Identification, characterization and putative function of HvRin4, a barley homolog of Arabidopsis Rin4

Physiological and Molecular Plant Pathology 80 (2012) 41e49

Contents lists available at SciVerse ScienceDirect

Physiological and Molecular Plant Pathology journal homepage: www.elsevier.com/locate/pmpp

Identification, characterization and putative function of HvRin4, a barley homolog of Arabidopsis Rin4q Upinder Gill a,1, Jayaveeramuthu Nirmala a,1, Robert Brueggeman b, Andris Kleinhofs a, c, *,1 a

Department of Crop and Soil Sciences, Washington State University, Pullman, WA 99164, USA Department of Plant Pathology, North Dakota State University, Fargo, ND 58108, USA c School of Molecular Biosciences, Washington State University, Pullman, WA 99164, USA b

a r t i c l e i n f o

a b s t r a c t

Article history: Accepted 30 August 2012

RIN4 is a signaling molecule that plays a key role in disease resistance responses in plants. Barley RIN4 (HvRIN4) was first identified as an interactor of the stem rust resistance protein RPG1 in a yeast twohybrid system. Therefore, we isolated, characterized and studied HvRIN4 role in barley. Yeast two hybrid analysis, employing several deletion mutants of HvRIN4 revealed that the C-terminal end and a partial deletion of N-terminal end of HvRIN4 are important for interacting with RPG1. HvRIN4 interactions with RPG1 mutated proteins, which inactivate autophosphorylation, suggested that autophosphorylation or the amino acids required for autophosphorylation of RPG1 are essential for interaction. Ó 2012 Elsevier Ltd. All rights reserved.

Keywords: Disease resistance Proteineprotein interactions RPG1 HvRin4 Stem rust Virus induced gene silencing (VIGS)

1. Introduction Plants have a well-regulated defense system for protection against diseases. This system is responsible for recognition of invading pathogens, activating the defense responses and limiting the pathogen’s growth. It is a multitier system comprising basal defense response followed by specific defense response based on recognition of pathogen avirulence (avr) factors by a battery of resistance (R) genes, each specific for one or more Avr gene. The interactions between plant R proteins and pathogen AVR proteins play an important role in resistance responses and are the basis for the gene for gene model [1]. So far, direct R-AVR protein interactions have been characterized only in a few cases [2e4]. Lack of direct interactions between Avr and R gene products in other systems, led to the guard hypothesis [5,6]. Guard hypothesis proposes that the R proteins interact with or guard another protein, referred as guardee. Guardee protein is targeted by pathogen AVR proteins and any subsequent perturbation in guardee protein is sensed by host R proteins to trigger a defense signaling response [6]. Role of PBS1 and RIN4 (RPM1 interacting protein 4) as guardee

q Data deposition: GenBank ID: JN375539. * Corresponding author. Department of Crop and Soil Sciences, Washington State University, Pullman, WA 99164, USA. E-mail address: [email protected] (A. Kleinhofs). 1 Current address: Plant Biology Division, The Samuel Roberts Noble Foundation, Ardmore, OK 73401, USA. 0885-5765/$ e see front matter Ó 2012 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.pmpp.2012.08.002

protein, in the Arabidopsis defense system, supports the guard hypothesis [7e10]. In Arabidopsis, RIN4 plays an important role in resistance against the bacterial pathogen Pseudomonas syringae (Ps). The Arabidopsis RIN4 is a membrane bound protein of 211 amino acids and acts as a negative regulator of basal defense response [11]. In Arabidopsis, over expression or lack of RIN4, inhibits or enhances the basal defense response, respectively [11]. RIN4 is targeted by four different type III bacterial effectors viz., AvrRpm1, AvrB, AvrRpt2 and HopF2pto [9,12,13]. RIN4 is phosphorylated in the presence of bacterial effectors AvrRpm1 or AvrB from Ps pv. maculicola and Ps pv. glycinea, respectively. RIN4 phosphorylation results in activation of resistance protein RPM1, which further leads to a hypersensitive response (HR) [9]. Alternatively, another bacterial effector, AvrRpt2, a cysteine protease from Ps pv. tomato, degrades RIN4 at two cysteine protease RIN4 cleavage sites (RCS). The degradation of RIN4 is recognized by another protein, Resistance to P. syringae 2 (RPS2), and culminates in a hypersensitive response [14]. Over expression of RPS2 was found to induce HR, however, coexpression of RIN4 along with RPS2 leads to suppression of HR in transient expression assays in Nicotiana benthamiana [8]. This suggests that RIN4 is a negative regulator of RPS2 and represses its activity in the absence of pathogen effectors. In contrast, another Ps effector, HopF2Pto, which also interacts with RIN4, interferes with AvrRpt2 induced RIN4 modification and hence, promotes Ps growth in Arabidopsis [13]. In Arabidopsis, membrane localization of RIN4 is indicated by the presence of potential prenylation and palmitoylation sites at cysteines C203
205 [8]. Palmitoylation of RIN4 has

42

U. Gill et al. / Physiological and Molecular Plant Pathology 80 (2012) 41e49

been characterized [12]. Both RPS2 and RPM1 are membraneassociated proteins and interact directly with RIN4. Mutation analyses have shown that the C-terminal end of RIN4 is also required for interaction with RPS2 [8]. Barley stem rust, caused by Puccinia graminis f. sp. tritici (Pgt), is an important disease of barley capable of causing huge crop losses [15]. The barley stem rust resistance gene Rpg1 has remained effective against many Pgt races since its first deployment in the 1940s indicating a high level of durability [16]. Rpg1 is unique due to the presence of two tandem protein kinase domains (pK1 and pK2) [17]. Both of these domains are important for resistance, however, only the pK2 domain is catalytically active and is required for autophosphorylation [18]. Dual kinase domains are also found in the mammalian Janus kinases, one of which is an active kinase and other a pseudokinase, with no known enzymatic activity, but required for normal gene function [19]. RPG1 is phosphorylated within 5 min after exposure to viable avirulent urediniospores from a stem rust fungus [20] and is subsequently degraded by the ubiquitination pathway [21]. Both phosphorylation and degradation are highly race specific and are required, but not sufficient, for disease resistance [20,21]. To identify host proteins underlying the RPG1-mediated signaling pathway, a yeast two-hybrid screen was conducted using RPG1 as bait. The screen resulted in the identification of several putative interactors (Nirmala et al., unpublished). One of the putative interactors is a barley homolog of RIN4 (HvRIN4). Due to the importance of RIN4 in other host-pathogen systems, we investigated its role in the RPG1-mediated stem rust resistance system. Here we present the results of identification and characterization of HvRin4 from barley. In spite of strong and apparently fairly specific interaction of HvRIN4 with RPG1 in the yeast two-hybrid system, we were not able to demonstrate any role for HvRIN4 in RPG1-mediated stem rust resistance. It is possible that HvRIN4 plays a role in barley basal resistance which results in enhancement of the RPG1-mediated resistance, but that remains to be proven.

HKHJ due to the presence of Rpg1. Leaf tissues, for genomic DNA and RNA isolation, were collected from barley plants grown in growth chambers in 400 plastic pots containing potting mix with a day and night temperature of 21  1  C and 18  1  C, respectively and with a 16-h photoperiod provided by cool fluorescent tubes (525 mE/m2 s). 2.2. PCR amplification and sequencing PCR primers were designed to amplify HvRin4 from gDNA (genomic DNA) using the web based application Primer3 (http:// frodo.wi.mit.edu/primer3/). PCR reactions of 20 ml contained 50 ng of genomic DNA, 0.15 mM dNTP mix, 2.5 mM MgCl2, 20 pmol of each primer, 1.0 ml (1.0 U) of RedTaq DNA polymerase (Sigmae Aldrich, St Louis, MO, USA) with 2.0 ml of 10 RedTaq reaction buffer. PCR amplifications were optimized to denature at 95  C for 40 s, annealing at 60  C for 40 s followed by extension at 72  C for appropriate time based on the amplicon size for 35 cycles in a PTC100 programmable thermal controller (MJ Research, Cambridge, MA, USA). Amplification products were sequenced with the BigDye terminator system on ABI Prizm 377 DNA sequencer (Applied Biosystems, Foster City, CA, USA) at the Bioanalytical Center, Washington State University, Pullman. Derived Cleaved Amplified Polymorphic Sequence (dCAPS) primers were designed by using web based application dCAPS Finder 2.0 (http://helix.wustl.edu/ dcaps/dcaps.html) [22]. dCAPS forward primer HvRIN4_dCAPS_F (GTTAATTTTGATTAGATGTATCGAATT) and reverse primer HvRIN4g2R (TGGATGGCATGATTAGATCGAC) were used to map HvRin4 with PCR amplification conditions as follows: denaturing for 1 min at 95  C, annealing for 1 min at 55  C and extension for 1 min at 72  C for 35 cycles. The PCR products were digested with EcoRI before electrophoresis on 3% metaphor agarose (FMC bioproducts, Philadelphia, ME, USA). Genotypic data was analyzed using Map Manager QTX [23]. 2.3. Southern and northern hybridizations and BAC screening

2. Materials and methods 2.1. Plant materials Barley cultivars Steptoe and Morex were used. Steptoe is susceptible to stem rust Pgt race MCCF and HKHJ due to a nonfunctional Rpg1 gene whereas, Morex is resistant to MCCF and

a

Genomic DNA from barley lines was extracted as previously described [24]. DNA samples were digested with restriction enzymes following manufacturer’s instructions and electrophoresed on 1% agarose gels at 25 V. Size separated DNA fragments were transferred onto nylon membrane (Amersham HybondÔ-N, GE Healthcare Life Sciences, Piscataway, NJ, USA) by an alkaline-

HvRin4 gDNA ATG

TGA

I

II

III

IV

bHvRin4 cDNA I II

c HvRIN4 protein 1

CS1

CS2

246

Intron = Exon =

Fig. 1. HvRin4 genomic, cDNA and predicted protein structure. (a) HvRin4 predicted gene structure spans ca. 3.2 kb and consists of four exons (Gray). RT-PCR identified two splice forms of HvRin4 due to alternate splicing of exon II (b). The larger transcript is predicted to encode a 246 amino acid protein with two predicted cysteine protease cleavage sites (CS) (c).

U. Gill et al. / Physiological and Molecular Plant Pathology 80 (2012) 41e49

transfer procedure. A PCR amplified fragment (953bp) of HvRin4, using primers HvRIN4_4F (GATCTCTTGTTCATCGCCCTCTCCGC) and HvRIN4_4R (TGAACTCTGCTCAGTGCCCAATGCC), labeled with [a-32P] dCTP (New England Nuclear, Boston, MA, USA) using the ALL-IN-ONE random prime kit (SigmaeAldrich, St Louis, MO, USA) was used as a probe. Hybridizations were performed as previously described [24]. Total RNA from 10 day-old barley seedling leaves was extracted by the hot phenol/guanidinium thiocyanate method (TRIzolÒ Reagent, Invitrogen, Carlsbad, CA, USA). mRNA was isolated from total RNA using Poly(A)PuristÔ mRNA Purification Kit (Applied Biosystems, Foster City, CA, USA). Quality and quantity of RNA samples was estimated by running an aliquot on formaldehyde denaturing agarose gel electrophoresis before transferring to nylon membrane (Amersham HybondÔ-N, GE Healthcare Life Sciences, Piscataway, NJ, USA). Northern hybridization was performed as described previously [25]. A cv. Morex BAC library was screened to identify BAC clones containing HvRin4 [26]. The HvRin4 probe, used for Southern hybridization, was used to screen BAC library using the same hybridization and washing conditions as described above. 2.4. 50 Rapid amplification of cDNA ends (50 RACE) HvRin4 transcription start site was identified by using SMARTerÔ RACE cDNA amplification kit (Clontech, Mountain View, CA, USA). 1 mg of total cv. Morex RNA was used to generate RACE ready cDNA. 50 RACE reaction was preformed according to the manufacturer’s instructions using Advantage 2 polymerase (Clontech, Mountain View, CA, USA). 50 RACE products were re-amplified using Red Taq polymerase (SigmaeAldrich, St. Louis, MO, USA) prior to cloning into pGEM-T Easy vector (Promega, Madison, WI, USA) and sequencing.

CM

43

Loci

ABG701 6.5 3.9 2.9

HvRin4 RZ612, CDO017 ABC308

12.2

2.9 3.2

ABC322A ABC154B RZ144B

5.7 Amy2

7H(1) Bin7 Fig. 3. Genetic mapping of HvRin4. HvRin4 was genetically mapped to chromosome 1(7H) bin 7 using the Steptoe  Morex doubled haploid mapping population.

brachypodium.org/. Sequences were aligned using the web based program clustalw omega (http://www.ebi.ac.uk/Tools/msa/ clustalo/).

2.5. Expression analyses of HvRin4 2.7. In vitro deletion mutagenesis and yeast two hybrid assays HvRin4 is represented in the Barley1 22k gene chip as contig9110_at (www.affymatrix.com). Therefore, microarray data generated previously from our lab were analyzed to determine the expression profile of HvRin4 [27]. Other microarray data available in the public domain were also analyzed for HvRin4 expression changes (www.plexdb.org). 2.6. Sequence alignment of RIN4 homologs HvRin4 sequence was used to identify cereal homologs by searching the NCBI database using blastx. Brachypodium distachyon (referred as BdRin4) sequence was accessed from http://www.

In vitro deletion mutagenesis was performed by using gene specific primers with flanking restriction sites. HvRIN4 constructs (HvRIN41
246, HvRIN41
245, HvRIN41
244, HvRIN41
243, HvRIN41
242, HvRIN41
241, HvRIN41
240, HvRIN41
239, HvRIN41
238, HvRIN41
237, HvRIN41
236, HvRIN41
235, HvRIN41
87, HvRIN426
234, HvRIN440
234, HvRIN440
246, HvRIN426
246 HvRIN410
246 HvRIN414
246 and HvRIN4184
246) were generated by cloning the specific in vitro mutated fragments into pMyr vector. Wild-type and mutated RPG1 constructs were previously generated in our lab [28]. Yeast two hybrid assays were performed using cytotrap two-hybrid system (Stratagene, La Jolla, CA, USA). Specific interactions among wild type and mutant

Fig. 2. Northern and Southern hybridization suggest a single gene product. (a) Northern hybridization detected a single band of approximately 1 kb, which corresponds to the larger transcription product detected by RT-PCR. The smaller RT-PCR product was not detected. (b) Southern hybridization of genomic DNA with HvRin4 probe indicated a single gene copy. Two bands in gDNA digested with EcoRI are due to an internal EcoRI site in intron I. DNA samples from left to right are, Steptoe (S), Morex (M), Harrington (H), TR306 (T), Q21861 (Q), SM89010 (SM) and Dictoo (D), digested with DraI, EcoRI, EcoRV and HindIII.

44

U. Gill et al. / Physiological and Molecular Plant Pathology 80 (2012) 41e49

constructs were tested by following the specifications of the manufacturer (Stratagene, La Jolla, CA, USA). 2.8. Virus induced gene silencing (VIGS) of HvRin4 Barley stripe mosaic virus (BSMV) vector has been established as a vector of choice for silencing genes of interest in wheat and barley [29]. For VIGS, two separate and unique regions of HvRin4 were selected and cloned independently into the gamma (g) genome, in reverse orientation, using gene specific primers harboring NotI and PacI restriction sites at their extremities.

Constructs g_HvRin4_T1 was engineered by cloning a 264bp fragment from 30 end of HvRin4 by using forward primer VIGS_RIN4_TARGET1_F1 (CAGCGGCCGCGTTGCCGCGGGAGGCGGCCCTG) and reverse VIGS_RIN4_TARGET1_R1 (GCTTAATTAAACGAGCGCCGG CCCAGCGAC). Construct g_HvRin4_T2 was engineered by cloning a 180bp fragment from 30 end of HvRin4 by using forward primer VIGS_RIN4_TARGET2_F1 (CAGCGGCCGCTACATTCCCAAAGATCCCTGC) and reverse primer VIGS_RIN4_TARGET2_R1 (GCTTAATTAACACC CAGGCCAAGGCGCCGGGGTTC). PCR amplified fragments were digested with PacI and NotI followed by cloning into PacI and NotI sites of g.bPDS2-as vector [29] in reverse orientation. The positive control,

Fig. 4. Sequence alignment of predicted amino acid sequences of RIN4 homologs from different species. RIN4 peptide sequence alignment of Arabidopsis thaliana (AtRIN4), Hordeum vulgare (HvRIN4), Brachypodium distachyon (BdRIN4), Oryza sativa (OsRIN4), Zea mays (ZmRIN4) and Sorghum bicolor (SbRIN4).

U. Gill et al. / Physiological and Molecular Plant Pathology 80 (2012) 41e49

BSMV.MCS construct was previously generated in our lab by cloning the pBluescript multi-cloning site fragment into g.bPDS2-as vector [30]. Alpha (a), beta (b), and respective g constructs were linearized by restriction enzymes MluI (a), SpeI (b), BSSHII (g_HvRin4_T1 and g_HvRin4_T2 and BSMV.MCS) respectively and treated with proteinase-K prior to chloroform purification as described [31]. Infectious RNA’s were generated from the linearized constructs by the mMESSAGE mMACHINEÒ kit (Applied Biosystems, Foster City, CA, USA). Barley plants at two-leaf stage were inoculated by procedures described previously [29]. 2.9. Stem rust inoculations Barley plants were screened against Pgt race HKHJ by inoculating the leaves with urediniospores at the rate of 0.25 mg per leaf mixed in 1:20 ratio of talc (SigmaeAldrich, St. Louis, MO, USA) as a carrier. Inoculated plants were misted with water periodically for 4 h and then allowed to dry slowly. After the complete drying of leaves surfaces, plants were kept in the growth chamber at 24  C and 100% relative humidity. Infected plants were phenotyped 14 days after the infection with rust urediniospores. 3. Results 3.1. Structural characterization of HvRin4 A partial clone of HvRIN4 was identified as an interactor of RPG1 by a yeast two-hybrid screen of a barley cDNA library (Nirmala

45

et al., unpublished). Realizing the importance of RIN4 as a guardee protein in Arabidopsis, we identified the full length HvRin4 gene and characterized it. An EST contig from the HarvEST database (www. harvest.ucr.edu/) and genomic clone sequences from cultivars (cvs.) Steptoe and Morex revealed an HvRin4 gene of ca. 3.2 kb consisting of four exons and three introns (Fig. 1a). In order to correctly identify the coding region of HvRin4, RT-PCR and northern blot analysis were conducted. RT-PCR analysis identified two splice variants one with and one without exon II in cvs. Steptoe and Morex (Fig. 1b). In silico translation of the larger, ca. 1 kb, mRNA yielded a predicted protein of 246 amino acids (Fig. 1c). The presence of the larger mRNA (with exon II and predicted size of 1 kb) was confirmed by northern blot analysis, but the smaller mRNA, lacking exon II, was not detected (Fig. 2a). Southern hybridization identified a single copy of HvRin4 in cvs. Morex and Steptoe (Fig. 2b). In order to identify the full length HvRin4 sequence including the promoter sequence, we screened cv. Morex BAC library [26] and identified two BAC clones, 608g06 and 751b01. BAC sequence analysis predicted a promoter sequence and transcription start site. 50 RACE results confirmed the predicted transcription start site 200bp upstream of the start methionine. To identify the possible differences in the coding and noncoding sequence of HvRin4 from both stem rust resistant and susceptible cvs. Morex and Steptoe, respectively, HvRin4 sequence were compared and found to be identical except for a single nucleotide polymorphism (SNP) i.e. A/G, in intron-I. This SNP was exploited to develop a dCAPS marker [22], which was used to map the gene in the Steptoe  Morex doubled haploid minimapper

a 450

Hybridization intensity

400 350 300 GP_MCCF

250

GP_QCCJ

200

GP_T_MCCF

150

GP_T_QCCJ

100 50 0 0

6

Percent of GAPDH expression

b

12 18 Hours after infection

24

36

140 120 100

M_MOCK

80

M_MCCF

60

S_MOCK

40

S_MCCF

20 0 0

12 Hours after inoculation

Fig. 5. Expression patterns of HvRin4 upon stem rust infection. (a) HvRin4 expression is up-regulated with stem rust infection. Microarray analyses of cv. Golden promise (GP) and Golden promise transgenic containing Rpg1 (GP_T) infected with either stem rust race MCCF or QCCJ showed increased HvRin4 expression during the first 12 h after infection regardless of stem rust race or presence of Rpg1. (b) HvRin4 transcript was also enhanced in both Steptoe and Morex, 12 h after infection with stem rust race MCCF compared to mock control.

46

U. Gill et al. / Physiological and Molecular Plant Pathology 80 (2012) 41e49

population [32] to the short arm of chromosome 7H(1) bin 7 (Fig. 3). 3.2. HvRin4 is highly conserved among cereal species Predicted HvRIN4 protein sequence alignment of Arabidopsis thaliana, Hordeum vulgare, Brachypodium distachyon, Oryza sativa, Zea mays and Sorghum bicolor using pair wise and multiple sequence alignment tool clustal omega (http://www.ebi.ac.uk/ Tools/msa/clustalo/) showed high sequence conservation among the monocots tested and Arabidopsis especially at the known cysteine protease RIN4 cleavage sites (RCS, as referred in [33]), RCS1 and RCS2 (Fig. 4). These sites are specifically targeted by Ps cysteine protease effector AvrRpt2 in Arabidopsis. 3.3. HvRin4 transcript level changes upon pathogen infection Microarray data available in plexdb (www.plexdb.org) shows HvRin4 expression in all plant tissues tested with high levels of expression in seedling roots and seedling leaves (data not shown). In order to identify the role of HvRin4 in Rpg1-mediated stem rust resistance, HvRin4 expression was examined at various time points

after stem rust infection. Microarray data generated from a previous study [27] were analyzed for HvRin4 expression level changes upon stem rust infection. HvRin4 expression was studied in genotypes lacking the Rpg1 gene, i.e. cv. Golden promise (GP), and an isogenic line (designated GP_T) transformed with a single copy of Rpg1 [34] (Fig. 5a). Both genotypes were inoculated with stem rust race MCCF and QCCJ, avirulent and virulent with Rpg1, respectively. Results of three replications showed that the expression of HvRin4 was significantly induced with pathogen infection regardless of pathogen race and presence or absence of Rpg1. Significant induction of HvRin4 expression was also observed in cvs. Steptoe (rpg1) and Morex (Rpg1) upon infection with stem rust MCCF spores compared to mock inoculations (Fig. 5b) suggesting an Rpg1 independent response to stem rust. 3.4. Characterization of in vitro proteineprotein interactions of HvRIN4 with RPG1 Although HvRin4 expression was induced with stem rust infection, its role, if any, in RPG1-mediated resistance was not clear. To examine it further, we investigated the RPG1-HvRIN4 in vitro interaction. Initially, a partial clone of HvRIN4 was identified as

Fig. 6. HvRIN4 structure affects proteineprotein interactions with RPG1. Full length HvRIN4 failed to interact with RPG1. Intact C-terminal with N-terminal deletions, including the RCS1 site (HvRIN440
246, HvRIN426
246) interacted with RPG1. All C-terminal deletions, HvRIN41
245 to 235 and HvRIN41
87, as well as deletions at both N- and C-terminal (HvRIN426
234 and HvRIN440
234) abolished interaction with RPG1. Interestingly, intact C-terminal and intact or partial RCS1 site (HvRIN414
245, HvRIN410
245) also failed to interact with RPG1 as did complete RCS1 deletion and partial RCS2 deletion (HvRIN4184
245). These results clearly demonstrate the importance of the C-terminal for HvRIN4 interaction with RPG1 and another region at the N-terminal.

U. Gill et al. / Physiological and Molecular Plant Pathology 80 (2012) 41e49

interacting with RPG1 in a yeast two-hybrid assay (Nirmala et al., unpublished). Therefore, a full length HvRIN4 clone was generated and tested for its ability to interact with RPG1. Yeast two hybrid assays showed that the full length HvRIN4 did not interact with RPG1 (Fig. 6). Therefore, we attempted to identify the region(s) of HvRIN4 responsible for interaction with RPG1. The results revealed that all deletions at the C-terminal end of HvRIN4 resulted in failure to interact with RPG1. However, an intact C-terminal end with Nterminal deletion including the RCS1 site (HvRIN440
246, HvRIN426
246) interacted with RPG1 (Fig. 6) suggesting a role of intact C-terminal end for interactions. Whereas, an intact Cterminal end with deletions at N-terminal end at RCS1 and RCS2 cleavage sites and intact RCS1 site (HvRIN414
246, HvRIN4184
246 and HvRIN410
246, respectively) failed to interact with RPG1 (Fig. 6) suggesting the importance of N-terminal end as well for interactions. Bioinformatics analysis by CSS-Palm and PrePS (http:// expasy.org/tools/#proteome) predicted the C-terminal end of HvRIN4 as a site for palmitoylation and membrane localization. Two HvRIN4 (HvRIN440
246, HvRIN426
246) protein fragments, which interacted with a functional RPG1, were tested for interaction with mutant RPG1 proteins. The results revealed that the mutations KK461/462NQ and K461N, which abolish autophosphorylation of RPG1, failed to interact with the HvRIN440
246 and HvRIN426
246 (Fig. 7). Further, the RPG1 pK1 domain mutant KK152/153NQ or the complete deletion of the pK1 domain also abolished interaction with the HvRIN4 peptides (Fig. 7). It is noteworthy that the KK461/462NQ (pK2) and KK152/153NQ (pK1) mutant transgenic plants were susceptible to the stem rust pathogen [28]. The GTT insertion mutation in the RPG1 pK1 domain, which resulted in serine (S) to arginine (R) conversion and a phenylalanine (F) insertion [17], and the K462Q mutation in pK2, which do not affect autophosphorylation, showed positive proteineprotein interaction with the HvRIN4 peptides (Fig. 7). Similarly, individual substitution of K152N or K153Q in the pK1 domain, which do not affect autophosphorylation activity [21], also retained ability to interact with HvRIN4 peptides (Fig. 7). These results indicate that RPG1 autophosphorylation and/or the sites required for autophosphorylation are required for interaction with HvRIN4. 3.5. Virus induced gene silencing of HvRin4 Virus induced gene silencing was employed in an attempt to understand the biological relevance of HvRin4. Stem rust race MCCF resistant (Morex) and susceptible (Steptoe) barley cvs. were infected with BSMV RNA from g_HvRin4_T1, g_HvRin4_T2 and BSMV.MCS. BSMV.MCS is a positive control for virus infection and a negative control for HvRin4 knockdown. Plants were challenged with Pgt race HKHJ, 10 days after virus inoculation and scored for disease phenotype two weeks after the application of urediniospores. No noticeable differences in stem rust infection were observed among BSMV.MCS, g_HvRin4_T1 and g_HvRin4_T2 infected Morex and Steptoe plants (Fig. 8, data not shown for Steptoe). However, there was some reduction in pustule size on BSMV infected plants compared to BSMV free plants. Phenotyped plants were also tested for the knockdown of HvRin4 by real-time quantitative PCR. Results showed up to four-fold reduction in HvRin4 knockdown plants compared to MCS control (Fig. 9). 4. Discussion HvRIN4, a homolog of Arabidopsis RIN4, was identified as an interactor of stem rust resistance protein RPG1 in cDNA library screen. To understand the role of HvRIN4 in Rpg1-mediated resistance, we structurally and functionally characterized it and studied

47

Fig. 7. RPG1 pK1 and pK2 domain mutations abolished proteineprotein interactions with HvRIN426
246. The KK461/462NQ and the K461N mutations in the catalytically active pK2 domain, which abolished RPG1 autophosphorylation also eliminated HvRIN4 protein interaction with RPG1 while the K462Q, which does not affect autophosphorylation, showed positive proteineprotein interaction. The KK152/153NQ mutation in the pK1 domain or the complete deletion of the pK1 domain also abolished the protein interaction, possibly due to conformational changes in the protein structure. This is suggested by the observation that the individual mutations K152N and K153Q showed positive proteineprotein interaction. The GTT insertion mutation also in the RPG1 pseudokinase domain (pK1), which does not affect RPG1 autophosphorylation, interacted positively with HvRIN4 (SD/Glu-UL: synthetic defined glucose medium lacking uracil and leucine; SD/Gal-UL: synthetic defined galactose medium lacking uracil and leucine; Saccharomyces cerevisiae yeast strain cdc25H can grow at 25  C but lacks ability to grow at 37  C. Positive proteineprotein interaction allows its growth at 37  C).

its interactions with RPG1 in further detail. Compared to AtRIN4, which codes for 211 amino acids, HvRIN4 is a larger protein of 246 amino acids with conserved RIN4 regions known to be important for defense mechanism in Arabidopsis. Interestingly, HvRIN4 shows complete homology for two cysteine protease cleavage sites (Fig. 1c), which are cleaved by P. syringae effector AvrRpt2 at the N and near the C termini in Arabidopsis [35]. Cleavage of AtRIN4 triggers RPS2-mediated hypersensitive response [14]. However, in our case, none of the two avirulent effectors identified to trigger RPG1 resistance, have known protease function [36]. These cysteine cleavage sites also show high sequence conservation with other cereal RIN4 homologs (Fig. 4) suggesting an evolutionary conserved role not only in Arabidopsis but in other plant species as well. So far, we do not know what role these cleavage sites play in barley. Elevation of HvRin4 transcript, independent of Rpg1 and pathogen virulence, suggested its possible involvement in basal resistance, but not in Rpg1-mediated resistance (Fig. 5a,b). SlRin4 transcript level was enhanced multifold with the pathogen infection and independent of the virulence of the pathogen [33]. However, SlRin4 also plays a specific role in ETI (effector triggered immunity) by interacting with AvrPto in the presence of plant

48

U. Gill et al. / Physiological and Molecular Plant Pathology 80 (2012) 41e49

Fig. 8. Silencing of HvRin4 by VIGS. Cultivar Morex plants were inoculated with BSMV vector engineered to carry antisense HvRin4 constructs, g_HvRin4_T1, g_HvRin4_T2 and BSMV.MCS. BSMV infected plants were infected with Pgt race HKHJ. Plants were phenotyped and pictured two weeks after fungal infection. Morex
ve control plants were only infected with fungus and not with BSMV and act as negative control.

resistance proteins, Pto and Prf [33]. Therefore, it is possible that interaction of HvRIN4 with RPG1 may facilitate specific stem rust resistance through activation of basal resistance or it may be an artifact. This prompted us to characterize the regions of HvRIN4 and RPG1, important for interactions and to deduce any possible roles of HvRIN4 in barley stem rust resistance. Although HvRIN4 was identified as an interactor of RPG1, the full length HvRIN4 did not interact with RPG1 in yeast-two hybrid system. Failure of HvRIN4 to interact with RPG1 is not known at this time unexplained. We speculate that the lack of interaction of RPG1 with full length HvRIN4 is due to certain protein confirmation which is achieved only by a specific cleavage of HvRIN4 or is due to interaction under in vivo conditions which is not replicated in the

yeast two hybrid assay. Similar observation was made for AvrPita176 and Pita interactions in the case of rice blast resistance [3]. Avr-Pita176 did not interact with full length Pita but interacted with a 341 amino acid C-terminal portion containing LRD (Leucine Rich Domain) possibly due to the large fusion protein not suitable for yeast two hybrid systems [3]. However, we identified the Cterminal end and partial deletions of the N-terminal end as important for HvRIN4-RPG1 interaction (Fig. 6). C-terminal end of AtRIN4 is important for plasma membrane localization and interacting with resistance protein RPS2 [8,9]. The C-terminal end of HvRIN4 as well as other monocot orthologs of RIN4 are conserved (Fig. 4). The two cysteine residues at the C-terminal end of HvRIN4 are predicted sites for palmitoylation, a modification required for

Fig. 9. Real-time quantitative PCR showing knockdown of HvRin4 with VIGS. Phenotyped Morex and Steptoe plants were assayed to determine the extent of HvRin4 transcript reduction. MT1-2, MT1-6, MT1-8, ST1-1, ST1-3 and ST1-5 plants were infected with BSMV construct g_HvRin4_T1. MT2-1, MT2-2, MT2-8, ST2-1, ST2-4 and ST2-8 were infected with BSMV construct g_HvRin4_T2. M MCS1, M MCS9, S MCS2, S MCS4 and S MCS8 were infected with BSMV construct BSMV.MCS. Expression of HvRin4 is represented as % of GAPDH expression (S: Steptoe; M: Morex).

U. Gill et al. / Physiological and Molecular Plant Pathology 80 (2012) 41e49

membrane localization of proteins. A small, but significant amount of RPG1 protein is localized in plasma membrane [18]. There is a possibility that these interactions take place in or at the plasma membrane in vivo and lack of C-terminal end either hinders the possible plasma membrane localization of HvRIN4 and/or changes the protein confirmation which might affect its ability to interact with RPG1. Detailed in vivo studies are needed to test this possibility. Since full length HvRIN4 failed to interact with RPG1, we tested partial clones HvRIN440
246, HvRIN426
246 for interaction with mutant RPG1 clones, which affect resistance response against stem rust. HvRIN4 abolished interactions with KK461/462NQ and K461N but not with K462Q suggesting that the sites required for autophosphorylation are also required for RPG1 interaction with HvRIN4 (Fig. 7). However, apart from autophosphorylation sites in pK2 domain, pK1 domain is also required for HvRIN4 interaction with RPG1. In RPG1, pK2 domain is the catalytically active kinase domain and is important for resistance against stem rust [18]. Deletion of pK1 domain or simultaneous double mutation KK152/ 153NQ abolishes interactions with HvRIN4 but single mutations K152N and K153Q do not (Fig. 7). Lack of interactions with pK1 deletion or double mutation may be due to conformational change in the protein structure which hinders its interactions with HvRIN4. Further, we were unable to pull down HvRIN4 by immunoprecipitation with polyclonal RPG1 antibody (data not shown), which indicates that in vivo interactions between HvRIN4 and RPG1 may not be strong enough or may not exist under in vivo conditions. To elucidate the functional role of HvRin4 in barley, HvRin4 was silenced using VIGS. Knockdown of HvRin4 by both g_HvRin4_T1 and g_HvRin4_T2 constructs did not change the disease reaction in Steptoe (rpg1) and Morex (Rpg1) plants when compared to negative control BSMV.MCS (Fig. 8). A significant reduction in transcript levels of HvRin4 in g_HvRin4_T1 and g_HvRin4_T2 infected plants was observed compared to BSMV.MCS (Fig. 9). Lack of observable change in the infection phenotype suggests that HvRin4 is not strongly involved in Rpg1-mediated resistance pathway to cause a significant change in disease reaction. VIGS often results in partial silencing of the gene of interest. It is also possible that a small amount of HvRIN4 protein is sufficient for its role in Rpg1-mediated disease response and complete knockdown of HvRin4 is required for visible symptoms to appear. Acknowledgment Research was supported by National Research Initiative of the United States Department of Agriculture Co-operative State Research, Education, and Extension Service Grant No. 2007-3530118205 to A.K and B.J.S. References [1] Flor HH. Current status of the gene-for-gene concept. Ann Rev Phytopathol 1971;9:275e96. [2] Dodds PN, Lawrence GJ, Catanzariti AM, Teh T, Wang CI, Ayliffe MA, et al. Direct protein interaction underlies gene-for-gene specificity and coevolution of the flax resistance genes and flax rust avirulence genes. Proc Natl Acad Sci U S A 2006;103:8888e93. [3] Jia Y, McAdams SA, Bryan GT, Hershey HP, Valent B. Direct interaction of resistance gene and avirulence gene products confers rice blast resistance. EMBO J 2000;19:4004e14. [4] Tang X, Frederick RD, Zhou J, Halterman DA, Jia Y, Martin GB. Initiation of plant disease resistance by physical interaction of AvrPto and Pto kinase. Science 1996;274:2060e3. [5] Dangl JL, Jones JD. Plant pathogens and integrated defense responses to infection. Nature 2001;411:826e33. [6] Van der Biezen EA, Jones JD. Plant disease-resistance proteins and the genefor-gene concept. Trends Biochem Sci 1998;23:454e6. [7] Axtell MJ, Stskawicz BJ. Initiation of RPS2-specified disease resistance in Arabidopsis is coupled to the AvrRpt2-directed elimination of RIN4. Cell 2003; 112:369e77.

49

[8] Day B, Dahlbeck D, Huang J, Chisholm ST, Li D, Staskawicz BJ. Molecular basis for the RIN4 negative regulation of RPS2 disease resistance. Plant Cell 2005; 17:1292e305. [9] Mackey D, Holt BF, Wiig A, Dangl JL. RIN4 interacts with Pseudomonas syringae type III effector molecules and is required for RPM1-mediated resistance in Arabidopsis. Cell 2002;108:743e54. [10] Shao F, Golstein C, Ade J, Stoutemyer M, Dixon JE, Innes RW. Cleavage of Arabidopsis PBS1 by a bacterial type III effector. Science 2003;301:1230e3. [11] Kim MG, da Cunha L, McFall AJ, Belkhadir Y, DebRoy S, Dangl JL, et al. Two Pseudomonas syringae type III effectors inhibit RIN4-regulated basal defense in Arabidopsis. Cell 2005;121:749e59. [12] Kim HS, Desveaux D, Singer AU, Patel P, Sondek J, Dangl JL. The Pseudomonas syringae effector AvrRpt2 cleaves its C-terminally acylated target, RIN4, from Arabidopsis membranes to block RPM1 activation. Proc Natl Acad Sci U S A 2005;102:6496e501. [13] Wilton M, Subramaniam R, Elmore J, Felsensteiner C, Coaker G, Desveaux D. The type III effector HopF2(Pto) targets Arabidopsis RIN4 protein to promote Pseudomonas syringae virulence. Proc Natl Acad Sci U S A 2010;107:2349e54. [14] Mackey D, Belkhadir Y, Alonso JM, Ecker JR, Dangl JL. Arabidopsis RIN4 is a target of the type III virulence effector AvrRpt2 and modulates RPS2mediated resistance. Cell 2003;112:379e89. [15] Staples RC. A novel gene for rust resistance. Trends Plant Sci 2003;8:149e51. [16] Steffenson BJ. Analysis of durable resistance to stem rust in barley. Euphytica 1992;63:153e67. [17] Brueggeman R, Rostoks N, Kudrna D, Kilian A, Han F, Chen J, et al. The barley stem rust-resistance gene Rpg1 is a novel disease-resistance gene with homology to receptor kinases. Proc Natl Acad Sci U S A 2002;99:9328e33. [18] Nirmala J, Brueggeman R, Maier C, Clay C, Rostoks N, Kannangara CG, et al. Subcellular localization and functions of the barley stem rust resistance receptor-like serine/threonine-specific protein kinase Rpg1. Proc Natl Acad Sci U S A 2006;103:7518e23. [19] Giordanetto F, Kroemer RT. Prediction of the structure of human Janus kinase 2 (JAK2) comprising JAK homology domains 1 through 7. Protein Eng 2002;9:727e37. [20] Nirmala J, Drader T, Chen X, Steffenson B, Kleinhofs A. Stem rust spores elicit rapid RPG1 phosphorylation. Mol Plant Microbe Interact 2010;23(12):1635e42. [21] Nirmala J, Dahl S, Steffenson BJ, Kannangara CG, von Wettstein D, Chen X, et al. Proteolysis of the barley receptor-like protein kinase RPG1 by a proteasome pathway is correlated with Rpg1-mediated stem rust resistance. Proc Natl Acad Sci U S A 2007;104:10276e81. [22] Neff MM, Neff JD, Chory J, Pepper AE. dCAPS, a simple technique for the genetic analysis of single nucleotide polymorphisms: experimental applications in Arabidopsis thaliana genetics. Plant J 1998;14:387e92. [23] Manly KF, Cudmore Jr RH, Meer JM. Map Manager QTX, cross-platform software for genetic mapping. Mamm Genome 2001;12:930e2. [24] Kleinhofs A, Kilian A, Maroof MAS, Biyashev RM, Hayes P, Chen FQ, et al. A molecular, isozyme and morphological map of the barley (Hordeum-vulgare) genome. Theor Appl Genet 1993;86:705e12. [25] Brueggeman R, Drader T, Kleinhofs A. The barley serine/threonine kinase gene Rpg1 providing resistance to stem rust belongs to a gene family with five other members encoding kinase domains. Theor Appl Genet 2006;113:1147e58. [26] Yu Y, Tomkins JP, Waugh R, Frisch DA, Kudrna D, Kleinhofs A, et al. A bacterial artificial chromosome library for barley (Hordeum vulgare L.) and the identification of clones containing putative resistance genes. Theor Appl Genet 2000;101:1093e9. [27] Zhang L, Castell-Miller C, Dahl S, Steffenson B, Kleinhofs A. Parallel expression profiling of barley-stem rust interactions. Funct Integr Genomics 2008;8:187e98. [28] Kleinhofs A, Brueggeman R, Nirmala J, Zhang L, Mirlohi A, Druka A, et al. Barley stem rust resistance genes: structure and function. Plant Genome 2009;2:109e20. [29] Holzberg S, Brosio P, Gross C, Pogue GP. Barley stripe mosaic virus-induced gene silencing in a monocot plant. Plant J 2002;30:315e27. [30] Brueggeman R, Druka A, Nirmala J, Cavileer T, Drader T, Rostoks N, et al. The stem rust resistance gene Rpg5 encodes a protein with nucleotide-bindingsite, leucine-rich, and protein kinase domains. Proc Natl Acad Sci U S A 2008;105:14970e5. [31] Scofield SR, Huang L, Brandt AS, Gill BS. Development of a virus-induced genesilencing system for hexaploid wheat and its use in functional analysis of the Lr21-mediated leaf rust resistance pathway. Plant Physiol 2005;138:2165e73. [32] Kleinhofs A, Graner A. An integrated map of the barley genome. In: Phillips RL, Vasil IK, editors. DNA-based markers in plants. Dordrecht: Kluwer Academic Publishers; 2001. p. 187e99. [33] Luo Y, Caldwell KS, Wroblewski T, Wright ME, Michelmore RW. Proteolysis of a negative regulator of innate immunity is dependent on resistance genes in tomato and Nicotiana benthamiana and induced by multiple bacterial effectors. Plant Cell 2009;21:2458e72. [34] Horvath H, Rostoks N, Brueggeman R, Steffenson B, von Wettstein D, Kleinhofs A. Genetically engineered stem rust resistance in barley using the Rpg1 gene. Proc Natl Acad Sci U S A 2003;100:364e9. [35] Chisholm ST, Dahlbeck D, Krishnamurthy N, Day B, Sjolander K, Staskawicz BJ. Molecular characterization of proteolytic cleavage sites of the Pseudomonas syringae effector AvrRpt2. Proc Natl Acad Sci U S A 2005;102:2087e92. [36] Nirmala J, Drader T, Lawrence P, Yin C, Hulbert S, Steber C, et al. Concerted action of two avirulent spore effectors activate reaction to Puccinia Graminis 1 (Rpg1)-mediated cereal stem rust resistance. Proc Natl Acad Sci U S A 2011; 108:14676e81.