharyngodon idella) Xingxing Chenga,b,c, Xinyu Jianga,b,c, Yunjie Songa,b,c, Jingduo Gaoa,b,c, Yujie Xuea,b,c, Zeinab Hassana,b,c, Qian Gaoa,b,c,∗, Jun Zoua,b,c,∗∗ a
Key Laboratory of Exploration and Utilization of Aquatic Genetic Resources, Ministry of Education, Shanghai Ocean University, Shanghai, 201306, China International Research Center for Marine Biosciences at Shanghai Ocean University, Ministry of Science and Technology, Shanghai, 201306, China c National Demonstration Center for Experimental Fisheries Science Education, Shanghai Ocean University, Shanghai, 201306, China b
ARTICLE INFO
ABSTRACT
Keywords: Evolution Expression Fish Grass carp Infection Tumor necrosis factor receptor superfamily
The TNF receptor superfamily member 25 (TNFRSF25) is part of the tumor necrosis factor receptor superfamily and contains a typical death domain. It is also known as DR3, TRAMP, LARD, WSL-1, Apo-3 and TR3, and has a vital role in regulating cell proliferation, differentiation and apoptosis. In this study, a homologue of the TNFRSF25 gene was identified in grass carp (Ctenopharyngodon idella). It encodes a transmembrane protein with an extracellular domain containing a cysteine-rich domain and an intracellular domain containing a death domain. It is an orthologue of fish TNFRSF1ALs and shares conserved gene synteny with human TNFRSF25. Expression studies showed that CiTNFRSF25 was constitutively expressed in the majority of fish tissues and can be modulated by interleukin 4/13B and infection by F. columnare. To our knowledge, this is the first report describing the existence of a TNFRSF25 homologue in teleost fish.
1. Introduction The tumor necrosis factor superfamily (TNFSF) of ligands and receptors (TNFRSF) are fundamental for many biological processes such as immunity, inflammation and hematopoiesis (Aggarwal, Gupta, & Kim, 2012). TNF was first discovered during attempts to treat mice with cancer with injections of serum pre-challenged with Serratia marcescens polysaccharide (Aggarwal et al., 2012). TNFRSF25 was discovered during trials to isolate proteins that interact with TNF receptor 1 (TNFR1) in the 1990's (Schreiber & Podack, 2013). To date, many members of the TNF superfamily have been identified in vertebrates. There are approx. 19 TNFSFs and 29 TNFRSFs in humans (Wiens & Glenney, 2011). The TNFRSF can be divided into three main groups: 1) the TNF receptor associated factor (TRAF) binding domain containing receptors, 2) the death domain (DD) motif (approx. 80 amino acids) containing receptors, and 3) the decoy receptors (Bodmer, Schneider, & Tschopp, 2002). The TNFRSFs contain 1-4 cysteine-rich domains (CRDs) in their ectoplasmic region and each CRD consists of three disulfide bonds with a core motif of CXXCXXC (Tafalla & Granja, 2018). The DD is present in a number of TNFR associated proteins and related
molecules such as death receptor (DR3-6) and Fas, which are primarily involved in signaling cell death (Wang et al., 2001). Among the TNFRSFs, the isoform TNFRSF25 shares the highest sequence homology with TNFRSF1 (Bittner, Knoll, & Ehrenschwender, 2017b). TNFRSF1 is ubiquitously expressed whilst TNFRSF25 expression is restricted primarily to lymphocyte-rich tissues such as the spleen, thymus, kidney and colon (Al-Lamki et al., 2003; Schreiber & Podack, 2013). Migone et al. have demonstrated that the TNF-like protein 1A (TL1A), also known as the TNF ligand superfamily 15 (TNFSF15), acts as the sole ligand for TNFRSF25 (Migone et al., 2002). TNFRSF25, once activated by TL1A, activates several cellular signaling pathways mediated by the nuclear factors (NF)-κB, c-Jun N-terminal kinase (JNK) and p38 mitogen activated protein kinases (MAPKs), leading to cell apoptosis or death (Bittner, Knoll, & Ehrenschwender, 2017a). TNFRSF25 mediated signaling can be suppressed by decoy receptor 3 (DcR3) via competition with TL1A (Siakavellas & Bamias, 2015). Homologues of TNFRSF members have been reported in fish (Secombes, 2016). In addition, the functions of TNFRSF1a/TNFR1 and TNFRSF1b/TNFR2 have also been established (Grayfer & Belosevic, 2009; Xu, Nie, Sun, & Chang, 2010; Zhang et al., 2016). Recombinant
∗ Corresponding author.Key Laboratory of Exploration and Utilization of Aquatic Genetic Resources, Ministry of Education, Shanghai Ocean University, 999 Huchenghuan Road, Shanghai, 201306, China. ∗∗ Corresponding author. Key Laboratory of Exploration and Utilization of Aquatic Genetic Resources, Ministry of Education, Shanghai Ocean University, 999 Huchenghuan Road, Shanghai, 201306, China. E-mail addresses: [email protected] (Q. Gao), [email protected] (J. Zou).
https://doi.org/10.1016/j.aaf.2019.10.007 Received 22 March 2019; Received in revised form 13 June 2019; Accepted 30 October 2019 2468-550X/ © 2019 Published by Elsevier B.V. on behalf of Shanghai Ocean University. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Please cite this article as: Xingxing Cheng, et al., Aquaculture and Fisheries, https://doi.org/10.1016/j.aaf.2019.10.007
Aquaculture and Fisheries xxx (xxxx) xxx–xxx
X. Cheng, et al.
goldfish TNFα2 induces the expression of TNFRSF1b/TNFR2 and downregulates its own expression in primary macrophages. In goldfish and grass carp, soluble receptors containing the extracellular region interact with TNFα and antagonize TNFα activities. However, research into fish TNFRSF25 is scarce. In the present study, an orthologue of TNFRSF25 (termed CiTNFRSF25) was identified in grass carp (Ctenopharyngodon idella) and its phylogenetic relationship with other known TNFRSF25s were determined. Expression analysis showed that the CiTNFRSF25 was differentially expressed in tissues of healthy fish and could be modulated after exposure to Flavobacterium columnare (F. columnare). The results suggest that the CiTNFRSF25 is involved in immune response to bacterial infection.
and 100 U/mL streptomycin) was prepared and pre-cooled before the experiment. The head kidney was transferred to a 70 μm nylon mesh and gently pushed through the mesh. The cell suspension was loaded onto a 51% Percoll gradient (GE Healthcare Life Sciences, USA) and centrifuged at 400 × g for 30 min at 4 °C without braking. The cells were collected at the Percoll/medium interface and resuspended in L-15 medium (0.1% FBS, 0.1% heparin, 100 U/mL penicillin, 100 U/mL streptomycin). Finally, the cells were washed twice with L-15 medium (0.1% FBS, 100 U/mL penicillin, 100 U/mL streptomycin) and centrifuged at 400 × g at 4 °C for 10 min. Following isolation, the cells were cultured in cell culture medium (RPMI with 10% FBS, 100 U/mL penicillin and 100 U/mL streptomycin) in 6 well plates (1.5 × 106 cells/well) at 28 °C for 4 h in a 5% CO2 incubator. The rCiIL-4/13B protein was added to the wells at a final concentration of 20 ng/mL and at day 3, the same amount of rCiIL4/13B was added again. The control cells were treated in parallel with an equal volume of protein buffer containing 20 mmol/L His-HCl and 50 mmol/L NaCl. The cells were collected at 12 h, 24 h, 48 h, 72 h and 7d for quantitation of mRNA levels of CiTNFRSF25 by qPCR as described below.
2. Materials and methods 2.1. Fish maintenance and tissue sampling Grass carp (120 ± 12 g), were purchased from a local fish farm (Shanghai, China). All fish were acclimatized at 25 ± 2 °C for 14 days in aerated tanks and fed with commercial diet twice daily until 24 h before the challenge experiment. Fish were anaesthetized with 0.05% MS-222 prior to experimental procedures. All experiments complied with the national regulations and guidelines of Shanghai Ocean University for use of animals for research (License No., SHOU-DW-2019-003). For tissue sampling, fish were anaesthetized with MS-222 and killed by cutting the spinal cord. Tissues were collected immediately, snap frozen in liquid nitrogen and stored at −80 °C until use.
2.5. RNA isolation and synthesis of cDNA All tissues were quickly frozen in liquid nitrogen after sampling and kept in a −80 °C freezer. Total RNA was extracted using TRIZOL (SIGMA, USA) according to the manufacturer's instructions. The firststrand cDNA was synthesized using a Prime Script™ RT reagent Kit with gDNA Eraser (Perfect Real Time) (TaKaRa, Japan) for cloning and quantitative real-time PCR (qPCR). The synthesized cDNA was stored at −20 °C until use.
2.2. Challenge experiment The pathogenic G4 strain of F. columnare was provided by Dr Haixie Xie, the Institute of Hydrobiology, Chinese Academy of Sciences (Wuhan, China) (Xie, Nie, & Sun, 2010). Experimental fish were randomly divided into two groups (12 fish per group) and were injected intraperitoneally (i.p.) withbacterial suspension (1 μL/g body weight, 1 × 107 cfu/mL) or PBS (1 μL/g body weight). Three fish were sampled from each group and killed at 12, 24, 48 and 72 h post injection (hpi). The head kidney and spleen were collected for total RNA extraction.
2.6. Cloning of the full-length TNFRSF25 sequences The partial cDNA sequence of grass carp TNFRSF25 was obtained by analyzing the whole-genome sequence database (http://www.ncgr.ac. cn/grasscarp/) (Wang et al., 2015). Based on the partial cDNA sequences, the 5′ and 3′ untranslated region (UTR) were obtained by Touchdown PCR and Nest PCR. The primers and adaptors used to obtain the full-length cDNA sequence of CiTNFRSF25 in this study are listed in Table 1. The amplicons were checked by electrophoresis and extracted from the agarose gel using a Gel Extraction Kit (OMEGA, USA), ligated into the pMD19-T vector (TaKaRa, Japan) and transformed into the E. coli DH5α competent cells. Positive clones containing inserts of correct size were screened by PCR and three randomly selected clones were sequenced (Sangon shanghai, China). Following the 5′ and 3′ RACE, the full-length coding sequence was confirmed by PCR using a pair of primers located at the 5′ and 3’ untranslated region (UTR) (Table 1).
2.3. Production and purification of recombinant interleukin (rCiIL-4/13B) The CiIL-4/13B was cloned into the expression vector pEHISTEVb using the restriction enzymes NcoI and HindIII. BL21 Star (DE3) competent cells were transformed with the pEHISTEVb-CiIL-4/13B plasmid. The recombinant CiIL-4/13B protein was expressed as inclusion bodies after induction of the transformed BL21 cells with 1 mM IPTG (SIGMA, USA). The inclusion bodies were dissolved in 6 M guanidine hydrochloride and gradually added into the refolding buffer (100 mmol/L Tris-HCl, 2 mmol/L EDTA, 400 mmol/L L-arginine-HCl, 0.5 mmol/L oxidized glutathione and 5 mmol/L reduced glutathione, pH 7.4). After incubation for 20 h at 4 °C, the refolded protein solution was centrifuged at 13,000 rpm for 20 min, concentrated by filtration, and purified by HPLC chromatography using a Superdex 75 10/60 column (GE Healthcare Life Sciences, USA). The protein fractions were collected in 1.5 mL tubes and checked by SDS-PAGE. The fractions containing protein of the expected size of recombinant CiIL-4/13B protein was mixed and quantified using a Pierce® BCA Protein Assay Kit (Thermo Fisher Scientific, USA) according to the manufacturer's protocols.
Table 1 Primers used in this study. Primer name
Sequence (5′-3′)
Application
F R UPM(long)
ATAGCCTCCCAATACCAATG GTTCTAGCTTCTCTTGCAGT CTAATACGACTCACTATAGGGC AAGCAGTGGTATCAACGCAGAGT CTAATACGACTCACTATAGGGC AAGCAGTGGTATCAACGCAGAGT TCCCACAAACTACTGCTGTGG CATGTTTTCATCAATTTGTAAGTC GGAACGAATCGAACTGGAGG CTACGTCTTTGGAGCCAGAGCAG ACTCGTCATTCATGACTCTTT TTTGCATTTATTTTTACATTATGCT TGTACCACGGTTGAAACAGACTT GCGTTTCTTTCCGTTGCTATGGGA CAGCACAAACATGGGCTGGTTC ACGGGTACAGTTCCAATACCTCCA
Partial CDS amplification Partial CDS amplification RACE
UPM(short) NUP 5′RACE-R1 5′RACE-R2 3′RACE-F1 3′RACE-F2 F′ R′ QPCR-F QPCR-R EF1α-F EF1α-R
2.4. Isolation of primary leucocytes and stimulation by interleukin (IL) −4/13B Primary leucocytes were collected from the head kidney of healthy grass carp using Percoll gradient centrifugation, which was carried out as follows. L-15 medium (2% FBS, 0.1% heparin, 100 U/mL penicillin 2
RACE RACE Touchdown PCR Nest PCR Touchdown PCR Nest PCR Verify the full-length cDNA Verify the full-length cDNA QPCR QPCR QPCR QPCR
Aquaculture and Fisheries xxx (xxxx) xxx–xxx
X. Cheng, et al.
2.7. Sequence analysis of TNFRSF25 The full-length sequence of TNFRSF25 cDNA was analyzed using the BLAST program in the NCBI database (http://www.ncbi.nlm.nih.gov). The deduced amino acid sequence was analyzed using the programs listed on the ExPASy website (http://www.us.expasy.org/tools/) (Wilkins et al., 1999). The amino acid sequences of vertebrate TNFRSF25s were obtained from the NCBI database (www.ncbi.nih.gov) and used for multiple alignment using the ClustalW 2 program (Chenna, 2003). The protein domains were predicted using the Simple Modular Architecture Research Tool (SMART) (http://smart.embl-heidelberg. de/). The signal peptide and the transmembrane region were predicted using the SignalP4.1 (http://www.cbs.dtu.dk/services/SignalP/) and TMHMM 2.0 Server (http://www.cbs.dtu.dk/services/TMHMM) respectively. A neighbor joining phylogenetic tree was constructed using the MEGA 5.0 programme with p-distance parameters and complete deletion of gaps. The size of grass carp TNFRSF25 introns and exons was obtained by comparing the genomic and corresponding cDNA sequence. Gene synteny data of human, mouse and zebrafish were taken from the Ensembl database and that of grass carp obtained by analyzing the genome sequences. 2.8. Real-time PCR quantification of gene expression Quantitative real-time PCR (qPCR) was carried out to examine gene expression. The primers for CiTNFRSF25 and elongation factor-1α (EF1α) are listed in Table 1. The qPCR reaction was set up as follows: 5 μL of SYBR Premix (Yeasen shanghai, China), 4.6 μL of the cDNA and 0.2 μL of forward and reverse primer (10 μmol/L). The qPCR was performed in a Bio-Rad Light Cycler 96 Real-time detection system (Roche, Switzerland) using SYBR Premix under following conditions: a preincubation at 95 °C for 30 s, followed by 40 cycles of 95 °C/5 s, 62 °C/ 30 s, 72 °C/10 s, and a melting reaction at 95 °C/10 s, 75 °C/60 s, 95 °C/ 1s. Each sample was run in triplicate. In these experiments, EF-1α was used as the internal control to normalize gene expression. Fold change in expression was calculated by comparing the normalized mRNA levels of CiTNFRSF25 of treatment group and that of the corresponding control group. 2.9. Data analysis The qPCR data were analyzed using one-way analysis of variance (One-Way ANOVA) and a LSD post hoc test with the SPSS package 20.0 (SPSS Inc., Chicago, IL, USA). P < 0.05 and P < 0.01 were considered significantly different between groups.
Fig. 1. Nucleotide and deduced protein sequence of CiTNFRSF25. The start and stop codon of the open reading frame are in bold. The polyadenylation signal (AATAAA) is underlined. The putative signal peptide is in Italics. Two potential N-glycosylation sites (grey), cysteine rich domains (CRDs) (green), death domain (DD) (blue) and transmembrane domain (yellow) are highlighted. The conserved cysteine residues in the CRD are circled. The predicted sumoylation site is boxed.
3. Results 3.1. Amino acid sequence and phylogenetic analysis of CiTNFRSF25 The cDNA sequence of CiTNFRSF25 was obtained and deposited in the NCBI database (Accession number: MK651506). The full-length cDNA sequence of CiTNFRSF25 was 1420 bp in length, and contained a 5′-UTR of 60 bp, a 3’ -UTR of 208 bp and an open reading frame of 1152 bp (Fig. 1). The CiTNFRSF25 cDNA encoded a peptide of 383 aa with a calculated molecular weight of 43.1 kDa and an isoelectric point of 8.0. A polyadenylation signal (AATAAA) site was located 15 bp upstream from the poly A tail (Fig. 1). The CiTNFRSF25 contained a signal peptide of 22 aa (Met1-Cys22) and a transmembrane region of 23 aa (Leu173-Phe195). A characteristic TNFR DD was identified between Val291 and Leu371 (Fig. 1). Further analysis revealed that the CiTNFRSF25 contained two conserved potential N-glycosylation sites (Asn55-Ser57, Asn242-Thr244) and a sumoylation site (Ala346-Glu349). In addition, there was a single typical TNFR domain, also called the cysteine rich domain (CRD), ranging from 48 to 89 aa, unlike mammalian and avian TNFRSF25s that contains two or three CRDs (Fig. 3).
A protein sequence alignment of TNFRSF25s was generated. As shown in Fig. 2, the CRD and DD were highly conserved in humans, mouse, chicken, zebrafish, crucian carp and grass carp. The CRD of grass carp contained six cysteine residues (Cys48, Cys63, Cys66, Cys69, Cys81 and Cys89) and three disulfide bonds (Fig. 2). To better understand the evolution of TNFRSF25, an unrooted phylogenetic tree was constructed using the Neighbor-Joining method (Fig. 4). It was apparent that CiTNFRSF25 was clustered with fish TNFRSF25s, also annotated as TNFRSF1ALs in some species in the NCBI and Ensembl database. Fish TNFRSF25s/TNFRSF1ALs formed a sister clade with TNFRSF25s from mammals and birds with a bootstrap value of 83%. The strong grouping demonstrates the homologous relationship of TNFRSF25s between fish and higher vertebrates. The CiTNFRSF25 gene organization was obtained by analyzing the 3
Aquaculture and Fisheries xxx (xxxx) xxx–xxx
X. Cheng, et al.
Fig. 2. Multiple sequence alignment of TNFRSF25 proteins. The identical aa residues are shaded in black and similar aa residues in grey. The signal peptide (SP), cysteine rich domain (CRD), transmembrane domain (TM) and death domain (DD) are indicated. Homo sapiens: AAO63495.1; Mus musculus:AAH17526.1;Gallus gallus:XP_423315.4;Danio rerio:XP_009295056.1;Carassius auratus:XP_026097489.1.
genomic and cDNA sequence. It spanned approx. 6.8 kb and was longer than its human and mouse counterparts and was organized into ten exons and nine introns, the same number as found in humans and mouse (Fig. 5). The CiTNFRSF25 gene was located in Scaffold_1000001 and the surrounding genes included CCDC30, UBR4 and RCC2 which were also present in the TNFRSF25 gene locus in humans, mouse and zebrafish (Fig. 6). As shown in Table 2, the deduced aa sequence of the CiTNFRSF25 gene shared 72.1% sequence identity with crucian carp TNFRSF25 and 20%–70% sequence identity with other vertebrate TNFRSF25s. The CRD domain of CiTNFRSF25 shared 57.1% and 54.8% aa identity with the zebrafish and crucian carp homologues, respectively (Table 3). However, only 21.4% sequence identity was found between grass carp and rainbow trout homologues (Table 3). Table 4 shows that the DD of CiTNFRSF25 was also highly conserved, sharing 97.3% sequence identity with the DD of zebrafish and crucian carp TNFRSF25.
3.2. Tissue distribution The expression levels of CiTNFRSF25 were determined in nine tissues of healthy grass carp using qPCR. As shown in Fig. 7, the CiTNFRSF25 transcripts were constitutively expressed in all the tissues examined, including brain, skin, gills, intestine, thymus, spleen, head kidney, trunk kidney and liver. The gills exhibited the highest expression followed by brain, spleen and liver. The lowest expression was detected in the head kidney. 3.3. Gene expression in response to F. columnare The expression levels of CiTNFRSF25 were investigated in grass carp after infection by F. columnare. As shown in Fig. 8, the CiTNFRSF25 was significantly down-regulated (P < 0.01) in both head kidney and spleen at 24 hpi. In the head kidney, the CiTNFRSF25 transcripts increased at 12 hpi, decreased significantly at 24 hpi and thereafter returned to normal level. However, in the spleen, the expression of CiTNFRSF25 hardly changed after infection except for a transient 4
Aquaculture and Fisheries xxx (xxxx) xxx–xxx
X. Cheng, et al.
Fig. 3. The protein domains of TNFSFR25 predicted using SMART program.
down-regulation at 24 hpi.
expression, the rCiIL-4/13B protein was purified. Primary head kidney leukocytes were isolated and the effects of rCiIL-4/13B on the CiTNFRSF25 expression examined. The cells were incubated with the rCiIL-4/13B protein for 12 h, 24 h, 48 h, 72 h and 7 d. Fig. 9 shows that the CiTNFRSF25 transcripts were up-regulated at 12, 24 and 48 hpi and returned to normal level at 72 h. The results demonstrated that the
3.4. Gene expression of CiTNFRSF25 in primary head kidney leucocytes after stimulation with rCiIL-4/13B To determine the effects of rCiIL-4/13B on the CiTNFRSF25
Fig. 4. Phylogenetic tree analysis of TNFRSF25s from Ctenopharyngodon idella and other species. The tree was constructed using the MEGA 5.0 program with the Neighbor-Joining method. Numbers at tree nodes represent the percentage of bootstrap values after 10,000 replicates. 5
Aquaculture and Fisheries xxx (xxxx) xxx–xxx
X. Cheng, et al.
Fig. 5. Genomic organization of the TNFRSF25 gene from human, mouse, grass carp and zebrafish. The exons are shown from 5′ to 3′ end. Black and open boxes represent coding regions and untranslated regions, respectively. The size of the coding region in each exons is numbered.
CiTNFRSF25 expression was modulated in kidney leukocytes by rCiIL4/13B.
Table 2 Percentage of amino acid identity (%) of TNFRSF25.
4. Discussion
1 2 3 4 5 6 7
In this paper, a homologue of TNFRSF25 (termed CiTNFRSF25) was identified in grass carp. Bioinformatics analysis revealed that it possessed the typical structure of other TNFRSF25 molecules, consisting of a cysteine-rich domain in the extracellular region and a death domain in the intracellular region. Moreover, the gene synteny of CiTNFRSF25 resembled that of human, mouse and zebrafish, suggesting they shared a common ancestor during evolution. The CiTNFRSF25 was constitutively expressed in tissues and was modulated by rCiIL-4/13B in primary head kidney leucocytes and by bacterial infection in head kidney and spleen.
a
H. sapiens M. musculus G. gallus O. mykiss C. auratus D. rerio C. idella
1
2
3
4
5
6
7
100 68.1 31.1 24.3 20.1 21.3 20.9
100 27.2 24.1 21.1 22.7 21.5
100 20.4 20.3 21.0 20.3
100 31.6 30.1 29.9
100 64.4 72.1a
100 67.0
100
Highest amino acid identity (%).
The TNFRSF25 is known to be a potent inducer of cell apoptosis and necroptosis in mammals and has similar functions to Fas and TNFRSF1 (Bodmer et al., 1997). The functions of TNFRSF25 are mediated via the
Fig. 6. Comparative synteny analysis of TNFRSF25 genes. The genomic data of human, mouse, and zebrafish were retrieved from the Ensembl database. The CiTNFRSF25 data were analyzed using the sequence deposited in the genome database. Gene symbols were taken from the Ensembl database. 6
Aquaculture and Fisheries xxx (xxxx) xxx–xxx
X. Cheng, et al.
Table 3 Percentage of amino acid identity (%) of CRDs in TNFRSF25.
1 2 3 4 5 6 7 a
H. sapiens M. musculus G. gallus O. mykiss C. auratus D. rerio C. idella
1
2
3
4
5
6
7
100 67.5 35.9 34.9 28.6 28.6 26.2
100 32.1 30.2 31.0 28.6 28.6
100 28.6 31.0 28.6 31.0
100 28.6 23.8 21.4
100 59.5 54.8
100 57.1a
100
6
7
Highest amino acid identity (%).
Table 4 Percentage of amino acid identity (%) of DD in TNFRSF25.
1 2 3 4 5 6 7 a
H. sapiens M. musculus G. gallus O. mykiss C. auratus D. rerio C. idella
1
2
100 95.0 62.5 42.5 37.5 37.0 36.4
100 65.0 41.3 38.9 38.4 37.7
3
100 46.2 43.1 42.5 42.9
4
100 56.2 56.8 57.7
5
100 97.3 97.3a
100 97.3a
Fig. 8. The expression levels of CiTNFRSF25 in head kidney and spleen stimulated with PBS or F. cloumnare for 12, 24, 48 and 72 hpi. CiTNFRSF25 expression levels were calculated relative to that of EF1α gene (internal control) and presented as fold change relative to the control (=1). The data are shown as mean ± S.E (N = 3). **P < 0.01 or *P < 0.05 are considered significantly different.
100
Highest amino acid identity (%).
Fig. 9. The expression levels of CiTNFRSF25 in primary head kidney leucocytes after stimulation with rCiIL-4/13B. The head kidney cells were isolated from 3 individual fish, and were cultured in 25 cm2 flasks for 4 h and then stimulated with 20 ng/mL of rCiIL-4/13B or protein buffer. At 12 h, 24 h, 48 h, 72 h and 7 d, the cells were harvested for qPCR analysis. The expression levels of CiTNFRSF25 were calculated relative to that of EF1α gene (internal control) and presented as fold change relative to the control (=1). The data are shown as mean + S.E (N = 3). *P < 0.05 is considered significantly different.
Fig. 7. Tissue expression of CiTNFRSF25. The expression levels of CiTNFRSF25 in the brain, skin, gills, intestine, thymus, spleen, head kidney, trunk kidney and liver were determined by qPCR and are presented as relative expression to EF1α (N = 3).
conserved gene synteny of genes neighboring the TNFRSF25 gene in fish and mammals (Fig. 6). Therefore, we propose that the TNFRSF1AL genes annotated in fish should be re-named, TNFRSF25, to avoid confusion in the future. In mammals, TNFRSF25 was expressed mainly in lymphocyte-rich tissues upon activation with inflammatory cytokines (Meylan et al., 2008). In the present study, CiTNFRSF25 mRNA transcripts were detected in a broad range of tissues, but at different levels (Fig. 7). For example, the expression of the CiTNFRSF25 gene was markedly higher in gills, brain and spleen than in other tissues (Fig. 7). It has previously been shown that TNFRSF25 is restricted to lymphocytes and is highly expressed by T reg cells (Schreiber et al., 2010; Twohig et al., 2012). However, other studies demonstrated that the expression of TNFRSF25 was less restricted (Cretney et al., 2003; Schreiber & Podack, 2013). We found that 24 h after i. p. administration of F. columnare, the expression levels of CiTNFRSF25 were decreased in both spleen and head kidney, the major systemic immune organs in teleost fish (Fig. 8). The inflammatory response to F. columnare infection was probably caused by migration of immune cells from the spleen and head kidney to the site
death domain in the intracellular region, and involves recruitment and activation of downstream signal molecules (Bossen et al., 2006; Ware, 2003). Once activated by its ligand (TNF-like molecule 1A) TNFRSF25 initiates two distinct downstream signaling cascades (Siakavellas, Sfikakis, & Bamias, 2015), 1) interaction of domains with the TNFRassociated death domain protein (TRADD), and 2) the TNFR-associated factor (TRAF) and receptor-interacting (RIP) proteins (Micheau & Tschopp, 2003), both elicit pro-inflammatory signals or cell death (Bittner & Ehrenschwender, 2017). CiTNFRSF25 has a well conserved death domain which is located between 291 aa and 371 aa (Fig. 2), suggesting it may have similar functions to the mammalian counterpart. In fact, cellular signaling molecules interacting with TNFRSF such as TRAF proteins have been reported in fish (Tafalla & Granja, 2018). Phylogenetic tree analysis revealed that the CiTNFRSF25 formed a clade with fish TNFRSF1ALs. This fish TNFRSF25/TNFRSF1ALs clade formed an expanded clade with mammalian TNFRSF25s supported by a high bootstrap value of 83% (Fig. 3), indicating they are evolutionarily related. The orthologous relationship was also supported by the 7
Aquaculture and Fisheries xxx (xxxx) xxx–xxx
X. Cheng, et al.
of infection to eliminate invading pathogens. Additionally, CiTNFRSF25 was up-regulated by CiIL-4/13B in primary kidney leukocytes (Fig. 9). This suggests that cytokines such as IL-4/13B may regulate TNFRSF25 mediated responses by altering the numbers of receptor molecules on the cell surface. To summarize, this is the first report on the TNFRSF25 gene in teleost fish. The results indicate that the TNFRSF25 mRNA was constitutively expressed in a broad range of tissues and could be modulated by infection with F. columnare. The predicted sequence motifs of CiTNFRSF25 suggests that it may have similar functions to mammalian TNFRSF25s.
human kidney and in rejecting renal transplants. American Journal Of Pathology, 163, 401–411. Bittner, S., & Ehrenschwender, M. (2017). Multifaceted death receptor 3 signaling-promoting survival and triggering death. FEBS Letters, 591, 2543–2555. Bittner, S., Knoll, G., & Ehrenschwender, M. (2017a). Death receptor 3 mediates necroptotic cell death. Cellular and Molecular Life Sciences, 74, 543–554. Bittner, S., Knoll, G., & Ehrenschwender, M. (2017b). Death receptor 3 signaling enhances proliferation of human regulatory T cells. FEBS Letters, 591, 1187–1195. Bodmer, J. L., Burns, K., Schneider, P., Hofmann, K., Steiner, V., Thome, M., et al. (1997). TRAMP, a novel apoptosis-mediating receptor with sequence homology to tumor necrosis factor receptor 1 and Fas(Apo-1/CD95). Immunity, 6, 79–88. Bodmer, J., Schneider, L. P., & Tschopp, J. (2002). The molecular architecture of the TNF superfamily. Trends in Biochemical Sciences, 27, 19–26. Bossen, C., Ingold, K., Tardivel, A., Bodmer, J. L., Gaide, O., & Hertig, S. (2006). Interactions of tumor necrosis factor (TNF) and TNF receptor family members in the mouse and human. Journal of Biological Chemistry, 281, 13964–13971. Chenna, R. (2003). Multiple sequence alignment with the Clustal series of programs. Nucleic Acids Research, 31, 3497–3500. Cretney, E., Uldrich, A. P., Berzins, S. P., Strasser, A., Godfrey, D. I., & Smyth, M. J. (2003). Normal thymocyte negative selection in TRAIL-deficient mice. Journal of Experimental Medicine, 198, 491–496. Grayfer, L., & Belosevic, M. (2009). Molecular characterization of tumor necrosis factor receptors 1 and 2 of the goldfish (Carassius aurutus L .). Molecular Immunology, 46, 2190–2199. Meylan, F., Davidson, T. S., Kahle, E., Kinder, M., Acharya, K., Jankovic, D., et al. (2008). The TNF-family receptor DR3 is essential for diverse T cell-mediated inflammatory diseases. Immunity, 29, 79–89. Micheau, O., & Tschopp, J. (2003). Induction of TNF receptor I-mediated apoptosis via two sequential signaling complexes. Cell, 114, 181–190. Migone, T. S., Zhang, J., Luo, X., Zhuang, L., Chen, C., Hu, B., et al. (2002). TL1A is a TNFlike ligand for DR3 and TR6/DcR3 and functions as a T cell costimulator. Immunity, 16, 479–492. Schreiber, T. H., & Podack, E. R. (2013). Immunobiology of TNFSF15 and TNFRSF25. Immunologic ResearchImmunologic Research, 57, 3–11. Schreiber, T. H., Wolf, D., Tsai, M. S., Chirinos, J., Deyev, V. V., Gonzalez, L., et al. (2010). Therapeutic Treg expansion in mice by TNFRSF25 prevents allergic lung inflammation. Journal of Clinical Investigation, 120, 3629–3640. Secombes, C. J. (2016). What's new in fish cytokine research? Fish & Shellfish Immunology, 53, 1–3. Siakavellas, S. I., & Bamias, G. (2015). Tumor necrosis factor-like cytokine TL1A and its receptors DR3 and DcR3: Important new factors in mucosal homeostasis and inflammation. Inflammatory Bowel Diseases, 21, 2441–2452. Siakavellas, S. I., Sfikakis, P. P., & Bamias, G. (2015). The TL1A/DR3/DcR3 pathway in autoimmune rheumatic diseases. Seminars in Arthritis and Rheumatism, 45, 1–8. Tafalla, C., & Granja, A. G. (2018). Novel insights on the regulation of B cell functionality by members of the tumor necrosis factor superfamily in jawed fish. Frontiers in Immunology, 9, 1285. Twohig, J. P., Marsden, M., Cuff, S. M., Ferdinand, J. R., Gallimore, A. M., Perks, W. V., et al. (2012). The death receptor 3/TL1A pathway is essential for efficient development of antiviral CD4(+) and CD8(+) T-cell immunity. Federation of American Societies for Experimental Biology Journal, 26, 3575–3586. Wang, Y., Lu, Y., Zhang, Y., Ning, Z., Li, Y., Zhao, Q., et al. (2015). The draft genome of the grass carp (Ctenopharyngodon idellus) provides insights into its evolution and vegetarian adaptation. Nature Genetics, 47 625-6231. Wang, E. C., Thern, A., Denzel, A., Kitson, J., Farrow, S. N., & Owen, M. J. (2001). DR3 regulates negative selection during thymocyte development. Molecular and Cellular Biology, 21, 3451–3461. Ware, C. F. (2003). The TNF superfamily. Cytokine & Growth Factor Reviews, 14, 181–184. Wiens, G. D., & Glenney, G. W. (2011). Origin and evolution of TNF and TNF receptor superfamilies. Developmental & Comparative Immunology, 35, 1324–1335. Wilkins, M. R., Gasteiger, E., Bairoch, A., Sanchez, J. C., Williams, K. L., Appel, R. D., et al. (1999). Protein identification and analysis tools in the ExPASy server. Methods in Molecular Biology, 112, 531–552. Xie, H. X., Nie, P., & Sun, B. J. (2010). Characterization of two membrane-associated protease genes obtained from screening out-membrane protein genes of Flavobacterium columnare G4. Journal of Fish Diseases, 27, 719–729. Xu, Z., Nie, P., Sun, B., & Chang, M. (2010). Molecular identification and expression analysis of tumor necrosis factor receptor-associated factor 2 in grass carp Ctenopharyngodon idella. Acta Biochimica et Biophysica Sinica, 39, 857–868. Zhang, S., Zhang, R., Ma, T., Qiu, X., Wang, X., Zhang, A., et al. (2016). Identification and functional characterization of tumor necrosis factor receptor 1 (TNFR1) of grass carp ( Ctenopharyngodon idella ). Fish & Shellfish Immunology, 58, 24–32.
Acknowledgements We thank Dr Haixia Xie from the Institute of Hydrobiology, Chinese Academy of Sciences for providing F. columnare in this study. This research is supported by the National Natural Science Foundation of China (Grant numbers U1605211 and 31272666). Abbreviations CiTNFRSF25 TNF receptor superfamily member 25 of Ctenopharyngodon idella CCDC30 coiled-coil domain containing 30 CRD cysteine-rich domain DD death domain DcR3 decoy receptor 3 EF1α elongation factor-1α F. columnare Flavobacterium columnare JNK c-Jun N-terminal kinase MAPKs mitogen activated protein kinases qPCR Quantitative real-time PCR RIP receptor-interacting RCC2 regulator of chromosome condensation 2 SP signal peptide; TNFSF the tumor necrosis factor superfamily TNFRSF the tumor necrosis factor receptor superfamily TNFRSF25 TNF receptor superfamily member 25 TNFRSF1AL TNF receptor superfamily member 1 A like; TNFRSF15 TNF ligand superfamily 15 TL1A TNF-like protein 1A TNFRSF1a TNF receptor superfamily member 1 a TNFR1 TNF receptor superfamily member 1 TNFR2 TNF receptor superfamily member 2 TM transmembrane region TRADD TNFR-associated death domain protein TRAF TNFR-associated factor UBR4 Recombinant Ubiquitin Protein Ligase E3 Component NRecognin 4 References Aggarwal, B. B., Gupta, S. C., & Kim, J. H. (2012). Historical perspectives on tumor necrosis factor and its superfamily: 25 years later, a golden journey. Blood, 119, 651–665. Al-Lamki, R. S., Wang, J., Thiru, S., Pritchard, N. R., Bradley, J. A., Pober, J. S., et al. (2003). Expression of silencer of death domains and death-receptor-3 in normal
8
Contents lists available at ScienceDirect
Aquaculture and Fisheries journal homepage: http://www.keaipublishing.com/en/journals/ aquaculture-and-fisheries
Identification and modulation of expression of a TNF receptor superfamily member 25 homologue in grass carp (Ctenopharyngodon idella) Xingxing Chenga,b,c, Xinyu Jianga,b,c, Yunjie Songa,b,c, Jingduo Gaoa,b,c, Yujie Xuea,b,c, Zeinab Hassana,b,c, Qian Gaoa,b,c,∗, Jun Zoua,b,c,∗∗ a
Key Laboratory of Exploration and Utilization of Aquatic Genetic Resources, Ministry of Education, Shanghai Ocean University, Shanghai, 201306, China International Research Center for Marine Biosciences at Shanghai Ocean University, Ministry of Science and Technology, Shanghai, 201306, China c National Demonstration Center for Experimental Fisheries Science Education, Shanghai Ocean University, Shanghai, 201306, China b
ARTICLE INFO
ABSTRACT
Keywords: Evolution Expression Fish Grass carp Infection Tumor necrosis factor receptor superfamily
The TNF receptor superfamily member 25 (TNFRSF25) is part of the tumor necrosis factor receptor superfamily and contains a typical death domain. It is also known as DR3, TRAMP, LARD, WSL-1, Apo-3 and TR3, and has a vital role in regulating cell proliferation, differentiation and apoptosis. In this study, a homologue of the TNFRSF25 gene was identified in grass carp (Ctenopharyngodon idella). It encodes a transmembrane protein with an extracellular domain containing a cysteine-rich domain and an intracellular domain containing a death domain. It is an orthologue of fish TNFRSF1ALs and shares conserved gene synteny with human TNFRSF25. Expression studies showed that CiTNFRSF25 was constitutively expressed in the majority of fish tissues and can be modulated by interleukin 4/13B and infection by F. columnare. To our knowledge, this is the first report describing the existence of a TNFRSF25 homologue in teleost fish.
1. Introduction The tumor necrosis factor superfamily (TNFSF) of ligands and receptors (TNFRSF) are fundamental for many biological processes such as immunity, inflammation and hematopoiesis (Aggarwal, Gupta, & Kim, 2012). TNF was first discovered during attempts to treat mice with cancer with injections of serum pre-challenged with Serratia marcescens polysaccharide (Aggarwal et al., 2012). TNFRSF25 was discovered during trials to isolate proteins that interact with TNF receptor 1 (TNFR1) in the 1990's (Schreiber & Podack, 2013). To date, many members of the TNF superfamily have been identified in vertebrates. There are approx. 19 TNFSFs and 29 TNFRSFs in humans (Wiens & Glenney, 2011). The TNFRSF can be divided into three main groups: 1) the TNF receptor associated factor (TRAF) binding domain containing receptors, 2) the death domain (DD) motif (approx. 80 amino acids) containing receptors, and 3) the decoy receptors (Bodmer, Schneider, & Tschopp, 2002). The TNFRSFs contain 1-4 cysteine-rich domains (CRDs) in their ectoplasmic region and each CRD consists of three disulfide bonds with a core motif of CXXCXXC (Tafalla & Granja, 2018). The DD is present in a number of TNFR associated proteins and related
molecules such as death receptor (DR3-6) and Fas, which are primarily involved in signaling cell death (Wang et al., 2001). Among the TNFRSFs, the isoform TNFRSF25 shares the highest sequence homology with TNFRSF1 (Bittner, Knoll, & Ehrenschwender, 2017b). TNFRSF1 is ubiquitously expressed whilst TNFRSF25 expression is restricted primarily to lymphocyte-rich tissues such as the spleen, thymus, kidney and colon (Al-Lamki et al., 2003; Schreiber & Podack, 2013). Migone et al. have demonstrated that the TNF-like protein 1A (TL1A), also known as the TNF ligand superfamily 15 (TNFSF15), acts as the sole ligand for TNFRSF25 (Migone et al., 2002). TNFRSF25, once activated by TL1A, activates several cellular signaling pathways mediated by the nuclear factors (NF)-κB, c-Jun N-terminal kinase (JNK) and p38 mitogen activated protein kinases (MAPKs), leading to cell apoptosis or death (Bittner, Knoll, & Ehrenschwender, 2017a). TNFRSF25 mediated signaling can be suppressed by decoy receptor 3 (DcR3) via competition with TL1A (Siakavellas & Bamias, 2015). Homologues of TNFRSF members have been reported in fish (Secombes, 2016). In addition, the functions of TNFRSF1a/TNFR1 and TNFRSF1b/TNFR2 have also been established (Grayfer & Belosevic, 2009; Xu, Nie, Sun, & Chang, 2010; Zhang et al., 2016). Recombinant
∗ Corresponding author.Key Laboratory of Exploration and Utilization of Aquatic Genetic Resources, Ministry of Education, Shanghai Ocean University, 999 Huchenghuan Road, Shanghai, 201306, China. ∗∗ Corresponding author. Key Laboratory of Exploration and Utilization of Aquatic Genetic Resources, Ministry of Education, Shanghai Ocean University, 999 Huchenghuan Road, Shanghai, 201306, China. E-mail addresses: [email protected] (Q. Gao), [email protected] (J. Zou).
https://doi.org/10.1016/j.aaf.2019.10.007 Received 22 March 2019; Received in revised form 13 June 2019; Accepted 30 October 2019 2468-550X/ © 2019 Published by Elsevier B.V. on behalf of Shanghai Ocean University. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Please cite this article as: Xingxing Cheng, et al., Aquaculture and Fisheries, https://doi.org/10.1016/j.aaf.2019.10.007
Aquaculture and Fisheries xxx (xxxx) xxx–xxx
X. Cheng, et al.
goldfish TNFα2 induces the expression of TNFRSF1b/TNFR2 and downregulates its own expression in primary macrophages. In goldfish and grass carp, soluble receptors containing the extracellular region interact with TNFα and antagonize TNFα activities. However, research into fish TNFRSF25 is scarce. In the present study, an orthologue of TNFRSF25 (termed CiTNFRSF25) was identified in grass carp (Ctenopharyngodon idella) and its phylogenetic relationship with other known TNFRSF25s were determined. Expression analysis showed that the CiTNFRSF25 was differentially expressed in tissues of healthy fish and could be modulated after exposure to Flavobacterium columnare (F. columnare). The results suggest that the CiTNFRSF25 is involved in immune response to bacterial infection.
and 100 U/mL streptomycin) was prepared and pre-cooled before the experiment. The head kidney was transferred to a 70 μm nylon mesh and gently pushed through the mesh. The cell suspension was loaded onto a 51% Percoll gradient (GE Healthcare Life Sciences, USA) and centrifuged at 400 × g for 30 min at 4 °C without braking. The cells were collected at the Percoll/medium interface and resuspended in L-15 medium (0.1% FBS, 0.1% heparin, 100 U/mL penicillin, 100 U/mL streptomycin). Finally, the cells were washed twice with L-15 medium (0.1% FBS, 100 U/mL penicillin, 100 U/mL streptomycin) and centrifuged at 400 × g at 4 °C for 10 min. Following isolation, the cells were cultured in cell culture medium (RPMI with 10% FBS, 100 U/mL penicillin and 100 U/mL streptomycin) in 6 well plates (1.5 × 106 cells/well) at 28 °C for 4 h in a 5% CO2 incubator. The rCiIL-4/13B protein was added to the wells at a final concentration of 20 ng/mL and at day 3, the same amount of rCiIL4/13B was added again. The control cells were treated in parallel with an equal volume of protein buffer containing 20 mmol/L His-HCl and 50 mmol/L NaCl. The cells were collected at 12 h, 24 h, 48 h, 72 h and 7d for quantitation of mRNA levels of CiTNFRSF25 by qPCR as described below.
2. Materials and methods 2.1. Fish maintenance and tissue sampling Grass carp (120 ± 12 g), were purchased from a local fish farm (Shanghai, China). All fish were acclimatized at 25 ± 2 °C for 14 days in aerated tanks and fed with commercial diet twice daily until 24 h before the challenge experiment. Fish were anaesthetized with 0.05% MS-222 prior to experimental procedures. All experiments complied with the national regulations and guidelines of Shanghai Ocean University for use of animals for research (License No., SHOU-DW-2019-003). For tissue sampling, fish were anaesthetized with MS-222 and killed by cutting the spinal cord. Tissues were collected immediately, snap frozen in liquid nitrogen and stored at −80 °C until use.
2.5. RNA isolation and synthesis of cDNA All tissues were quickly frozen in liquid nitrogen after sampling and kept in a −80 °C freezer. Total RNA was extracted using TRIZOL (SIGMA, USA) according to the manufacturer's instructions. The firststrand cDNA was synthesized using a Prime Script™ RT reagent Kit with gDNA Eraser (Perfect Real Time) (TaKaRa, Japan) for cloning and quantitative real-time PCR (qPCR). The synthesized cDNA was stored at −20 °C until use.
2.2. Challenge experiment The pathogenic G4 strain of F. columnare was provided by Dr Haixie Xie, the Institute of Hydrobiology, Chinese Academy of Sciences (Wuhan, China) (Xie, Nie, & Sun, 2010). Experimental fish were randomly divided into two groups (12 fish per group) and were injected intraperitoneally (i.p.) withbacterial suspension (1 μL/g body weight, 1 × 107 cfu/mL) or PBS (1 μL/g body weight). Three fish were sampled from each group and killed at 12, 24, 48 and 72 h post injection (hpi). The head kidney and spleen were collected for total RNA extraction.
2.6. Cloning of the full-length TNFRSF25 sequences The partial cDNA sequence of grass carp TNFRSF25 was obtained by analyzing the whole-genome sequence database (http://www.ncgr.ac. cn/grasscarp/) (Wang et al., 2015). Based on the partial cDNA sequences, the 5′ and 3′ untranslated region (UTR) were obtained by Touchdown PCR and Nest PCR. The primers and adaptors used to obtain the full-length cDNA sequence of CiTNFRSF25 in this study are listed in Table 1. The amplicons were checked by electrophoresis and extracted from the agarose gel using a Gel Extraction Kit (OMEGA, USA), ligated into the pMD19-T vector (TaKaRa, Japan) and transformed into the E. coli DH5α competent cells. Positive clones containing inserts of correct size were screened by PCR and three randomly selected clones were sequenced (Sangon shanghai, China). Following the 5′ and 3′ RACE, the full-length coding sequence was confirmed by PCR using a pair of primers located at the 5′ and 3’ untranslated region (UTR) (Table 1).
2.3. Production and purification of recombinant interleukin (rCiIL-4/13B) The CiIL-4/13B was cloned into the expression vector pEHISTEVb using the restriction enzymes NcoI and HindIII. BL21 Star (DE3) competent cells were transformed with the pEHISTEVb-CiIL-4/13B plasmid. The recombinant CiIL-4/13B protein was expressed as inclusion bodies after induction of the transformed BL21 cells with 1 mM IPTG (SIGMA, USA). The inclusion bodies were dissolved in 6 M guanidine hydrochloride and gradually added into the refolding buffer (100 mmol/L Tris-HCl, 2 mmol/L EDTA, 400 mmol/L L-arginine-HCl, 0.5 mmol/L oxidized glutathione and 5 mmol/L reduced glutathione, pH 7.4). After incubation for 20 h at 4 °C, the refolded protein solution was centrifuged at 13,000 rpm for 20 min, concentrated by filtration, and purified by HPLC chromatography using a Superdex 75 10/60 column (GE Healthcare Life Sciences, USA). The protein fractions were collected in 1.5 mL tubes and checked by SDS-PAGE. The fractions containing protein of the expected size of recombinant CiIL-4/13B protein was mixed and quantified using a Pierce® BCA Protein Assay Kit (Thermo Fisher Scientific, USA) according to the manufacturer's protocols.
Table 1 Primers used in this study. Primer name
Sequence (5′-3′)
Application
F R UPM(long)
ATAGCCTCCCAATACCAATG GTTCTAGCTTCTCTTGCAGT CTAATACGACTCACTATAGGGC AAGCAGTGGTATCAACGCAGAGT CTAATACGACTCACTATAGGGC AAGCAGTGGTATCAACGCAGAGT TCCCACAAACTACTGCTGTGG CATGTTTTCATCAATTTGTAAGTC GGAACGAATCGAACTGGAGG CTACGTCTTTGGAGCCAGAGCAG ACTCGTCATTCATGACTCTTT TTTGCATTTATTTTTACATTATGCT TGTACCACGGTTGAAACAGACTT GCGTTTCTTTCCGTTGCTATGGGA CAGCACAAACATGGGCTGGTTC ACGGGTACAGTTCCAATACCTCCA
Partial CDS amplification Partial CDS amplification RACE
UPM(short) NUP 5′RACE-R1 5′RACE-R2 3′RACE-F1 3′RACE-F2 F′ R′ QPCR-F QPCR-R EF1α-F EF1α-R
2.4. Isolation of primary leucocytes and stimulation by interleukin (IL) −4/13B Primary leucocytes were collected from the head kidney of healthy grass carp using Percoll gradient centrifugation, which was carried out as follows. L-15 medium (2% FBS, 0.1% heparin, 100 U/mL penicillin 2
RACE RACE Touchdown PCR Nest PCR Touchdown PCR Nest PCR Verify the full-length cDNA Verify the full-length cDNA QPCR QPCR QPCR QPCR
Aquaculture and Fisheries xxx (xxxx) xxx–xxx
X. Cheng, et al.
2.7. Sequence analysis of TNFRSF25 The full-length sequence of TNFRSF25 cDNA was analyzed using the BLAST program in the NCBI database (http://www.ncbi.nlm.nih.gov). The deduced amino acid sequence was analyzed using the programs listed on the ExPASy website (http://www.us.expasy.org/tools/) (Wilkins et al., 1999). The amino acid sequences of vertebrate TNFRSF25s were obtained from the NCBI database (www.ncbi.nih.gov) and used for multiple alignment using the ClustalW 2 program (Chenna, 2003). The protein domains were predicted using the Simple Modular Architecture Research Tool (SMART) (http://smart.embl-heidelberg. de/). The signal peptide and the transmembrane region were predicted using the SignalP4.1 (http://www.cbs.dtu.dk/services/SignalP/) and TMHMM 2.0 Server (http://www.cbs.dtu.dk/services/TMHMM) respectively. A neighbor joining phylogenetic tree was constructed using the MEGA 5.0 programme with p-distance parameters and complete deletion of gaps. The size of grass carp TNFRSF25 introns and exons was obtained by comparing the genomic and corresponding cDNA sequence. Gene synteny data of human, mouse and zebrafish were taken from the Ensembl database and that of grass carp obtained by analyzing the genome sequences. 2.8. Real-time PCR quantification of gene expression Quantitative real-time PCR (qPCR) was carried out to examine gene expression. The primers for CiTNFRSF25 and elongation factor-1α (EF1α) are listed in Table 1. The qPCR reaction was set up as follows: 5 μL of SYBR Premix (Yeasen shanghai, China), 4.6 μL of the cDNA and 0.2 μL of forward and reverse primer (10 μmol/L). The qPCR was performed in a Bio-Rad Light Cycler 96 Real-time detection system (Roche, Switzerland) using SYBR Premix under following conditions: a preincubation at 95 °C for 30 s, followed by 40 cycles of 95 °C/5 s, 62 °C/ 30 s, 72 °C/10 s, and a melting reaction at 95 °C/10 s, 75 °C/60 s, 95 °C/ 1s. Each sample was run in triplicate. In these experiments, EF-1α was used as the internal control to normalize gene expression. Fold change in expression was calculated by comparing the normalized mRNA levels of CiTNFRSF25 of treatment group and that of the corresponding control group. 2.9. Data analysis The qPCR data were analyzed using one-way analysis of variance (One-Way ANOVA) and a LSD post hoc test with the SPSS package 20.0 (SPSS Inc., Chicago, IL, USA). P < 0.05 and P < 0.01 were considered significantly different between groups.
Fig. 1. Nucleotide and deduced protein sequence of CiTNFRSF25. The start and stop codon of the open reading frame are in bold. The polyadenylation signal (AATAAA) is underlined. The putative signal peptide is in Italics. Two potential N-glycosylation sites (grey), cysteine rich domains (CRDs) (green), death domain (DD) (blue) and transmembrane domain (yellow) are highlighted. The conserved cysteine residues in the CRD are circled. The predicted sumoylation site is boxed.
3. Results 3.1. Amino acid sequence and phylogenetic analysis of CiTNFRSF25 The cDNA sequence of CiTNFRSF25 was obtained and deposited in the NCBI database (Accession number: MK651506). The full-length cDNA sequence of CiTNFRSF25 was 1420 bp in length, and contained a 5′-UTR of 60 bp, a 3’ -UTR of 208 bp and an open reading frame of 1152 bp (Fig. 1). The CiTNFRSF25 cDNA encoded a peptide of 383 aa with a calculated molecular weight of 43.1 kDa and an isoelectric point of 8.0. A polyadenylation signal (AATAAA) site was located 15 bp upstream from the poly A tail (Fig. 1). The CiTNFRSF25 contained a signal peptide of 22 aa (Met1-Cys22) and a transmembrane region of 23 aa (Leu173-Phe195). A characteristic TNFR DD was identified between Val291 and Leu371 (Fig. 1). Further analysis revealed that the CiTNFRSF25 contained two conserved potential N-glycosylation sites (Asn55-Ser57, Asn242-Thr244) and a sumoylation site (Ala346-Glu349). In addition, there was a single typical TNFR domain, also called the cysteine rich domain (CRD), ranging from 48 to 89 aa, unlike mammalian and avian TNFRSF25s that contains two or three CRDs (Fig. 3).
A protein sequence alignment of TNFRSF25s was generated. As shown in Fig. 2, the CRD and DD were highly conserved in humans, mouse, chicken, zebrafish, crucian carp and grass carp. The CRD of grass carp contained six cysteine residues (Cys48, Cys63, Cys66, Cys69, Cys81 and Cys89) and three disulfide bonds (Fig. 2). To better understand the evolution of TNFRSF25, an unrooted phylogenetic tree was constructed using the Neighbor-Joining method (Fig. 4). It was apparent that CiTNFRSF25 was clustered with fish TNFRSF25s, also annotated as TNFRSF1ALs in some species in the NCBI and Ensembl database. Fish TNFRSF25s/TNFRSF1ALs formed a sister clade with TNFRSF25s from mammals and birds with a bootstrap value of 83%. The strong grouping demonstrates the homologous relationship of TNFRSF25s between fish and higher vertebrates. The CiTNFRSF25 gene organization was obtained by analyzing the 3
Aquaculture and Fisheries xxx (xxxx) xxx–xxx
X. Cheng, et al.
Fig. 2. Multiple sequence alignment of TNFRSF25 proteins. The identical aa residues are shaded in black and similar aa residues in grey. The signal peptide (SP), cysteine rich domain (CRD), transmembrane domain (TM) and death domain (DD) are indicated. Homo sapiens: AAO63495.1; Mus musculus:AAH17526.1;Gallus gallus:XP_423315.4;Danio rerio:XP_009295056.1;Carassius auratus:XP_026097489.1.
genomic and cDNA sequence. It spanned approx. 6.8 kb and was longer than its human and mouse counterparts and was organized into ten exons and nine introns, the same number as found in humans and mouse (Fig. 5). The CiTNFRSF25 gene was located in Scaffold_1000001 and the surrounding genes included CCDC30, UBR4 and RCC2 which were also present in the TNFRSF25 gene locus in humans, mouse and zebrafish (Fig. 6). As shown in Table 2, the deduced aa sequence of the CiTNFRSF25 gene shared 72.1% sequence identity with crucian carp TNFRSF25 and 20%–70% sequence identity with other vertebrate TNFRSF25s. The CRD domain of CiTNFRSF25 shared 57.1% and 54.8% aa identity with the zebrafish and crucian carp homologues, respectively (Table 3). However, only 21.4% sequence identity was found between grass carp and rainbow trout homologues (Table 3). Table 4 shows that the DD of CiTNFRSF25 was also highly conserved, sharing 97.3% sequence identity with the DD of zebrafish and crucian carp TNFRSF25.
3.2. Tissue distribution The expression levels of CiTNFRSF25 were determined in nine tissues of healthy grass carp using qPCR. As shown in Fig. 7, the CiTNFRSF25 transcripts were constitutively expressed in all the tissues examined, including brain, skin, gills, intestine, thymus, spleen, head kidney, trunk kidney and liver. The gills exhibited the highest expression followed by brain, spleen and liver. The lowest expression was detected in the head kidney. 3.3. Gene expression in response to F. columnare The expression levels of CiTNFRSF25 were investigated in grass carp after infection by F. columnare. As shown in Fig. 8, the CiTNFRSF25 was significantly down-regulated (P < 0.01) in both head kidney and spleen at 24 hpi. In the head kidney, the CiTNFRSF25 transcripts increased at 12 hpi, decreased significantly at 24 hpi and thereafter returned to normal level. However, in the spleen, the expression of CiTNFRSF25 hardly changed after infection except for a transient 4
Aquaculture and Fisheries xxx (xxxx) xxx–xxx
X. Cheng, et al.
Fig. 3. The protein domains of TNFSFR25 predicted using SMART program.
down-regulation at 24 hpi.
expression, the rCiIL-4/13B protein was purified. Primary head kidney leukocytes were isolated and the effects of rCiIL-4/13B on the CiTNFRSF25 expression examined. The cells were incubated with the rCiIL-4/13B protein for 12 h, 24 h, 48 h, 72 h and 7 d. Fig. 9 shows that the CiTNFRSF25 transcripts were up-regulated at 12, 24 and 48 hpi and returned to normal level at 72 h. The results demonstrated that the
3.4. Gene expression of CiTNFRSF25 in primary head kidney leucocytes after stimulation with rCiIL-4/13B To determine the effects of rCiIL-4/13B on the CiTNFRSF25
Fig. 4. Phylogenetic tree analysis of TNFRSF25s from Ctenopharyngodon idella and other species. The tree was constructed using the MEGA 5.0 program with the Neighbor-Joining method. Numbers at tree nodes represent the percentage of bootstrap values after 10,000 replicates. 5
Aquaculture and Fisheries xxx (xxxx) xxx–xxx
X. Cheng, et al.
Fig. 5. Genomic organization of the TNFRSF25 gene from human, mouse, grass carp and zebrafish. The exons are shown from 5′ to 3′ end. Black and open boxes represent coding regions and untranslated regions, respectively. The size of the coding region in each exons is numbered.
CiTNFRSF25 expression was modulated in kidney leukocytes by rCiIL4/13B.
Table 2 Percentage of amino acid identity (%) of TNFRSF25.
4. Discussion
1 2 3 4 5 6 7
In this paper, a homologue of TNFRSF25 (termed CiTNFRSF25) was identified in grass carp. Bioinformatics analysis revealed that it possessed the typical structure of other TNFRSF25 molecules, consisting of a cysteine-rich domain in the extracellular region and a death domain in the intracellular region. Moreover, the gene synteny of CiTNFRSF25 resembled that of human, mouse and zebrafish, suggesting they shared a common ancestor during evolution. The CiTNFRSF25 was constitutively expressed in tissues and was modulated by rCiIL-4/13B in primary head kidney leucocytes and by bacterial infection in head kidney and spleen.
a
H. sapiens M. musculus G. gallus O. mykiss C. auratus D. rerio C. idella
1
2
3
4
5
6
7
100 68.1 31.1 24.3 20.1 21.3 20.9
100 27.2 24.1 21.1 22.7 21.5
100 20.4 20.3 21.0 20.3
100 31.6 30.1 29.9
100 64.4 72.1a
100 67.0
100
Highest amino acid identity (%).
The TNFRSF25 is known to be a potent inducer of cell apoptosis and necroptosis in mammals and has similar functions to Fas and TNFRSF1 (Bodmer et al., 1997). The functions of TNFRSF25 are mediated via the
Fig. 6. Comparative synteny analysis of TNFRSF25 genes. The genomic data of human, mouse, and zebrafish were retrieved from the Ensembl database. The CiTNFRSF25 data were analyzed using the sequence deposited in the genome database. Gene symbols were taken from the Ensembl database. 6
Aquaculture and Fisheries xxx (xxxx) xxx–xxx
X. Cheng, et al.
Table 3 Percentage of amino acid identity (%) of CRDs in TNFRSF25.
1 2 3 4 5 6 7 a
H. sapiens M. musculus G. gallus O. mykiss C. auratus D. rerio C. idella
1
2
3
4
5
6
7
100 67.5 35.9 34.9 28.6 28.6 26.2
100 32.1 30.2 31.0 28.6 28.6
100 28.6 31.0 28.6 31.0
100 28.6 23.8 21.4
100 59.5 54.8
100 57.1a
100
6
7
Highest amino acid identity (%).
Table 4 Percentage of amino acid identity (%) of DD in TNFRSF25.
1 2 3 4 5 6 7 a
H. sapiens M. musculus G. gallus O. mykiss C. auratus D. rerio C. idella
1
2
100 95.0 62.5 42.5 37.5 37.0 36.4
100 65.0 41.3 38.9 38.4 37.7
3
100 46.2 43.1 42.5 42.9
4
100 56.2 56.8 57.7
5
100 97.3 97.3a
100 97.3a
Fig. 8. The expression levels of CiTNFRSF25 in head kidney and spleen stimulated with PBS or F. cloumnare for 12, 24, 48 and 72 hpi. CiTNFRSF25 expression levels were calculated relative to that of EF1α gene (internal control) and presented as fold change relative to the control (=1). The data are shown as mean ± S.E (N = 3). **P < 0.01 or *P < 0.05 are considered significantly different.
100
Highest amino acid identity (%).
Fig. 9. The expression levels of CiTNFRSF25 in primary head kidney leucocytes after stimulation with rCiIL-4/13B. The head kidney cells were isolated from 3 individual fish, and were cultured in 25 cm2 flasks for 4 h and then stimulated with 20 ng/mL of rCiIL-4/13B or protein buffer. At 12 h, 24 h, 48 h, 72 h and 7 d, the cells were harvested for qPCR analysis. The expression levels of CiTNFRSF25 were calculated relative to that of EF1α gene (internal control) and presented as fold change relative to the control (=1). The data are shown as mean + S.E (N = 3). *P < 0.05 is considered significantly different.
Fig. 7. Tissue expression of CiTNFRSF25. The expression levels of CiTNFRSF25 in the brain, skin, gills, intestine, thymus, spleen, head kidney, trunk kidney and liver were determined by qPCR and are presented as relative expression to EF1α (N = 3).
conserved gene synteny of genes neighboring the TNFRSF25 gene in fish and mammals (Fig. 6). Therefore, we propose that the TNFRSF1AL genes annotated in fish should be re-named, TNFRSF25, to avoid confusion in the future. In mammals, TNFRSF25 was expressed mainly in lymphocyte-rich tissues upon activation with inflammatory cytokines (Meylan et al., 2008). In the present study, CiTNFRSF25 mRNA transcripts were detected in a broad range of tissues, but at different levels (Fig. 7). For example, the expression of the CiTNFRSF25 gene was markedly higher in gills, brain and spleen than in other tissues (Fig. 7). It has previously been shown that TNFRSF25 is restricted to lymphocytes and is highly expressed by T reg cells (Schreiber et al., 2010; Twohig et al., 2012). However, other studies demonstrated that the expression of TNFRSF25 was less restricted (Cretney et al., 2003; Schreiber & Podack, 2013). We found that 24 h after i. p. administration of F. columnare, the expression levels of CiTNFRSF25 were decreased in both spleen and head kidney, the major systemic immune organs in teleost fish (Fig. 8). The inflammatory response to F. columnare infection was probably caused by migration of immune cells from the spleen and head kidney to the site
death domain in the intracellular region, and involves recruitment and activation of downstream signal molecules (Bossen et al., 2006; Ware, 2003). Once activated by its ligand (TNF-like molecule 1A) TNFRSF25 initiates two distinct downstream signaling cascades (Siakavellas, Sfikakis, & Bamias, 2015), 1) interaction of domains with the TNFRassociated death domain protein (TRADD), and 2) the TNFR-associated factor (TRAF) and receptor-interacting (RIP) proteins (Micheau & Tschopp, 2003), both elicit pro-inflammatory signals or cell death (Bittner & Ehrenschwender, 2017). CiTNFRSF25 has a well conserved death domain which is located between 291 aa and 371 aa (Fig. 2), suggesting it may have similar functions to the mammalian counterpart. In fact, cellular signaling molecules interacting with TNFRSF such as TRAF proteins have been reported in fish (Tafalla & Granja, 2018). Phylogenetic tree analysis revealed that the CiTNFRSF25 formed a clade with fish TNFRSF1ALs. This fish TNFRSF25/TNFRSF1ALs clade formed an expanded clade with mammalian TNFRSF25s supported by a high bootstrap value of 83% (Fig. 3), indicating they are evolutionarily related. The orthologous relationship was also supported by the 7
Aquaculture and Fisheries xxx (xxxx) xxx–xxx
X. Cheng, et al.
of infection to eliminate invading pathogens. Additionally, CiTNFRSF25 was up-regulated by CiIL-4/13B in primary kidney leukocytes (Fig. 9). This suggests that cytokines such as IL-4/13B may regulate TNFRSF25 mediated responses by altering the numbers of receptor molecules on the cell surface. To summarize, this is the first report on the TNFRSF25 gene in teleost fish. The results indicate that the TNFRSF25 mRNA was constitutively expressed in a broad range of tissues and could be modulated by infection with F. columnare. The predicted sequence motifs of CiTNFRSF25 suggests that it may have similar functions to mammalian TNFRSF25s.
human kidney and in rejecting renal transplants. American Journal Of Pathology, 163, 401–411. Bittner, S., & Ehrenschwender, M. (2017). Multifaceted death receptor 3 signaling-promoting survival and triggering death. FEBS Letters, 591, 2543–2555. Bittner, S., Knoll, G., & Ehrenschwender, M. (2017a). Death receptor 3 mediates necroptotic cell death. Cellular and Molecular Life Sciences, 74, 543–554. Bittner, S., Knoll, G., & Ehrenschwender, M. (2017b). Death receptor 3 signaling enhances proliferation of human regulatory T cells. FEBS Letters, 591, 1187–1195. Bodmer, J. L., Burns, K., Schneider, P., Hofmann, K., Steiner, V., Thome, M., et al. (1997). TRAMP, a novel apoptosis-mediating receptor with sequence homology to tumor necrosis factor receptor 1 and Fas(Apo-1/CD95). Immunity, 6, 79–88. Bodmer, J., Schneider, L. P., & Tschopp, J. (2002). The molecular architecture of the TNF superfamily. Trends in Biochemical Sciences, 27, 19–26. Bossen, C., Ingold, K., Tardivel, A., Bodmer, J. L., Gaide, O., & Hertig, S. (2006). Interactions of tumor necrosis factor (TNF) and TNF receptor family members in the mouse and human. Journal of Biological Chemistry, 281, 13964–13971. Chenna, R. (2003). Multiple sequence alignment with the Clustal series of programs. Nucleic Acids Research, 31, 3497–3500. Cretney, E., Uldrich, A. P., Berzins, S. P., Strasser, A., Godfrey, D. I., & Smyth, M. J. (2003). Normal thymocyte negative selection in TRAIL-deficient mice. Journal of Experimental Medicine, 198, 491–496. Grayfer, L., & Belosevic, M. (2009). Molecular characterization of tumor necrosis factor receptors 1 and 2 of the goldfish (Carassius aurutus L .). Molecular Immunology, 46, 2190–2199. Meylan, F., Davidson, T. S., Kahle, E., Kinder, M., Acharya, K., Jankovic, D., et al. (2008). The TNF-family receptor DR3 is essential for diverse T cell-mediated inflammatory diseases. Immunity, 29, 79–89. Micheau, O., & Tschopp, J. (2003). Induction of TNF receptor I-mediated apoptosis via two sequential signaling complexes. Cell, 114, 181–190. Migone, T. S., Zhang, J., Luo, X., Zhuang, L., Chen, C., Hu, B., et al. (2002). TL1A is a TNFlike ligand for DR3 and TR6/DcR3 and functions as a T cell costimulator. Immunity, 16, 479–492. Schreiber, T. H., & Podack, E. R. (2013). Immunobiology of TNFSF15 and TNFRSF25. Immunologic ResearchImmunologic Research, 57, 3–11. Schreiber, T. H., Wolf, D., Tsai, M. S., Chirinos, J., Deyev, V. V., Gonzalez, L., et al. (2010). Therapeutic Treg expansion in mice by TNFRSF25 prevents allergic lung inflammation. Journal of Clinical Investigation, 120, 3629–3640. Secombes, C. J. (2016). What's new in fish cytokine research? Fish & Shellfish Immunology, 53, 1–3. Siakavellas, S. I., & Bamias, G. (2015). Tumor necrosis factor-like cytokine TL1A and its receptors DR3 and DcR3: Important new factors in mucosal homeostasis and inflammation. Inflammatory Bowel Diseases, 21, 2441–2452. Siakavellas, S. I., Sfikakis, P. P., & Bamias, G. (2015). The TL1A/DR3/DcR3 pathway in autoimmune rheumatic diseases. Seminars in Arthritis and Rheumatism, 45, 1–8. Tafalla, C., & Granja, A. G. (2018). Novel insights on the regulation of B cell functionality by members of the tumor necrosis factor superfamily in jawed fish. Frontiers in Immunology, 9, 1285. Twohig, J. P., Marsden, M., Cuff, S. M., Ferdinand, J. R., Gallimore, A. M., Perks, W. V., et al. (2012). The death receptor 3/TL1A pathway is essential for efficient development of antiviral CD4(+) and CD8(+) T-cell immunity. Federation of American Societies for Experimental Biology Journal, 26, 3575–3586. Wang, Y., Lu, Y., Zhang, Y., Ning, Z., Li, Y., Zhao, Q., et al. (2015). The draft genome of the grass carp (Ctenopharyngodon idellus) provides insights into its evolution and vegetarian adaptation. Nature Genetics, 47 625-6231. Wang, E. C., Thern, A., Denzel, A., Kitson, J., Farrow, S. N., & Owen, M. J. (2001). DR3 regulates negative selection during thymocyte development. Molecular and Cellular Biology, 21, 3451–3461. Ware, C. F. (2003). The TNF superfamily. Cytokine & Growth Factor Reviews, 14, 181–184. Wiens, G. D., & Glenney, G. W. (2011). Origin and evolution of TNF and TNF receptor superfamilies. Developmental & Comparative Immunology, 35, 1324–1335. Wilkins, M. R., Gasteiger, E., Bairoch, A., Sanchez, J. C., Williams, K. L., Appel, R. D., et al. (1999). Protein identification and analysis tools in the ExPASy server. Methods in Molecular Biology, 112, 531–552. Xie, H. X., Nie, P., & Sun, B. J. (2010). Characterization of two membrane-associated protease genes obtained from screening out-membrane protein genes of Flavobacterium columnare G4. Journal of Fish Diseases, 27, 719–729. Xu, Z., Nie, P., Sun, B., & Chang, M. (2010). Molecular identification and expression analysis of tumor necrosis factor receptor-associated factor 2 in grass carp Ctenopharyngodon idella. Acta Biochimica et Biophysica Sinica, 39, 857–868. Zhang, S., Zhang, R., Ma, T., Qiu, X., Wang, X., Zhang, A., et al. (2016). Identification and functional characterization of tumor necrosis factor receptor 1 (TNFR1) of grass carp ( Ctenopharyngodon idella ). Fish & Shellfish Immunology, 58, 24–32.
Acknowledgements We thank Dr Haixia Xie from the Institute of Hydrobiology, Chinese Academy of Sciences for providing F. columnare in this study. This research is supported by the National Natural Science Foundation of China (Grant numbers U1605211 and 31272666). Abbreviations CiTNFRSF25 TNF receptor superfamily member 25 of Ctenopharyngodon idella CCDC30 coiled-coil domain containing 30 CRD cysteine-rich domain DD death domain DcR3 decoy receptor 3 EF1α elongation factor-1α F. columnare Flavobacterium columnare JNK c-Jun N-terminal kinase MAPKs mitogen activated protein kinases qPCR Quantitative real-time PCR RIP receptor-interacting RCC2 regulator of chromosome condensation 2 SP signal peptide; TNFSF the tumor necrosis factor superfamily TNFRSF the tumor necrosis factor receptor superfamily TNFRSF25 TNF receptor superfamily member 25 TNFRSF1AL TNF receptor superfamily member 1 A like; TNFRSF15 TNF ligand superfamily 15 TL1A TNF-like protein 1A TNFRSF1a TNF receptor superfamily member 1 a TNFR1 TNF receptor superfamily member 1 TNFR2 TNF receptor superfamily member 2 TM transmembrane region TRADD TNFR-associated death domain protein TRAF TNFR-associated factor UBR4 Recombinant Ubiquitin Protein Ligase E3 Component NRecognin 4 References Aggarwal, B. B., Gupta, S. C., & Kim, J. H. (2012). Historical perspectives on tumor necrosis factor and its superfamily: 25 years later, a golden journey. Blood, 119, 651–665. Al-Lamki, R. S., Wang, J., Thiru, S., Pritchard, N. R., Bradley, J. A., Pober, J. S., et al. (2003). Expression of silencer of death domains and death-receptor-3 in normal
8