- Email: [email protected]
Molecular and functional characterization of Toll-like receptor 21 in large yellow croaker (Larimichthys crocea)
Fish & Shellfish Immunology 59 (2016) 179e188
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Full length article
Molecular and functional characterization of Toll-like receptor 21 in large yellow croaker (Larimichthys crocea) Min Sun a, b, c, Yinnan Mu b, c, Yang Ding b, c, Jingqun Ao b, c, Xinhua Chen b, c, d, * a
School of Marine Sciences, Ningbo University, Ningbo 315211, China Key Laboratory of Marine Biogenetic Resources, Third Institute of Oceanography, State Oceanic Administration, Xiamen 361005, China c Fujian Collaborative Innovation Center for Exploitation and Utilization of Marine Biological Resources, Xiamen 361005, China d Laboratory for Marine Biology and Biotechnology, Qingdao National Laboratory for Marine Science and Technology, Qingdao 266071, China b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 9 August 2016 Received in revised form 7 October 2016 Accepted 13 October 2016 Available online 14 October 2016
Toll-like receptor 21 (TLR21) is a non-mammalian TLR that functions similar to mammalian TLR9 in recognizing CpG DNA. In the present study, we identified a TLR21 homologue, LycTLR21, from large yellow croaker (Larimichthys crocea). The complete coding sequence of LycTLR21 is 2946 nucleotides long, encoding a protein of 981 amino acids. The deduced LycTLR21 protein has typical TLR domain architecture, including a signal peptide, 13 leucine-rich repeats (LRRs) in the extracellular region, a transmembrane region, and a cytoplasmic Toll-Interleukin-1 receptor (TIR) domain. Phylogenetic analysis showed that LycTLR21 falls into a major clade formed by all fish TLR21 sequences and is closely related to TLR21 in Epinephelus coioides and Oplegnathus fasciatus. LycTLR21 mRNA was constitutively expressed in all tissues tested, with higher levels in immune-related tissues, such as spleen, head kidney, and gills. Upon stimulation with inactivated trivalent bacterial vaccine, LycTLR21 mRNA was significantly increased in these three tissues. Overexpression of a chimeric plasmid containing the extracellular domain of human cluster of differentiation 4 (CD4) and the transmembrane and cytoplasmic domains of LycTLR21 could activate NF-kB, but not IFN-b in Chinese hamster ovary (CHO) cells, suggesting that LycTLR21 could mediate activation of NF-kB. LycTLR21 could specifically recognize three CpG-oligodeoxynucleotides (CpG-ODNs), CpG-ODN 1826, 2006, and 2007, but not other CpG-ODNs detected, poly(I:C), lipopolysaccharide (LPS), and lipoteichoic acid (LTA-SA). These three CpG-ODNs were found to significantly up-regulate the expression of LycTLR21 and downstream proinflammatory cytokines IL-1b and IL-6 of NF-kB pathway in large yellow croaker head kidney (LYCK) cells. In addition, the expression levels of LycTLR21, c-Rel subunit of NF-kB, IL-1b and IL-6 genes were quickly increased in the spleen and head kidney by bacterial infection, suggesting that LycTLR21 signaling pathway may play a role in immune response to bacterial infection. © 2016 Elsevier Ltd. All rights reserved.
Keywords: Large yellow croaker Larimichthys crocea Toll-like receptor 21 CpG-oligodeoxynucleotides NF-kB activation Proinflammatory cytokine
1. Introduction Innate immunity serves as the first line of host defense against various pathogenic infections [1e3]. Toll-like receptors (TLRs) are type I transmembrane proteins composed of several domains: the signal peptide, leucine-rich repeats (LRRs) that recognize ligands, the transmembrane (TM) domain, and the cytoplasmic TollInterleukin 1 receptor (TIR) domain that interacts with adaptor molecules [2,4]. TLRs play a significant role in host defense by
* Corresponding author. Key Laboratory of Marine Biogenetic Resources, Third Institute of Oceanography, State Oceanic Administration, 184 Daxue Road, Xiamen 361005, Fujian Province, China. E-mail address: [email protected] (X. Chen). http://dx.doi.org/10.1016/j.fsi.2016.10.024 1050-4648/© 2016 Elsevier Ltd. All rights reserved.
recognizing pathogen-associated molecular patterns (PAMPs), such as lipopolysaccharide (LPS), lipoprotein, lipoteichoic acid (LTA-SA), flagellin, and DNA/RNA from a broad range of potentially pathogenic microbes [5]. At present, 13 different TLRs have been identified in mammals [6]. When activated by PAMPs, TLRs immediately initiate intracellular signal transduction pathways by a MyD88dependent or MyD88-independent pathway and induce the production of multiple cytokines. These cytokines not only modulate innate immune responses but also instruct the development of antigen-specific acquired immunity [7]. Based on amino acid similarity, genomic structure, and ligand properties, at least 23 vertebrate TLRs have been found and classified into seven major families: TLR1, TLR3, TLR4, TLR5, TLR7, TLR11, and TLR21 [8,9]. In teleosts, the TLR21 family includes TLR13,
180
M. Sun et al. / Fish & Shellfish Immunology 59 (2016) 179e188
TLR19, TLR20, TLR21, TLR22, and TLR23. TLR21 is a non-mammalian TLR found in birds [10,11], amphibians [12], and teleosts [13,14]. Chicken TLR21 has been shown to be a functional homologue to mammalian TLR9 in terms of response to CpG-ODN stimulation. Once recognized by a specific CpG-ODN or microbial DNA, TLR21 mediates a serial of signaling cascades, thus triggering downstream innate and adaptive immune responses [15,16]. To date, TLR21 has been identified from several teleost fish species, including pufferfish (Takifugu rubripes) [13], zebrafish (Danio rerio) [14], catfish (Ictalurus punctatus) [17], orange-spotted grouper (Epinephelus coioides) [18], olive flounder (Paralichthys olivaceus) [19], grass carp (Ctenopharyngodon idella) [20], Atlantic salmon (Salmo salar) [21], rock bream (Oplegnathus fasciatus) [22], and yellowtail (Seriola lalandi) [23]. Expression of TLR21 in some fish species was significantly increased by CpG-ODNs, poly(I:C) or aquatic pathogens [18e20,22,23], suggesting the immunological functions of fish TLR21. Further studies demonstrated that zebrafish TLR21 can sense a panel of CpG-ODNs with different sequences, but with a preferential recognition of CpG-ODN 2006 and CpG-ODN 2007 containing GTCGTT motifs [24]. Olive flounder TLR21 is found to be strongly induced by CpG-ODN 1668 with a GACGTT motif [19], while grass carp TLR21 is not responsive to the CpG-ODNs tested [25]. Thus, the ligand specificity and function of TLR21 from different fish species remain to be investigated. In this study, we report the molecular characterization of a TLR21 homologue (LycTLR21) from large yellow croaker (Larimichthys crocea), an economically important marine fish in China. The tissue expression profile and expression modulation upon stimulation with inactivated bacterial vaccine of LycTLR21 were analyzed. We also demonstrated that LycTLR21 specifically recognized three CpG-ONDs, CpG-ODN 1826, 2006, and 2007, and mediated NF-kB activation. All these three CpG-ODNs were able to increase the expression of LycTLR21 and proinflammatory cytokines IL-1b and IL-6 in LYCK cells. In addition, the expression levels of LycTLR21, c-Rel, IL-1b and IL-6 genes were also found to increase by bacterial infection. 2. Materials and methods 2.1. Experimental fish and cell lines Large yellow croakers (weight: 112 ± 19.6 g) were purchased from a mari-culture farm at Lianjiang county, Fuzhou city, China. After 3 days of acclimatizing in aerated seawater tanks, these fish were used for induction experiments. Two groups of 30 fish were intraperitoneally injected with the inactivated trivalent bacterial vaccine consisting of 1.0 108 colony forming units (CFU)/mL of Vibrio alginolyticus, Vibrio parahaemolyticus, and Aeromonas hydrophila at a dose of 0.2 mL/100 g fish, or the mixed bacteria (1.0 108 CFU/mL of V. alginolyticus, V. parahaemolyticus, and A. hydrophila) at a dose of 0.2 mL/100 g fish. The inactivated trivalent bacterial vaccine was prepared in our laboratory as described previously [26]. A third group of 30 fish were injected with sterilized phosphate buffered saline (PBS, pH7.4) at a dose of 0.2 mL/100 g fish as a control. The spleen, head kidney, and gills were collected from 5 fish at different time points (0, 6, 12, 24, 48, and 72 h) after induction and stored at 80 C for further use. The large yellow croaker head kidney (LYCK) cells were derived from the head kidney of fish and the continuous cell lines were maintained at 28 C in L-15 medium (Life Technologies, Carlsbad, CA, USA), supplemented with 10% Fetal Bovine Serum (FBS) according to the previous study [27]. The CHO cells (China Center for Type Culture Collection, Wuhan, China) were cultured in DMEM-F/ 12 containing 10% FBS, 100 units/mL penicillin, and 100 mg/mL streptomycin at 37 C in a 5% CO2 incubator.
2.2. Cloning of complete coding sequence of LycTLR21 The coding sequence of LycTLR21 was predicted from the genome sequence of large yellow croaker (JRPU00000000) [28], and a pair of gene-specific primers LycTLR21 ORF-F and -R (Supplementary Table 1) was designed. Using cDNA from the spleen of large yellow croaker as a template, PCR was performed using EasyPfu DNA Polymerase (TransGen Biotech) under the following conditions: 95 C for 3 min, then 35 cycles of 95 C for 30 s, 58 C for 30 s, 72 C for 3 min, followed by a final extension at 72 C for 5 min. The resulting PCR product was then added a single adenosine (A) at its 30 end using Taq DNA Polymerase (Takara, China) and cloned into pMD18-T simple vector (Takara, China). At least three clones containing the insert were sequenced. Sequence alignment was performed using DNAMAN program. Protein domains were predicted by Simple Modular Architecture Research Tool (SMART) (http://smart.embl-heidelberg.de/). Signal peptide was predicted using SignalP 4.1 (http://www.cbs.dtu.dk/services/ SignalP/). Phylogenetic tree was constructed with Molecular Evolution Genetics Analysis (MEGA) software version 6.06 using the neighbor-joining method [29]. 2.3. Tissue expression analysis of LycTLR21 Various tissues including brain, spleen, heart, skin, head kidney, muscle, intestine, blood, liver, and gills were collected from 5 healthy large yellow croakers. Total RNA was isolated, treated with RNase-free DNase I, and reverse transcribed into the first strand cDNA using Oligo-dT Adaptor primer (TaKaRa, China). To determine the tissue expression profile of LycTLR21, real-time PCR was performed with gene-specific primers (Supplementary Table 1). The reference gene b-actin was amplified as an internal control with the primer set of Actin-F and -R (Supplementary Table 1). Real-time PCR was performed on the Mastercycler ep gradient realplex4 system (Eppendorf, Germany) using SYBR® Premix ExTaq™ (TaKaRa). Cycling conditions were 20 s at 95 C, then 40 cycles of 95 C for 5 s, 57 C for 15 s, and 72 C for 20 s. The fluorescence output for each cycle was analyzed upon the completion of the entire run. The expression levels of LycTLR21 were normalized by bactin using the 2DDCT method and expressed as the ratio of the LycTLR21 expression levels in the brain [30]. Each real-time PCR assay was repeated three times. The data of real-time PCR were expressed as the standard error of the mean (SEM). To understand the modulation of LycTLR21 expression upon the trivalent bacterial vaccine induction, total RNA was extracted from spleen, head kidney, and gills of 5 fish sampled above. The first strand cDNA was synthesized from 1 mg of each total RNA and used as template for real-time PCR analysis. Real-time PCR was performed to detect expression levels of LycTLR21 gene as above. The expression levels of LycTLR21 gene were normalized by b-actin. Fold change was expressed as the ratio of the normalized gene expression levels in fish injected with bacterial vaccine versus those in fish injected with PBS (defined as 1) at the corresponding time points. All data were obtained from three independent PCR assays with three replicates in each assay. 2.4. Luciferase reporter assay To investigate whether the TIR domain of LycTLR21 was able to activate the signal transduction pathways that lead to the activation of NF-kB and/or IFN-b, a constitutively activated chimera CD4LycTLR21 was generated by fusing cDNAs encoding the extracellular domain of human CD4 (amino acids 1e397) and the transmembrane and cytoplasmic domains of LycTLR21 (amino acids 795e944). The cDNA encoding the extracellular domain of human
M. Sun et al. / Fish & Shellfish Immunology 59 (2016) 179e188 Table 1 Sequences of CpG-ODNs used in this study. CpG-ODNs
Sequence 50 -30
CpG-2006 CpG-2007 CpG-1681 CpG-202 CpG-685 CpG-684 CpG-1826 CpG-1826-GC CpG-2000 CpG-2002 CpG-1670 CpG-HC4040 CpG-201
tcgtcgttttgtcgttttgtcgtt tcgtcgttgtcgttttgtcgtt accgatgtcgttgccggtgacg gatctcgctcgctcgctat tcgtcgacgtcgttcgttctc tcgacgttcgtcgttcgtcgttc tccatgacgttcctgacgtt tccatgagcttcctgagctt tccatgacgttcctgcagttcctgacgtt tccacgacgttttcgacgtt accgataacgttgccggtgacg tgactgtgaacgttcgagatga gatcacgtacgtacgtctat
CD4 was amplified from the first strand cDNA from HEK293T cells using primer set of CD4-F/R and inserted into Xhol I/BamH I-digested pcDNA3.1 plasmid. The resulting recombinant plasmid was named pcDNA3.1-CD4. Then the PCR product encoding the transmembrane and cytoplasmic domains of LycTLR21 was cloned
181
into BamH I/Hind III sites of pcDNA3.1-CD4 above and recombinant plasmid pcDNA3.1-CD4-TLR21 obtained. The CHO cells were transfected with 3.2 mg of pcDNA3.1-CD4-TLR21 plasmid/pcDNA3.1 plasmid (control) and Western-blotting was performed to detect the expression of CD4-TLR21 fusion protein at 48 h posttransfection. The TLR activation assays were performed as described previously [31]. Briefly, the CHO cells (5 104 cells/well) were seeded in 96-well plates overnight and co-transfected with 200 ng of pcDNA3.1-CD4-TLR21 plasmid/pcDNA3.1 plasmid (control), pGL4.32[luc2P/NF-kB-RE/Hygro]/pGL3-IFNb-luc plasmid (200 ng), and pRL-TK plasmid (2 ng) using ViaFect™ Transfection Reagent (Promega). At 24 and 48 h post-transfection, the luciferase activity of total cell lysates was measured on a GloMax 20/20 luminometer (Promega) according to the Dual-Luciferase® Repoter Assay System (Promega), respectively. The firefly luciferase activity was normalized to the Renilla luciferase activity (pRL-TK), and the relative luciferase activity was expressed as the ratio of normalized luciferase activity in cells transfected with pcDNA3.1-CD4-TLR21 versus that in cells transfected with the empty vector pcDNA3.1. All data were obtained from three independent experiments with three replicates in each experiment.
Fig. 1. Nucleotide and deduced amino acid sequences of LycTLR21 gene. Signal peptide is marked in red (residues 1e23). The LRR domains are shown with grey shade (residues 81e104, 105e128, 129e152, 153e174, 179e202, 428e454, 455e475, 476e499, 500e523, 577e603, 604e626, 627e653, 654e678). The transmembrane domain is boxed in blue (residues 745e767). The TIR domain is underlined in black (residues 795e944). (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
182
M. Sun et al. / Fish & Shellfish Immunology 59 (2016) 179e188
Fig. 2. Comparison of TLR21 domain structures between different species. The domain organization of LycTLR21 was predicted by SMART analysis. The GenBank accession numbers for TLR21 sequences used are listed in Table 2. LRR: leucine-rich repeat; LRR-TYP: leucine-rich repeat typical subfamily; TIR: Toll/IL-1 receptor; CT: C -terminal; : signal peptide; : transmembrane domain.
To identify the ligands to which LycTLR21 responded, a LycTLR21 cell-based activation assay with CHO cells was established. Briefly, the complete coding sequence of LycTLR21 was amplified with the primer set of TLR21-F and -R (Supplementary Table 1) and inserted
into Xhol I/BamH I-digested pcDNA3.1 plasmid. The resulting pcDNA3.1-TLR21 plasmid/pcDNA3.1 plasmid (control) (200 ng), pGL4.32[luc2P/NF-kB-RE/Hygro] plasmid (200 ng), and pRL-TK plasmid (2 ng) were cotransfected into the CHO cells in 96-well
Fig. 3. Alignment of large yellow croaker TLR21 TIR domain with that of other fish species TLR21. The three active motifs are boxed in blue: box 1 (796YDxFxSYN803), box 2 (827LCL-RD-LG837), and box 3 (933FWxxL937). The alignment was performed using DNAMAN version 6.0.3. The GenBank accession numbers for TLR21 sequences used are listed in Table 2. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
M. Sun et al. / Fish & Shellfish Immunology 59 (2016) 179e188
plates using ViaFect™ Transfection Reagent. After 48 h, the cells were transfected with CpG-ODNs with different sequences (Table 1), poly(I:C), LPS, and LTA-SA at a final concentration of 3 mM, 25 mg/mL, 25 ng/mL, and 10 mg/mL for 6 h, respectively. Then the cells were harvested and relative luciferase activity was calculated as described above. 2.5. TLR21 and cytokine expression in CpG- ODNs-treated LYCK cells To understand the effect of three CpG-ODNs (ligands) on LycTLR21 signaling pathway, LYCK cells (1 106 cells/well) were cultured in 24-well plates overnight and transfected with CpG-ODN 1826, CpG-ODN 2006, and CpG-ODN 2007 at a final concentration of 3 mM. The cells were then harvested at 6, 12, 24, and 48 h after treatment. Total RNA was extracted for expression analysis of LycTLR21 and downstream proinflammatory cytokines IL-1b and IL-6 of NF-kB pathway. Real-time PCR was performed with the gene-specific primers (Supplementary Table 1) and data were analyzed as described above. The PBS-treated LYCK cells were harvested at different time points as controls. Fold change was expressed as the ratio of gene expression levels in cells stimulated with CpG-ODNs versus those in cells stimulated with PBS at each time point. All data were obtained from three independent experiments with three replicates in each experiment. 2.6. Effect of bacterial infection on LycTLR21 signaling pathway To further know whether LycTLR21 signaling pathway was involved in immune response to bacterial infection, the expression levels of LycTLR21, c-Rel subunit of NF-kB, and downstream cytokines IL-1b and IL-6 in the spleen and head kidney during bacterial infection were analyzed by real-time PCR. Real-time PCR was performed with the gene-specific primers as described above (Supplementary Table 1). Data were obtained from three independent PCR assays with three replicates in each assay.
183
3. Results 3.1. Characterization of LycTLR21 The determined coding sequence of LycTLR21 (KY025428) was 2946 nucleotides (nt) long, encoding a protein of 981 amino acids (aa) with a theoretical molecular mass of 113 kDa. The deduced LycTLR21 exhibited a typical TLR domain architecture, including a signal peptide (residues 1e23), 13 LRRs at the extracellular region (residues 81e677), a transmembrane region (residues 745e767), and a TIR domain (residues 795e944) in the cytoplasmic region (Figs. 1 and 2). LycTLR21 has 13 LRR domains, one more than zebrafish (Danio rerio) TLR21 (12 LRRs), and less than pufferfish (Takifugu rubripes) (16 LRRs), orange-spotted grouper (Epinephelus coioides) TLR21 (16 LRRs), and catfish (Ictalurus punctatus) TLR21 (18 LRRs). All known fish TLR21 molecules have no a C-terminal LRR (LRR-CT), whereas chicken and goose TLR21 sequences contain a LRR-CT (Fig. 2). Additionally, LycTLR21 also has three conserved regions found in the TIR domain of fish TLR21: box 1 (796YDxFxSYN803), box 2 (827LCL-RD-LG837), and box 3 (933FWxxL937) (Fig. 3). Multiple sequence alignment shows that the deduced LycTLR21 has 74.6%, 70.9%, 68.2%, 65.2%, 60.9%, 60.1%, 56.2%, 56%, 53%, 51.9%, 51.6%, 41.7%, and 39.7% sequence identity to rock bream, orangespotted grouper, nile tilapia, pufferfish, Atlantic salmon, Maraena whitefish, Atlantic cod, catfish, walking catfish, zebrafish, grass carp, goose, and chicken TLR21, respectively. Relatively, it shares a lower identity to TLR22 and TLR20 in fish (26.7e29.3% and 24.4e25% identity, respectively) and TLR9 in fish, mice, and human (14.6e21.4% sequence identity) (Table 2). Phylogenetic analysis showed that fish specific TLRs (TLR20, TLR21, and TLR22) and TLR 9 were found to fall into two major groups. Moreover, members from TLR20, TLR21, and TLR22 formed separate branches, respectively. LycTLR21 was positioned in the fish TLR21 clade and exhibited the closest relationship with the TLR21 in orange-spotted grouper and rock bream (Fig. 4).
Table 2 The TLR protein sequences used for structure and phylogenetic analyses. Species
TLR21 (Identity, %) Entire sequence
TIR
Oplegnathus fasciatus (rock bream) TLR21 Epinephelus coioides (orange-spotted grouper) TLR21 Oreochromis niloticus (nile tilapia) TLR21 Takifugu rubripes (fugu) TLR21 Salmo salar (Atlantic salmon) TLR21 Coregonus maraena (Maraena whitefish) TLR21 Gadus morhua (Atlantic cod) TLR21 Ictalurus punctatus (catfish) TLR21 Clarias batrachus (walking catfish) TLR21 Danio rerio (zebrafish) TLR21 Ctenopharyngodon idella (grass carp) TLR21 Anser cygnoides (goose) TLR21 Gallus gallus (chicken) TLR21 Cyprinus carpio (common carp) TLR20 Ctenopharyngodon idella (grass carp) TLR20 Catla catla (catla) TLR22 Ictalurus punctatus (catfish) TLR22 Danio rerio (zebrafish) TLR22 Epinephelus coioides (orange-spotted grouper) TLR22 Larimichthys crocea (large yellow croaker) TLR22 Scophthalmus maximus (turbot) TLR22 Takifugu rubripes (fugu) TLR22 Mus musculus (house mouse) TLR9 Ictalurus punctatus (catfish) TLR9 Takifugu rubripes (fugu) TLR9 Danio rerio (zebrafish) TLR9 Homo sapiens (human) TLR9 Larimichthys crocea (large yellow croaker) TLR9 A Larimichthys crocea (large yellow croaker) TLR9 B
74.6 70.9 68.2 65.2 60.9 60.1 56.2 56.0 53.0 51.9 51.6 41.7 39.7 25.0 24.4 29.3 28.7 28.7 28.5 27.9 27.2 26.7 21.4 20.6 19.9 19.9 19.8 19.4 14.6
94.0 91.3 92.7 86.7 83.3 83.3 83.3 78.7 77.3 79.3 78.7 61.3 61.3 53.6 53.0 56.7 58.0 57.3 58.0 56.0 57.3 54.7 32.3 30.2 33.3 30.3 29.2 31.2 19.5
GenBank accession number AIT52504.1 AEK49148 AHK13949.1 AAW69371 CDH93614.1 CEF90221.1 AFK76484.1 AEI59678 AGM39445.1 CAQ13807 AGM21642.1 AMB20882 NP_001025729 AHH85805.1 AHN49762.1 AGW43269.2 AEI59679.1 AAI63527.1 AGA84053.1 NP_001290325.1 AIC75881.1 AAW69372.1 EDL21125.1 AEI59673.1 AAW69377.1 AAI63628.1 AAZ95520.1 ACF60624.1 ACF60625.1
184
M. Sun et al. / Fish & Shellfish Immunology 59 (2016) 179e188
Fig. 4. Phylogenetic tree based on the genetic distances of TLR20, TLR 21, and TLR 22 in fish and TLR9 in fish, mice, and human. Complete amino acid sequences of the TLRs were aligned by using CLUSTAL W, and the tree was constructed using the neighbor-joining method in MEGA 6.06 and supported by 1000 bootstrap repetitions. The GenBank accession numbers for the sequences used here are listed in Table 2.
3.2. Tissue expression analysis of LycTLR21 Tissue expression analysis showed that LycTLR21 gene was ubiquitously expressed in all tissues examined, including muscle, brain, intestine, skin, head kidney, gills, heart, blood, liver, and spleen. The higher transcript levels of LycTLR21 were detected in the spleen, head kidney, and gills, and the lower levels in blood, heart, and skin (Fig. 5A). Upon stimulation with the trivalent bacterial vaccine, the transcript levels of LycTLR21 were significantly up-regulated in the spleen, head kidney, and gills, with the highest increase in the spleen at 48 h post-induction (more than 13-fold increases) (Fig. 5B).
consisting of the extracellullar domain of human CD4 and the transmembrane and cytoplasmic regions of LycTLR21. Westernblotting analysis showed that the CD4-TLR21 fusion protein was expressed in the CHO cells transfected with recombinant plasmid pcDNA3.1-CD4-TLR21 (Fig. 6A). Then we examined whether the CD4-TLR21 fusion protein activates the NF-kB or human IFN-b in CHO cells. The results showed that the overexpression of the CD4-TLR21 fusion protein significantly up-regulated the NF-kB luciferase activity, with 3- and 20-fold increases at 24 and 48 h, respectively, whereas no alteration of IFN-b luciferase activity was observed (Fig. 6B), suggesting that the LycTLR21 TIR domain was functional and was able to activate the transcription factor NF-kB in CHO cells.
3.3. Effect of LycTLR21 TIR domain on NF-kB activity 3.4. Ligand recognized by LycTLR21 Since CD4 can autodimerize, the functional TLR-TIR domain will activate the downstream TLR signaling pathways [32]. To estimate the output of LycTLR21 signaling, we constructed a fusion protein
CHO cells were overexpressed with LycTLR21, pRL-TK plasmid and pGL4.32[luc2P/NF-kB-RE/Hygro] plasmid, followed by
M. Sun et al. / Fish & Shellfish Immunology 59 (2016) 179e188
185
LPS, and LTA-SA could not induce NF-kB activity (Fig. 6C), suggesting that LycTLR21 specifically recognized the CpG-ODN 1826, 2006, and 2007. 3.5. Effect of CpG ODNs on LycTLR21 signaling pathway
Fig. 5. Tissue expression analysis of LycTLR21 gene. A. Tissue expression profile of LycTLR21 gene. Total RNA was extracted from various tissues of 5 healthy fish, and realtime PCR was used to detect the expression levels of LycTLR21 in these tissues. The expression levels of LycTLR21 were normalized by b-actin and expressed as the ratio of the expression levels in the brain (Br: brain; Bl: blood; Mu: muscle; Sk: skin; Li: liver; He: heart; In: intestines; HK: head kidney; Gi: gills; Sp: spleen). B. Expression modulation of LycTLR21 gene in spleen, head kidney, and gills after induction with inactivated trivalent bacterial vaccine. Each tissue was collected from 5 fish at different time points after bacterial vaccine induction, and total RNA was extracted from each mixed tissue (5 fish) for real-time PCR analysis. All data were obtained from three independent PCR assays with three replicates in each assay. Error bars represent the standard error of the mean (SEM). Asterisks represent a significant difference by t-test method (*p < 0.05; **p < 0.01).
treatment with a panel of candidate ligands. We estimated which ligand can activate the LycTLR21 signaling pathway by measuring NF-kB activity. As shown in Fig. 6C, three CpG-ODNs, CpG-ODN 1826, 2006, and 2007, were able to markedly activate NF-kB activity in the LycTLR21-overexpressing CHO cells, with 3.04-, 3.13-, 3.89fold increases, respectively, whereas other CpG-ODNs, poly(I:C),
It is found that LycTLR21 could mediate the activation of NF-kB (Fig. 6A and B). To further understand the effect of CpG-ODN 1826, 2006, and 2007(ligands) on LycTLR21 signaling pathway, the expression levels of LycTLR21 and downstream cytokines IL-1b and IL-6 of NF-kB pathway were detected in LYCK cells treated with these three CpG-ODNs. As shown in Fig. 7, the expression levels of LycTLR21, IL-1b, and Il-6 were quickly up-regulated by the three CpG-ODNs. The LycTLR21, IL-1b, and Il-6 transcripts were upregulated 93-, 25-, and 5-fold by CpG-ODN 1826, respectively (Fig. 7A), while their transcripts were increased 24-, 7-, and 4-fold by CpG-ODN 2006, and 30-, 14-, and 4-fold by CpG-ODN 2007 (Fig. 7B and C), indicating that CpG-ODN 1826 was more potent than other two in increasing the expression of LycTLR21, IL-1b, and IL-6. These results suggested that all the three CpG-ODNs had an effect on activation of LycTLR21 signaling pathway and CpG-ODN 1826 had the most remarkable effect. 3.6. LycTLR21 signaling pathway may play a role in immune response to bacterial infection To understand whether LycTLR21 signaling pathway was involved in immune response to bacterial infection, the expression levels of LycTLR21, c-Rel, IL-1b and IL-6 genes in the spleen and head kidney during bacterial infection were analyzed. As shown in Fig. 8, the expression levels of LycTLR21, c-Rel, IL-1b and IL-6 in the spleen and head kidney were quickly up-regulated by bacterial infection, suggesting that LycTLR21 signaling pathway may play a role in immune response to bacterial infection. 4. Discussions In the previous study, TLR22, a member of the TLR21 family, has
Fig. 6. A. Expression analysis of the CD4-TLR21 fusion protein by Western-blotting. CHO cells were transfected with 3.2 mg of pcDNA3.1 or pcDNA3.1-CD4-TLR21 plasmid. At 48 h post-transfection, the cells were collected and lysed in lysis buffer containing a protease inhibitor cocktail. Cell lysates were then resolved on 12% SDSePAGE and transferred onto nitrocellulose membranes for Western-blotting analysis with mouse anti-Myc monoclonal antibody as the primary antibody (Thermo Fisher). B. Constitutively active LycTLR21 (CD4-TLR21) activates NF-kB. CHO cells were transfected with pcDNA3.1-CD4-TLR21/pcDNA3.1 plasmid, pGL4.32[luc2P/NF-kB-RE/Hygro]/pGL3-IFN-b-luciferase plasmid, and pRLTK. At 24 and 48 h post-transfection, the luciferase activity of total cell lysates was measured with a luminometer, respectively. The relative luciferase activity was determined as the ratio of the Firefly luciferase activity versus the Renilla luciferase activity. Fold change was expressed as the ratio of relative luciferase activity in cells transfected with pcDNA3.1CD4-TLR21 versus that in cells transfected with pcDNA3.1. C. Activation of LycTRL21 by three CpG-ODNs. CHO cells were transfected with pcDNA3.1-TLR21/pcDNA3.1 plasmid, pGL4.32[luc2P/NF-kB-RE/Hygro] plasmid, and pRL-TK. After 48 h, cells were treated with different CpG-ODNs, poly(I:C), LPS, and LTA-SA, respectively. The luciferase activity was examined as described above. All data were obtained from three independent experiments with three replicates in each experiment. Error bars represent SEM. Asterisks represent a significant difference by t-test method (*p < 0.05; **p < 0.01).
186
M. Sun et al. / Fish & Shellfish Immunology 59 (2016) 179e188
Fig. 8. Expression analysis of LycTLR21, c-Rel, IL-1b and IL-6 genes in the spleen (A) and head kidney (B) of bacteria-infected fish. Two tissues were collected from 5 fish at different time points after bacterial infection, and total RNA was extracted from each mixed tissue (5 fish) for real-time PCR analysis. Fish were injected with the sterilized PBS as control. The relative expression levels of these genes were normalized by bactin, and expressed as fold change compared with the control at each time point. Data were obtained from three independent PCR assays with three replicates in each assay. Error bars represent SEM. Asterisks represent a significant difference by t-test method (*p < 0.05; **p < 0.01).
Fig. 7. Expression analysis of LycTLR21, IL-1b, and IL-6 in the CpG-ODNs-treated LYCK cells. LYCK cells were transfected with CpG-ODN 1826 (A), CpG-ODN 2006 (B), and CpG-ODN 2007 (C) at a final concentration of 3 mM, and were harvested at different time points after treatment. Total RNA was extracted for expression analysis of LycTLR21, IL-1b, and IL-6 by real-time PCR. LYCK cells were treated with PBS as control. The relative expression levels of these genes were normalized by b-actin and expression as fold change compared with the control at each time point. All data were obtained from three independent experiments with three replicates in each experiment. Error bars represent SEM. Asterisks represent a significant difference by t-test method (*p < 0.05; **p < 0.01).
been cloned and identified from large yellow croaker (Larimichthys crocea) [33]. Here, we identified another member of the TLR21 family, TLR21 (LycTLR21), from this species. The deduced LycTLR21 has the typical TLR domain architecture as found in other fish TLR21 molecules (Figs. 1 and 2). LycTLR21 has 13 LRR domains, which is different from TLR21 in zebrafish (12 LRRs), pufferfish (16 LRRs), orange-spotted grouper (16 LRRs), and catfish (18 LRRs). As the TLR LRR domain is implicated in ligand binding, whether the differences in the LRR number of TLR21 among various fish species change their ligand binding will require further investigations. The LycTLR21 TIR domain also has three conserved regions as found in other fish TLR21: box 1 (796YDxFxSYN803), box 2 (827LCL-RD-LG837),
and box 3 (933FWxxL937) (Fig. 3). Homology comparison and phylogenetic analysis further showed that LycTLR21 is a novel member of the TLR21 family (Table 2; Fig. 4). Tissue expression study revealed that LycTLR21 was constitutively expressed in all tissues examined although at a different level (Fig. 5A). Higher expression levels of LycTLR21 were found in the spleen, head kidney, and gills (Fig. 5A), which was consistent with the findings in Atlantic salmon (Salmo salar) [21], orange-spotted grouper [18], zebrafish [24], grass carp [20], rock bream [22] and yellowtail (Seriola lalandi) [23], indicating that fish TLR21 is highly expressed in the immune-related tissues, such as spleen and head kidney. The spleen and head kidney are major sites of innate and adaptive immune responses in fish [34], where a large number of immune cells including macrophages and lymphocytes resided in. Meanwhile, the macrophages, T lymphocytes, and B lymphocytes are considered to be pivotal sources of the TLRs [1]. We therefore speculated that the higher expression of fish TLR21 in spleen and head kidney might be due to the presence of abundant immune cells in these two tissues. Upon stimulation with the trivalent bacterial vaccine, the expression of LycTLR21 was significantly up-regulated in the spleen, head kidney, and gills (Fig. 5B). In olive flounder, TLR21 expression was significantly up-regulated after V. anguillarum infection [19]. Rock bream TLR21 mRNA was found to be considerably increased by pathogenic bacteria and iridovirus [22]. Grass carp TLR21 expression was also modulated in the spleen at the early phase after infection with A. hydrophila and Aquareovirus [20]. In addition, Cryptocaryon irritans infection could induce the orange-
M. Sun et al. / Fish & Shellfish Immunology 59 (2016) 179e188
spotted grouper TLR21 expression [18]. All these observations suggest that fish TLR21 may play an important role in the host defense against pathogen infection. The TLR TIR domain has been shown to be involved in the signaling as well as in the localization of the TLR [35]. To understand the output of LycTLR21 signaling, we constructed a chimera consisting of the extracellullar domain of human CD4 and the transmembrane and cytoplasmic regions of LycTLR21 and coexpressed it along with NF-kB/IFN-b reporter plasmid in CHO cells. We found that the LycTLR21 TIR domain was able to activate the NFkB in CHO cells (Fig. 6A), suggesting that LycTLR21 could mediate the activation of NF-kB. Activation of chicken TLR21 is dependent on the nucleotide sequence of the ODN [16]. Zebrafish TLR21 preferentially responded to CpG-ODN 2006 and 2007, but not to CpG-ODN 1826 [24]. TLR21 in grass carp did not appear to be responsive to CpG-ODN 2006 [25]. Here, LycTLR21 was significantly activated by CpGODN 1826, 2006, and 2007 in CHO cells (Fig. 6B). These results thus suggest that TLR21 from different fish species may have a differential preference for the sequence of the ODN recognized. One possible explanation may be due to the differences in the LRR number of TLR21 among various fish species (Fig. 2). Immune stimulatory activities of CpG-ODNs as antimicrobial agents have been demonstrated in varieties of fish species [24,25,36e38]. In this study, all three LycTLR21 ligands, CpG-ODN 1826, 2006, and 2007, could markedly up-regulate the expression of LycTLR21 and downstream cytokines IL-1b and IL-6 of NF-kB pathway in LYCK cells (Fig. 7), thus providing further evidence that LycTLR21 mediated the activation of NF-kB. Additionally, the expression levels of LycTLR21, c-Rel (a subunit of NF-kB), IL-1b and IL-6 were quickly up-regulated by bacterial infection (Fig. 8), suggesting that LycTLR21 signaling pathway may play a role in immune response to bacterial infection in large yellow croaker. However, further studies are needed to elucidate the exact LycTLR21 signaling pathway and its functions.
[11]
[12]
[13]
[14] [15]
[16]
[17]
[18]
[19]
[20]
[21]
[22]
[23]
[24]
Acknowledgements This work was supported by the National Natural Science Foundation of China (31530080 and 31372556) and National Basic Research Program of China (2015CB755903).
[25]
[26]
Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.fsi.2016.10.024.
[27]
[28]
References [1] S. Akira, S. Uematsu, O. Takeuchi, Pathogen recognition and innate immunity, Cell 124 (4) (2006) 783e801. [2] L.A. O'Neill, A.G. Bowie, The family of five: TIR-domain-containing adaptors in Toll-like receptor signalling, Nat. Rev. Immunol. 7 (5) (2007) 353e364. [3] A. Abdelsadik, A. Trad, Toll-like receptors on the fork roads between innate and adaptive immunity, Hum. Immunol. 72 (12) (2011) 1188e1193. [4] E.M.Y. Moresco, D. LaVine, B. Beutler, Toll-like receptors, Curr. Biol. 21 (13) (2011) R488eR493. [5] S. Akira, Toll-like receptors and innate immunity, Adv. Immunol. 78 (2001) 1e56. [6] J.E. Cole, E. Georgiou, C. Monaco, The expression and functions of toll-like receptors in atherosclerosis, Mediat. Inflamm. 2010 (2010) 393946. [7] R. Medzhitov, C.A. Janeway Jr., Innate immunity: the virtues of a nonclonal system of recognition, Cell 91 (3) (1997) 295e298. [8] M. Coscia, S. Giacomelli, U. Oreste, Toll-like receptors: an overview from invertebrates to vertebrates, ISJ 8 (2011) 210e226. [9] J.C. Roach, G. Glusman, L. Rowen, A. Kaur, M.K. Purcell, K.D. Smith, L.E. Hood, A. Aderem, The evolution of vertebrate Toll-like receptors, P. Nat. Acad. Sci. U. S. A. 102 (27) (2005) 9577e9582. [10] Y. Qi, B. Yan, S. Chen, H. Chen, M. Wang, R. Jia, D. Zhu, M. Liu, F. Liu, Q. Yang, CpG oligodeoxynucleotide-specific goose TLR21 initiates an anti-viral
[29]
[30]
[31]
[32]
[33]
[34]
187
immune response against NGVEV but not AIV strain H9N2 infection, Immunobiology 221 (3) (2015) 454e461. K. Chrzastek, D. Borowska, P. Kaiser, L. Vervelde, Class B CpG ODN stimulation upregulates expression of TLR21 and IFN-in chicken Harderian gland cells, Vet. Immunol. Immunop. 160 (3e4) (2014) 293e299. A. Ishii, M. Kawasaki, M. Matsumoto, S. Tochinai, T. Seya, Phylogenetic and expression analysis of amphibian Xenopus Toll-like receptors, Immunogenetics 59 (4) (2007) 281e293. H. Oshiumi, T. Tsujita, K. Shida, M. Matsumoto, K. Ikeo, T. Seya, Prediction of the prototype of the human Toll-like receptor gene family from the pufferfish, Fugu rubripes, genome, Immunogenetics 54 (11) (2003) 791e800. C. Jault, L. Pichon, J. Chluba, Toll-like receptor gene family and TIR-domain adapters in Danio rerio, Mol. Immunol. 40 (11) (2004) 759e771. A.M. Keestra, M.R. de Zoete, L.I. Bouwman, J.P. van Putten, Chicken TLR21 is an innate CpG DNA receptor distinct from mammalian TLR9, J. Immunol. 185 (1) (2010) 460e467. R. Brownlie, J. Zhu, B. Allan, G.K. Mutwiri, L.A. Babiuk, A. Potter, P. Griebel, Chicken TLR21 acts as a functional homologue to mammalian TLR9 in the recognition of CpG oligodeoxynucleotides, Mol. Immunol. 46 (15) (2009) 3163e3170. P. Baoprasertkul, P. Xu, E. Peatman, H. Kucuktas, Z. Liu, Divergent Toll-like receptors in catfish (Ictalurus punctatus): TLR5S, TLR20, TLR21, Fish. Shellfish Immunol. 23 (6) (2007) 1218e1230. Y.-W. Li, X.-C. Luo, X.-M. Dan, W. Qiao, X.-Z. Huang, A.-X. Li, Molecular cloning of orange-spotted grouper (Epinephelus coioides) TLR21 and expression analysis post Cryptocaryon irritans infection, Fish. Shellfish Immunol. 32 (3) (2012) 476e481. H. Gao, L. Wu, J.S. Sun, X.Y. Geng, B.P. Pan, Molecular characterization and expression analysis of Toll-like receptor 21 cDNA from Paralichthys olivaceus, Fish. Shellfish Immunol. 35 (4) (2013) 1138e1145. W. Wang, Y. Shen, N.P. Pandit, J. Li, Molecular cloning, characterization and immunological response analysis of Toll-like receptor 21 (TLR21) gene in grass carp, Ctenopharyngodon idella, Dev. Comp. Immunol. 40 (3e4) (2013) 227e231. P.T. Lee, J. Zou, J.W. Holland, S.A. Martin, B. Collet, T. Kanellos, C.J. Secombes, Identification and characterisation of TLR18-21 genes in Atlantic salmon (Salmo salar), Fish. Shellfish Immunol. 41 (2) (2014) 549e559. T.T. Priyathilaka, D.A. Elvitigala, I. Whang, B.S. Lim, H.B. Jeong, S.Y. Yeo, C.Y. Choi, J. Lee, Molecular characterization and transcriptional analysis of non-mammalian type Toll like receptor (TLR21) from rock bream (Oplegnathus fasciatus), Gene 553 (2) (2014) 105e116. M. Reyes-Becerril, F. Ascencio-Valle, I. Hirono, H. Kondo, W. Jirapongpairoj, M.A. Esteban, E. Alamillo, C. Angulo, TLR21's agonists in combination with Aeromonas antigens synergistically up-regulate functional TLR21 and cytokine gene expression in yellowtail leucocytes, Dev. Comp. Immunol. 6 (2016) 107e115. D.-W. Yeh, Y.-L. Liu, Y.-C. Lo, C.-H. Yuh, G.-Y. Yu, J.-F. Lo, Y. Luo, R. Xiang, T.H. Chuang, Toll-like receptor 9 and 21 have different ligand recognition profiles and cooperatively mediate activity of CpG-oligodeoxynucleotides in zebrafish, P. Nat. Acad. Sci. 110 (51) (2013) 20711e20716. H. Su, G. Yuan, J. Su, A specific CpG oligodeoxynucleotide induces protective antiviral responses against grass carp reovirus in grass carp Ctenopharyngodon idella, Dev. Comp. Immunol. 60 (2016) 218e227. W. Zheng, C. Tian, X. Chen, Molecular characterization of goose-type lysozyme homologue of large yellow croaker and its involvement in immune response induced by trivalent bacterial vaccine as an acute-phase protein, Immunol. Lett. 113 (2) (2007) 107e116. X. Wang, K. Wang, P. Nie, X. Chen, J. Ao, Establishment and characterization of a head kidney cell line from large yellow croaker Pseudosciaena crocea, J. Fish. Biol. 84 (5) (2014) 1551e1561. J. Ao, Y. Mu, L.X. Xiang, D. Fan, M. Feng, S. Zhang, Q. Shi, L.Y. Zhu, T. Li, Y. Ding, L. Nie, Q. Li, W.R. Dong, L. Jiang, B. Sun, X. Zhang, M. Li, H.Q. Zhang, S. Xie, Y. Zhu, X. Jiang, X. Wang, P. Mu, W. Chen, Z. Yue, Z. Wang, J. Wang, J.Z. Shao, X. Chen, Genome sequencing of the perciform fish Larimichthys crocea provides insights into molecular and genetic mechanisms of stress adaptation, PLoS Genet. 11 (4) (2015) e1005118. K. Tamura, G. Stecher, D. Peterson, A. Filipski, S. Kumar, MEGA6: molecular evolutionary genetics analysis version 6.0, Mol. Biol. Evol. 30 (12) (2013) 2725e2729. Y. Ding, J. Ao, C. Ai, X. Chen, Molecular and functional identification of three interleukin-17A/F (IL-17A/F) homologues in large yellow croaker (Larimichthys crocea), Dev. Comp. Immunol. 55 (2016) 221e232. A. Matsuo, H. Oshiumi, T. Tsujita, H. Mitani, H. Kasai, M. Yoshimizu, M. Matsumoto, T. Seya, Teleost TLR22 recognizes RNA duplex to induce IFN and protect cells from birnaviruses, J. Immunol. 181 (5) (2008) 3474e3485. Z. Shi, Z. Cai, A. Sanchez, T. Zhang, S. Wen, J. Wang, J. Yang, S. Fu, D. Zhang, A novel Toll-like receptor that recognizes vesicular stomatitis virus, J. Biol. Chem. 286 (6) (2011) 4517e4524. X. Xiao, Q. Qin, X. Chen, Molecular characterization of a Toll-like receptor 22 homologue in large yellow croaker (Pseudosciaena crocea) and promoter activity analysis of its 5'-flanking sequence, Fish. Shellfish Immunol. 30 (1) (2011) 224e233. E. Chaves-Pozo, P. Munoz, A. Lopez-Munoz, P. Pelegrin, A. Garcia Ayala, V. Mulero, J. Meseguer, Early innate immune response and redistribution of inflammatory cells in the bony fish gilthead seabream experimentally infected
188
M. Sun et al. / Fish & Shellfish Immunology 59 (2016) 179e188
with Vibrio anguillarum, Cell. Tissue Res. 320 (1) (2005) 61e68. [35] K. Funami, M. Matsumoto, H. Oshiumi, T. Akazawa, A. Yamamoto, T. Seya, The cytoplasmic 'linker region' in Toll-like receptor 3 controls receptor localization and signaling, Int. Immunol. 16 (8) (2004) 1143e1154. [36] T. Cardenas-Reyna, C. Angulo, S. Hori-Oshima, E. Velazquez-Lizarraga, M. Reyes-Becerril, B-cell activating CpG ODN 1668 enhance the immune response of Pacific red snapper (Lutjanus Peru) exposed to Vibrio parahaemolitycus, Dev. Comp. Immunol. 62 (2016) 72e81.
[37] J.B. Jorgensen, L.H. Johansen, K. Steiro, A. Johansen, CpG DNA induces protective antiviral immune responses in Atlantic salmon (Salmo salar L.), J. Virol. 77 (21) (2003) 11471e11479. [38] J.W. Pridgeon, P.H. Klesius, X. Mu, R.J. Yancey, M.S. Kievit, P.J. Dominowski, Efficacy of QCDCR formulated CpG ODN 2007 in Nile tilapia against Streptococcus iniae and identification of upregulated genes, Vet. Immunol. Immunopathol. 145 (1e2) (2012) 179e190.
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Full length article
Molecular and functional characterization of Toll-like receptor 21 in large yellow croaker (Larimichthys crocea) Min Sun a, b, c, Yinnan Mu b, c, Yang Ding b, c, Jingqun Ao b, c, Xinhua Chen b, c, d, * a
School of Marine Sciences, Ningbo University, Ningbo 315211, China Key Laboratory of Marine Biogenetic Resources, Third Institute of Oceanography, State Oceanic Administration, Xiamen 361005, China c Fujian Collaborative Innovation Center for Exploitation and Utilization of Marine Biological Resources, Xiamen 361005, China d Laboratory for Marine Biology and Biotechnology, Qingdao National Laboratory for Marine Science and Technology, Qingdao 266071, China b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 9 August 2016 Received in revised form 7 October 2016 Accepted 13 October 2016 Available online 14 October 2016
Toll-like receptor 21 (TLR21) is a non-mammalian TLR that functions similar to mammalian TLR9 in recognizing CpG DNA. In the present study, we identified a TLR21 homologue, LycTLR21, from large yellow croaker (Larimichthys crocea). The complete coding sequence of LycTLR21 is 2946 nucleotides long, encoding a protein of 981 amino acids. The deduced LycTLR21 protein has typical TLR domain architecture, including a signal peptide, 13 leucine-rich repeats (LRRs) in the extracellular region, a transmembrane region, and a cytoplasmic Toll-Interleukin-1 receptor (TIR) domain. Phylogenetic analysis showed that LycTLR21 falls into a major clade formed by all fish TLR21 sequences and is closely related to TLR21 in Epinephelus coioides and Oplegnathus fasciatus. LycTLR21 mRNA was constitutively expressed in all tissues tested, with higher levels in immune-related tissues, such as spleen, head kidney, and gills. Upon stimulation with inactivated trivalent bacterial vaccine, LycTLR21 mRNA was significantly increased in these three tissues. Overexpression of a chimeric plasmid containing the extracellular domain of human cluster of differentiation 4 (CD4) and the transmembrane and cytoplasmic domains of LycTLR21 could activate NF-kB, but not IFN-b in Chinese hamster ovary (CHO) cells, suggesting that LycTLR21 could mediate activation of NF-kB. LycTLR21 could specifically recognize three CpG-oligodeoxynucleotides (CpG-ODNs), CpG-ODN 1826, 2006, and 2007, but not other CpG-ODNs detected, poly(I:C), lipopolysaccharide (LPS), and lipoteichoic acid (LTA-SA). These three CpG-ODNs were found to significantly up-regulate the expression of LycTLR21 and downstream proinflammatory cytokines IL-1b and IL-6 of NF-kB pathway in large yellow croaker head kidney (LYCK) cells. In addition, the expression levels of LycTLR21, c-Rel subunit of NF-kB, IL-1b and IL-6 genes were quickly increased in the spleen and head kidney by bacterial infection, suggesting that LycTLR21 signaling pathway may play a role in immune response to bacterial infection. © 2016 Elsevier Ltd. All rights reserved.
Keywords: Large yellow croaker Larimichthys crocea Toll-like receptor 21 CpG-oligodeoxynucleotides NF-kB activation Proinflammatory cytokine
1. Introduction Innate immunity serves as the first line of host defense against various pathogenic infections [1e3]. Toll-like receptors (TLRs) are type I transmembrane proteins composed of several domains: the signal peptide, leucine-rich repeats (LRRs) that recognize ligands, the transmembrane (TM) domain, and the cytoplasmic TollInterleukin 1 receptor (TIR) domain that interacts with adaptor molecules [2,4]. TLRs play a significant role in host defense by
* Corresponding author. Key Laboratory of Marine Biogenetic Resources, Third Institute of Oceanography, State Oceanic Administration, 184 Daxue Road, Xiamen 361005, Fujian Province, China. E-mail address: [email protected] (X. Chen). http://dx.doi.org/10.1016/j.fsi.2016.10.024 1050-4648/© 2016 Elsevier Ltd. All rights reserved.
recognizing pathogen-associated molecular patterns (PAMPs), such as lipopolysaccharide (LPS), lipoprotein, lipoteichoic acid (LTA-SA), flagellin, and DNA/RNA from a broad range of potentially pathogenic microbes [5]. At present, 13 different TLRs have been identified in mammals [6]. When activated by PAMPs, TLRs immediately initiate intracellular signal transduction pathways by a MyD88dependent or MyD88-independent pathway and induce the production of multiple cytokines. These cytokines not only modulate innate immune responses but also instruct the development of antigen-specific acquired immunity [7]. Based on amino acid similarity, genomic structure, and ligand properties, at least 23 vertebrate TLRs have been found and classified into seven major families: TLR1, TLR3, TLR4, TLR5, TLR7, TLR11, and TLR21 [8,9]. In teleosts, the TLR21 family includes TLR13,
180
M. Sun et al. / Fish & Shellfish Immunology 59 (2016) 179e188
TLR19, TLR20, TLR21, TLR22, and TLR23. TLR21 is a non-mammalian TLR found in birds [10,11], amphibians [12], and teleosts [13,14]. Chicken TLR21 has been shown to be a functional homologue to mammalian TLR9 in terms of response to CpG-ODN stimulation. Once recognized by a specific CpG-ODN or microbial DNA, TLR21 mediates a serial of signaling cascades, thus triggering downstream innate and adaptive immune responses [15,16]. To date, TLR21 has been identified from several teleost fish species, including pufferfish (Takifugu rubripes) [13], zebrafish (Danio rerio) [14], catfish (Ictalurus punctatus) [17], orange-spotted grouper (Epinephelus coioides) [18], olive flounder (Paralichthys olivaceus) [19], grass carp (Ctenopharyngodon idella) [20], Atlantic salmon (Salmo salar) [21], rock bream (Oplegnathus fasciatus) [22], and yellowtail (Seriola lalandi) [23]. Expression of TLR21 in some fish species was significantly increased by CpG-ODNs, poly(I:C) or aquatic pathogens [18e20,22,23], suggesting the immunological functions of fish TLR21. Further studies demonstrated that zebrafish TLR21 can sense a panel of CpG-ODNs with different sequences, but with a preferential recognition of CpG-ODN 2006 and CpG-ODN 2007 containing GTCGTT motifs [24]. Olive flounder TLR21 is found to be strongly induced by CpG-ODN 1668 with a GACGTT motif [19], while grass carp TLR21 is not responsive to the CpG-ODNs tested [25]. Thus, the ligand specificity and function of TLR21 from different fish species remain to be investigated. In this study, we report the molecular characterization of a TLR21 homologue (LycTLR21) from large yellow croaker (Larimichthys crocea), an economically important marine fish in China. The tissue expression profile and expression modulation upon stimulation with inactivated bacterial vaccine of LycTLR21 were analyzed. We also demonstrated that LycTLR21 specifically recognized three CpG-ONDs, CpG-ODN 1826, 2006, and 2007, and mediated NF-kB activation. All these three CpG-ODNs were able to increase the expression of LycTLR21 and proinflammatory cytokines IL-1b and IL-6 in LYCK cells. In addition, the expression levels of LycTLR21, c-Rel, IL-1b and IL-6 genes were also found to increase by bacterial infection. 2. Materials and methods 2.1. Experimental fish and cell lines Large yellow croakers (weight: 112 ± 19.6 g) were purchased from a mari-culture farm at Lianjiang county, Fuzhou city, China. After 3 days of acclimatizing in aerated seawater tanks, these fish were used for induction experiments. Two groups of 30 fish were intraperitoneally injected with the inactivated trivalent bacterial vaccine consisting of 1.0 108 colony forming units (CFU)/mL of Vibrio alginolyticus, Vibrio parahaemolyticus, and Aeromonas hydrophila at a dose of 0.2 mL/100 g fish, or the mixed bacteria (1.0 108 CFU/mL of V. alginolyticus, V. parahaemolyticus, and A. hydrophila) at a dose of 0.2 mL/100 g fish. The inactivated trivalent bacterial vaccine was prepared in our laboratory as described previously [26]. A third group of 30 fish were injected with sterilized phosphate buffered saline (PBS, pH7.4) at a dose of 0.2 mL/100 g fish as a control. The spleen, head kidney, and gills were collected from 5 fish at different time points (0, 6, 12, 24, 48, and 72 h) after induction and stored at 80 C for further use. The large yellow croaker head kidney (LYCK) cells were derived from the head kidney of fish and the continuous cell lines were maintained at 28 C in L-15 medium (Life Technologies, Carlsbad, CA, USA), supplemented with 10% Fetal Bovine Serum (FBS) according to the previous study [27]. The CHO cells (China Center for Type Culture Collection, Wuhan, China) were cultured in DMEM-F/ 12 containing 10% FBS, 100 units/mL penicillin, and 100 mg/mL streptomycin at 37 C in a 5% CO2 incubator.
2.2. Cloning of complete coding sequence of LycTLR21 The coding sequence of LycTLR21 was predicted from the genome sequence of large yellow croaker (JRPU00000000) [28], and a pair of gene-specific primers LycTLR21 ORF-F and -R (Supplementary Table 1) was designed. Using cDNA from the spleen of large yellow croaker as a template, PCR was performed using EasyPfu DNA Polymerase (TransGen Biotech) under the following conditions: 95 C for 3 min, then 35 cycles of 95 C for 30 s, 58 C for 30 s, 72 C for 3 min, followed by a final extension at 72 C for 5 min. The resulting PCR product was then added a single adenosine (A) at its 30 end using Taq DNA Polymerase (Takara, China) and cloned into pMD18-T simple vector (Takara, China). At least three clones containing the insert were sequenced. Sequence alignment was performed using DNAMAN program. Protein domains were predicted by Simple Modular Architecture Research Tool (SMART) (http://smart.embl-heidelberg.de/). Signal peptide was predicted using SignalP 4.1 (http://www.cbs.dtu.dk/services/ SignalP/). Phylogenetic tree was constructed with Molecular Evolution Genetics Analysis (MEGA) software version 6.06 using the neighbor-joining method [29]. 2.3. Tissue expression analysis of LycTLR21 Various tissues including brain, spleen, heart, skin, head kidney, muscle, intestine, blood, liver, and gills were collected from 5 healthy large yellow croakers. Total RNA was isolated, treated with RNase-free DNase I, and reverse transcribed into the first strand cDNA using Oligo-dT Adaptor primer (TaKaRa, China). To determine the tissue expression profile of LycTLR21, real-time PCR was performed with gene-specific primers (Supplementary Table 1). The reference gene b-actin was amplified as an internal control with the primer set of Actin-F and -R (Supplementary Table 1). Real-time PCR was performed on the Mastercycler ep gradient realplex4 system (Eppendorf, Germany) using SYBR® Premix ExTaq™ (TaKaRa). Cycling conditions were 20 s at 95 C, then 40 cycles of 95 C for 5 s, 57 C for 15 s, and 72 C for 20 s. The fluorescence output for each cycle was analyzed upon the completion of the entire run. The expression levels of LycTLR21 were normalized by bactin using the 2DDCT method and expressed as the ratio of the LycTLR21 expression levels in the brain [30]. Each real-time PCR assay was repeated three times. The data of real-time PCR were expressed as the standard error of the mean (SEM). To understand the modulation of LycTLR21 expression upon the trivalent bacterial vaccine induction, total RNA was extracted from spleen, head kidney, and gills of 5 fish sampled above. The first strand cDNA was synthesized from 1 mg of each total RNA and used as template for real-time PCR analysis. Real-time PCR was performed to detect expression levels of LycTLR21 gene as above. The expression levels of LycTLR21 gene were normalized by b-actin. Fold change was expressed as the ratio of the normalized gene expression levels in fish injected with bacterial vaccine versus those in fish injected with PBS (defined as 1) at the corresponding time points. All data were obtained from three independent PCR assays with three replicates in each assay. 2.4. Luciferase reporter assay To investigate whether the TIR domain of LycTLR21 was able to activate the signal transduction pathways that lead to the activation of NF-kB and/or IFN-b, a constitutively activated chimera CD4LycTLR21 was generated by fusing cDNAs encoding the extracellular domain of human CD4 (amino acids 1e397) and the transmembrane and cytoplasmic domains of LycTLR21 (amino acids 795e944). The cDNA encoding the extracellular domain of human
M. Sun et al. / Fish & Shellfish Immunology 59 (2016) 179e188 Table 1 Sequences of CpG-ODNs used in this study. CpG-ODNs
Sequence 50 -30
CpG-2006 CpG-2007 CpG-1681 CpG-202 CpG-685 CpG-684 CpG-1826 CpG-1826-GC CpG-2000 CpG-2002 CpG-1670 CpG-HC4040 CpG-201
tcgtcgttttgtcgttttgtcgtt tcgtcgttgtcgttttgtcgtt accgatgtcgttgccggtgacg gatctcgctcgctcgctat tcgtcgacgtcgttcgttctc tcgacgttcgtcgttcgtcgttc tccatgacgttcctgacgtt tccatgagcttcctgagctt tccatgacgttcctgcagttcctgacgtt tccacgacgttttcgacgtt accgataacgttgccggtgacg tgactgtgaacgttcgagatga gatcacgtacgtacgtctat
CD4 was amplified from the first strand cDNA from HEK293T cells using primer set of CD4-F/R and inserted into Xhol I/BamH I-digested pcDNA3.1 plasmid. The resulting recombinant plasmid was named pcDNA3.1-CD4. Then the PCR product encoding the transmembrane and cytoplasmic domains of LycTLR21 was cloned
181
into BamH I/Hind III sites of pcDNA3.1-CD4 above and recombinant plasmid pcDNA3.1-CD4-TLR21 obtained. The CHO cells were transfected with 3.2 mg of pcDNA3.1-CD4-TLR21 plasmid/pcDNA3.1 plasmid (control) and Western-blotting was performed to detect the expression of CD4-TLR21 fusion protein at 48 h posttransfection. The TLR activation assays were performed as described previously [31]. Briefly, the CHO cells (5 104 cells/well) were seeded in 96-well plates overnight and co-transfected with 200 ng of pcDNA3.1-CD4-TLR21 plasmid/pcDNA3.1 plasmid (control), pGL4.32[luc2P/NF-kB-RE/Hygro]/pGL3-IFNb-luc plasmid (200 ng), and pRL-TK plasmid (2 ng) using ViaFect™ Transfection Reagent (Promega). At 24 and 48 h post-transfection, the luciferase activity of total cell lysates was measured on a GloMax 20/20 luminometer (Promega) according to the Dual-Luciferase® Repoter Assay System (Promega), respectively. The firefly luciferase activity was normalized to the Renilla luciferase activity (pRL-TK), and the relative luciferase activity was expressed as the ratio of normalized luciferase activity in cells transfected with pcDNA3.1-CD4-TLR21 versus that in cells transfected with the empty vector pcDNA3.1. All data were obtained from three independent experiments with three replicates in each experiment.
Fig. 1. Nucleotide and deduced amino acid sequences of LycTLR21 gene. Signal peptide is marked in red (residues 1e23). The LRR domains are shown with grey shade (residues 81e104, 105e128, 129e152, 153e174, 179e202, 428e454, 455e475, 476e499, 500e523, 577e603, 604e626, 627e653, 654e678). The transmembrane domain is boxed in blue (residues 745e767). The TIR domain is underlined in black (residues 795e944). (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
182
M. Sun et al. / Fish & Shellfish Immunology 59 (2016) 179e188
Fig. 2. Comparison of TLR21 domain structures between different species. The domain organization of LycTLR21 was predicted by SMART analysis. The GenBank accession numbers for TLR21 sequences used are listed in Table 2. LRR: leucine-rich repeat; LRR-TYP: leucine-rich repeat typical subfamily; TIR: Toll/IL-1 receptor; CT: C -terminal; : signal peptide; : transmembrane domain.
To identify the ligands to which LycTLR21 responded, a LycTLR21 cell-based activation assay with CHO cells was established. Briefly, the complete coding sequence of LycTLR21 was amplified with the primer set of TLR21-F and -R (Supplementary Table 1) and inserted
into Xhol I/BamH I-digested pcDNA3.1 plasmid. The resulting pcDNA3.1-TLR21 plasmid/pcDNA3.1 plasmid (control) (200 ng), pGL4.32[luc2P/NF-kB-RE/Hygro] plasmid (200 ng), and pRL-TK plasmid (2 ng) were cotransfected into the CHO cells in 96-well
Fig. 3. Alignment of large yellow croaker TLR21 TIR domain with that of other fish species TLR21. The three active motifs are boxed in blue: box 1 (796YDxFxSYN803), box 2 (827LCL-RD-LG837), and box 3 (933FWxxL937). The alignment was performed using DNAMAN version 6.0.3. The GenBank accession numbers for TLR21 sequences used are listed in Table 2. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
M. Sun et al. / Fish & Shellfish Immunology 59 (2016) 179e188
plates using ViaFect™ Transfection Reagent. After 48 h, the cells were transfected with CpG-ODNs with different sequences (Table 1), poly(I:C), LPS, and LTA-SA at a final concentration of 3 mM, 25 mg/mL, 25 ng/mL, and 10 mg/mL for 6 h, respectively. Then the cells were harvested and relative luciferase activity was calculated as described above. 2.5. TLR21 and cytokine expression in CpG- ODNs-treated LYCK cells To understand the effect of three CpG-ODNs (ligands) on LycTLR21 signaling pathway, LYCK cells (1 106 cells/well) were cultured in 24-well plates overnight and transfected with CpG-ODN 1826, CpG-ODN 2006, and CpG-ODN 2007 at a final concentration of 3 mM. The cells were then harvested at 6, 12, 24, and 48 h after treatment. Total RNA was extracted for expression analysis of LycTLR21 and downstream proinflammatory cytokines IL-1b and IL-6 of NF-kB pathway. Real-time PCR was performed with the gene-specific primers (Supplementary Table 1) and data were analyzed as described above. The PBS-treated LYCK cells were harvested at different time points as controls. Fold change was expressed as the ratio of gene expression levels in cells stimulated with CpG-ODNs versus those in cells stimulated with PBS at each time point. All data were obtained from three independent experiments with three replicates in each experiment. 2.6. Effect of bacterial infection on LycTLR21 signaling pathway To further know whether LycTLR21 signaling pathway was involved in immune response to bacterial infection, the expression levels of LycTLR21, c-Rel subunit of NF-kB, and downstream cytokines IL-1b and IL-6 in the spleen and head kidney during bacterial infection were analyzed by real-time PCR. Real-time PCR was performed with the gene-specific primers as described above (Supplementary Table 1). Data were obtained from three independent PCR assays with three replicates in each assay.
183
3. Results 3.1. Characterization of LycTLR21 The determined coding sequence of LycTLR21 (KY025428) was 2946 nucleotides (nt) long, encoding a protein of 981 amino acids (aa) with a theoretical molecular mass of 113 kDa. The deduced LycTLR21 exhibited a typical TLR domain architecture, including a signal peptide (residues 1e23), 13 LRRs at the extracellular region (residues 81e677), a transmembrane region (residues 745e767), and a TIR domain (residues 795e944) in the cytoplasmic region (Figs. 1 and 2). LycTLR21 has 13 LRR domains, one more than zebrafish (Danio rerio) TLR21 (12 LRRs), and less than pufferfish (Takifugu rubripes) (16 LRRs), orange-spotted grouper (Epinephelus coioides) TLR21 (16 LRRs), and catfish (Ictalurus punctatus) TLR21 (18 LRRs). All known fish TLR21 molecules have no a C-terminal LRR (LRR-CT), whereas chicken and goose TLR21 sequences contain a LRR-CT (Fig. 2). Additionally, LycTLR21 also has three conserved regions found in the TIR domain of fish TLR21: box 1 (796YDxFxSYN803), box 2 (827LCL-RD-LG837), and box 3 (933FWxxL937) (Fig. 3). Multiple sequence alignment shows that the deduced LycTLR21 has 74.6%, 70.9%, 68.2%, 65.2%, 60.9%, 60.1%, 56.2%, 56%, 53%, 51.9%, 51.6%, 41.7%, and 39.7% sequence identity to rock bream, orangespotted grouper, nile tilapia, pufferfish, Atlantic salmon, Maraena whitefish, Atlantic cod, catfish, walking catfish, zebrafish, grass carp, goose, and chicken TLR21, respectively. Relatively, it shares a lower identity to TLR22 and TLR20 in fish (26.7e29.3% and 24.4e25% identity, respectively) and TLR9 in fish, mice, and human (14.6e21.4% sequence identity) (Table 2). Phylogenetic analysis showed that fish specific TLRs (TLR20, TLR21, and TLR22) and TLR 9 were found to fall into two major groups. Moreover, members from TLR20, TLR21, and TLR22 formed separate branches, respectively. LycTLR21 was positioned in the fish TLR21 clade and exhibited the closest relationship with the TLR21 in orange-spotted grouper and rock bream (Fig. 4).
Table 2 The TLR protein sequences used for structure and phylogenetic analyses. Species
TLR21 (Identity, %) Entire sequence
TIR
Oplegnathus fasciatus (rock bream) TLR21 Epinephelus coioides (orange-spotted grouper) TLR21 Oreochromis niloticus (nile tilapia) TLR21 Takifugu rubripes (fugu) TLR21 Salmo salar (Atlantic salmon) TLR21 Coregonus maraena (Maraena whitefish) TLR21 Gadus morhua (Atlantic cod) TLR21 Ictalurus punctatus (catfish) TLR21 Clarias batrachus (walking catfish) TLR21 Danio rerio (zebrafish) TLR21 Ctenopharyngodon idella (grass carp) TLR21 Anser cygnoides (goose) TLR21 Gallus gallus (chicken) TLR21 Cyprinus carpio (common carp) TLR20 Ctenopharyngodon idella (grass carp) TLR20 Catla catla (catla) TLR22 Ictalurus punctatus (catfish) TLR22 Danio rerio (zebrafish) TLR22 Epinephelus coioides (orange-spotted grouper) TLR22 Larimichthys crocea (large yellow croaker) TLR22 Scophthalmus maximus (turbot) TLR22 Takifugu rubripes (fugu) TLR22 Mus musculus (house mouse) TLR9 Ictalurus punctatus (catfish) TLR9 Takifugu rubripes (fugu) TLR9 Danio rerio (zebrafish) TLR9 Homo sapiens (human) TLR9 Larimichthys crocea (large yellow croaker) TLR9 A Larimichthys crocea (large yellow croaker) TLR9 B
74.6 70.9 68.2 65.2 60.9 60.1 56.2 56.0 53.0 51.9 51.6 41.7 39.7 25.0 24.4 29.3 28.7 28.7 28.5 27.9 27.2 26.7 21.4 20.6 19.9 19.9 19.8 19.4 14.6
94.0 91.3 92.7 86.7 83.3 83.3 83.3 78.7 77.3 79.3 78.7 61.3 61.3 53.6 53.0 56.7 58.0 57.3 58.0 56.0 57.3 54.7 32.3 30.2 33.3 30.3 29.2 31.2 19.5
GenBank accession number AIT52504.1 AEK49148 AHK13949.1 AAW69371 CDH93614.1 CEF90221.1 AFK76484.1 AEI59678 AGM39445.1 CAQ13807 AGM21642.1 AMB20882 NP_001025729 AHH85805.1 AHN49762.1 AGW43269.2 AEI59679.1 AAI63527.1 AGA84053.1 NP_001290325.1 AIC75881.1 AAW69372.1 EDL21125.1 AEI59673.1 AAW69377.1 AAI63628.1 AAZ95520.1 ACF60624.1 ACF60625.1
184
M. Sun et al. / Fish & Shellfish Immunology 59 (2016) 179e188
Fig. 4. Phylogenetic tree based on the genetic distances of TLR20, TLR 21, and TLR 22 in fish and TLR9 in fish, mice, and human. Complete amino acid sequences of the TLRs were aligned by using CLUSTAL W, and the tree was constructed using the neighbor-joining method in MEGA 6.06 and supported by 1000 bootstrap repetitions. The GenBank accession numbers for the sequences used here are listed in Table 2.
3.2. Tissue expression analysis of LycTLR21 Tissue expression analysis showed that LycTLR21 gene was ubiquitously expressed in all tissues examined, including muscle, brain, intestine, skin, head kidney, gills, heart, blood, liver, and spleen. The higher transcript levels of LycTLR21 were detected in the spleen, head kidney, and gills, and the lower levels in blood, heart, and skin (Fig. 5A). Upon stimulation with the trivalent bacterial vaccine, the transcript levels of LycTLR21 were significantly up-regulated in the spleen, head kidney, and gills, with the highest increase in the spleen at 48 h post-induction (more than 13-fold increases) (Fig. 5B).
consisting of the extracellullar domain of human CD4 and the transmembrane and cytoplasmic regions of LycTLR21. Westernblotting analysis showed that the CD4-TLR21 fusion protein was expressed in the CHO cells transfected with recombinant plasmid pcDNA3.1-CD4-TLR21 (Fig. 6A). Then we examined whether the CD4-TLR21 fusion protein activates the NF-kB or human IFN-b in CHO cells. The results showed that the overexpression of the CD4-TLR21 fusion protein significantly up-regulated the NF-kB luciferase activity, with 3- and 20-fold increases at 24 and 48 h, respectively, whereas no alteration of IFN-b luciferase activity was observed (Fig. 6B), suggesting that the LycTLR21 TIR domain was functional and was able to activate the transcription factor NF-kB in CHO cells.
3.3. Effect of LycTLR21 TIR domain on NF-kB activity 3.4. Ligand recognized by LycTLR21 Since CD4 can autodimerize, the functional TLR-TIR domain will activate the downstream TLR signaling pathways [32]. To estimate the output of LycTLR21 signaling, we constructed a fusion protein
CHO cells were overexpressed with LycTLR21, pRL-TK plasmid and pGL4.32[luc2P/NF-kB-RE/Hygro] plasmid, followed by
M. Sun et al. / Fish & Shellfish Immunology 59 (2016) 179e188
185
LPS, and LTA-SA could not induce NF-kB activity (Fig. 6C), suggesting that LycTLR21 specifically recognized the CpG-ODN 1826, 2006, and 2007. 3.5. Effect of CpG ODNs on LycTLR21 signaling pathway
Fig. 5. Tissue expression analysis of LycTLR21 gene. A. Tissue expression profile of LycTLR21 gene. Total RNA was extracted from various tissues of 5 healthy fish, and realtime PCR was used to detect the expression levels of LycTLR21 in these tissues. The expression levels of LycTLR21 were normalized by b-actin and expressed as the ratio of the expression levels in the brain (Br: brain; Bl: blood; Mu: muscle; Sk: skin; Li: liver; He: heart; In: intestines; HK: head kidney; Gi: gills; Sp: spleen). B. Expression modulation of LycTLR21 gene in spleen, head kidney, and gills after induction with inactivated trivalent bacterial vaccine. Each tissue was collected from 5 fish at different time points after bacterial vaccine induction, and total RNA was extracted from each mixed tissue (5 fish) for real-time PCR analysis. All data were obtained from three independent PCR assays with three replicates in each assay. Error bars represent the standard error of the mean (SEM). Asterisks represent a significant difference by t-test method (*p < 0.05; **p < 0.01).
treatment with a panel of candidate ligands. We estimated which ligand can activate the LycTLR21 signaling pathway by measuring NF-kB activity. As shown in Fig. 6C, three CpG-ODNs, CpG-ODN 1826, 2006, and 2007, were able to markedly activate NF-kB activity in the LycTLR21-overexpressing CHO cells, with 3.04-, 3.13-, 3.89fold increases, respectively, whereas other CpG-ODNs, poly(I:C),
It is found that LycTLR21 could mediate the activation of NF-kB (Fig. 6A and B). To further understand the effect of CpG-ODN 1826, 2006, and 2007(ligands) on LycTLR21 signaling pathway, the expression levels of LycTLR21 and downstream cytokines IL-1b and IL-6 of NF-kB pathway were detected in LYCK cells treated with these three CpG-ODNs. As shown in Fig. 7, the expression levels of LycTLR21, IL-1b, and Il-6 were quickly up-regulated by the three CpG-ODNs. The LycTLR21, IL-1b, and Il-6 transcripts were upregulated 93-, 25-, and 5-fold by CpG-ODN 1826, respectively (Fig. 7A), while their transcripts were increased 24-, 7-, and 4-fold by CpG-ODN 2006, and 30-, 14-, and 4-fold by CpG-ODN 2007 (Fig. 7B and C), indicating that CpG-ODN 1826 was more potent than other two in increasing the expression of LycTLR21, IL-1b, and IL-6. These results suggested that all the three CpG-ODNs had an effect on activation of LycTLR21 signaling pathway and CpG-ODN 1826 had the most remarkable effect. 3.6. LycTLR21 signaling pathway may play a role in immune response to bacterial infection To understand whether LycTLR21 signaling pathway was involved in immune response to bacterial infection, the expression levels of LycTLR21, c-Rel, IL-1b and IL-6 genes in the spleen and head kidney during bacterial infection were analyzed. As shown in Fig. 8, the expression levels of LycTLR21, c-Rel, IL-1b and IL-6 in the spleen and head kidney were quickly up-regulated by bacterial infection, suggesting that LycTLR21 signaling pathway may play a role in immune response to bacterial infection. 4. Discussions In the previous study, TLR22, a member of the TLR21 family, has
Fig. 6. A. Expression analysis of the CD4-TLR21 fusion protein by Western-blotting. CHO cells were transfected with 3.2 mg of pcDNA3.1 or pcDNA3.1-CD4-TLR21 plasmid. At 48 h post-transfection, the cells were collected and lysed in lysis buffer containing a protease inhibitor cocktail. Cell lysates were then resolved on 12% SDSePAGE and transferred onto nitrocellulose membranes for Western-blotting analysis with mouse anti-Myc monoclonal antibody as the primary antibody (Thermo Fisher). B. Constitutively active LycTLR21 (CD4-TLR21) activates NF-kB. CHO cells were transfected with pcDNA3.1-CD4-TLR21/pcDNA3.1 plasmid, pGL4.32[luc2P/NF-kB-RE/Hygro]/pGL3-IFN-b-luciferase plasmid, and pRLTK. At 24 and 48 h post-transfection, the luciferase activity of total cell lysates was measured with a luminometer, respectively. The relative luciferase activity was determined as the ratio of the Firefly luciferase activity versus the Renilla luciferase activity. Fold change was expressed as the ratio of relative luciferase activity in cells transfected with pcDNA3.1CD4-TLR21 versus that in cells transfected with pcDNA3.1. C. Activation of LycTRL21 by three CpG-ODNs. CHO cells were transfected with pcDNA3.1-TLR21/pcDNA3.1 plasmid, pGL4.32[luc2P/NF-kB-RE/Hygro] plasmid, and pRL-TK. After 48 h, cells were treated with different CpG-ODNs, poly(I:C), LPS, and LTA-SA, respectively. The luciferase activity was examined as described above. All data were obtained from three independent experiments with three replicates in each experiment. Error bars represent SEM. Asterisks represent a significant difference by t-test method (*p < 0.05; **p < 0.01).
186
M. Sun et al. / Fish & Shellfish Immunology 59 (2016) 179e188
Fig. 8. Expression analysis of LycTLR21, c-Rel, IL-1b and IL-6 genes in the spleen (A) and head kidney (B) of bacteria-infected fish. Two tissues were collected from 5 fish at different time points after bacterial infection, and total RNA was extracted from each mixed tissue (5 fish) for real-time PCR analysis. Fish were injected with the sterilized PBS as control. The relative expression levels of these genes were normalized by bactin, and expressed as fold change compared with the control at each time point. Data were obtained from three independent PCR assays with three replicates in each assay. Error bars represent SEM. Asterisks represent a significant difference by t-test method (*p < 0.05; **p < 0.01).
Fig. 7. Expression analysis of LycTLR21, IL-1b, and IL-6 in the CpG-ODNs-treated LYCK cells. LYCK cells were transfected with CpG-ODN 1826 (A), CpG-ODN 2006 (B), and CpG-ODN 2007 (C) at a final concentration of 3 mM, and were harvested at different time points after treatment. Total RNA was extracted for expression analysis of LycTLR21, IL-1b, and IL-6 by real-time PCR. LYCK cells were treated with PBS as control. The relative expression levels of these genes were normalized by b-actin and expression as fold change compared with the control at each time point. All data were obtained from three independent experiments with three replicates in each experiment. Error bars represent SEM. Asterisks represent a significant difference by t-test method (*p < 0.05; **p < 0.01).
been cloned and identified from large yellow croaker (Larimichthys crocea) [33]. Here, we identified another member of the TLR21 family, TLR21 (LycTLR21), from this species. The deduced LycTLR21 has the typical TLR domain architecture as found in other fish TLR21 molecules (Figs. 1 and 2). LycTLR21 has 13 LRR domains, which is different from TLR21 in zebrafish (12 LRRs), pufferfish (16 LRRs), orange-spotted grouper (16 LRRs), and catfish (18 LRRs). As the TLR LRR domain is implicated in ligand binding, whether the differences in the LRR number of TLR21 among various fish species change their ligand binding will require further investigations. The LycTLR21 TIR domain also has three conserved regions as found in other fish TLR21: box 1 (796YDxFxSYN803), box 2 (827LCL-RD-LG837),
and box 3 (933FWxxL937) (Fig. 3). Homology comparison and phylogenetic analysis further showed that LycTLR21 is a novel member of the TLR21 family (Table 2; Fig. 4). Tissue expression study revealed that LycTLR21 was constitutively expressed in all tissues examined although at a different level (Fig. 5A). Higher expression levels of LycTLR21 were found in the spleen, head kidney, and gills (Fig. 5A), which was consistent with the findings in Atlantic salmon (Salmo salar) [21], orange-spotted grouper [18], zebrafish [24], grass carp [20], rock bream [22] and yellowtail (Seriola lalandi) [23], indicating that fish TLR21 is highly expressed in the immune-related tissues, such as spleen and head kidney. The spleen and head kidney are major sites of innate and adaptive immune responses in fish [34], where a large number of immune cells including macrophages and lymphocytes resided in. Meanwhile, the macrophages, T lymphocytes, and B lymphocytes are considered to be pivotal sources of the TLRs [1]. We therefore speculated that the higher expression of fish TLR21 in spleen and head kidney might be due to the presence of abundant immune cells in these two tissues. Upon stimulation with the trivalent bacterial vaccine, the expression of LycTLR21 was significantly up-regulated in the spleen, head kidney, and gills (Fig. 5B). In olive flounder, TLR21 expression was significantly up-regulated after V. anguillarum infection [19]. Rock bream TLR21 mRNA was found to be considerably increased by pathogenic bacteria and iridovirus [22]. Grass carp TLR21 expression was also modulated in the spleen at the early phase after infection with A. hydrophila and Aquareovirus [20]. In addition, Cryptocaryon irritans infection could induce the orange-
M. Sun et al. / Fish & Shellfish Immunology 59 (2016) 179e188
spotted grouper TLR21 expression [18]. All these observations suggest that fish TLR21 may play an important role in the host defense against pathogen infection. The TLR TIR domain has been shown to be involved in the signaling as well as in the localization of the TLR [35]. To understand the output of LycTLR21 signaling, we constructed a chimera consisting of the extracellullar domain of human CD4 and the transmembrane and cytoplasmic regions of LycTLR21 and coexpressed it along with NF-kB/IFN-b reporter plasmid in CHO cells. We found that the LycTLR21 TIR domain was able to activate the NFkB in CHO cells (Fig. 6A), suggesting that LycTLR21 could mediate the activation of NF-kB. Activation of chicken TLR21 is dependent on the nucleotide sequence of the ODN [16]. Zebrafish TLR21 preferentially responded to CpG-ODN 2006 and 2007, but not to CpG-ODN 1826 [24]. TLR21 in grass carp did not appear to be responsive to CpG-ODN 2006 [25]. Here, LycTLR21 was significantly activated by CpGODN 1826, 2006, and 2007 in CHO cells (Fig. 6B). These results thus suggest that TLR21 from different fish species may have a differential preference for the sequence of the ODN recognized. One possible explanation may be due to the differences in the LRR number of TLR21 among various fish species (Fig. 2). Immune stimulatory activities of CpG-ODNs as antimicrobial agents have been demonstrated in varieties of fish species [24,25,36e38]. In this study, all three LycTLR21 ligands, CpG-ODN 1826, 2006, and 2007, could markedly up-regulate the expression of LycTLR21 and downstream cytokines IL-1b and IL-6 of NF-kB pathway in LYCK cells (Fig. 7), thus providing further evidence that LycTLR21 mediated the activation of NF-kB. Additionally, the expression levels of LycTLR21, c-Rel (a subunit of NF-kB), IL-1b and IL-6 were quickly up-regulated by bacterial infection (Fig. 8), suggesting that LycTLR21 signaling pathway may play a role in immune response to bacterial infection in large yellow croaker. However, further studies are needed to elucidate the exact LycTLR21 signaling pathway and its functions.
[11]
[12]
[13]
[14] [15]
[16]
[17]
[18]
[19]
[20]
[21]
[22]
[23]
[24]
Acknowledgements This work was supported by the National Natural Science Foundation of China (31530080 and 31372556) and National Basic Research Program of China (2015CB755903).
[25]
[26]
Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.fsi.2016.10.024.
[27]
[28]
References [1] S. Akira, S. Uematsu, O. Takeuchi, Pathogen recognition and innate immunity, Cell 124 (4) (2006) 783e801. [2] L.A. O'Neill, A.G. Bowie, The family of five: TIR-domain-containing adaptors in Toll-like receptor signalling, Nat. Rev. Immunol. 7 (5) (2007) 353e364. [3] A. Abdelsadik, A. Trad, Toll-like receptors on the fork roads between innate and adaptive immunity, Hum. Immunol. 72 (12) (2011) 1188e1193. [4] E.M.Y. Moresco, D. LaVine, B. Beutler, Toll-like receptors, Curr. Biol. 21 (13) (2011) R488eR493. [5] S. Akira, Toll-like receptors and innate immunity, Adv. Immunol. 78 (2001) 1e56. [6] J.E. Cole, E. Georgiou, C. Monaco, The expression and functions of toll-like receptors in atherosclerosis, Mediat. Inflamm. 2010 (2010) 393946. [7] R. Medzhitov, C.A. Janeway Jr., Innate immunity: the virtues of a nonclonal system of recognition, Cell 91 (3) (1997) 295e298. [8] M. Coscia, S. Giacomelli, U. Oreste, Toll-like receptors: an overview from invertebrates to vertebrates, ISJ 8 (2011) 210e226. [9] J.C. Roach, G. Glusman, L. Rowen, A. Kaur, M.K. Purcell, K.D. Smith, L.E. Hood, A. Aderem, The evolution of vertebrate Toll-like receptors, P. Nat. Acad. Sci. U. S. A. 102 (27) (2005) 9577e9582. [10] Y. Qi, B. Yan, S. Chen, H. Chen, M. Wang, R. Jia, D. Zhu, M. Liu, F. Liu, Q. Yang, CpG oligodeoxynucleotide-specific goose TLR21 initiates an anti-viral
[29]
[30]
[31]
[32]
[33]
[34]
187
immune response against NGVEV but not AIV strain H9N2 infection, Immunobiology 221 (3) (2015) 454e461. K. Chrzastek, D. Borowska, P. Kaiser, L. Vervelde, Class B CpG ODN stimulation upregulates expression of TLR21 and IFN-in chicken Harderian gland cells, Vet. Immunol. Immunop. 160 (3e4) (2014) 293e299. A. Ishii, M. Kawasaki, M. Matsumoto, S. Tochinai, T. Seya, Phylogenetic and expression analysis of amphibian Xenopus Toll-like receptors, Immunogenetics 59 (4) (2007) 281e293. H. Oshiumi, T. Tsujita, K. Shida, M. Matsumoto, K. Ikeo, T. Seya, Prediction of the prototype of the human Toll-like receptor gene family from the pufferfish, Fugu rubripes, genome, Immunogenetics 54 (11) (2003) 791e800. C. Jault, L. Pichon, J. Chluba, Toll-like receptor gene family and TIR-domain adapters in Danio rerio, Mol. Immunol. 40 (11) (2004) 759e771. A.M. Keestra, M.R. de Zoete, L.I. Bouwman, J.P. van Putten, Chicken TLR21 is an innate CpG DNA receptor distinct from mammalian TLR9, J. Immunol. 185 (1) (2010) 460e467. R. Brownlie, J. Zhu, B. Allan, G.K. Mutwiri, L.A. Babiuk, A. Potter, P. Griebel, Chicken TLR21 acts as a functional homologue to mammalian TLR9 in the recognition of CpG oligodeoxynucleotides, Mol. Immunol. 46 (15) (2009) 3163e3170. P. Baoprasertkul, P. Xu, E. Peatman, H. Kucuktas, Z. Liu, Divergent Toll-like receptors in catfish (Ictalurus punctatus): TLR5S, TLR20, TLR21, Fish. Shellfish Immunol. 23 (6) (2007) 1218e1230. Y.-W. Li, X.-C. Luo, X.-M. Dan, W. Qiao, X.-Z. Huang, A.-X. Li, Molecular cloning of orange-spotted grouper (Epinephelus coioides) TLR21 and expression analysis post Cryptocaryon irritans infection, Fish. Shellfish Immunol. 32 (3) (2012) 476e481. H. Gao, L. Wu, J.S. Sun, X.Y. Geng, B.P. Pan, Molecular characterization and expression analysis of Toll-like receptor 21 cDNA from Paralichthys olivaceus, Fish. Shellfish Immunol. 35 (4) (2013) 1138e1145. W. Wang, Y. Shen, N.P. Pandit, J. Li, Molecular cloning, characterization and immunological response analysis of Toll-like receptor 21 (TLR21) gene in grass carp, Ctenopharyngodon idella, Dev. Comp. Immunol. 40 (3e4) (2013) 227e231. P.T. Lee, J. Zou, J.W. Holland, S.A. Martin, B. Collet, T. Kanellos, C.J. Secombes, Identification and characterisation of TLR18-21 genes in Atlantic salmon (Salmo salar), Fish. Shellfish Immunol. 41 (2) (2014) 549e559. T.T. Priyathilaka, D.A. Elvitigala, I. Whang, B.S. Lim, H.B. Jeong, S.Y. Yeo, C.Y. Choi, J. Lee, Molecular characterization and transcriptional analysis of non-mammalian type Toll like receptor (TLR21) from rock bream (Oplegnathus fasciatus), Gene 553 (2) (2014) 105e116. M. Reyes-Becerril, F. Ascencio-Valle, I. Hirono, H. Kondo, W. Jirapongpairoj, M.A. Esteban, E. Alamillo, C. Angulo, TLR21's agonists in combination with Aeromonas antigens synergistically up-regulate functional TLR21 and cytokine gene expression in yellowtail leucocytes, Dev. Comp. Immunol. 6 (2016) 107e115. D.-W. Yeh, Y.-L. Liu, Y.-C. Lo, C.-H. Yuh, G.-Y. Yu, J.-F. Lo, Y. Luo, R. Xiang, T.H. Chuang, Toll-like receptor 9 and 21 have different ligand recognition profiles and cooperatively mediate activity of CpG-oligodeoxynucleotides in zebrafish, P. Nat. Acad. Sci. 110 (51) (2013) 20711e20716. H. Su, G. Yuan, J. Su, A specific CpG oligodeoxynucleotide induces protective antiviral responses against grass carp reovirus in grass carp Ctenopharyngodon idella, Dev. Comp. Immunol. 60 (2016) 218e227. W. Zheng, C. Tian, X. Chen, Molecular characterization of goose-type lysozyme homologue of large yellow croaker and its involvement in immune response induced by trivalent bacterial vaccine as an acute-phase protein, Immunol. Lett. 113 (2) (2007) 107e116. X. Wang, K. Wang, P. Nie, X. Chen, J. Ao, Establishment and characterization of a head kidney cell line from large yellow croaker Pseudosciaena crocea, J. Fish. Biol. 84 (5) (2014) 1551e1561. J. Ao, Y. Mu, L.X. Xiang, D. Fan, M. Feng, S. Zhang, Q. Shi, L.Y. Zhu, T. Li, Y. Ding, L. Nie, Q. Li, W.R. Dong, L. Jiang, B. Sun, X. Zhang, M. Li, H.Q. Zhang, S. Xie, Y. Zhu, X. Jiang, X. Wang, P. Mu, W. Chen, Z. Yue, Z. Wang, J. Wang, J.Z. Shao, X. Chen, Genome sequencing of the perciform fish Larimichthys crocea provides insights into molecular and genetic mechanisms of stress adaptation, PLoS Genet. 11 (4) (2015) e1005118. K. Tamura, G. Stecher, D. Peterson, A. Filipski, S. Kumar, MEGA6: molecular evolutionary genetics analysis version 6.0, Mol. Biol. Evol. 30 (12) (2013) 2725e2729. Y. Ding, J. Ao, C. Ai, X. Chen, Molecular and functional identification of three interleukin-17A/F (IL-17A/F) homologues in large yellow croaker (Larimichthys crocea), Dev. Comp. Immunol. 55 (2016) 221e232. A. Matsuo, H. Oshiumi, T. Tsujita, H. Mitani, H. Kasai, M. Yoshimizu, M. Matsumoto, T. Seya, Teleost TLR22 recognizes RNA duplex to induce IFN and protect cells from birnaviruses, J. Immunol. 181 (5) (2008) 3474e3485. Z. Shi, Z. Cai, A. Sanchez, T. Zhang, S. Wen, J. Wang, J. Yang, S. Fu, D. Zhang, A novel Toll-like receptor that recognizes vesicular stomatitis virus, J. Biol. Chem. 286 (6) (2011) 4517e4524. X. Xiao, Q. Qin, X. Chen, Molecular characterization of a Toll-like receptor 22 homologue in large yellow croaker (Pseudosciaena crocea) and promoter activity analysis of its 5'-flanking sequence, Fish. Shellfish Immunol. 30 (1) (2011) 224e233. E. Chaves-Pozo, P. Munoz, A. Lopez-Munoz, P. Pelegrin, A. Garcia Ayala, V. Mulero, J. Meseguer, Early innate immune response and redistribution of inflammatory cells in the bony fish gilthead seabream experimentally infected
188
M. Sun et al. / Fish & Shellfish Immunology 59 (2016) 179e188
with Vibrio anguillarum, Cell. Tissue Res. 320 (1) (2005) 61e68. [35] K. Funami, M. Matsumoto, H. Oshiumi, T. Akazawa, A. Yamamoto, T. Seya, The cytoplasmic 'linker region' in Toll-like receptor 3 controls receptor localization and signaling, Int. Immunol. 16 (8) (2004) 1143e1154. [36] T. Cardenas-Reyna, C. Angulo, S. Hori-Oshima, E. Velazquez-Lizarraga, M. Reyes-Becerril, B-cell activating CpG ODN 1668 enhance the immune response of Pacific red snapper (Lutjanus Peru) exposed to Vibrio parahaemolitycus, Dev. Comp. Immunol. 62 (2016) 72e81.
[37] J.B. Jorgensen, L.H. Johansen, K. Steiro, A. Johansen, CpG DNA induces protective antiviral immune responses in Atlantic salmon (Salmo salar L.), J. Virol. 77 (21) (2003) 11471e11479. [38] J.W. Pridgeon, P.H. Klesius, X. Mu, R.J. Yancey, M.S. Kievit, P.J. Dominowski, Efficacy of QCDCR formulated CpG ODN 2007 in Nile tilapia against Streptococcus iniae and identification of upregulated genes, Vet. Immunol. Immunopathol. 145 (1e2) (2012) 179e190.