- Email: [email protected]
Molecular characterization and expression analysis of interferon-gamma in the large yellow croaker Larimichthys crocea
Fish & Shellfish Immunology 46 (2015) 596e602
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Short communication
Molecular characterization and expression analysis of interferongamma in the large yellow croaker Larimichthys crocea Ruan-Ni Chen a, Yong-Quan Su a, Jun Wang a, Min Liu a, Ying Qiao a, Yong Mao a, *, Qiao-Zhen Ke b, Kun-Huang Han b, Wei-Qiang Zheng b, Jian-She Zhang c, Chang-Wen Wu c a b c
College of Ocean and Earth Sciences, Xiamen University, Xiamen, 361005, China Ningde Fufa Fisheries Co., LTD, Ningde, 352002, China Zhejiang Ocean University, Zhoushan, 316022, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 25 March 2015 Received in revised form 16 July 2015 Accepted 16 July 2015 Available online 17 July 2015
The large yellow croaker Larimichthys crocea is an important mariculture fish species in China, and the bacterium Vibrio harveyi (V. harveyi) and the ciliate protozoan Cryptocaryon irritans (C. irritans) are the two major pathogens in its aquaculture sector. Interferon-gamma (IFN-g) plays important roles in regulating both innate and cell mediated immune responses as an inflammatory cytokine. In this study, we obtained the nucleotide sequence of IFN-g from the large yellow croaker (LcIFN-g). The phylogenetic relationship tree of 18 available IFN-g genes was constructed based on their sequences. Expression analyses in 10 various tissues were conducted after the croaker challenged with V. harveyi and C. irritans, respectively. Real time PCR analysis showed that the expression of LcIFN-g was observed broadly in health individuals. After injected with V. harveyi, the 10 tissues had a higher expression of IFN-g at the first day (1 d); only spleen, muscle, intestine, heart and skin had higher expressions after infected with C. irritans at 1 d. Major immune tissues (skin, gill, head kidney and spleen) and detoxification tissue (liver) were sampled at 0 h, 6 h, 1 d, 2 d, 3 d, 4 d, 5 d and 7 d to understand the expression trends of LcIFN-g after challenged with C. irritans. The expressions of LcIFNg in skin and gill (the primary immune organs) showed a clear correlative relationship with the life cycle of C. irritans. © 2015 Elsevier Ltd. All rights reserved.
Keywords: Cryptocaryon irritans Interferon-gamma Gene expression Larimichthys crocea Vibrio harveyi
1. Introduction Disease and death caused by bacteria and parasites have led to severe economic losses in aquaculture sector. The bacterium Vibrio harveyi is one of the most serious pathogens in marine fish culture operations [1] and the infected individuals were always found with deep dermal lesions but not internal abnormalities [2]. Bacterial vaccines have been developed in marine fishes [3,4]. The ciliate protozoan Cryptocaryon irritans has been found to infect marine fishes; however, pathogenic mechanisms remained unclear [5,6]. Various medicines and chemicals, known to be nonenvironmental friendly, were commonly used in treatments or prevention. Understanding the pathogenic mechanisms and
* Corresponding author. E-mail address: [email protected] (Y. Mao). http://dx.doi.org/10.1016/j.fsi.2015.07.008 1050-4648/© 2015 Elsevier Ltd. All rights reserved.
immunity of fishes were necessary to treat disease and prevent death. Interferon (IFN) plays important roles in regulating both innate and cell mediated immune responses as an inflammatory cytokine. In mammals, three types of IFNs [Type I IFN, Type II IFN and IFN-g] can be distinguished based on their gene sequence, protein structure and functional property [7], and IFN-g is mainly produced by T, NK and NKT cells [8e10]. IFN was first found in fishes in the 1970s [11,12], and the IFN-g producing cells were similar to those in mammals [9]. IFN-g plays an important role in antimicrobial and antiviral through the JAK-STAT signal transduction pathway [10,13,14]. Among the key activities of IFN-g, little has been studied to understand its effects with parasites in fishes. The large yellow croaker Larimichthys crocea (Perciformes: Sciaenidae) was once one of the three commercially important marine fishes in capture fisheries in 1950se1980s in China. Exploration of both spawning and over-wintering grounds, and ineffective and insufficient management measures led to the
R.-N. Chen et al. / Fish & Shellfish Immunology 46 (2015) 596e602
dramatically decline of the wild stocks of the croaker [15]. The croaker has been widely cultured in southern China since the 1990s, mainly in floating cages; in terms of the estimated national marine fish culture production (volume) at species level the croaker is currently at the second rank [16]. V. harveyi and C. irritans are the two major pathogens in the croaker culture industry, and have contributed to severe economic losses. In this study, we documented the cDNA and genomic sequences of LcIFN-g from the croaker. We reported the expression trends of LcIFN-g in 10 different tissues of the croaker after challenges of V. harveyi and C. irritans respectively. The results provide a theoretical basis for further study the inflammatory cytokines in immune responses against pathogen infections in fishes. 2. Materials and methods 2.1. Sample collection and treatment Individuals of the large yellow croaker under healthy condition were purchased from a farm in Ningde City, Fujian Province, China, and kept alive in a concrete tank under aeration and 26e27 C. In order to obtain enough blood samples, fifty large individuals of the croaker (mean body weight of 403.0 ± 82.0 g) were selected for V. harveyi challenge treatment in summer, May, 2010. Individuals of the treatment group (n ¼ 25) were injected with 107 colony-forming units (cfu) of V. harveyi TS-628, which was isolated from the orange-spotted grouper Epinephelus coioides. Individuals of the control group (n ¼ 25) were injected with the same volume of 1.5% of NaCl. At the first day (1 d) after injection, 10 tissues (i.e. head kidney, gill, stomach, intestine, brain, blood, spleen, liver, heart and muscle) from both treatment (n ¼ 3) and control (n ¼ 3) groups were randomly collected and stored at 80 C in RNA fixer (BioTek Corporation). Muscle was also sampled and stored at 20 C in 100% ethanol for DNA extraction. Sixty small individuals of the croaker (mean body weight of 85.5 ± 15.1 g) were selected for C. irritans challenge treatment in summer, June, 2012. Individuals (n ¼ 50) were maintained with a dose of 26,665 theronts per fish for three days. The infected individuals were subsequently transferred to a tank with clear seawater at 4 d right after the release of the trophonts from the infected individuals, and kept till 7 d. The protozoan was previously obtained from an outbreak of white spot disease in the croaker culture area. Ten tissues (see above except replace blood with skin) were collected at 1 d (n ¼ 3), and additionally skin, head-kidney, liver, gill and spleen were collected at 0 h, 6 h, 1 d, 2 d, 3 d, 4 d, 5 d and 7 d (n ¼ 3 each) post treatment and stored at 80 C in RNA fixer (BioTek Corporation). The skin samples were taken from the dorsal part of the body trunk. Same 10 tissues were sampled from the control group at 0 h (n ¼ 3). 2.2. Identification of LcIFN-g cDNA and genomic sequences Total RNA from head kidney (0 h and 1 d with V. harveyi challenge treatment) of the croaker was extracted using RNAiso Plus (TaKaRa) according to the manufacturer's instructions. The suppression subtractive hybridization (SSH) cDNA library of head kidney infected by V. harveyi was constructed. According to the SSH cDNA library, LcIFN-g was obtained from different cDNA fragments. cDNA was cloned in pMD18-T plasmid and transformed into competent Escherichia coli. IFN-g was identified by BLASTX analysis of sequences. Rapid amplification of cDNA ends (RACE) PCR were performed with a SMART RACE cDNA Amplification kit (TaKaRa) to get the full-length LcIFN-g cDNA using primers based on the partial
597
sequences obtained above. With DNA extracted from muscle as template, specific primers were used to amplify the full-length of LcIFN-g (Table 1). 2.3. Real-time quantitative PCR (RT-PCR) Total RNA of the 10 different tissues with both V. harveyi and saline injected individuals were extracted as described above. Firststrand cDNA was synthesized using the PrimeScript RT reagent Kit with gDNA Eraser (TaKaRa DRR034A) according to the manufacturer's protocol. Quantitative PCR was performed using ABI Prism 7500 RT PCR machine with SYBR Premix DimerEraser (TaKaRa RR091A). RT primers for LcIFN-g and the endogenous controls bactin were listed in Table 1. Thermo cycling condition was 95 C for 30 s, followed by 40 cycles at 95 C for 3 s, 60 C for 30 s and 72 C for 30 s. A melting curve analysis of the amplification products was added to the protocol to assess the specificity of the PCR products. In all RT PCR ran a negative control without templates and each reaction was performed in triplicate. b-actin was used as endogenous control for both treatment and control groups. The PCR efficiencies were determined by analyzing three-fold serial dilutions of cDNA. The amplified efficiencies were close to 100% in order to use the 2△△CT method for calculation. With C. irritans infected (1 d) experiment, the 10 tissues from healthy individuals served as calibrators. Total RNA of different tissues was extracted as described above. Total RNA was also isolated from skin, gill, head-kidney, liver and spleen at 0 h, 6 h, 1 d, 2 d, 3 d, 4 d, 5 d and 7 d post treatments. All analysis conditions were the same as mentioned above. 2.4. Statistical analysis Sequences were analyzed through the National Center for Biotechnology Information (NCBI). Potential transcription factor binding sites were identified using the TFBIND (http://tfbind.ims.utokyo.ac.jp/). The signal peptide was predicted using the signal P3.0 server (http://www.cbs.dtu.dk/services/SignalP/). Sequence alignments and percent amino acid identity between sequences were performed using the MegAlign program (DNASTAR Inc., Madison, WI, USA). The phylogenetic tree was constructed from the multiple alignments using the Neighbour-Joining (NJ) method in the MEGA3.1 software package. The reliability of the tree topology was tested using bootstrap resampling (2500 replicates). Secondary structure was predicted using STRIDE (http://pbil.univ-lyon1.fr/). Data on relative mRNA expression of LcIFN-g in different tissues were calculated as the means ± SD (n ¼ 3), and the significant
Table 1 Nine primers and their applications used in this study. Primer
Sequence (50 -30 )
Application
Cdna3f Cdna3r Cdna5f Cdna5r F R P1 P2 P3 vrtf vrtr crtf crtr b-Actinf b-Actinr
GGTCATGGGCGGCGTGTTGAACA CCAACGACTGGAAGCACCGAGAC GCCTTCCGTGCTTGCCGCCG TGGGGATGACCGGCTTCCCGTC CGCCAGACTCCGGACAAACTTTGGGAATCG GCTGGCACGCTGGTTTGGATTTGGCTGTC TGTGAACGCAGCAGGAGGAAACAGGGCTTG TCATCTCCGCGGGGATGGTGAAGCCTC GTGAGGGCAGTGGTTTGTCTGTCTC CAGGTCAGAGGCTTCACCATCCCCG TGTTCAGGCATCATCTCTTTGGGGA CAAGGACCTGAAGAAATACCGTTAC CTCCCACAATGCTTTGGACTGAA AAGCCAACAGGGAGAAGATGAC ACAGCTTCTCCTTGATGTCACG
PCR PCR PCR PCR PCR PCR Genome walking Genome walking Genome walking Real-time PCR Real-time PCR Real-time PCR Real-time PCR Real-time PCR Real-time PCR
598
R.-N. Chen et al. / Fish & Shellfish Immunology 46 (2015) 596e602
difference was determined using one-way ANOVA with Tukey's post-hoc test at a level of 0.05.
predicted glycosylation sites in the N-terminal region of the mature peptide.
3. Results
3.2. Phylogenetic tree of LcIFN-g
3.1. DNA sequence of LcIFN-g
IFN-g genes among 18 vertebrates from fish to human had relatively low sequences similarity (Table 2). LcIFN-g showed the highest degree (56.8%) of identity with E. coioides and relatively
The full-length of LcIFN-g sequence was 4561 bp, consisted of four exons and three introns and had 50 UTR (76 bp) and 30 UTR (787 bp) (Fig. 1). The first exon contained a region of 196 bp that encoding a 22 amino acid (aa) signal sequence. Exons 2, 3 and 4 encoded 17, 74 and 55 aa, respectively. All three introns interrupted the open reading frame exactly between two codons and obeyed the GT/AG rule. Transcription factor binding sites, such as TATA boxes, AML1a, CAP, ADR1, GATA-1 and CdxA were predicted. Putative binding sites for the transcription factors activator protein 1 (AP-1), the highly polymorphic CA microsatellite repeats in first intron and the CT microsatellite repeats in 50 UTR were also presented in LcIFN-g gene. Additionally six RNA instability regions (ATTTA) characteristic of IFN-g transcripts presented in the 30 UTR. The open reading frame encoded a 200 aa peptide. Secondary structure showed that LcIFN-g had six main a-helices. The mature protein contained a signature motif [I/V]-Q-X-[K/Q]-A-X2-E-[L/F]X2-[I/V] and a nuclear localization signal (NLS) motif at the C-terminal end of the protein. The LcIFN-g also contained one noncharacteristic nuclear localization signal (RRRR) and two
Table 2 Amino acid identity of IFNg genes in 18 vertebrates from fishes to mammals. Species
Amino acid identity (%)
Organe-spotted grouper Epinephelus coioides Japanese flounder Paralichthys olivaceus Torafugu Takifugu rubripes Atlantic cod Gadus morhua Atlantic salmon Salmo salar Rainbow trout Oncorhynchus mykiss Channel catfish Ictalurus punctatus Common carp Cyprinus carpio Zebrafish Danio rerio Frog Xenopus tropicalis Chicken Gallus gallus Rabbit Oryctolagus cuniculus Dog Canis lupus familiaris Horse Equus caballus Mouse Mus musculus Human Homo sapiens
56.8 54.1 45.7 26.3 26.7 27.2 18.3 16.5 15.1 15.1 17.1 14.4 17.5 15.7 12.3 10.8
Fig. 1. The nucleotide sequence and deduced amino acid sequence of IFN-g gene in the large yellow croaker. TATA box, AML1a, CAP, ADR1, GATA-1 and CdxA binding sites, and simple sequence repeats were marked with underline. The amino acid sequence shown in upper case letters under the nucleotide sequence and the predicted signal sequence underlined whilst the translation stop codon is indicated by an asterisk.
R.-N. Chen et al. / Fish & Shellfish Immunology 46 (2015) 596e602
599
Fig. 2. Phylogenetic tree of 18 IFN-g genes from 11 fishes included Cyprinus carpio (CAJ51088.1), Carassius auratus (ACG68885.1), Danio rerio (NP_998029.1), Epinephelus coioides (AFM31242.1), Gadus morhua (ADG85734), Ictalurus punctatus (ADG85734), Larimichthys crocea (AIZ77177), Oncorhynchus mykiss (NP_001153975.1), Paralichthys olivaceus (BAG50576.1), Salmo salar (NP_001117030.1) and Takifugu rubripes (CAE82301.2), and seven higher vertebrates including frog Xenopus tropicalis (XP_002938555.1), chicken Gallus gallus (NP_990480.1), rabbit Oryctolagus cuniculus (NP_001075460.1), horse Equus caballus (ABS28998.1), dog Canis lupus familiaris (NP_001003174.1), mouse Mus musculus (NP_032363.1) and human Homo sapiens (CAA31639.1).
high with Paralichthys olivaceus and Takifugu rubripes (50.5% and 47.1%, respectively) and low identity (15.1e26.3%) with the remaining fishes (Table 2). The lowest level of sequence identity was with IFN-g from human (10.8%) whilst the identity with IFN-g sequences in other higher vertebrates varied from 10.8 to 17.5% (Table 2). The IFN-g sequences from fishes and other higher vertebrates segregated into two separate clusters with high bootstrap confidence values, and the fishes further grouped into three clades (Fig. 2). 3.3. Expression of LcIFN-g after V. harveyi infection Liver displayed the most abundant expression level of LcIFN-g among the tested tissues of the healthy individuals; gill and spleen also displayed high level, but little in heart and muscle (data not show). The levels of LcIFN-g transcripts increased
significantly in all tissues except gill at 1 d after V. harveyi injection; 22-fold in head kidney and 9-fold in spleen compared to the control (Fig. 3). 3.4. Expression of LcIFN-g after C. irritans infection Expression of LcIFN-g was low in muscle, heart, brain, skin, stomach, intestine and head kidney, and high in spleen, liver and gill (Fig. 4). Significant differences were found in all 10 tissues before and after infection with C. irritans (p < 0.05). After infection, heart, intestine, muscle, spleen and skin showed an up-regulation. The remaining tissues had a down-regulation; there was over more than 7efold down-regulation in gill. The level of LcIFN-g transcripts in skin sharply increased at 6 h and steadied till 1 d, after a low expression at 2e4 d, a significant increase occurred at 5 d then dropped at 7 d (Fig. 5A). The
Fig. 3. Relative expression of IFN-g in 10 tissues of the large yellow croaker at one day after Vibrio harveyi infection (n ¼ 3, mean ± SD). Gene expression was normalized to b-actin. Significant differences (p < 0.05) between control and infection groups were indicated with an asterisk.
600
R.-N. Chen et al. / Fish & Shellfish Immunology 46 (2015) 596e602
Fig. 4. Relative expression of IFN-g in 10 tissues of the large yellow croaker at one day after infected with Cryptocaryon irritans (n ¼ 3, mean ± SD). Gene expression was normalized to b-actin. Significant differences (p < 0.05) between control and infection groups were indicated with an asterisk.
transcripts in head kidney increased slightly first then showed a sharp drop to the lowest at 3 d; a recovery occurred at 4 d and recovered to a new top at 5 d then stayed low level at 7 d (Fig. 5B). In liver, the expression stayed low and there was a sharp increase at 4 d; a sharp drop occurred at 5e7 d (Fig. 5C). LcIFN-g in gill varied by days and there was obviously an up-regulation from 2 d to 3 d (Fig. 5D) (p < 0.05). The expression of IFN-g in spleen showed a similar trend with head kidney but with relatively high transcripts at 6 h (Fig. 5E). 4. Discussion IFN-g has been extensively studied in higher vertebrates (e.g. chicken, mouse and human) with respects to its characterization, expression and regulation of immune functions [7,10,17]; however, it was not well investigated in lower vertebrates such as fishes [18e20]. In this study, we obtained the whole genomic sequence of IFN-g from the large yellow croaker, which showed similar structure with those of higher vertebrates and fishes documented, containing four exons and three introns but with low sequence identity (Figs. 1 and 2) [21]. A number of transcription factors such as STAT, GATA-3 and AP-1 were involved in regulation of IFN-g production in mammals. In fishes such as the Atlantic cod Gadus morhua, an ISRE/STAT element was found and suggested to be important in up-regulating by Type I and dsRNA [22]. In this study TATA box, AML1a, CAP, ADR1, GATA-1, CdxA and AP1 in the LcIFN-g were identified, inferring their important roles in immune activity in the large yellow croaker. The polymorphism of CA microsatellites in the first intron of IFN-g was known to be associated with a variety of diseases (e.g. rheumatoid arthritis, leprosy and Hashimoto's disease) in mammals [23e26]; however, it is little known in fishes. In this study, a CA repeat was identified in first intron of LcIFN-g, and also a CT repeat was found in 50 UTR. It merits further studies to understand the relationship between the polymorphisms of CA microsatellites and disease resistances with LcIFN-g. The LcIFN-g amino acids sequence had similar hallmark features with other fishes, including some of the binding sites, signature sequence and nuclear localization signal which were very important for its activities [13] Furthermore, the mature peptide sequence of LcIFN-g showed high degree of identity with other fishes (the highest up to 56.8%). These results suggested that IFN-g served as similar functions in fishes.
Vibrio species are important pathogens in aquaculture sector [6,27e32]. Studies mainly focused on the mechanisms of immune responses and the application [1,30]. Fishes such as goldfish and Atlantic cod showed the expression of IFN-g in head-kidney, an important immune organ [22,33,34], suggested that IFN-g might play important roles in antibacterial. In this study, LcIFN-g was expressed constitutively in all 10 tested tissues (i.e. head kidney, gill, stomach, intestine, brain, blood, spleen, liver, heart and muscle) after V. harveyi injection. IFN-g were produced in multiple organs illustrated that it was also a vital factor to immune system of the large yellow croaker and the higher expression (Fig. 3) might suggested it plays important roles in against V. harveyi infection. Little was known about the role of IFN-g in the defense against C. irritans in fishes [35,36]. This study for the first time investigated the expression of LcIFN-g after C. irritans infection to understand its function in immunity. The expressions of LcIFN-g in head kidney, stomach, brain, gill and liver were decreased after infected with C. irritans. Gill, as the first line of defense and directly contacted with environment, showed a high expression of LcIFN-g in healthy individuals (Fig. 4). The expression of LcIFN-g in gill was finally suppressed, inferred the poor resistance of the large yellow croaker after infection. In mammals Th1 response, including IFN-g, is considered to lead the attack against intracellular pathogens such as viruses. Th2 response is believed to emphasize protection against extracellular pathogens such as multicellular parasites [37]. In the large yellow croaker, a recent study on its genome revealed a well-established innate immune system and a partially established adaptive immune system [35], therefore it is possible that the Th2 response is induced by the parasite infection and that IFN-gamma expression are inhibited. Skin, also the first line of defense but with low coverage rate of C. irritans, had a higher expression after infection. The life cycle of C. irritans involves four developmental stages, which are trophont, protomont, tomont and theront [6]. The whole life cycle usually takes 7e10 days; the theront, been born infectious in 6 h, parasitizing at skin and gill to form the trophont, which would release and ulcerated hosts after three days. Then new theronts been born after another three day. In this study, primary immune organs (skin, gill, spleen and head-kidney) and detoxification organ (liver) of the large yellow croaker were further constructed after C. irritans infection (Fig. 5). Skin, as the first line against parasites, increased strongly immediately after infection and a slightly recover occurred when C. irritans released. Low
R.-N. Chen et al. / Fish & Shellfish Immunology 46 (2015) 596e602
601
Fig. 5. Expressions of IFN-g in skin (A), head kidney (B), liver (C), gill (D) and spleen (E) of the large yellow croaker by SYBR Green real-time PCR at 0h, 6h,1d, 2d, 3d, 4d, 5d and 7d post infection with Cryptocaryon irritans. Gene expression was normalized to b-actin. Significant differences (p < 0.05) between control and infection groups were indicated with an asterisk.
transcript levels were observed in gill at 1 d until a sharp recovery occurred at 3 d when C. irritans released from hosts. This phenomenon suggested that C. irritans could suppress the expression of IFN-g in gill. The transcript level of IFN-g in spleen was immediately up-regulated after C. irritans infection, which might prove that spleen was the first immune tissue to take part in immune regulations. Same pattern was documented in Atlantic cod, goldfish and channel catfish [22,33,38]. We found the liver maintained a low expression of LcIFN-g until 4 d, the day after theronts released, indicated liver did not participate the immune against C. irritans. In head-kidney a slight change agreed with infected progress which down regulated during C. irritans infection then up to the point at 5 d and down again. The expression of LcIFN-g in the skin and gill suggested that their expression trends had a clear relationship with the infection progress of C. irritans. In another study, Vibrio species was isolated from fish after infected by C. irritans [39], inferring the secondary bacterial infection was the main reason led to the death of the large yellow croaker.
In conclusion, IFN-g was cloned and investigated in the large yellow croaker, expressed broadly in tissues with the highest level in liver by using RT-PCR. After injected by V. harveyi, the transcript levels of IFN-g were higher in all tissues tested; however, displayed a lower level in gill, liver, head-kidney, stomach and brain after infected with C. irritans. The expression trends related to the infection progress of C. irritans. The expressions infected by the two pathogens demonstrated that IFN-g played an important role in pathogen defenses.
Acknowledgments This work was financial supported by the State 863 Project of China (Grant No. 2012AA10A403) and the National Natural Science Foundation of China (Grant Nos. 31372504 and 41476118). The authors would like to thank Ningde (Fujian Province, China) Fufa Fisheries Co., Ltd. for providing fish and facility.
602
R.-N. Chen et al. / Fish & Shellfish Immunology 46 (2015) 596e602
References [1] P.C. Liuxy, K.K. Lee, S.N. Chen, Pathogenicity of different isolates of Vibrio harveyi in tiger prawn, Penaeus monodon, Lett. Appl. Microbiol. 22 (1996) 413e416. [2] B. Austin, X. Zhang, Vibrio harveyi: a significant pathogen of marine vertebrates and invertebrates, Lett. Appl. Microbiol. 43 (2006) 119e124. [3] T. Håstein, R. Gudding, O. Evensen, Bacterial vaccines for fishean update of the current situation worldwide, Dev. Biol. 121 (2004) 55e74. [4] D.H. Lenz, K.C. Mok, B.N. Lilley, R.V. Kulkarni, N.S. Wingreen, B.L. Bassler, The small RNA chaperone Hfq and multiple small RNAs control quorum sensing in Vibrio harveyi and Vibrio cholerae, Cell 118 (2004) 69e82. [5] Y.S. Zhong, Prevention and cure of fish disease surveys and control countermeasures of diseases of Cryptocaryon irritans in marine cage cultured fishes in the main cultured areas of Fuiian province, Fish. Sci. Technol. Inf. 36 (2009) 4e7 (Chinese). [6] A. Li, X. Lin, N. Teng, X. Zhu, A standardized method to propagate Cryptocaryon irritans on a susceptible host pompano Trachinotus ovatus, Aquaculture 258 (2006) 127e133. [7] S. Pestka, C.D. Krause, M.R. Walter, Interferons, interferon-like cytokines, and their receptors, Immunol. Rev. 202 (2004) 8e32. [8] P.S. Subramaniam, M.M. Green, J. Larkin, B.A. Torres, H.M. Johnson, Nuclear translocation of IFN-g is an intrinsic requirement for its biologic activity and can be driven by a heterologous nuclear localization sequence, J. Interferon Cytokine Res. 21 (2001) 951e959. [9] B. Robertsen, The interferon system of teleost fish, Fish Shellfish Immunol. 20 (2006) 172e191. [10] C. Langevin, E. Aleksejeva, G. Passoni, N. Palha, J.-P. Levraud, P. Boudinot, The antiviral innate immune response in fish: evolution and conservation of the IFN system, J. Mol. Biol. 425 (2013) 4904e4920. [11] P. De Kinkelin, M. Dorson, Interferon production in rainbow trout (Salmo gairdneri) experimentally infected with Egtved virus, J. General Virol. 19 (1973) 125e127. [12] H. Oie, P. Loh, Reovirus type 2: induction of viral resistance and interferon production in fathead minnow cells, Exp. Biol. Med. 136 (1971) 369e373. [13] J. Zou, C.J. Secombes, Teleost fish interferons and their role in immunity, Dev. Comp. Immunol. 35 (2011) 1376e1387. [14] D.S. Aaronson, C.M. Horvath, A road map for those who don't know JAK-STAT, Science 296 (2002) 1653e1655. [15] M. Liu, Y. Sadovy de Mitcheson, Profile of a fishery collapse: why mariculture failed to save the large yellow croaker, Fish Fish. 9 (2008) 219e242. [16] Bureau of Fisheries, Ministry of Agriculture, China Fishery Statistical Yearbook, Agriculture Press, Beijing, 2013. [17] A. Isaacs, J. Lindenmann, Virus interference. I. The interferon, Proc. R. Soc. Lond. Ser. B-Biol. Sci. 147 (1957) 258e267. [18] R.R. Herberman, J.R. Ortaldo, G.D. Bonnard, Augmentation by interferon of human natural and antibody-dependent cell-mediated cytotoxicity, Nature 277 (1979) 221e223. [19] D.K. Dalton, S. Pitts-Meek, S. Keshav, I.S. Figari, A. Bradley, T.A. Stewart, Multiple defects of immune cell function in mice with disrupted interferongamma genes, Science 259 (1993) 1739e1742. [20] M.R. Digby, J.W. Lowenthal, Cloning and expression of the chicken interferong gene, J. Interferon Cytokine Res. 15 (1995) 939e945. [21] R. Savan, S. Ravichandran, J.R. Collins, M. Sakai, H.A. Young, Structural conservation of interferon gamma among vertebrates, Cytokine Growth Factor Rev. 20 (2009) 115e124.
[22] C. Furnes, M. Seppola, B. Robertsen, Molecular characterisation and expression analysis of interferon gamma in Atlantic cod (Gadus morhua), Fish Shellfish Immunol. 26 (2009) 285e292. [23] V. Pravica, C. Perrey, A. Stevens, J.H. Lee, I.V. Hutchinson, A single nucleotide polymorphism in the first intron of the human IFN-gamma gene: absolute correlation with a polymorphic CA microsatellite marker of high IFN-g production, Hum. Immunol. 61 (2000) 863e866. [24] A. Khani-Hanjani, D. Lacaille, D. Hoar, A. Chalmers, D. Horsman, M. Anderson, et al., Association between dinucleotide repeat in non-coding region of interferon-gamma gene and susceptibility to, and severity of, rheumatoid arthritis, Lancet 356 (2000) 820e825. [25] G.A. Silva, M.P. Santos, I. Mota-Passos, A.L. Boechat, A. Malheiro, F.G. Naveca, et al., IFN-gamma þ875 microsatellite polymorphism as a potential protection marker for leprosy patients from Amazonas state, Brazil, Cytokine 60 (2012) 493e497. [26] C. Ito, M. Watanabe, N. Okuda, C. Watanabe, Y. Iwatani, Association between the severity of Hashimoto's disease and the functionalþ 874A/T polymorphism in the interferon-gamma gene, Endocr. J. 53 (2006) 473e478. [27] S.M.J. Punitha, M.M. Babu, V. Sivaram, V.S. Shankar, S.A. Dhas, T.C. Mahesh, et al., Immunostimulating influence of herbal biomedicines on nonspecific immunity in Grouper Epinephelus tauvina juvenile against Vibrio harveyi infection, Aquac. Int. 16 (2008) 511e523. [28] B. Diggles, J. Carson, P. Hine, R. Hickman, M. Tait, Vibrio species associated with mortalities in hatchery-reared turbot (Colistium nudipinnis) and brill (C. guntheri) in New Zealand, Aquaculture 183 (2000) 1e12. [29] M. Li, C. Wang, L. Sun, A pathogenic Vibrio harveyi lineage causes recurrent disease outbreaks in cultured Japanese flounder (Paralichthys olivaceus) and induces apoptosis in host cells, Aquaculture 319 (2011) 30e36. [30] E.A. Tendencia, Vibrio harveyi isolated from cage-cultured seabass Lates calcarifer Bloch in the Philippines, Aquac. Res. 33 (2002) 455e458. ~ igo, [31] R. Rico, S. Tapia-Paniagua, E. Martínez-Manzanares, M. Balebona, M. Morin Characterization of Vibrio harveyi strains recovered from diseased farmed Senegalese sole (Solea senegalensis), J. Appl. Microbiol. 105 (2008) 752e760. [32] C. Chen, B. Cheng, H. Yu, Y. Wang, Z. Yang, C. Shi, Isolation and identification of a pathogenic bacterium from Epinephelus septemfasciatus with exophthalmic disease, Prog. Fish. Sci. 31 (2010) 25e33 (Chinese). [33] L. Grayfer, M. Belosevic, Molecular characterization, expression and functional analysis of goldfish (Carassius aurutus L.) interferon gamma, Dev. Comp. Immunol. 33 (2009) 235e246. [34] B. Huang, S.N. Chen, W.S. Huang, P. Nie, Molecular characterization and expression of interferon gamma(IFN-g) in orange-spotted grouper (Epinephelus coioides), J. Fish. Sci. China 2 (2013) 269e275 (Chinese). [35] C. Wu, D. Zhang, M. Kan, Z. Lv, A. Zhu, Y. Su, et al., The draft genome of the large yellow croaker reveals well-developed innate immunity, Nat. Commun. (2014), http://dx.doi.org/10.1038/ncomms6227. [36] P. Alvarez-Pellitero, Fish immunity and parasite infections: from innate immunity to immunoprophylactic prospects, Veterinary Immunol. Immunopathol. 126 (2008) 171e198. [37] P. Kidd, Th1/Th2 balance: the hypothesis, its limitations, and implications for health and disease, Altern. Med. Rev. 8 (2003) 223e246. [38] I. Milev-Milovanovic, S. Long, M. Wilson, E. Bengten, N.W. Miller, V.G. Chinchar, Identification and expression analysis of interferon gamma genes in channel catfish, Immunogenetics 58 (2006) 70e80. [39] Z.Y. Liu, Research on death caused by secondary bacterial infection of Cryptocaryon irritans on Pseudosciaena crocea, J. Fish. 34 (2012) 11e15 (Chinese).
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Short communication
Molecular characterization and expression analysis of interferongamma in the large yellow croaker Larimichthys crocea Ruan-Ni Chen a, Yong-Quan Su a, Jun Wang a, Min Liu a, Ying Qiao a, Yong Mao a, *, Qiao-Zhen Ke b, Kun-Huang Han b, Wei-Qiang Zheng b, Jian-She Zhang c, Chang-Wen Wu c a b c
College of Ocean and Earth Sciences, Xiamen University, Xiamen, 361005, China Ningde Fufa Fisheries Co., LTD, Ningde, 352002, China Zhejiang Ocean University, Zhoushan, 316022, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 25 March 2015 Received in revised form 16 July 2015 Accepted 16 July 2015 Available online 17 July 2015
The large yellow croaker Larimichthys crocea is an important mariculture fish species in China, and the bacterium Vibrio harveyi (V. harveyi) and the ciliate protozoan Cryptocaryon irritans (C. irritans) are the two major pathogens in its aquaculture sector. Interferon-gamma (IFN-g) plays important roles in regulating both innate and cell mediated immune responses as an inflammatory cytokine. In this study, we obtained the nucleotide sequence of IFN-g from the large yellow croaker (LcIFN-g). The phylogenetic relationship tree of 18 available IFN-g genes was constructed based on their sequences. Expression analyses in 10 various tissues were conducted after the croaker challenged with V. harveyi and C. irritans, respectively. Real time PCR analysis showed that the expression of LcIFN-g was observed broadly in health individuals. After injected with V. harveyi, the 10 tissues had a higher expression of IFN-g at the first day (1 d); only spleen, muscle, intestine, heart and skin had higher expressions after infected with C. irritans at 1 d. Major immune tissues (skin, gill, head kidney and spleen) and detoxification tissue (liver) were sampled at 0 h, 6 h, 1 d, 2 d, 3 d, 4 d, 5 d and 7 d to understand the expression trends of LcIFN-g after challenged with C. irritans. The expressions of LcIFNg in skin and gill (the primary immune organs) showed a clear correlative relationship with the life cycle of C. irritans. © 2015 Elsevier Ltd. All rights reserved.
Keywords: Cryptocaryon irritans Interferon-gamma Gene expression Larimichthys crocea Vibrio harveyi
1. Introduction Disease and death caused by bacteria and parasites have led to severe economic losses in aquaculture sector. The bacterium Vibrio harveyi is one of the most serious pathogens in marine fish culture operations [1] and the infected individuals were always found with deep dermal lesions but not internal abnormalities [2]. Bacterial vaccines have been developed in marine fishes [3,4]. The ciliate protozoan Cryptocaryon irritans has been found to infect marine fishes; however, pathogenic mechanisms remained unclear [5,6]. Various medicines and chemicals, known to be nonenvironmental friendly, were commonly used in treatments or prevention. Understanding the pathogenic mechanisms and
* Corresponding author. E-mail address: [email protected] (Y. Mao). http://dx.doi.org/10.1016/j.fsi.2015.07.008 1050-4648/© 2015 Elsevier Ltd. All rights reserved.
immunity of fishes were necessary to treat disease and prevent death. Interferon (IFN) plays important roles in regulating both innate and cell mediated immune responses as an inflammatory cytokine. In mammals, three types of IFNs [Type I IFN, Type II IFN and IFN-g] can be distinguished based on their gene sequence, protein structure and functional property [7], and IFN-g is mainly produced by T, NK and NKT cells [8e10]. IFN was first found in fishes in the 1970s [11,12], and the IFN-g producing cells were similar to those in mammals [9]. IFN-g plays an important role in antimicrobial and antiviral through the JAK-STAT signal transduction pathway [10,13,14]. Among the key activities of IFN-g, little has been studied to understand its effects with parasites in fishes. The large yellow croaker Larimichthys crocea (Perciformes: Sciaenidae) was once one of the three commercially important marine fishes in capture fisheries in 1950se1980s in China. Exploration of both spawning and over-wintering grounds, and ineffective and insufficient management measures led to the
R.-N. Chen et al. / Fish & Shellfish Immunology 46 (2015) 596e602
dramatically decline of the wild stocks of the croaker [15]. The croaker has been widely cultured in southern China since the 1990s, mainly in floating cages; in terms of the estimated national marine fish culture production (volume) at species level the croaker is currently at the second rank [16]. V. harveyi and C. irritans are the two major pathogens in the croaker culture industry, and have contributed to severe economic losses. In this study, we documented the cDNA and genomic sequences of LcIFN-g from the croaker. We reported the expression trends of LcIFN-g in 10 different tissues of the croaker after challenges of V. harveyi and C. irritans respectively. The results provide a theoretical basis for further study the inflammatory cytokines in immune responses against pathogen infections in fishes. 2. Materials and methods 2.1. Sample collection and treatment Individuals of the large yellow croaker under healthy condition were purchased from a farm in Ningde City, Fujian Province, China, and kept alive in a concrete tank under aeration and 26e27 C. In order to obtain enough blood samples, fifty large individuals of the croaker (mean body weight of 403.0 ± 82.0 g) were selected for V. harveyi challenge treatment in summer, May, 2010. Individuals of the treatment group (n ¼ 25) were injected with 107 colony-forming units (cfu) of V. harveyi TS-628, which was isolated from the orange-spotted grouper Epinephelus coioides. Individuals of the control group (n ¼ 25) were injected with the same volume of 1.5% of NaCl. At the first day (1 d) after injection, 10 tissues (i.e. head kidney, gill, stomach, intestine, brain, blood, spleen, liver, heart and muscle) from both treatment (n ¼ 3) and control (n ¼ 3) groups were randomly collected and stored at 80 C in RNA fixer (BioTek Corporation). Muscle was also sampled and stored at 20 C in 100% ethanol for DNA extraction. Sixty small individuals of the croaker (mean body weight of 85.5 ± 15.1 g) were selected for C. irritans challenge treatment in summer, June, 2012. Individuals (n ¼ 50) were maintained with a dose of 26,665 theronts per fish for three days. The infected individuals were subsequently transferred to a tank with clear seawater at 4 d right after the release of the trophonts from the infected individuals, and kept till 7 d. The protozoan was previously obtained from an outbreak of white spot disease in the croaker culture area. Ten tissues (see above except replace blood with skin) were collected at 1 d (n ¼ 3), and additionally skin, head-kidney, liver, gill and spleen were collected at 0 h, 6 h, 1 d, 2 d, 3 d, 4 d, 5 d and 7 d (n ¼ 3 each) post treatment and stored at 80 C in RNA fixer (BioTek Corporation). The skin samples were taken from the dorsal part of the body trunk. Same 10 tissues were sampled from the control group at 0 h (n ¼ 3). 2.2. Identification of LcIFN-g cDNA and genomic sequences Total RNA from head kidney (0 h and 1 d with V. harveyi challenge treatment) of the croaker was extracted using RNAiso Plus (TaKaRa) according to the manufacturer's instructions. The suppression subtractive hybridization (SSH) cDNA library of head kidney infected by V. harveyi was constructed. According to the SSH cDNA library, LcIFN-g was obtained from different cDNA fragments. cDNA was cloned in pMD18-T plasmid and transformed into competent Escherichia coli. IFN-g was identified by BLASTX analysis of sequences. Rapid amplification of cDNA ends (RACE) PCR were performed with a SMART RACE cDNA Amplification kit (TaKaRa) to get the full-length LcIFN-g cDNA using primers based on the partial
597
sequences obtained above. With DNA extracted from muscle as template, specific primers were used to amplify the full-length of LcIFN-g (Table 1). 2.3. Real-time quantitative PCR (RT-PCR) Total RNA of the 10 different tissues with both V. harveyi and saline injected individuals were extracted as described above. Firststrand cDNA was synthesized using the PrimeScript RT reagent Kit with gDNA Eraser (TaKaRa DRR034A) according to the manufacturer's protocol. Quantitative PCR was performed using ABI Prism 7500 RT PCR machine with SYBR Premix DimerEraser (TaKaRa RR091A). RT primers for LcIFN-g and the endogenous controls bactin were listed in Table 1. Thermo cycling condition was 95 C for 30 s, followed by 40 cycles at 95 C for 3 s, 60 C for 30 s and 72 C for 30 s. A melting curve analysis of the amplification products was added to the protocol to assess the specificity of the PCR products. In all RT PCR ran a negative control without templates and each reaction was performed in triplicate. b-actin was used as endogenous control for both treatment and control groups. The PCR efficiencies were determined by analyzing three-fold serial dilutions of cDNA. The amplified efficiencies were close to 100% in order to use the 2△△CT method for calculation. With C. irritans infected (1 d) experiment, the 10 tissues from healthy individuals served as calibrators. Total RNA of different tissues was extracted as described above. Total RNA was also isolated from skin, gill, head-kidney, liver and spleen at 0 h, 6 h, 1 d, 2 d, 3 d, 4 d, 5 d and 7 d post treatments. All analysis conditions were the same as mentioned above. 2.4. Statistical analysis Sequences were analyzed through the National Center for Biotechnology Information (NCBI). Potential transcription factor binding sites were identified using the TFBIND (http://tfbind.ims.utokyo.ac.jp/). The signal peptide was predicted using the signal P3.0 server (http://www.cbs.dtu.dk/services/SignalP/). Sequence alignments and percent amino acid identity between sequences were performed using the MegAlign program (DNASTAR Inc., Madison, WI, USA). The phylogenetic tree was constructed from the multiple alignments using the Neighbour-Joining (NJ) method in the MEGA3.1 software package. The reliability of the tree topology was tested using bootstrap resampling (2500 replicates). Secondary structure was predicted using STRIDE (http://pbil.univ-lyon1.fr/). Data on relative mRNA expression of LcIFN-g in different tissues were calculated as the means ± SD (n ¼ 3), and the significant
Table 1 Nine primers and their applications used in this study. Primer
Sequence (50 -30 )
Application
Cdna3f Cdna3r Cdna5f Cdna5r F R P1 P2 P3 vrtf vrtr crtf crtr b-Actinf b-Actinr
GGTCATGGGCGGCGTGTTGAACA CCAACGACTGGAAGCACCGAGAC GCCTTCCGTGCTTGCCGCCG TGGGGATGACCGGCTTCCCGTC CGCCAGACTCCGGACAAACTTTGGGAATCG GCTGGCACGCTGGTTTGGATTTGGCTGTC TGTGAACGCAGCAGGAGGAAACAGGGCTTG TCATCTCCGCGGGGATGGTGAAGCCTC GTGAGGGCAGTGGTTTGTCTGTCTC CAGGTCAGAGGCTTCACCATCCCCG TGTTCAGGCATCATCTCTTTGGGGA CAAGGACCTGAAGAAATACCGTTAC CTCCCACAATGCTTTGGACTGAA AAGCCAACAGGGAGAAGATGAC ACAGCTTCTCCTTGATGTCACG
PCR PCR PCR PCR PCR PCR Genome walking Genome walking Genome walking Real-time PCR Real-time PCR Real-time PCR Real-time PCR Real-time PCR Real-time PCR
598
R.-N. Chen et al. / Fish & Shellfish Immunology 46 (2015) 596e602
difference was determined using one-way ANOVA with Tukey's post-hoc test at a level of 0.05.
predicted glycosylation sites in the N-terminal region of the mature peptide.
3. Results
3.2. Phylogenetic tree of LcIFN-g
3.1. DNA sequence of LcIFN-g
IFN-g genes among 18 vertebrates from fish to human had relatively low sequences similarity (Table 2). LcIFN-g showed the highest degree (56.8%) of identity with E. coioides and relatively
The full-length of LcIFN-g sequence was 4561 bp, consisted of four exons and three introns and had 50 UTR (76 bp) and 30 UTR (787 bp) (Fig. 1). The first exon contained a region of 196 bp that encoding a 22 amino acid (aa) signal sequence. Exons 2, 3 and 4 encoded 17, 74 and 55 aa, respectively. All three introns interrupted the open reading frame exactly between two codons and obeyed the GT/AG rule. Transcription factor binding sites, such as TATA boxes, AML1a, CAP, ADR1, GATA-1 and CdxA were predicted. Putative binding sites for the transcription factors activator protein 1 (AP-1), the highly polymorphic CA microsatellite repeats in first intron and the CT microsatellite repeats in 50 UTR were also presented in LcIFN-g gene. Additionally six RNA instability regions (ATTTA) characteristic of IFN-g transcripts presented in the 30 UTR. The open reading frame encoded a 200 aa peptide. Secondary structure showed that LcIFN-g had six main a-helices. The mature protein contained a signature motif [I/V]-Q-X-[K/Q]-A-X2-E-[L/F]X2-[I/V] and a nuclear localization signal (NLS) motif at the C-terminal end of the protein. The LcIFN-g also contained one noncharacteristic nuclear localization signal (RRRR) and two
Table 2 Amino acid identity of IFNg genes in 18 vertebrates from fishes to mammals. Species
Amino acid identity (%)
Organe-spotted grouper Epinephelus coioides Japanese flounder Paralichthys olivaceus Torafugu Takifugu rubripes Atlantic cod Gadus morhua Atlantic salmon Salmo salar Rainbow trout Oncorhynchus mykiss Channel catfish Ictalurus punctatus Common carp Cyprinus carpio Zebrafish Danio rerio Frog Xenopus tropicalis Chicken Gallus gallus Rabbit Oryctolagus cuniculus Dog Canis lupus familiaris Horse Equus caballus Mouse Mus musculus Human Homo sapiens
56.8 54.1 45.7 26.3 26.7 27.2 18.3 16.5 15.1 15.1 17.1 14.4 17.5 15.7 12.3 10.8
Fig. 1. The nucleotide sequence and deduced amino acid sequence of IFN-g gene in the large yellow croaker. TATA box, AML1a, CAP, ADR1, GATA-1 and CdxA binding sites, and simple sequence repeats were marked with underline. The amino acid sequence shown in upper case letters under the nucleotide sequence and the predicted signal sequence underlined whilst the translation stop codon is indicated by an asterisk.
R.-N. Chen et al. / Fish & Shellfish Immunology 46 (2015) 596e602
599
Fig. 2. Phylogenetic tree of 18 IFN-g genes from 11 fishes included Cyprinus carpio (CAJ51088.1), Carassius auratus (ACG68885.1), Danio rerio (NP_998029.1), Epinephelus coioides (AFM31242.1), Gadus morhua (ADG85734), Ictalurus punctatus (ADG85734), Larimichthys crocea (AIZ77177), Oncorhynchus mykiss (NP_001153975.1), Paralichthys olivaceus (BAG50576.1), Salmo salar (NP_001117030.1) and Takifugu rubripes (CAE82301.2), and seven higher vertebrates including frog Xenopus tropicalis (XP_002938555.1), chicken Gallus gallus (NP_990480.1), rabbit Oryctolagus cuniculus (NP_001075460.1), horse Equus caballus (ABS28998.1), dog Canis lupus familiaris (NP_001003174.1), mouse Mus musculus (NP_032363.1) and human Homo sapiens (CAA31639.1).
high with Paralichthys olivaceus and Takifugu rubripes (50.5% and 47.1%, respectively) and low identity (15.1e26.3%) with the remaining fishes (Table 2). The lowest level of sequence identity was with IFN-g from human (10.8%) whilst the identity with IFN-g sequences in other higher vertebrates varied from 10.8 to 17.5% (Table 2). The IFN-g sequences from fishes and other higher vertebrates segregated into two separate clusters with high bootstrap confidence values, and the fishes further grouped into three clades (Fig. 2). 3.3. Expression of LcIFN-g after V. harveyi infection Liver displayed the most abundant expression level of LcIFN-g among the tested tissues of the healthy individuals; gill and spleen also displayed high level, but little in heart and muscle (data not show). The levels of LcIFN-g transcripts increased
significantly in all tissues except gill at 1 d after V. harveyi injection; 22-fold in head kidney and 9-fold in spleen compared to the control (Fig. 3). 3.4. Expression of LcIFN-g after C. irritans infection Expression of LcIFN-g was low in muscle, heart, brain, skin, stomach, intestine and head kidney, and high in spleen, liver and gill (Fig. 4). Significant differences were found in all 10 tissues before and after infection with C. irritans (p < 0.05). After infection, heart, intestine, muscle, spleen and skin showed an up-regulation. The remaining tissues had a down-regulation; there was over more than 7efold down-regulation in gill. The level of LcIFN-g transcripts in skin sharply increased at 6 h and steadied till 1 d, after a low expression at 2e4 d, a significant increase occurred at 5 d then dropped at 7 d (Fig. 5A). The
Fig. 3. Relative expression of IFN-g in 10 tissues of the large yellow croaker at one day after Vibrio harveyi infection (n ¼ 3, mean ± SD). Gene expression was normalized to b-actin. Significant differences (p < 0.05) between control and infection groups were indicated with an asterisk.
600
R.-N. Chen et al. / Fish & Shellfish Immunology 46 (2015) 596e602
Fig. 4. Relative expression of IFN-g in 10 tissues of the large yellow croaker at one day after infected with Cryptocaryon irritans (n ¼ 3, mean ± SD). Gene expression was normalized to b-actin. Significant differences (p < 0.05) between control and infection groups were indicated with an asterisk.
transcripts in head kidney increased slightly first then showed a sharp drop to the lowest at 3 d; a recovery occurred at 4 d and recovered to a new top at 5 d then stayed low level at 7 d (Fig. 5B). In liver, the expression stayed low and there was a sharp increase at 4 d; a sharp drop occurred at 5e7 d (Fig. 5C). LcIFN-g in gill varied by days and there was obviously an up-regulation from 2 d to 3 d (Fig. 5D) (p < 0.05). The expression of IFN-g in spleen showed a similar trend with head kidney but with relatively high transcripts at 6 h (Fig. 5E). 4. Discussion IFN-g has been extensively studied in higher vertebrates (e.g. chicken, mouse and human) with respects to its characterization, expression and regulation of immune functions [7,10,17]; however, it was not well investigated in lower vertebrates such as fishes [18e20]. In this study, we obtained the whole genomic sequence of IFN-g from the large yellow croaker, which showed similar structure with those of higher vertebrates and fishes documented, containing four exons and three introns but with low sequence identity (Figs. 1 and 2) [21]. A number of transcription factors such as STAT, GATA-3 and AP-1 were involved in regulation of IFN-g production in mammals. In fishes such as the Atlantic cod Gadus morhua, an ISRE/STAT element was found and suggested to be important in up-regulating by Type I and dsRNA [22]. In this study TATA box, AML1a, CAP, ADR1, GATA-1, CdxA and AP1 in the LcIFN-g were identified, inferring their important roles in immune activity in the large yellow croaker. The polymorphism of CA microsatellites in the first intron of IFN-g was known to be associated with a variety of diseases (e.g. rheumatoid arthritis, leprosy and Hashimoto's disease) in mammals [23e26]; however, it is little known in fishes. In this study, a CA repeat was identified in first intron of LcIFN-g, and also a CT repeat was found in 50 UTR. It merits further studies to understand the relationship between the polymorphisms of CA microsatellites and disease resistances with LcIFN-g. The LcIFN-g amino acids sequence had similar hallmark features with other fishes, including some of the binding sites, signature sequence and nuclear localization signal which were very important for its activities [13] Furthermore, the mature peptide sequence of LcIFN-g showed high degree of identity with other fishes (the highest up to 56.8%). These results suggested that IFN-g served as similar functions in fishes.
Vibrio species are important pathogens in aquaculture sector [6,27e32]. Studies mainly focused on the mechanisms of immune responses and the application [1,30]. Fishes such as goldfish and Atlantic cod showed the expression of IFN-g in head-kidney, an important immune organ [22,33,34], suggested that IFN-g might play important roles in antibacterial. In this study, LcIFN-g was expressed constitutively in all 10 tested tissues (i.e. head kidney, gill, stomach, intestine, brain, blood, spleen, liver, heart and muscle) after V. harveyi injection. IFN-g were produced in multiple organs illustrated that it was also a vital factor to immune system of the large yellow croaker and the higher expression (Fig. 3) might suggested it plays important roles in against V. harveyi infection. Little was known about the role of IFN-g in the defense against C. irritans in fishes [35,36]. This study for the first time investigated the expression of LcIFN-g after C. irritans infection to understand its function in immunity. The expressions of LcIFN-g in head kidney, stomach, brain, gill and liver were decreased after infected with C. irritans. Gill, as the first line of defense and directly contacted with environment, showed a high expression of LcIFN-g in healthy individuals (Fig. 4). The expression of LcIFN-g in gill was finally suppressed, inferred the poor resistance of the large yellow croaker after infection. In mammals Th1 response, including IFN-g, is considered to lead the attack against intracellular pathogens such as viruses. Th2 response is believed to emphasize protection against extracellular pathogens such as multicellular parasites [37]. In the large yellow croaker, a recent study on its genome revealed a well-established innate immune system and a partially established adaptive immune system [35], therefore it is possible that the Th2 response is induced by the parasite infection and that IFN-gamma expression are inhibited. Skin, also the first line of defense but with low coverage rate of C. irritans, had a higher expression after infection. The life cycle of C. irritans involves four developmental stages, which are trophont, protomont, tomont and theront [6]. The whole life cycle usually takes 7e10 days; the theront, been born infectious in 6 h, parasitizing at skin and gill to form the trophont, which would release and ulcerated hosts after three days. Then new theronts been born after another three day. In this study, primary immune organs (skin, gill, spleen and head-kidney) and detoxification organ (liver) of the large yellow croaker were further constructed after C. irritans infection (Fig. 5). Skin, as the first line against parasites, increased strongly immediately after infection and a slightly recover occurred when C. irritans released. Low
R.-N. Chen et al. / Fish & Shellfish Immunology 46 (2015) 596e602
601
Fig. 5. Expressions of IFN-g in skin (A), head kidney (B), liver (C), gill (D) and spleen (E) of the large yellow croaker by SYBR Green real-time PCR at 0h, 6h,1d, 2d, 3d, 4d, 5d and 7d post infection with Cryptocaryon irritans. Gene expression was normalized to b-actin. Significant differences (p < 0.05) between control and infection groups were indicated with an asterisk.
transcript levels were observed in gill at 1 d until a sharp recovery occurred at 3 d when C. irritans released from hosts. This phenomenon suggested that C. irritans could suppress the expression of IFN-g in gill. The transcript level of IFN-g in spleen was immediately up-regulated after C. irritans infection, which might prove that spleen was the first immune tissue to take part in immune regulations. Same pattern was documented in Atlantic cod, goldfish and channel catfish [22,33,38]. We found the liver maintained a low expression of LcIFN-g until 4 d, the day after theronts released, indicated liver did not participate the immune against C. irritans. In head-kidney a slight change agreed with infected progress which down regulated during C. irritans infection then up to the point at 5 d and down again. The expression of LcIFN-g in the skin and gill suggested that their expression trends had a clear relationship with the infection progress of C. irritans. In another study, Vibrio species was isolated from fish after infected by C. irritans [39], inferring the secondary bacterial infection was the main reason led to the death of the large yellow croaker.
In conclusion, IFN-g was cloned and investigated in the large yellow croaker, expressed broadly in tissues with the highest level in liver by using RT-PCR. After injected by V. harveyi, the transcript levels of IFN-g were higher in all tissues tested; however, displayed a lower level in gill, liver, head-kidney, stomach and brain after infected with C. irritans. The expression trends related to the infection progress of C. irritans. The expressions infected by the two pathogens demonstrated that IFN-g played an important role in pathogen defenses.
Acknowledgments This work was financial supported by the State 863 Project of China (Grant No. 2012AA10A403) and the National Natural Science Foundation of China (Grant Nos. 31372504 and 41476118). The authors would like to thank Ningde (Fujian Province, China) Fufa Fisheries Co., Ltd. for providing fish and facility.
602
R.-N. Chen et al. / Fish & Shellfish Immunology 46 (2015) 596e602
References [1] P.C. Liuxy, K.K. Lee, S.N. Chen, Pathogenicity of different isolates of Vibrio harveyi in tiger prawn, Penaeus monodon, Lett. Appl. Microbiol. 22 (1996) 413e416. [2] B. Austin, X. Zhang, Vibrio harveyi: a significant pathogen of marine vertebrates and invertebrates, Lett. Appl. Microbiol. 43 (2006) 119e124. [3] T. Håstein, R. Gudding, O. Evensen, Bacterial vaccines for fishean update of the current situation worldwide, Dev. Biol. 121 (2004) 55e74. [4] D.H. Lenz, K.C. Mok, B.N. Lilley, R.V. Kulkarni, N.S. Wingreen, B.L. Bassler, The small RNA chaperone Hfq and multiple small RNAs control quorum sensing in Vibrio harveyi and Vibrio cholerae, Cell 118 (2004) 69e82. [5] Y.S. Zhong, Prevention and cure of fish disease surveys and control countermeasures of diseases of Cryptocaryon irritans in marine cage cultured fishes in the main cultured areas of Fuiian province, Fish. Sci. Technol. Inf. 36 (2009) 4e7 (Chinese). [6] A. Li, X. Lin, N. Teng, X. Zhu, A standardized method to propagate Cryptocaryon irritans on a susceptible host pompano Trachinotus ovatus, Aquaculture 258 (2006) 127e133. [7] S. Pestka, C.D. Krause, M.R. Walter, Interferons, interferon-like cytokines, and their receptors, Immunol. Rev. 202 (2004) 8e32. [8] P.S. Subramaniam, M.M. Green, J. Larkin, B.A. Torres, H.M. Johnson, Nuclear translocation of IFN-g is an intrinsic requirement for its biologic activity and can be driven by a heterologous nuclear localization sequence, J. Interferon Cytokine Res. 21 (2001) 951e959. [9] B. Robertsen, The interferon system of teleost fish, Fish Shellfish Immunol. 20 (2006) 172e191. [10] C. Langevin, E. Aleksejeva, G. Passoni, N. Palha, J.-P. Levraud, P. Boudinot, The antiviral innate immune response in fish: evolution and conservation of the IFN system, J. Mol. Biol. 425 (2013) 4904e4920. [11] P. De Kinkelin, M. Dorson, Interferon production in rainbow trout (Salmo gairdneri) experimentally infected with Egtved virus, J. General Virol. 19 (1973) 125e127. [12] H. Oie, P. Loh, Reovirus type 2: induction of viral resistance and interferon production in fathead minnow cells, Exp. Biol. Med. 136 (1971) 369e373. [13] J. Zou, C.J. Secombes, Teleost fish interferons and their role in immunity, Dev. Comp. Immunol. 35 (2011) 1376e1387. [14] D.S. Aaronson, C.M. Horvath, A road map for those who don't know JAK-STAT, Science 296 (2002) 1653e1655. [15] M. Liu, Y. Sadovy de Mitcheson, Profile of a fishery collapse: why mariculture failed to save the large yellow croaker, Fish Fish. 9 (2008) 219e242. [16] Bureau of Fisheries, Ministry of Agriculture, China Fishery Statistical Yearbook, Agriculture Press, Beijing, 2013. [17] A. Isaacs, J. Lindenmann, Virus interference. I. The interferon, Proc. R. Soc. Lond. Ser. B-Biol. Sci. 147 (1957) 258e267. [18] R.R. Herberman, J.R. Ortaldo, G.D. Bonnard, Augmentation by interferon of human natural and antibody-dependent cell-mediated cytotoxicity, Nature 277 (1979) 221e223. [19] D.K. Dalton, S. Pitts-Meek, S. Keshav, I.S. Figari, A. Bradley, T.A. Stewart, Multiple defects of immune cell function in mice with disrupted interferongamma genes, Science 259 (1993) 1739e1742. [20] M.R. Digby, J.W. Lowenthal, Cloning and expression of the chicken interferong gene, J. Interferon Cytokine Res. 15 (1995) 939e945. [21] R. Savan, S. Ravichandran, J.R. Collins, M. Sakai, H.A. Young, Structural conservation of interferon gamma among vertebrates, Cytokine Growth Factor Rev. 20 (2009) 115e124.
[22] C. Furnes, M. Seppola, B. Robertsen, Molecular characterisation and expression analysis of interferon gamma in Atlantic cod (Gadus morhua), Fish Shellfish Immunol. 26 (2009) 285e292. [23] V. Pravica, C. Perrey, A. Stevens, J.H. Lee, I.V. Hutchinson, A single nucleotide polymorphism in the first intron of the human IFN-gamma gene: absolute correlation with a polymorphic CA microsatellite marker of high IFN-g production, Hum. Immunol. 61 (2000) 863e866. [24] A. Khani-Hanjani, D. Lacaille, D. Hoar, A. Chalmers, D. Horsman, M. Anderson, et al., Association between dinucleotide repeat in non-coding region of interferon-gamma gene and susceptibility to, and severity of, rheumatoid arthritis, Lancet 356 (2000) 820e825. [25] G.A. Silva, M.P. Santos, I. Mota-Passos, A.L. Boechat, A. Malheiro, F.G. Naveca, et al., IFN-gamma þ875 microsatellite polymorphism as a potential protection marker for leprosy patients from Amazonas state, Brazil, Cytokine 60 (2012) 493e497. [26] C. Ito, M. Watanabe, N. Okuda, C. Watanabe, Y. Iwatani, Association between the severity of Hashimoto's disease and the functionalþ 874A/T polymorphism in the interferon-gamma gene, Endocr. J. 53 (2006) 473e478. [27] S.M.J. Punitha, M.M. Babu, V. Sivaram, V.S. Shankar, S.A. Dhas, T.C. Mahesh, et al., Immunostimulating influence of herbal biomedicines on nonspecific immunity in Grouper Epinephelus tauvina juvenile against Vibrio harveyi infection, Aquac. Int. 16 (2008) 511e523. [28] B. Diggles, J. Carson, P. Hine, R. Hickman, M. Tait, Vibrio species associated with mortalities in hatchery-reared turbot (Colistium nudipinnis) and brill (C. guntheri) in New Zealand, Aquaculture 183 (2000) 1e12. [29] M. Li, C. Wang, L. Sun, A pathogenic Vibrio harveyi lineage causes recurrent disease outbreaks in cultured Japanese flounder (Paralichthys olivaceus) and induces apoptosis in host cells, Aquaculture 319 (2011) 30e36. [30] E.A. Tendencia, Vibrio harveyi isolated from cage-cultured seabass Lates calcarifer Bloch in the Philippines, Aquac. Res. 33 (2002) 455e458. ~ igo, [31] R. Rico, S. Tapia-Paniagua, E. Martínez-Manzanares, M. Balebona, M. Morin Characterization of Vibrio harveyi strains recovered from diseased farmed Senegalese sole (Solea senegalensis), J. Appl. Microbiol. 105 (2008) 752e760. [32] C. Chen, B. Cheng, H. Yu, Y. Wang, Z. Yang, C. Shi, Isolation and identification of a pathogenic bacterium from Epinephelus septemfasciatus with exophthalmic disease, Prog. Fish. Sci. 31 (2010) 25e33 (Chinese). [33] L. Grayfer, M. Belosevic, Molecular characterization, expression and functional analysis of goldfish (Carassius aurutus L.) interferon gamma, Dev. Comp. Immunol. 33 (2009) 235e246. [34] B. Huang, S.N. Chen, W.S. Huang, P. Nie, Molecular characterization and expression of interferon gamma(IFN-g) in orange-spotted grouper (Epinephelus coioides), J. Fish. Sci. China 2 (2013) 269e275 (Chinese). [35] C. Wu, D. Zhang, M. Kan, Z. Lv, A. Zhu, Y. Su, et al., The draft genome of the large yellow croaker reveals well-developed innate immunity, Nat. Commun. (2014), http://dx.doi.org/10.1038/ncomms6227. [36] P. Alvarez-Pellitero, Fish immunity and parasite infections: from innate immunity to immunoprophylactic prospects, Veterinary Immunol. Immunopathol. 126 (2008) 171e198. [37] P. Kidd, Th1/Th2 balance: the hypothesis, its limitations, and implications for health and disease, Altern. Med. Rev. 8 (2003) 223e246. [38] I. Milev-Milovanovic, S. Long, M. Wilson, E. Bengten, N.W. Miller, V.G. Chinchar, Identification and expression analysis of interferon gamma genes in channel catfish, Immunogenetics 58 (2006) 70e80. [39] Z.Y. Liu, Research on death caused by secondary bacterial infection of Cryptocaryon irritans on Pseudosciaena crocea, J. Fish. 34 (2012) 11e15 (Chinese).