Identification of a potential target for treatment of squamous cell carcinoma of the tongue: follistatin

YBJOM-5911;

No. of Pages 6

ARTICLE IN PRESS Available online at www.sciencedirect.com

ScienceDirect British Journal of Oral and Maxillofacial Surgery xxx (2020) xxx–xxx

Identification of a potential target for treatment of squamous cell carcinoma of the tongue: follistatin M. Yu a,∗,1 , L. Xiao c,1 , Y. Chen a , H. Wang a , Y. Gao d , A. Wang b,∗ a

Department of Oral and Maxillofacial Surgery, Guangzhou Women and Children’s Medical Center, Guangzhou, China Department of Oral and Maxillofacial Surgery, First Affiliated Hospital, Sun Yat-sen University, Guangzhou, China c Department of Periodontology, Haizhu Square Hospital, Stomatological Hospital of Southern Medical University d Department of Stomatology, Longgang Central Hospital of Shenzhen, Shenzhen, China b

Abstract Squamous cell carcinoma (SCC) of the tongue is the most common oral cancer and is prone to develop regional lymph nodes and distant metastases. Reliable and stable therapeutic targets can improve the curative effect and reduce toxic side effects caused by traditional treatments such as surgery, radiotherapy, and chemotherapy. We have analysed three sets of series of functional gene expression of SCC of the tongue from gene expression omnibus (GEO) datasets, and 154 common differentially expressed genes (DEG) between SCC of the tongue and the corresponding normal tissues were screened. Further bioinformatics research that was based on the data from the Cancer genome atlas, Gene ontology, and the Kyoto encyclopaedia of genes and genomes indicated that the increased expression of follistatin might be correlated with a poor prognosis in these patients. By assay of colony formation, reverse transcription polymerase chain reaction (RT-PCR), western blotting, immunohistochemical staining, and lentivirus transfection, we confirmed that downregulation of follistatin inhibited the proliferation of SCC cells in the tongue. © 2020 The British Association of Oral and Maxillofacial Surgeons. Published by Elsevier Ltd. All rights reserved. Keywords: Squamous cell carcinoma of the tongue; differentially expressed genes; bioinformatics; prognosis; biomarker; follistatin

Introduction Squamous cell carcinoma (SCC) of the tongue is the most common oral cancer. Because of the tongue’s frequent movement, abundant lymphatic drainage, and rich blood supply, the SCC is prone to regional lymph nodes and distant metastases, and its prognosis is worse than that of the other oral cancers.1 In addition, because of its special location, it and its secondary tissue defect postperatively may impair the patient’s pronunciation and swallowing. Reliable and stable therapeutic targets can improve the curative effect and

∗

Corresponding authors. E-mail addresses: [email protected] (M. Yu), [email protected] (A. Wang). 1 These authors contributed equally to this work.

reduce the toxic side effects caused by surgery, radiotherapy, and chemotherapy.2–4 To achieve this goal, comprehensive analyses of as many cases as possible are required.5 Rapid development of molecular profiling technology makes DNA/RNA sequencing and protein detection faster and easier. Differentially expressed genes (DEG) or proteins within tumours and normal tissues can be screened by bioinformatic methods. By analysing the correlation between DEG, proteins, and patients’ survival, potential prognostic markers of the tumour can be screened, which is essential to help clinicians to formulate treatment plans and achieve “personalised” or “precise” treatment. Precise treatment has made remarkable achievements in the anti-cancer war. For example, imatinib mesylate (Gleevec, Novartis), which targets the BCR-Abl protein, increases the 5-year survival rate of patients with chronic

https://doi.org/10.1016/j.bjoms.2020.01.028 0266-4356/© 2020 The British Association of Oral and Maxillofacial Surgeons. Published by Elsevier Ltd. All rights reserved.

Please cite this article in press as: Yu M, et al. Identification of a potential target for treatment of squamous cell carcinoma of the tongue: follistatin. Br J Oral Maxillofac Surg (2020), https://doi.org/10.1016/j.bjoms.2020.01.028

YBJOM-5911;

No. of Pages 6

2

ARTICLE IN PRESS M. Yu et al. / British Journal of Oral and Maxillofacial Surgery xxx (2020) xxx–xxx

myeloid leukemia from 30% to 90%.6,7 Gefitinib (Iressa, AstraZeneca) and oxitinib mesylate (Terisha, Dachner) for the treatment of non-small cell lung cancer with mutant epidermal growth factor receptor (EGFR) effectively inhibited the division and reproduction of cancer cells.8–10 Advancements in bioinformatics facilitate largescale and in-depth analysis of abundant genomics data. Taking full advantage of existing data about gene function expression profiles is a cost-effective way to screen DEG. In this study, DEG between SCC of the tongue and paracancerous normal tissues in three series (GSE13601, GSE31056, and GSE9844) from GEO datasets (Gene Expression Omnibus11 ) were analysed.12–15 A total of 154 common DEG in the interactions of these three series were screened. Further bioinformatics research based on the data from the Cancer genome atlas,16 Gene ontology,17 and the Kyoto encyclopedia of genes and genomes18 indicate that the increased expression of follistatin might be correlated with poor prognosis in patients with SCC of the tongue. We therefore used colony formation assay, reverse transcription polymerase chain reaction (RT-PCR), western blotting, immunohistochemical staining, flowcytometry, and lentivirus transfection to show the relations between the two.

Material and methods DEG of SCC of the tongue and prognostic biomarker screening by bioinformatics The data of the three SCC of the tongue gene expression series (GSE13601-58 samples; GSE31056 - 96 samples; and GSE9844 - 38 samples) from GEO datasets were analysed using GEO2R (a software of GEO datasets based on open source R statistical programming language). The cutoff criteria are: probability of 0.05 or less, and the log2 -fold change (logFC)≤-1 or ≥1. By the DiVenn on-line reference, (Venn 2.1.0, an interactive tool for comparing lists with Venn diagrams),19 the common DEG of SCC of the tongue of these four series were acquired. The Cancer genome atlas was launched by the National Cancer Institute and the National Human Genome Research Institute which released the genome map of SCC of the head and neck in 2015.16 Their analysis of 279 cases provides a comprehensive view of the genomic changes of SCC of the head and neck.17 The common DEG screened above were analysed based on the data from the Cancer genome atlas to study the correlation between the degree of expression of these DEG and the prognosis of the patients with SCC of the head and neck.16,20 Using GraphPad software (version 7.0a), we drew a survival curve (Kaplan–Meier method) and compared the group that expressed many DEG (using the log rank test) with the group that expressed few DEG.

Experimental identification of the prognostic biomarker follistatin for SCC of the tongue RT-PCR Total RNA was extracted from the 62 fresh specimens (including 32 SCC of the tongue tissues and 30 matched normal tissues) using Trizol reagent (Invitrogen) according to the manufacturer’s protocol. RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) were used for converting mRNA to cDNA. Expression of follistatin mRNA was measured by quantitative RT-PCR using Perfectstart SYBR Green qPCR Master Mix (Omega BioTek). The primer sequences were as follows: 5 - AACCTACCGCAACGAATGTG3 (forward), 5 - AGCCTTGAAATCCCATAAGC3 (reverse), for FST; 5 -GACAGGATGCAGAAGGAGA TTACT3 (forward), 5 -TGATCCACATCTGCTG GAAGGT-3 (reverse) for ␤-actin. RT-PCR assays were done as described.21 Each assay reaction was made in triplicate and the mean value taken to reduce the experimental error. The 2-Ct method was used to quantify the relative expression of follistatin.22

Immunohistochemistry A retrospective study was made of 78 cases that had previously been diagnosed histopathologically as SCC of the tongue from 2006 to 2016. The operation was done by the same surgeon. Sections made of archived formalin-fixed, paraffin-embedded, tissues of these 78 cases were prepared for immunohistochemical staining. The sections were placed in boiled ethylene diamine tetraacetic acid (EDTA) for 20 minutes to retrieve the antigen, and treated by methanol containing 3% hydrogen peroxide to quench the endogenous peroxidase activity. Then, 1% bovine serum was used to block the non-specific binding. The sections were incubated with anti-follistatin antibody (1:1000; R&D Systems) at room temperature for 30 minutes and then treated with secondary antibody in working solutions. The sections were divided into two groups according to the percentage of follistatin-positive cells: a low expression group (<60%) and a high expression group (60%). Each slide was read and scored independently by two pathologists who had no information about this study. A survival curve was drawn using GraphPad software (version 7.0a) (Kaplan–Meier method) and the two groups compared (log-rank test). The correlation between the expression of follistatin protein and clinicopathological features of patients with SCC of the tongue was analysed.

Cell culture and materials The SCC of the tongue cell line SCC9 was obtained from Dr. Xiaofeng Zhou.22,23–26 SCC9 was cultured in Dulbecco’s modified Eagle medium/F12 medium supplemented with 10% fetal bovine serum (Gibco), in a standard humidified incubator with 5% CO2 at 37 ◦ C.

Please cite this article in press as: Yu M, et al. Identification of a potential target for treatment of squamous cell carcinoma of the tongue: follistatin. Br J Oral Maxillofac Surg (2020), https://doi.org/10.1016/j.bjoms.2020.01.028

YBJOM-5911;

No. of Pages 6

ARTICLE IN PRESS M. Yu et al. / British Journal of Oral and Maxillofacial Surgery xxx (2020) xxx–xxx

3

Fig. 1. Squamous cell carcinoma of the tongue differentially expressed genes and prognostic biomarker screening by bioinformatics.

Colony formation assay A total of 600 cells was plated in a 6-well plate in triplicate/experimental group as biological replicates. The cells were cultured at 37 ◦ C in a 5% CO2 incubator for 14 days. The medium was replaced with paraformaldehyde 4% 1 ml/well and incubated for 60 minutes at room temperature to fix the cells. After the supernatant had been removed, the clones were stained using 1 ml/well of Giemsa staining reagent (ThermoFisher Scientific) for one minute and examined under a light microscope. Each colony formation assay was made in triplicate.

Protein extraction and western blotting The cytoplasmic proteins of SCC9 cells were extracted according to the instructions of the cytoplasmic protein extraction kit (Beyotime). A total of cytoplasmic protein 30–60 μg was resolved on an 8%–12% precast gel using sodium dodecyl sulphate–polyacrylamide gel electrophoresis (Invitrogen) and transferred to polyvinylidene fluoride membranes (Bio-Rad). The membranes were then incubated with anti-follistatin antibody (1:5000; R&D Systems), overnight at 4 ◦ C, washed with phosphate-buffered saline, and incubated with secondary antibody (Beyotime) for one hour at room temperature. Finally, the immune complexes were developed using an enhanced chemiluminescence western blotting substrate, and protein expression was quantified using ImageJ software. Follistatin band intensities were normalised with ␤-actin signals.

Lentivirus transfection The siRNAs were designed and synthesised by a Jikai Gene Biological Inc. The Sense of the siRNA was as follows: 5 -AGAAACGUGCGAGAACGUGGATT3 and Anti-sense were 5 -UCCACGUUCUC GCACGUUUCUTT-3 . Lentiviral vectors expressing follistatinsiRNA (LV-FST-RNAi), non-silencing siRNA sequence (LV-Ctrl-RNAi), identical lentiviral vectors (LV-Ctrl) containing green fluorescent protein (GFP) were used for transfections.

CCK-8 assay Cell Counting Assay Kit-8 (CCK-8) was purchased from Dojindo Laboratory. SCC9-LV-FST-RNAi, SCC9-LV-CtrlRNAi and LV-Ctrl cells were seeded in 96-well plates (4 × 103 cells/well) and cultured for 24 and 48 hours. Then, 10 ␮l of CCK-8 solution was added to each well and the cells were incubated for another two hours. The absorbance values were then measured at 450 nm using a VICTOR X5 Multilabel plate reader (PerkinElmer). Statistical analyses We used the software GraphPad Prism (version 7.0a) for statistical analyses. The two-tailed Student’s t test for independent samples was used when a pair of conditions was compared. The analysis for each sample was repeated at least three times. Asterisks denote significance (*p < 0.05; **p < 0.01; ***p < 0.001). The data are reported as mean (SD).

Results DEG of SCC of the tongue and prognostic biomarker screening by bioinformatics A total of 154 common DEG of SCC of the tongue were screened based on the data of the three SCC of the tongue gene expression series (GSE13601 n = 58 samples; GSE31056 n = 96 Samples; GSE9844 n = 38 samples) from GEO datasets. Univariate analysis based on the data from the Cancer genome atlas showed that greater expression of follistatin was significantly related to poor prognosis in patients with SCC of the tongue, log-rank p value = 0.0004 (Fig. 1). Experimental identification of the potential target follistatin for treatment of SCC of the tongue RT-PCR validated that the follistatin mRNA level in SCC tissues in the tongue was significantly higher than that in matched normal tissues. Immunohistochemical staining con-

Please cite this article in press as: Yu M, et al. Identification of a potential target for treatment of squamous cell carcinoma of the tongue: follistatin. Br J Oral Maxillofac Surg (2020), https://doi.org/10.1016/j.bjoms.2020.01.028

YBJOM-5911;

ARTICLE IN PRESS

No. of Pages 6

4

M. Yu et al. / British Journal of Oral and Maxillofacial Surgery xxx (2020) xxx–xxx

Fig. 2. Correlation between expression of follistatin expression and squamous cell carcinoma of the tongue. Table 1 Correlation between expression of follistatin protein and clinicopathological features of patients with squamous cell carcinoma of the tongue. No. of patients Follistatin protein expression

p value

Low (≤65%) High (>65%) All patients Sex: Male Female Age (years): ≤60 >60 Maximum diameter of tumour (cm): ≤3 >3 Lymph node metastases: N0 N1 –N3 TNM stages: I II, III

78

38

40

46 32

21 17

25 15

42 36

20 16

22 20

0.198

0.355

0.019

40 38

26 15

14 23 0.025

30 48

17 20

13 28

26 52

16 22

10 30

0.022

firmed that follistatin protein expression was higher than that in matched normal tissue; Kaplan Meier curves showed that the five-year survival of the group with less expression was higher than that in the group with greater expression (Fig. 2). The expression of follistatin correlated with the prognosis of SCC of the tongue (Table 1). Follistatin was downregulated in SCC9 cells by lentivirus transfection, and western blotting, colony formation, and CCK8 assay showed that its downregulation inhibited the proliferative capacity of SCC9 cells (Fig. 3).

Discussion Follistatin is a protein coding gene that encodes a secreted ligand of transforming growth factor ␤ (TGF-␤). It regulates gene expression by recruiting and activating transcription factors of SMAD proteins. The encoded preproprotein is proteolytically processed to generate a subunit of the dimeric activin and inhibin protein complexes, and raised expression of this gene may be associated with cancer cachexia.27,28 Follistatin is an antagonist of activin (a member of the TGF-␤ superfamily) that acts as a pleiotropic growth factor, and is involved in proliferation, differentiation, and apoptosis of a number of multiple cells.28–32 Gene ontology,17 a database built by the Gene Onotology Consortium, shows that annotation for follistatin includes the following aspects: TGF-␤-receptor binding; transmembrane receptor protein serine/threonine kinase binding; bone morphogenetic protein receptor binding; carbohydrate derivative binding; and heparin binding. The Kyoto encyclopedia of genes and genomes18 pathway analysis for follistatin includes the following aspects: TGF-␤ signalling pathway; cytokine-cytokine receptor interaction; Hippo signalling pathway; and hedgehog signalling pathway. The TGF-␤ signalling pathway is involved in cell growth, cell differentiation, apoptosis, and cellular homeostasis, among other things. The Hippo signalling pathway, also known as Salvador/Warts/Hippo (SWH) pathway, is involved in restraining cell proliferation and promoting apoptosis. The above pathways have become increasingly important in the study of human cancer.32 Further study on the molecular mechanisms of follistatin in the development of SCC of the tongue is necessary to provide a potential therapeutic target for its treatment.

Please cite this article in press as: Yu M, et al. Identification of a potential target for treatment of squamous cell carcinoma of the tongue: follistatin. Br J Oral Maxillofac Surg (2020), https://doi.org/10.1016/j.bjoms.2020.01.028

YBJOM-5911;

ARTICLE IN PRESS

No. of Pages 6

M. Yu et al. / British Journal of Oral and Maxillofacial Surgery xxx (2020) xxx–xxx

5

Fig. 3. Downregulation of follistatin in squamous cell carcinoma (SCC) of the tongue cells by lentivirus transfection inhibited the proliferative capacity of the SCC cells.

Conflict of interest We have no conflicts of interest. Ethics statement/confirmation of patients’ permission The study was approved by the Institutional Review Board of Guangzhou Women and Children’s Medical Center and complied with the Helsinki Declaration. There are no patients’ personal details in any part of the paper or in any supplementary materials. Acknowledgements This work was supported in part by grants from the National Nature Science Foundation of China (NSFC81672659, NSFC81472523, NSFC31560265), the Guangzhou Science and Technology program project Collaborative Innovation Major Projects (201605131226218), the Guangdong Natural Science Foundation (2015A030313017 and S2012010008665). References 1. Byers RM, El-Naggar AK, Lee YY, et al. Can we detect or predict the presence of occult nodal metastases in patients with squamous carcinoma of the oral tongue? Head Neck 1998;20:138–44. 2. Zohdi I, El Sharkawy LS, El Bestar MF, et al. Selective neck dissection (IIa, III): a rational replacement for extended supraomohyoid neck dissection in patients with N0 supraglottic and glottic squamous cell carcinoma. Clin Med Insights Ear Nose Throat 2015;8:1–6.

3. Huang SF, Kang CJ, Lin CY, et al. Neck treatment of patients with early stage oral tongue cancer: comparison between observation, supraomohyoid dissection, and extended dissection. Cancer 2008;112:1066–75. 4. Ferlito A, Mannara GM, Rinaldo A, et al. Is extended selective supraomohyoid neck dissection indicated for treatment of oral cancer with clinically negative neck? Acta Otolaryngol 2000;120:792–5. 5. Bello IO, Soini Y, Salo T. Prognostic evaluation of oral tongue cancer: means, markers and perspectives (I). Oral Oncol 2010;46:630–5. 6. Peggs K, Mackinnon S. Imatinib mesylate—the new gold standard for treatment of chronic myeloid leukemia. N Engl J Med 2003;348:1048–50. 7. Apperley JF, Gardembas M, Melo JV, et al. Response to imatinib mesylate in patients with chronic myeloproliferative diseases with rearrangements of the platelet-derived growth factor receptor beta. N Engl J Med 2002;347:481–7. 8. Liu Y, Jiang H, Zhou H, et al. Lentivirus-mediated silencing of HOTAIR lncRNA restores gefitinib sensitivity by activating Bax/Caspase-3 and suppressing TGF-alpha/EGFR signaling in lung adenocarcinoma. Oncol Lett 2018;15:2829–38. 9. Li YQ, Liu YS, Ying XW, et al. Lentivirus-mediated disintegrin and metalloproteinase 17 RNA interference reversed the acquired resistance to gefitinib in lung adenocarcinoma cells in vitro. Biotechnol Prog 2018;34:196–205. 10. Lin KH, Hong ST, Wang HT, et al. Enhancing anticancer effect of gefitinib across the blood-brain barrier model using liposomes modified with one alpha-helical cell-penetrating peptide or glutathione and Tween 80. Int J Mol Sci 2016;17, pii: E1998. 11. Gene expression omnibus. Available from IRL: https://www.ncbi.nlm.nih.gov/gds. Last accessed 28 January 2020. 12. Enokida T, Fujii S, Takahashi M, et al. Gene expression profiling to predict recurrence of advanced squamous cell carcinoma of the tongue: discovery and external validation. Oncotarget 2017;8:61786–99. 13. Tuch BB, Laborde RR, Xu X, et al. Tumor transcriptome sequencing reveals allelic expression imbalances associated with copy number alterations. PLoS One 2010;5:e9317. 14. Estilo CL, O-charoenrat P, Talbot S, et al. Oral tongue cancer gene expression profiling: identification of novel potential prognosticators by oligonucleotide microarray analysis. BMC Cancer 2009;9:11. 15. Ye H, Yu T, Temam S, et al. Transcriptomic dissection of tongue squamous cell carcinoma. BMC Genomics 2008;9:69.

Please cite this article in press as: Yu M, et al. Identification of a potential target for treatment of squamous cell carcinoma of the tongue: follistatin. Br J Oral Maxillofac Surg (2020), https://doi.org/10.1016/j.bjoms.2020.01.028

YBJOM-5911; 6

No. of Pages 6

ARTICLE IN PRESS M. Yu et al. / British Journal of Oral and Maxillofacial Surgery xxx (2020) xxx–xxx

16. Cancer genome atlas. Available from URL: https://cancergenome.nih.gov/. Last accessed 6 February 2020. 17. Gene ontology. Available from URL: Geneontology.org. Last accessed 29 January 2020. 18. Kyoto encyclopedia of genes and genomes. Available from URL: https://www.genome.jp/kegg/mapper.html. Last accessed 6 February 2020. 19. Sun L, Dong S, Ge Y, et al. DiVenn: an interactive and integrated web-based visualization tool for comparing gene lists. Front Genet 2019;10:421. 20. The Cancer Genome Atlas Network. Comprehensive genomic characterization of head and neck squamous cell carcinomas. Nature 2015;517:576–82. 21. Lu Z, He Q, Liang J, et al. miR-31-5p is a potential circulating biomarker and therapeutic target for oral cancer. Mol Ther Nucleic Acids 2019;16:471–80. 22. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 2001;25:402–8. 23. He Q, Chen Z, Cabay RJ, et al. microRNA-21 and microRNA-375 from oral cytology as biomarkers for oral tongue cancer detection. Oral Oncol 2016;57:15–20. 24. Jiang L, Dai Y, Liu X, et al. Identification and experimental validation of G protein alpha inhibiting activity polypeptide 2 (GNAI2) as a microRNA-138 target in tongue squamous cell carcinoma. Hum Genet 2011;129:189–97.

25. Pascal TA, Abrol R, Mittal R, et al. Experimental validation of the predicted binding site of Escherichia coli K1 outer membrane protein A to human brain microvascular endothelial cells: identification of critical mutations that prevent E. coli meningitis. J Biol Chem 2010;285:37753–61. 26. Rappaport S, Fishilevich S, Nadel R. Rational confederation of genes and diseases: NGS interpretation via GeneCards, MalaCards and VarElect. Biomed Eng 2017;16(Suppl. 1):72. 27. Fishilevich S, Zimmerman S, Kohn A, et al. Genic insights from integrated human proteomics in GeneCards. Database (Oxford) 2016, pii: baw030. 28. McPherson SJ, Mellor SL, Wang H, et al. Expression of activin A and follistatin core proteins by human prostate tumor cell lines. Endocrinology 1999;140:5303–9. 29. Sulyok S, Wankell M, Alzheimer C, et al. Activin: an important regulator of wound repair, fibrosis, and neuroprotection. Mol Cell Endocrinol 2004;225:127–32. 30. Hashimoto O, Kawasaki N, Tsuchida K, et al. Difference between follistatin isoforms in the inhibition of activin signalling: activin neutralizing activity of follistatin isoforms is dependent on their affinity for activin. Cell Signal 2000;12:565–71. 31. Lerch TF, Shimasaki S, Woodruff TK, et al. Structural and biophysical coupling of heparin and activin binding to follistatin isoform functions. J Biol Chem 2007;282:15930–9. 32. Saucedo LJ, Edgar BA. Filling out the Hippo pathway. Nat Rev Mol Cell Biol 2007;8:613–21.

Please cite this article in press as: Yu M, et al. Identification of a potential target for treatment of squamous cell carcinoma of the tongue: follistatin. Br J Oral Maxillofac Surg (2020), https://doi.org/10.1016/j.bjoms.2020.01.028