- Email: [email protected]
Molecular and expression characterizations of interleukin-8 gene in large yellow croaker (Larimichthys crocea)
Fish & Shellfish Immunology 34 (2013) 799e809
Contents lists available at SciVerse ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Molecular and expression characterizations of interleukin-8 gene in large yellow croaker (Larimichthys crocea) Chan Li, Cui-Luan Yao* Key Laboratory of Healthy Mariculture for the East China Sea, Ministry of Agriculture, Fisheries College, Jimei University, Xiamen 361021, PR China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 18 October 2012 Received in revised form 21 November 2012 Accepted 11 December 2012 Available online 18 January 2013
IL-8 plays a crucial role in acute inflammation by recruiting and mediating neutrophils and other cells and in initiating the oxidative burst in neutrophils and inducing wound healing by promoting angiogenesis. In the present study, the full-length cDNA and genome sequence of interleukin-8 (LcIL-8) were cloned from large yellow croaker Larimichthys crocea. The LcIL-8 cDNA sequence was 931 bp, containing a 118-bp 50 -untranslated region (UTR), a 528-bp 30 -UTR and a 285-bp open reading frame (ORF) which encoded 94 amino acids. A putative signal peptide including 20 amino acid residues was found at N-terminal in LcIL-8 protein. And a small cytokine (SCY) domain showing a typical CXC chemokine gene organization was predicted in LcIL-8. The genome sequence of LcIL-8 gene was composed of 1930 nucleotides, including four exons and three introns. Quantitative real-time PCR analysis indicated a broad expression of LcIL-8 in most detected tissues, with the most predominant expression in liver. After injection with LPS, Vibrio parahaemolyticus and poly I:C, LcIL-8 expression levels showed up-regulation in head-kidney and spleen. The peak value was in the spleen with 6 times (at 6 h) greater expression than in the control after LPS injection (p < 0.05). However, LcIL-8 transcripts showed down-regulation in the liver after all the three stimulants injection. Recombinant LcIL-8 mature peptide was produced by Escherichia coli, which enhanced the production of superoxide anion in PCK cells. In addition, 5 singlenucleotide polymorphisms (SNPs) were identified in LcIL-8 gene. The results suggested that LcIL-8 might play an important role in fish’s immune response, and the SNPs might be used as potential candidate molecular markers for selection for disease-resistant large yellow croaker. Ó 2013 Elsevier Ltd. All rights reserved.
Keywords: Larimichthys crocea IL-8 Characterization Expression SNPs
1. Introduction Chemokines are a group of structurally related, low molecular weight (8e12 kDa) cytokines that are able to attract and activate specific types of leucocytes to the site of inflammation or injury [1,2]. Based on the arrangement of the first two cysteine residues, chemokines have been classified into four subfamilies: CXC, CC, C and CX3C [3]. IL-8, also called CXCL8, as the first known chemokine, is a prototypical one in the CXC chemokine subfamily [2,3]. IL-8 affects multiple target cells and is produced by a variety of cells, including peripheral blood mononuclear cell [4], macrophages [5], lymphocytes [6], and epithelial cells [7]. IL-8 plays a crucial role in acute inflammation by recruiting and mediating neutrophils and other cells [1]. In addition, IL-8 also plays a pivotal role in initiating the oxidative burst in neutrophils and inducing wound healing by promoting angiogenesis [4]. Up to now, IL-8 has been obtained from many different species. In fish, * Corresponding author. Tel.: þ86 592 6182669; fax: þ86 592 6181476. E-mail address: [email protected] (C.-L. Yao). 1050-4648/$ e see front matter Ó 2013 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.fsi.2012.12.019
it was demonstrated that IL-8 transcripts increased significantly after LPS [8] poly I:C injection [2] or after infected with pathogenic bacteria [9,10], which indicated that IL-8 played an important role in fish’s immune response. More important, previous studies demonstrated that recombinant fish IL-8-like protein stimulated migration of fish neutrophils and macrophages [11]. Recombinant fish IL-8 also showed the biological activity of inducing the migration of headkidney leukocytes, eliciting neutrophils, peripheral blood leukocytes and initiate superoxide production [10,12]. Single nucleotide polymorphisms (SNPs) are one of the most common types of genetic variation and some SNPs in important genes are found to be involved in the etiology of many human diseases and are becoming of particular interest in pharmacogenetics. Some SNPs in IL-8 were associated with disease susceptibility in human [13e15]. However, SNP sites in fish IL-8 gene are still unknown. Large yellow croaker, Larimichthys crocea, is the most cultured marine fish species in China [16]. It distributes mainly from the south of Yellow Sea to the north of South China Sea (Fig. 1). It is well known that there are two main populations of L. crocea including
800
C. Li, C.-L. Yao / Fish & Shellfish Immunology 34 (2013) 799e809
Dai-ju stock and Min-yue stock, which mainly distribute North of Zhejiang Province (30 070 -30 38’N, 121310 -12317’E) and East of Fujian Province (26180 -27400 N, 118 320 -120 44’E) respectively, and more than eighty percent production of mari-cultured large yellow croaker is in the East of Fujian Province. In recent years, cultured large yellow croaker has suffered from severe natural resources exhaustion and serious disease caused by viral, bacterial and parasitic infections, which results in huge economic loss in its culture industry [17e20]. Until now, more than 30 different pathogens have been identified from large yellow croaker. However, Dai-ju stock is insensitive to many pathogens affecting the Min-yue stock. Therefore, many researchers are interested in the candidate disease-resistance SNPs in some important genes between the two stocks. Here, we reported the characterization of putative protein and genomic structure of IL-8 from large yellow croaker. The tissuespecific expression and temporal expression profiles of the gene after stimulation with LPS, poly I:C and one of the main fish pathogens, Vibrio parahaemolyticus, were examined and compared in order to better understand their potential roles in fish immune responses. The recombinant large yellow croaker IL-8 was produced in Escherichia coli. In addition, some SNPs in LcIL-
8 had been identified by polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) and sequencing.
2. Materials and methods 2.1. Fish collection and immune challenge Healthy juvenile large yellow croaker (fish length 16.6 1.5 cm, weighing 80.7 22.2 g) were collected at the Experimental Fish Farm of Ningde Centre of Popularization of Fisheries Technology, Fujian province, China. Before the experiments, fish was acclimated for at least 1 week in 4 m3 tanks in salinity (25e26 psu), temperature (16e 18 C) and density conditions similar to those of the culture net cages from which the specimens were obtained. Blood was collected from eugenol-anaesthetized fish by cutting the tail, blood was diluted 1:2 in anticoagulant solution (0.48% citric acid, 1.32% sodium citrate and 1.47% glucose) and blood cells were separated by centrifugation at 800 g for 5 min at 4 C and were stored in RNA fixer (Bioteke, Beijing). Head-kidney, kidney, intestine, spleen, liver, gill, skin, brain, heart, muscle, and stomach were dissected out from normal un-stimulated fish and preserved in RNA fixer for RNA extraction.
Fig. 1. Maps for sampling localities of the large yellow croaker used in this study. 7 Dai-ju stock from Zhoushan, Zhejiang province, 30 170 N, 122 100 E; 7 Min-yue stock from Ningde, Fujian province 26 300 N, 119 360 E; and 6 hybrids cultured in Ningde, Fujian province 2740 N, 120 440 E.
C. Li, C.-L. Yao / Fish & Shellfish Immunology 34 (2013) 799e809
Fish immune stimulation was performed by intraperitoneal injection of 250 ml poly I:C (27472901, GE, 1 mg/mL) in phosphate buffered saline (PBS, pH 7.4), 250 ml LPS (L2880, Sigma, 1 mg/mL) in PBS or 250 ml suspension formalin-inactivated Gram-negative bacteria V. parahaemolyticus (108 cfu/mL) in PBS, respectively. Fish injected with 250 ml PBS were used as controls (Huang et al., 2011). Six fish were used for each group. Spleen, head-kidney and liver of each group were collected at 3, 6, 12, 24, 48 and 72 h after injection and preserved for real-time reverse transcript polymerase chain reaction (RT-PCR). 2.2. RNA extraction and cDNA synthesis Total RNA was isolated from the tissues of the fishes using Trizol reagent (Invitrogen, China) following the protocol of the manufacturer. Total RNA was incubated with RNase-free DNase (Promega, China) to remove any contaminating genomic DNA. First strand cDNA was synthesized from total RNA by M-MLV reverse transcriptase (Fermentas, China), following the manufacturer’s protocol with Oligo (dT)18 primer. 2.3. Cloning and sequencing of LcIL-8 cDNA and genomic DNA The 30 and 50 ends were obtained by rapid amplification of cDNA ends (RACE) approaches, using gene-specific primers that were designed based on the partial large yellow croaker EST sequence and adapter primers (Table 1). The 30 end RACE PCR was performed with liver cDNA template using the gene-specific primer IL-83F1 and adapter primer AOLP for the first round followed by nested PCR using primers IL-83F2 and adapter primer AP. PCR conditions for the first round were carried out at 94 C for 3 min, 30 cycles of 94 C 30 s, 57 C 30 s and 72 C 1 min, followed by an 8 min postextension at 72 C. For the second round, PCR was performed at the same condition with an annealing temperature of 59 C. The PCR products were gel-purified and ligated into pGEM-T Easy vector (Promega, USA), transformed into the competent E. coli TOP10 cells, and plated on the LB-agar Petri dish. Positive clones containing the expected-size inserts were screened by colony PCR and then sequenced by Invitrogen Corp (Shanghai, China). For the 50 end, the liver mRNA was transcribed by M-MLV reverse transcriptase with Oligo (dT)18 primer. Then the cDNA was purified with a DNA purification kit (TAKARA, China) and tailed with poly (C) at the 50 end by terminal deoxynucleotidyl transferase (TdT) (Fermentas, China). PCR was performed initially with gene-specific Table 1 Primers used for LcIL-8 gene cloning and expression analysis. Primer
Sequence (50 e30 )
Purpose
IL-83F1 IL-83F2 IL-85R1 IL-85R2 AOLP AAP AP IL-8OF1 IL-8OF2 IL-8OR1 IL-8OR2 IL-8QF IL-8QR b-actin-F b-actin-R IL-8 SF IL-8 SR IL-8EF IL-8ER
ATCTCCCAGACTGCTACCCT CCCTCTGCGTTGATACCACT GACATATCCTTCGCCCATCC AGGAATCACCTCCACTTGTC GGCCACGCGTCGACTAGTAC(T)16 GGCCACGCGTCGACTAGTAC(G)10 GGCCACGCGTCGACTAGTAC TGGTATCAACGCAGAGGG TCAGAAATTACTGTCTATTGTACCG TGTGCCAAATCTGGGAAG TAAGCCGTTCCTCCACCT CTATCGTGGCACTCCTGGTT GCAGGAATCACCTCCACTTGT TGAACCCCAAAGCCAACAGG CATACAGGGACAGCACAGCC TTACTATCGTGGCACTCCTG AATCACCTCCACTTGTCCTATGT CGCGGATCCCTGGGAGATCAAACACTGCT-3 CCGGAATTCTCACGGTGCCGGCTGAACCATTT
30 RACE method 50 RACE method General primers for RACE Genomic sequence
mRNA expression
801
primer IL-85R1 and adapter primer AAP using the tailed cDNA as the template, PCR were performed at annealing temperature of 57 C and then a nested PCR was carried out with a gene-specific primer IL-85R2 and adapter primer AP at the same condition. PCR products were gel-purified, cloned, and sequenced as described above. To obtain the genomic sequence of LcIL-8, two primers were designed based on obtained LcIL-8 cDNA sequences. PCR was performed with IL-8OF1 and IL-8OR1 (Table 1) primers at an annealing temperature of 54 C and followed a nested PCR using IL-8OF2 (Table 1) and IL-8OR2 at the same condition and genomic DNA was used as a template for amplification. PCR products were gel-purified, cloned, and sequenced as described. Then the LcIL-8 genomic and cDNA sequences were aligned using bl2seq (http://blast.ncbi.nlm.nih.gov/ Blast.cgi) to verify intron/exon boundaries. 2.4. Amino acid sequence analysis, multiple sequence alignment and phylogenetic tree analysis Sequence homology analysis was performed using BLAST program (http://blast.ncbi.nlm.nih.gov/Blast.cgi). The deduced amino acid sequences were analyzed with the Expert Protein Analysis System (EXPASY) (http://www.expasy.org/) and the protein domain features were predicted by Simple Modular Architecture Reach Tool (SMART) (http://smart.embl-heidelberg.de/) [21]. Multiple alignments of IL-8 amino acid sequences of large yellow croaker with other species (Table 2) were performed using Clustal W (http:// www.ebi.ac.uk/clustalw/) and a phylogenetic tree of IL-8 protein was made by MEGA 4.1 (http://www.megasoftware.net). 2.5. Real-time PCR analysis of LcIL-8 mRNA expression The expression of LcIL-8 mRNA in the different tissues including the kidney, head-kidney, intestine, spleen, liver, gill, brain, skin, muscle, heart, stomach and blood cells, and the temporal expression in the spleen, head-kidney and liver challenged with LPS, poly I:C or V. parahaemolyticus were assessed using qRT-PCR (Real-Time Quantitative Reverse Transcription PCR) in an ABI 7500 Real-time Detection System (Applied Biosystems, USA). The housekeeping gene b-actin was used as an internal control for cDNA normalization. The primers b-actin-F and b-actin-R (Table 1) for b-actin gene were used to amplify a 107-bp fragment and LcIL-8 cDNA was amplified 142-bp fragment using the gene-specific primers IL-8QF and IL-8QR (Table 1). The PCR product was sequenced to verify the specificity of RT-PCR. The amplification was performed in a total volume of 20 ml, containing 10 ml of 2 SYBR Green I real-time PCR Master Mix (TOYOBO, Japan), 1 ml of the diluted cDNA, 0.5 ml of each primer (10 mM), and 8 ml of nuclease-free water. The real-time PCR program was 95 C for 1 min, followed by 40 cycles of 95 C for 15 s, 60 C for 60 s. Dissociation analysis of amplification products was performed at the end of each PCR reaction to confirm that only the special PCR product was amplified and detected. After the PCR program, data were analyzed with ABI 7500 SDS software. To maintain consistency, the baseline was set automatically by the software. The comparative CT method (2DDCT method) was used to analyze the expression level of LcIL-8 [22]. All data were given in terms of relative mRNA expression as means SE. The data obtained from six independent biological replicates were subjected to analysis of t-test. Differences were considered significant at p < 0.05 and supremely significant at p < 0.01. 2.6. Recombinant expression of LcIL-8
SSCP Recombinant expression
The cDNA encoding sequences of the putative mature peptide of LcIL-8 were amplified using gene-specific primers IL-8EF and IL-8ER, with BamHI and EcoRI sites respectively. The obtained
802
C. Li, C.-L. Yao / Fish & Shellfish Immunology 34 (2013) 799e809
Table 2 The IL-8 protein sequences used for multiple alignments and phylogenetic analysis. Species
Common name
Protein
Similarity (%)
Identity (%)
Accession no.
Latris lineata Oreochromis niloticus Dicentrarchus labrax Lateolabrax japonicus Acanthopagrus schlegelii Takifugu rubripes Cynoglossus semilaevis Melanogrammus aeglefinus Cyprinus carpio Salmo salar Gadus morhua Paralichthys olivaceus Xenopus tropicalis Gallus gallus Pelodiscus sinensis Homo sapiens Oryctolagus cuniculus Macaca mulatta
Trumpeter Tilapia European see bass Japanese sea perch Black porgy Fugu rubripes Tongue sole Haddock Common carp Atlantic salmon Atlantic cod Japanese flounder Western clawed frog Chicken Chinese soft-shelled turtle Human Rabbit Rhesus monkey
IL-8 IL-8-like IL-8 Putative IL-8 IL-8 IL-8 precursor IL-8 IL-8 IL-8 IL-8 precursor IL-8 IL-8 IL-8-like IL-8 precursor IL-8 IL-8 IL-8 precursor IL-8 precursor
90 100 88 97 90 92 92 79 97 96 78 90 95 82 82 75 91 75
60 59 60 54 58 52 54 56 47 51 55 49 39 42 44 44 36 43
ACQ99511.1 XP_003452249.1 CAM32186.1 DQ855621.1 AAY18807.1 NP_001027759.1 AEH59114.1 CAD97422.2 ABE47600.1 NP_001134182.1 CAD59734.2 AAL05442.1 XP_002942578.1 NP_990349.1 ACP28489.1 CAA77745.1 NP_001075762 NP_001028137.1
fragment was purified with DNA Purification System (Takara, Dalian) and digested with BamHI/EcoRI. The digested PCR products by the two restriction enzymes were subcloned into a prokaryotic expression vector pGEX-4T-2 (Pharmacia Co.). Sequencing was done to confirm the construction. Then, the recombinant plasmid pGEX-4T-2-IL8 was transformed into the E. coli BL21 (DE3) codon plus. A single bacterial colony was inoculated into 5 ml LB medium containing 50 mg ml1 Ampicillin. Cultures were grown at 37 C with shaking overnight. The overnight culture was transferred into fresh LB medium, incubation was continued until the culture reached an A600 between 0.6 and 0.8, at which point expression was induced by isopropylthiogalactopyranoside (IPTG). The cells were harvested by centrifugation and the cell pellet resuspended in ice-cold lysis buffer (50 mM Tris-Cl, pH 8.0; 200 mM NaCl; 10 mM b-mercaptoethanol; 10% glycerol, 0.1% NP-40, 1 mg/ml leupeptin and 1 mg/ml pepstatin). The recombinant protein was collected by centrifuging the bacterial lysate at 12,500 g for 20 min at 4 C and purified by a Glutathione Sepharose 4B affinity column according to the instructions of the manufacturer (GE Healthcare). The column was washed with elution buffer (50 mM TriseHCl, 10 mM reduced glutathione, 1 mg/ml leupeptin and 1 mg/ml pepstain, pH 8.0). Fractions with the target protein were pooled and purified again using ToxinEraserÔ endotoxin removal resin (Genscript, Nanjing) to get rid of endotoxin and dialyzed against PBS buffer with gradually reduced guanidineeHCl concentration at 4 C. The purity of the expressed protein was verified by 12% SDS-PAGE and Western blot, the monoclonal antibody of GST (EarthOx, USA, E022040) was used as the primary antibody for the detection of the Western blot. The fusion protein was digested with thrombin. The purified protein was saved at 80 C until use.
The deposits were solubilized in 120 ml, 2 M KOH and 140 ml DMSO. After homogenization of the contents in the wells, the extinction was read at 620 nm in a Synergy HT Multi-Detection Microplate Reader. 2.8. Fish collection, PCR amplification and-SSCP analysis In order to identify the SNPs in the LcIL-8 gene, genomic DNA sequences from 20 individuals (7 Dai-ju stock from Zhoushan, Zhejiang Province, 30170 N, 122100 E, 7 Min-yue stock from Ningde, Fujian Province 26 300 N, 119 36’E, and 6 hybrids cultured in Ningde, Fujian Province 2740 N, 120 440 E) were investigated (Fig. 1). Dorsal fin-clip was preserved in 95% alcohol for DNA extraction, prepared for the PCR-SSCP analysis. Genomic DNA was extracted from fin-clip using the standard phenol/chloroform method. PCR was performed with two gene-specific primers IL-8 SF and IL-8 SR (Table 1) and genomic DNA. PCR conditions were carried out at 94 C for 3 min, 30 cycles of 94 C 30 s, 57 C 30 s and 72 C 30 s, followed by an 8 min post-extension at 72 C. The PCR products were used for SSCP analysis to detect the existence of DNA variation. Five ml of each PCR product was mixed with 5 ml of denaturing solution (98% deionized formamide, 10 mmol/L EDTA (pH 8.0), 0.025% xylene cyanole FF and 0.025% bromophenol blue), heatdenatured for 10 min at 98 C, and then cooled immediately on ice for 10 min. The denatured DNA was separated by 12% nondenaturing polyacrylamide gel under the electrophoresis conditions of 250 V for 10 min, 150 V for 16 h. SSCP patterns on the gel were visualized by silver staining. The PCR products which showed polymorphism on the gel were sequenced by Invitrogen Corp (Shanghai, China). 2.9. Statistical analysis
2.7. Superoxide anion detection Superoxide anion was quantified by the method of Muñoz et al. and Ji et al. [23,24]. Briefly, PCK cells (large yellow croaker kidney cell strain) were cultured in a 96-well microtiter plate (Corning, costar 3599) with 1 ng and 10 ng recombinant LcIL-8. One ng and 10 ng BSA in the same buffer were used as control. The mediums were then eliminated and replaced by 100 ml of CM solution (2.63% NaCl, 0.042% KCl, 0.006% NaH2PO4$2H2O, 0.32% MgSO4$7H2O, 0.074% CaCl2$2H2O, 0.03% L-Glutamine pH 7.45). Then, 50 ml of 0.3% NBT working solution in the appropriate medium were immediately distributed to the wells. Following a 2-h-incubation, the supernatants were removed and the cells were fixed by the addition of 200 ml absolute methanol, washed twice with 70% methanol, then dried.
A multiple comparison (Tukey) test was performed to examine the significant differences among treatments using the SPSS 15.0 (SPSS, Chicago, IL, USA). For statistically significant differences, it was required that p < 0.05. One-way ANOVA was analyzed and the results were plotted to figures by Origin 8.0 software (Origin Lab Corporation, MS, USA). 3. Results 3.1. Characterization of the full-length cDNA of LcIL-8 BLASTX search indicated that a 372-bp cDNA fragment from our EST database had 61% identity with the IL-8 of European
C. Li, C.-L. Yao / Fish & Shellfish Immunology 34 (2013) 799e809
seabass (Dicentrarchus labrax). Then, by 30 RACE PCR, a fragment of 688-bp was obtained. Subsequently, 50 RACE PCR was carried out, and a 255-bp fragment was obtained, which contained an initial start codon for Met. As a result, a 931-bp nucleotide sequence representing the full-length cDNA of LcIL-8 was obtained by cluster analysis of the above fragments. BLASTX analysis suggested that LcIL-8 had high homology to other fish IL-8. The full-length cDNA sequence of LcIL-8 was deposited to GenBank (with accession number of JQ407041) which contained an ORF of 285 bp encoding a polypeptide of 94 amino acids residues, a 50 -UTR of 118 bp, and a 30 -UTR of 528 bp. In the 30 -UTR, there was an RNA instability motif (ATTTA), a 22-bp poly (A) tail and a canonical polyadenylation signal (ATTAAA) which located at the 19 bp upstream of the poly (A) tail (Fig. 2). 3.2. The structure of the LcIL-8 gene and sequence analysis Prediction of protein domains by SMART program revealed that LcIL-8 consisted of a signal peptide in the first 20 amino acids at the N-terminal and an SCY domain at the positions 27e88 (Fig. 2). The putative molecular weight (Mw) of LcIL-8 is 10.524 kDa, and the calculated Mw of deduced LcIL-8 mature peptide was 8.438 kDa and the isoelectric point was 9.80. The genome sequence of LcIL-8 was 1930 bp (JQ407042), including four exons and three introns (Fig. 3).
803
3.3. Multiple analysis and phylogenetic analysis of LcIL-8 Comparison of the LcIL-8 amino acid sequence with IL-8 from other species using the BLAST program indicated that LcIL-8 showed high homology to other IL-8 molecules (Table 2). Multiple alignments indicated that the four conservative cysteine residues were identified at nt 30, 32, 56, and 73 in LcIL-8 conforming to the CXC pattern, and a Leu-Leu-Arg (LLR) motif was predicted in SCY domain (Fig. 4). To assess the evolutionary relations among vertebrate IL-8 genes, phylogenetic tree was conducted using the NJ (Neighbor-Joining) method. The results revealed that the deduced amino acid sequence of the LcIL-8 was in the same subgroup with the IL-8 from other teleost and the closest relationship with IL-8 from tilapia (Oreochromis niloticus). IL-8 deduced protein sequences from amphibians, reptiles, birds and mammals were also used in this analysis and were clustered to their corresponding subgroups. The observed relationships within this cluster reflected the taxonomic positions of the species (Fig. 5). 3.4. Expression of LcIL-8 mRNA in tissues The tissue expression of LcIL-8 gene was examined in twelve tissues, including the kidney, head-kidney, intestine, spleen, liver, gill, brain, skin, muscle, heart, stomach and blood cells, from six healthy fish using qRT-PCR. The LcIL-8 transcripts were broadly expressed in all the detected tissues with the most predominant
Fig. 2. Nucleotide and deduced amino acid sequence of LcIL-8 cDNA. The start codon (ATG) and the stop codon (TGA) are bold. The polyadenylation signal motif (AATAAA) and the motif associated with mRNA instability (ATTTA) are bold italic. In the deduced amino acid sequence, signal peptide is marked by underline (1e20 aa). The SCY domain is shaded (27e88 aa). The LLR motif is shaded and underlined. The CXC motif and other two conserved cysteine residues are boxed.
804
C. Li, C.-L. Yao / Fish & Shellfish Immunology 34 (2013) 799e809
expression was found at 3 h (p < 0.05) and then a gradual recover from 6 to 12 h. However, it began to increase again from 24 h and reached the peak value at 48 h with 3.1-fold higher than that of control group (p < 0.05) and the significant high expression maintained to 72 h (p < 0.05). LcIL-8 transcripts in liver after immuno-stimulation are shown in Fig. 7C. The levels of LcIL-8 expression decreased significantly after all the three stimulations (p < 0.05). In the control, LcIL-8 also showed significant decrease after PBS injection. 3.6. Production and purification of recombinant LcIL-8 Recombinant LcIL-8 was produced in E. coli cells after cloning into the pGEX-4T-2 expression vector. Recombinant LcIL-8 was seen in the bacterial lysates after IPTG induction. Glutathione Sepharose 4B affinity chromatography and ToxinEraserÔ column were subsequently used to purify the recombinant protein. The size of purified GST-LcIL-8 was about 34 kDa and LcIL-8 was approximately 8 kDa. The expression and purification of LcIL-8 were detected by SDS-PAGE and Western blot (Fig. 8). The superoxide anion production in PCK cells increased significantly after 1 ng and 10 ng recombinant LcIL-8 stimulation (p < 0.05). However, the superoxide anion production in the control group did not show significant variation post-stimulation. No significant differences between 1 ng and 10 ng BSA stimulation group, therefore only the result of 10 ng BSA stimulation group was shown in Fig. 9. Fig. 3. Diagrammatic comparison of IL-8 gene from large yellow croaker, rainbow trout, fugu, Atlantic cod, channel catfish, chicken and human. Exons are represented by black boxes and lines represent introns; exon lengths are shown on the top of each figure and intron lengths are on the bottom.
expression in liver, followed by heart and skin. Expression of LcIL-8 in spleen of normal un-stimulated fish was very weak (Fig. 6). 3.5. Expression profiles of LcIL-8 mRNA after LPS, poly I:C and V. parahaemolyticus injection Transcriptional changing of LcIL-8 after immuno-stimulation in spleen is shown in Fig. 7A. LcIL-8 gene expression was up-regulated after challenge with LPS, poly I:C or V. parahaemolyticus. After injection with LPS, LcIL-8 expression level showed significant increase at 6 h and 72 h post-injection (p < 0.05) with the peak value of 6.0-fold higher than that of the control group at 6 h. After injection with poly I:C, LcIL-8 expression levels showed significant increase at 3 h and 6 h post-injection (p < 0.05) with the peak value of 2.8-fold higher than that of the control group at 3 h and then it recovered to that of the control level from 12 h to 72 h. In addition, LcIL-8 transcripts increased gradually from 3 h to 12 h after injection with V. parahaemolyticus with significant high expression at 12 h (p < 0.05). Then it returned to that of the control level from 24 to 72 h. The levels LcIL-8 expression did not show significant change after injection with PBS. Expression profiles of LcIL-8 in head-kidney after LPS, poly I:C or V. parahaemolyticus stimulation are shown in Fig. 7B. After LPS injection, LcIL-8 transcripts increased significantly at 6 h with the value of 3.8-fold higher than that of the control group (p < 0.05) and it recovered to that of the control level at 12 h. After poly I:C stimulation, LcIL-8 transcripts showed significant (p < 0.05) up-regulation from 12 h to 24 h with the value of 2.9- and 2.1-fold greater than that of the control group, respectively; then, it returned to that of the control level. After V. parahaemolyticus injection, four different phases could be distinguished from the expression profiles of LcIL-8: significant increase of LcIL-8
3.7. SSCP analysis The PCR-SSCP method was applied to detect part of the genomic sequence polymorphism of LcIL-8 gene. The PCR productions of primers IL-8 SF and IL-8 SR were denatured, and the polymorphism was found using polyacrylamide gel electrophoresis (Fig. 10a). Five mutations were identified in the genomic sequence 129e436 bp. Among them, four are in the intron 1 (C229T, 247T248 insertion or deletion, T289A, 322A323 insertion or deletion) and the last one in exon 2 (A352G), which did not lead to amino acid change (Fig. 10b). 4. Discussion In the present study, LcIL-8 was cloned and characterized from large yellow croaker. The full-length cDNA of LcIL-8 was 931 bp, including an ORF of 285 bp encoding a polypeptide of 94 amino acids. In the deduced amino acid sequence, four conservative cysteine residues were identified at position 30, 32, 56, and 73, which were typical structure in CXC chemokines. And a single glutamine residue (Gln32) separated the first two cysteine residues near the N-terminal. These characters are in correspondence with the CXC chemokines subfamily from other species [2]. Using SMART program, the first 20 N-terminal amino acids were predicted as a signal peptide and an SCY domain were found in LcIL-8, suggesting that LcIL-8 might be a secreted cytokine, similar structure was identified in other secreted chemokines [25,26]. Generally, a typical feature of the mammalian and birds CXC subfamily is the ELR motif which plays an important role in attracting neutrophils and angiogenic [3,27]. LcIL-8, like most bony fish such as lamprey, rainbow trout and flounder, doesn’t possess the ELR motif, which is found in the CXC chemokines attracting neutrophils via CXC-R1 or CXC-R2 [28]. However, an LLR motif was found in LcIL-8 instead. Interestingly, most bony fish IL-8 genes are lack the ELR motif which is replaced by a DLR [25], ELH [29] or other motifs (Fig. 4). It was demonstrated that a single amino acid mutation in ELR, for example ELR to DLR as present in the rainbow trout IL-8 molecule, resulted to a 100-fold decrease in biological activity [25,30]. However, the recombinant
C. Li, C.-L. Yao / Fish & Shellfish Immunology 34 (2013) 799e809
805
Fig. 4. Multiple alignments of LcIL-8 with other known IL-8 amino acids sequences, residues aligned by the CLUSTAL W program. Identical and similar sites were shown with sparks (*) and dots (. or ), respectively. The ELR motif, CXC motif and other two conserved cysteine residues are boxed, respectively. GenBank accession numbers of these genes are listed in Table 2.
IL-8 homolog of black sea bream (Acanthopagrus schlegelii) showed no significant difference in the induction of chemotaxis of fish blood neutrophils compared with the ELR mutant [31]. Therefore, the function of the LLR motif of LcIL-8 requires further study.
In the 30 UTR, only one RNA instability motifs (ATTTA) was found in LcIL-8. However, seven ATTTA motifs were identified in rainbow trout IL-8 [25] and five instability motifs were found in flounder IL-8 [9]. It was reported that five or six copies of the motif are
806
C. Li, C.-L. Yao / Fish & Shellfish Immunology 34 (2013) 799e809
Fig. 5. Phylogenetic tree of IL-8 sequence. Complete amino acids sequences were aligned by using CLUSTAL W, and the tree was constructed with NJ method in MEGA 4.1 and a bootstrap analysis was performed using 1000 replicates to test the relative support for particular clades. GenBank accession numbers of these genes are listed in Table 2.
required to destabilize an mRNA [32], suggesting that LcIL-8 mRNA might be more stable than that of other fish species. Four exons were identified from LcIL-8 genomic sequences, similar with the IL-8 gene structure from other fish, bird and human, suggesting that genomic organization of LcIL-8 gene was very conservative (Fig. 3). Phylogenetic analysis showed that LcIL-8
Fig. 6. Relative expression of LcIL-8 in different tissues of large yellow croaker, include spleen, brain, intestine, head-kidney, gill, stomach, kidney, blood, muscle, skin, heart and liver, respectively (n ¼ 6).
was grouped together with the IL-8 from other teleost, while IL-8 from the amphibians, reptiles, birds, mammals are clustered into the same subgroup, and the result is in line with the traditional classification (Fig. 5). LcIL-8 transcripts were broadly expressed in all the examined tissues of large yellow croaker. The greatest expression was found in liver, followed by heart and skin while the weakest expression was found in the spleen and brain (Fig. 6). According to the reported researches, IL-8 specific expression levels in different fishes are not highly consistent. In large yellow croaker, the highest-level expression was detected in liver, which was similar to that of the half-smooth tongue sole (Cynoglossus semilaevis) [11], conversely, the expression of IL-8 in spleen was very weak, which was different from other fish IL-8 [11,29]. Interesting, the transcripts of immunerelated gene Toll-like receptor3 [33] was also very low in spleen in normal un-stimulated large yellow croaker, as compared with other fish species, the difference might be due to the different fish species or different physiological status. It is well known that IL-8 plays important roles in inflammatory responses [34]. From previous studies, it is known that several bony fish IL-8 are up-regulated at transcription level by bacterial or LPS challenge [35,36]. In our study, the temporal expression profiles of LcIL-8 after LPS, poly I:C and V. parahaemolyticus injection were investigated in spleen, head-kidney and liver. Our results revealed that LcIL-8 expression levels were up-regulated in spleen and headkidney while down-regulated in liver after the three immunostimulations. In spleen, the peak value of LcIL-8 expression appeared at 6 h post-LPS-injection, with 6.0-fold higher than that of the control group (p < 0.05), similar to the results in Japanese sea perch (Lateolabrax japonicus) with the peak value 9.1-fold higher
C. Li, C.-L. Yao / Fish & Shellfish Immunology 34 (2013) 799e809
807
Fig. 8. The production and purification of recombinant LcIL-8 in E. coli. (a) Lane 1, pGEX-4T-2 vector containing GST gene without IPTG induction, lane 2, pGEX-4T-2-GST after IPTG induction. Lane 3, pGEX-4T-2 vector containing LcIL-8 gene without IPTG induction, lane 4. pGEX-4T-2 vector containing LcIL-8 gene after IPTG induction, lane 5, purified recombinant GST-LcIL-8, lane 6: Molecular standard. (Gel concentration: 12% SDS-PAGE). (b) Identification of recombinant LcIL-8 protein by Western blot (anti-GST was used as the primary antibody). Lane 1, pGEX-4T-2 vector containing GST gene without IPTG induction, lane 2, pGEX-4T-2-GST after IPTG induction. Lane 3, pGEX-4T2 vector containing LcIL-8 gene without IPTG induction, lane 4. pGEX-4T-2 vector containing LcIL-8 gene after IPTG induction, lane 5. purified recombinant GST-LcIL-8.
was also found after Vibrio injection, corresponding to the results in channel catfish [9] and haddock [38], which showed that IL-8 expression increased significantly after bacteria injection. IL-8 in spleen could be induced by both virus and bacteria stimulation, suggesting that IL-8 might play an important role in spleen by inducing some immune cell migration or activating immune
Fig. 7. Analysis of LcIL-8 expression in spleen (A), head-kidney (B) and liver (C) of the LPS, poly I:C and V. parahaemolyticus challenged group and the control group by realtime RT-PCR at 0, 3, 6, 12, 24, 48, 72 h post-injection. Data (mean SE, n ¼ 6) within the same post-injection time with different letters (a, b, c) are significantly different (p < 0.05) among the treatments.
than the control at 6 h [29]. In the same organ, LcIL-8 expression levels showed significant increase after injection with poly I:C. Similar to the results in rainbow trout that showed the peak value (3.6-fold) of IL-8 transcripts appeared at the first day during the detected 28 days [37]. Significant up-regulation of LcIL-8 transcripts
Fig. 9. Changes of superoxide anion production in PCK cells after stimulation with PBS (control), 1 ng and 10 ng recombinant LcIL-8. The samples were collected at 12 h after stimulation. Ten ng BSA in the same buffer were used as control. Data are expressed as mean SE of three replications. Bars with asterisk are significantly difference (p < 0.05) compare to control group.
808
C. Li, C.-L. Yao / Fish & Shellfish Immunology 34 (2013) 799e809
Fig. 10. SNP sites identification in LcIL-8 gene. (a) SSCP detection of PCR amplification using primers IL-8 SF and IL-8 SR from 20 fishes. Line 1e7, 7 fish of Dai-ju stock from Zhoushan, Zhejiang province; line 8e14, 7 fish of min-yue stock from Ningde, Fujian Province; 15-20, 6 fishes from hybrids cultured in Ningde, Fujian province. (b) Sequence of PCR amplification using primers IL-8 SF and IL-8 SR from 20 fishes for SSCP analysis. Five mutations were identified from the 20 fishes in the genomic sequence 129e436 bp, which were represented in bold letters, underlined, and dark gray. They were: C229T, 247T248 insertion or deletion (), T289A, 322A323 insertion or deletion () and A352G, which did not lead to amino acid change.
response. In head-kidney, the expression levels of LcIL-8 transcripts significantly increased after LPS stimulation, which were in contrast to the result of haddock [38]. In the same organ, LcIL-8 transcripts significantly up-regulated post-poly I:C-injection, similarly to what observed in Atlantic cod [35]. In addition, significant increases of LcIL-8 transcripts were found after V. parahaemolyticus injection, analogously to what reported in haddock [38] and halfsmooth tongue sole [10] after V. parahaemolyticus injection. Fish IL-8 was demonstrated to induce the stimulated migration of neutrophils, macrophages, head-kidney leukocytes, neutrophils, and peripheral blood leukocytes [10e12]. Our results suggested that IL-8 might play a crucial role in head-kidney of large yellow croaker by attracting some immune cells. However, LcIL-8 response was slower in head-kidney than that in spleen, suggesting that IL-8 related immune response in spleen could be induced faster than that in head-kidney. The level of LcIL-8 expression significantly decreased in liver after all the three stimulations and PBS mock injection, suggesting that IL-8 transcripts in liver could be inhibited in a transient systemic immune response to the stimulation inflicted by penetration of the needle and injection of heterogeneous substance [17,33]. In the present study, we also produced the recombinant IL-8 protein and demonstrated that the recombinant LcIL-8 could initiate superoxide anion production in PCK cells. Some previous studies indicated that the biological function of IL-8 was to promote recruitment and activation of neutrophils to areas of acute inflammation and induction of active oxygen reaction in neutrophils [1,4]. Similarly, the recombinant trout IL-8 induced the migration of head-kidney leukocytes, activated the respiratory burst in vitro and mainly attracted leukocytes into the peritoneal cavity in vivo of trout [12]. Our results showed that recombinant LcIL-8 could induce the production of superoxide anion in PCK cells. Superoxide anion production is produced during the respiratory burst of phagocytes and an indicator can be induced by a variety of phagocyte activation, which could be activated by a number of agents [24,39]. The increased superoxide agents might prime the cells for enhancing killing ability. Our results suggested that recombinant LcIL-8 might change the cell immune response ability by stimulation of active oxygen release.
Until to the present study, several SNPs have been identified in IL-8 that showed a close correlation with disease resistance in human [40]. Here, five SNPs were identified in the intron 1 and exon 2 region of LcIL-8 gene. There is no report for the synonymous mutation (A352G) at this position from previous studies on SNP detection in the fish IL-8 gene. These SNPs need further investigation in larger samples and large yellow croaker disease-resistant breeds to evaluate it potential application for disease-resistant traits. In conclusion, the putative protein and genomic structure of IL-8 were obtained from large yellow croaker. LcIL-8 transcripts were broadly expressed in all examined tissues with the highest expression in liver and the lowest level in spleen. The expression of LcIL-8 is induced in spleen and head-kidney and inhibited in liver after LPS, poly I:C, and V. parahaemolyticus injection. The recombinant LcIL-8 can increase the production of superoxide anion in PCK cells. In addition, five SNPs of LcIL-8 have been identified, which provide a potential application for anti-disease traits. Overall, these results indicate that LcIL-8 transcripts expression played an important role in fish immune response. Acknowledgments This research was supported by “973 Program” (2011CB111604) and NSFC (31101882) to C.L.Y. References [1] Baggiolini M, Imboden P, Detmers P. Neutrophil activation and the effects of interleukin-8/neutrophil-activating peptide 1 (IL-8/NAP-1). Cytokines 1992;4: 1e17. [2] Laing KJ, Secombes CJ. Chemokines. Dev Comp Immunol 2004;28(5):443e60. [3] Wuyts A, Proost P, Van Damme J. Interleukin-8 and other CXC chemokines. In: Thomson A, editor. The cytokine handbook. 3rd ed. London: Academic Press; 1998. p. 271e311. [4] Mukaida N, Harada A, Matsushima K. Interleukin-8 (IL-8) and monocyte chemotactic and activating factor (MCAF/MCP-1), chemokines essentially involved in inflammatory and immune reactions. Cytokine Growth Factor Rev 1998;9:9e23. [5] Goodman RB, Forstrom J, Osborn S, Chi E, Martin T. Identification of two neutrophil chemotactic peptides produced by porcine alveolar macrophages. J Biol Chem 1991;266:8455e63. [6] Gregory H, Young J, Schröder JM, Mrowietz U, Christophers E. Structure determination of a human lymphocyte derived neutrophil activating peptide (LYNAP). Biochem Biophys Res Commun 1988;151:883e90. [7] Nakamura H, Yoshimura K, Jaffe HA, Crystal R. Interleukin-8 gene expression in human bronchial epithelial cells. J Biol Chem 1991;266:19611e7. [8] Lee EY, Park HH, Kim Y, Chung JK, Choi TJ. Cloning and sequence analysis of the interleukin-8 gene from flounder (Paralichthys olivaceous). Gene 2001; 274:237e43. [9] Chen L, He C, Baoprasertkul P, Xu P, Li P, Serapion J, et al. Analysis of a catfish gene resembling interleukin-8: cDNA cloning, gene structure, and expression after infection with Edwardsiella ictaluri. Dev Comp Immunol 2005;29:135e42. [10] Sun JS, Zhao L, Sun L. Interleukin-8 of Cynoglossus semilaevis is a chemoattractant with immunoregulatory property. Fish Shellfish Immunol 2011;30: 1362e7. [11] Zhonghua C, Chunpin G, Yong Z, Kezhi X, Yaou Z. Cloning and bioactivity analysis of a CXC ligand in black seabream Acanthopagrus schlegelii: the evolutionary clues of ELRþCXC chemokines. BMC Immunol 2008;9:66. [12] Harun NO, Zou J, Zhang YA, Nie P, Secombes CJ. The biological effects of rainbow trout (Oncorhynchus mykiss) recombinant interleukin-8. Dev Comp Immunol 2008;32(6):673e81. [13] Andia DC, de Oliveira NFP, Letra AM, Nociti Jr FH, Line SRP, de Souza AP. Interleukin-8 gene promoter polymorphism (rs4073) may contribute to chronic periodontitis. J Periodontol 2011;82:893e9. [14] Angels N, Gaia L, Martin H, Kirk R, Hassan J, David M, et al. Innate immunity in ocular Chlamydia trachomatis infection: contribution of IL8 and CSF2 gene variants to risk of trachomatous scarring in Gambians. BMC Med Genet 10, 138. [15] Gu L, Jia H, Zhao Y, Liu N, Wang S, Cui B, et al. Association studies of interleukin-8 gene in Graves’ disease and Graves’ ophthalmopathy. Endocrine 2009;36:452e6. [16] Wang Z, Wang Y, Lin L, Khoo S, Okamoto N. Genetic polymorphisms in wild and cultured large yellow croaker Pseudosciaena crocea using AFLP fingerprinting. JFSC 2002;9:198e202.
C. Li, C.-L. Yao / Fish & Shellfish Immunology 34 (2013) 799e809 [17] Yao CL, Kong P, Wang ZY, Ji PF, Cai MY, Liu XD, et al. Cloning and expression analysis of two alternative splicing toll-like receptor 9 isoforms A and B in large yellow croaker, Pseudosciaena crocea. Fish Shellfish Immunol 2008;25: 648e56. [18] Yao CL, Kong P, Wang ZY, Ji PF, Liu XD, Cai MY, et al. Molecular cloning and expression of MyD88 in large yellow croaker, Pseudosciaena crocea. Fish Shellfish Immunol 2009;26:249e55. [19] Li S, Ao J, Chen X. Molecular and functional characterization of a cystatin analogue in large yellow croaker (Pseudosciaena crocea). Mol Immunol 2009; 46:1638e46. [20] Zhou L, Wang X, Liu Q, Wang Q, Zhao Y, Zhang Y. A novel multivalent vaccine based on secretary antigen-delivery induces protective immunity against Vibrio anguillarum and Aeromonas hydrophila. J Biotechnol 2010;146:25e30. [21] Letunic I, Copley RR, Pils B, Pinkert S, Schultz J, Bork P. SMART 5: domains in the context of genomes and networks. Nucleic Acids Res 2006;34(Database issue):D257e60. [22] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2-[Delta][Delta] CT method. Methods 2001;25:402e8. [23] Muñoz M, Cedeño R, Rodriguez J, van der Knaap WPW, Mialhe E, Bachère E. Measurement of reactive oxygen intermediate production in haemocyte of the penaeid shrimp (Penaeus vannamei). Aquaculture 2000;191:89e107. [24] Ji P, Yao CL, Wang ZY. Immune response and gene expression in shrimp (Litopenaeus vannamei) hemocytes and hepatopancreas against some pathogen-associated molecular patterns. Fish Shellfish Immunol 2009;27: 563e70. [25] Laing KJ, Zou JJ, Wang T, Bols N, Hirono I, Aoki T, et al. Identification and analysis of an interleukin 8-like molecule in rainbow trout Oncorhynchus mykiss. Dev Comp Immunol 2002;26:433e44. [26] Vaddi K, Keller M, Newton RC. The chemokine factsbook. London: Academic Press; 1997. [27] Strieter RM, Polverini PJ, Kunkel SL, Arenberg DA, Burdick MD, Kasper J, et al. The functional role of the ELR motif in CXC chemokine-mediated angiogenesis. J Biol Chem 1995;270:27348e57. [28] Bizzarri C, Beccari AR, Bertini R, Cavicchia MR, Giorgini S, Allegretti M. ELRþ CXC chemokines and their receptors (CXC chemokine receptor 1 and CXC
[29]
[30]
[31] [32] [33]
[34] [35]
[36]
[37]
[38]
[39] [40]
809
chemokine receptor 2) as new therapeutic targets. Pharmacol Ther 2006;112: 139e49. Qiu L, Zhang H, Yang K, Jiang S. Molecular cloning and mRNA expression analysis of interleukin-8 gene in Japanese sea perch (Lateolabrax japonicus). Mol Biol Rep 2009;36:1099e105. Hebert CA, Vitangcol R, Baker JB. Scanning mutagenesis of interleukin-8 identifies a cluster of residues required for receptor binding. J Biol Chem 1991;266:18989e94. Cai Z, Gao C, Zhang Y, Xing K. Functional characterization of the ELR motif in piscine ELRþCXC-like chemokine. Mar Biotechnol 2009;11:505e12. Clark AR, Dean JLE, Saklatvala J. Post-transcriptional regulation of gene expression by mitogen-activated protein kinase p38. FEBS Lett 2003;546:37e44. Huang XN, Wang ZY, Yao CL. Characterization of Toll-like receptor 3 gene in large yellow croaker, Pseudosciaena crocea. Fish Shellfish Immunol 2011;31: 98e106. Magnadóttir B. Innate immunity of fish (overview). Fish Shellfish Immunol 2006;20:137e51. Seppola M, Larsen AN, Steiro K, Robertsen B, Jensen I. Characterisation and expression analysis of the interleukin genes, IL-1 [beta], IL-8 and IL-10, in Atlantic cod (Gadus morhua L. Mol Immunol 2008;45:887e97. Sigh J, Lindenstrom T, Buchmann K. Expression of pro-inflammatory cytokines in rainbow trout (Oncorhynchus mykiss) during an infection with Ichthyophthirius multifiliis. Fish Shellfish Immunol 2004;17:75e86. Purcell MK, Kurath G, Garver KA, Herwig RP, Winton JR. Quantitative expression profiling of immune response genes in rainbow trout following infectious haematopoietic necrosis virus (IHNV) infection or DNA vaccination. Fish Shellfish Immunol 2004;17:447e62. Corripio-Miyar Y, Bird S, Tsamopoulos K, Secombe CJ. Cloning and expression analysis of two pro-inflammatory cytokines, IL-1 beta and IL-8, in haddock (Melanogrammus aeglefinus). Mol Immunol 2007;44:1361e73. Secombes CJ, Fletcher TC. The role of phagocytes in the protective mechanisms of fish. Ann Rev Fish Dis 1992;2:53e71. Heinzmann A, Ahlert I, Kurz T, Berner R, Deichmann KA. Association study suggests opposite effects of polymorphisms within IL8 on bronchial asthma and respiratory syncytial virus bronchiolitis. J Allergy Clin Immunol 2004;114: 671e6.
Contents lists available at SciVerse ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Molecular and expression characterizations of interleukin-8 gene in large yellow croaker (Larimichthys crocea) Chan Li, Cui-Luan Yao* Key Laboratory of Healthy Mariculture for the East China Sea, Ministry of Agriculture, Fisheries College, Jimei University, Xiamen 361021, PR China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 18 October 2012 Received in revised form 21 November 2012 Accepted 11 December 2012 Available online 18 January 2013
IL-8 plays a crucial role in acute inflammation by recruiting and mediating neutrophils and other cells and in initiating the oxidative burst in neutrophils and inducing wound healing by promoting angiogenesis. In the present study, the full-length cDNA and genome sequence of interleukin-8 (LcIL-8) were cloned from large yellow croaker Larimichthys crocea. The LcIL-8 cDNA sequence was 931 bp, containing a 118-bp 50 -untranslated region (UTR), a 528-bp 30 -UTR and a 285-bp open reading frame (ORF) which encoded 94 amino acids. A putative signal peptide including 20 amino acid residues was found at N-terminal in LcIL-8 protein. And a small cytokine (SCY) domain showing a typical CXC chemokine gene organization was predicted in LcIL-8. The genome sequence of LcIL-8 gene was composed of 1930 nucleotides, including four exons and three introns. Quantitative real-time PCR analysis indicated a broad expression of LcIL-8 in most detected tissues, with the most predominant expression in liver. After injection with LPS, Vibrio parahaemolyticus and poly I:C, LcIL-8 expression levels showed up-regulation in head-kidney and spleen. The peak value was in the spleen with 6 times (at 6 h) greater expression than in the control after LPS injection (p < 0.05). However, LcIL-8 transcripts showed down-regulation in the liver after all the three stimulants injection. Recombinant LcIL-8 mature peptide was produced by Escherichia coli, which enhanced the production of superoxide anion in PCK cells. In addition, 5 singlenucleotide polymorphisms (SNPs) were identified in LcIL-8 gene. The results suggested that LcIL-8 might play an important role in fish’s immune response, and the SNPs might be used as potential candidate molecular markers for selection for disease-resistant large yellow croaker. Ó 2013 Elsevier Ltd. All rights reserved.
Keywords: Larimichthys crocea IL-8 Characterization Expression SNPs
1. Introduction Chemokines are a group of structurally related, low molecular weight (8e12 kDa) cytokines that are able to attract and activate specific types of leucocytes to the site of inflammation or injury [1,2]. Based on the arrangement of the first two cysteine residues, chemokines have been classified into four subfamilies: CXC, CC, C and CX3C [3]. IL-8, also called CXCL8, as the first known chemokine, is a prototypical one in the CXC chemokine subfamily [2,3]. IL-8 affects multiple target cells and is produced by a variety of cells, including peripheral blood mononuclear cell [4], macrophages [5], lymphocytes [6], and epithelial cells [7]. IL-8 plays a crucial role in acute inflammation by recruiting and mediating neutrophils and other cells [1]. In addition, IL-8 also plays a pivotal role in initiating the oxidative burst in neutrophils and inducing wound healing by promoting angiogenesis [4]. Up to now, IL-8 has been obtained from many different species. In fish, * Corresponding author. Tel.: þ86 592 6182669; fax: þ86 592 6181476. E-mail address: [email protected] (C.-L. Yao). 1050-4648/$ e see front matter Ó 2013 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.fsi.2012.12.019
it was demonstrated that IL-8 transcripts increased significantly after LPS [8] poly I:C injection [2] or after infected with pathogenic bacteria [9,10], which indicated that IL-8 played an important role in fish’s immune response. More important, previous studies demonstrated that recombinant fish IL-8-like protein stimulated migration of fish neutrophils and macrophages [11]. Recombinant fish IL-8 also showed the biological activity of inducing the migration of headkidney leukocytes, eliciting neutrophils, peripheral blood leukocytes and initiate superoxide production [10,12]. Single nucleotide polymorphisms (SNPs) are one of the most common types of genetic variation and some SNPs in important genes are found to be involved in the etiology of many human diseases and are becoming of particular interest in pharmacogenetics. Some SNPs in IL-8 were associated with disease susceptibility in human [13e15]. However, SNP sites in fish IL-8 gene are still unknown. Large yellow croaker, Larimichthys crocea, is the most cultured marine fish species in China [16]. It distributes mainly from the south of Yellow Sea to the north of South China Sea (Fig. 1). It is well known that there are two main populations of L. crocea including
800
C. Li, C.-L. Yao / Fish & Shellfish Immunology 34 (2013) 799e809
Dai-ju stock and Min-yue stock, which mainly distribute North of Zhejiang Province (30 070 -30 38’N, 121310 -12317’E) and East of Fujian Province (26180 -27400 N, 118 320 -120 44’E) respectively, and more than eighty percent production of mari-cultured large yellow croaker is in the East of Fujian Province. In recent years, cultured large yellow croaker has suffered from severe natural resources exhaustion and serious disease caused by viral, bacterial and parasitic infections, which results in huge economic loss in its culture industry [17e20]. Until now, more than 30 different pathogens have been identified from large yellow croaker. However, Dai-ju stock is insensitive to many pathogens affecting the Min-yue stock. Therefore, many researchers are interested in the candidate disease-resistance SNPs in some important genes between the two stocks. Here, we reported the characterization of putative protein and genomic structure of IL-8 from large yellow croaker. The tissuespecific expression and temporal expression profiles of the gene after stimulation with LPS, poly I:C and one of the main fish pathogens, Vibrio parahaemolyticus, were examined and compared in order to better understand their potential roles in fish immune responses. The recombinant large yellow croaker IL-8 was produced in Escherichia coli. In addition, some SNPs in LcIL-
8 had been identified by polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) and sequencing.
2. Materials and methods 2.1. Fish collection and immune challenge Healthy juvenile large yellow croaker (fish length 16.6 1.5 cm, weighing 80.7 22.2 g) were collected at the Experimental Fish Farm of Ningde Centre of Popularization of Fisheries Technology, Fujian province, China. Before the experiments, fish was acclimated for at least 1 week in 4 m3 tanks in salinity (25e26 psu), temperature (16e 18 C) and density conditions similar to those of the culture net cages from which the specimens were obtained. Blood was collected from eugenol-anaesthetized fish by cutting the tail, blood was diluted 1:2 in anticoagulant solution (0.48% citric acid, 1.32% sodium citrate and 1.47% glucose) and blood cells were separated by centrifugation at 800 g for 5 min at 4 C and were stored in RNA fixer (Bioteke, Beijing). Head-kidney, kidney, intestine, spleen, liver, gill, skin, brain, heart, muscle, and stomach were dissected out from normal un-stimulated fish and preserved in RNA fixer for RNA extraction.
Fig. 1. Maps for sampling localities of the large yellow croaker used in this study. 7 Dai-ju stock from Zhoushan, Zhejiang province, 30 170 N, 122 100 E; 7 Min-yue stock from Ningde, Fujian province 26 300 N, 119 360 E; and 6 hybrids cultured in Ningde, Fujian province 2740 N, 120 440 E.
C. Li, C.-L. Yao / Fish & Shellfish Immunology 34 (2013) 799e809
Fish immune stimulation was performed by intraperitoneal injection of 250 ml poly I:C (27472901, GE, 1 mg/mL) in phosphate buffered saline (PBS, pH 7.4), 250 ml LPS (L2880, Sigma, 1 mg/mL) in PBS or 250 ml suspension formalin-inactivated Gram-negative bacteria V. parahaemolyticus (108 cfu/mL) in PBS, respectively. Fish injected with 250 ml PBS were used as controls (Huang et al., 2011). Six fish were used for each group. Spleen, head-kidney and liver of each group were collected at 3, 6, 12, 24, 48 and 72 h after injection and preserved for real-time reverse transcript polymerase chain reaction (RT-PCR). 2.2. RNA extraction and cDNA synthesis Total RNA was isolated from the tissues of the fishes using Trizol reagent (Invitrogen, China) following the protocol of the manufacturer. Total RNA was incubated with RNase-free DNase (Promega, China) to remove any contaminating genomic DNA. First strand cDNA was synthesized from total RNA by M-MLV reverse transcriptase (Fermentas, China), following the manufacturer’s protocol with Oligo (dT)18 primer. 2.3. Cloning and sequencing of LcIL-8 cDNA and genomic DNA The 30 and 50 ends were obtained by rapid amplification of cDNA ends (RACE) approaches, using gene-specific primers that were designed based on the partial large yellow croaker EST sequence and adapter primers (Table 1). The 30 end RACE PCR was performed with liver cDNA template using the gene-specific primer IL-83F1 and adapter primer AOLP for the first round followed by nested PCR using primers IL-83F2 and adapter primer AP. PCR conditions for the first round were carried out at 94 C for 3 min, 30 cycles of 94 C 30 s, 57 C 30 s and 72 C 1 min, followed by an 8 min postextension at 72 C. For the second round, PCR was performed at the same condition with an annealing temperature of 59 C. The PCR products were gel-purified and ligated into pGEM-T Easy vector (Promega, USA), transformed into the competent E. coli TOP10 cells, and plated on the LB-agar Petri dish. Positive clones containing the expected-size inserts were screened by colony PCR and then sequenced by Invitrogen Corp (Shanghai, China). For the 50 end, the liver mRNA was transcribed by M-MLV reverse transcriptase with Oligo (dT)18 primer. Then the cDNA was purified with a DNA purification kit (TAKARA, China) and tailed with poly (C) at the 50 end by terminal deoxynucleotidyl transferase (TdT) (Fermentas, China). PCR was performed initially with gene-specific Table 1 Primers used for LcIL-8 gene cloning and expression analysis. Primer
Sequence (50 e30 )
Purpose
IL-83F1 IL-83F2 IL-85R1 IL-85R2 AOLP AAP AP IL-8OF1 IL-8OF2 IL-8OR1 IL-8OR2 IL-8QF IL-8QR b-actin-F b-actin-R IL-8 SF IL-8 SR IL-8EF IL-8ER
ATCTCCCAGACTGCTACCCT CCCTCTGCGTTGATACCACT GACATATCCTTCGCCCATCC AGGAATCACCTCCACTTGTC GGCCACGCGTCGACTAGTAC(T)16 GGCCACGCGTCGACTAGTAC(G)10 GGCCACGCGTCGACTAGTAC TGGTATCAACGCAGAGGG TCAGAAATTACTGTCTATTGTACCG TGTGCCAAATCTGGGAAG TAAGCCGTTCCTCCACCT CTATCGTGGCACTCCTGGTT GCAGGAATCACCTCCACTTGT TGAACCCCAAAGCCAACAGG CATACAGGGACAGCACAGCC TTACTATCGTGGCACTCCTG AATCACCTCCACTTGTCCTATGT CGCGGATCCCTGGGAGATCAAACACTGCT-3 CCGGAATTCTCACGGTGCCGGCTGAACCATTT
30 RACE method 50 RACE method General primers for RACE Genomic sequence
mRNA expression
801
primer IL-85R1 and adapter primer AAP using the tailed cDNA as the template, PCR were performed at annealing temperature of 57 C and then a nested PCR was carried out with a gene-specific primer IL-85R2 and adapter primer AP at the same condition. PCR products were gel-purified, cloned, and sequenced as described above. To obtain the genomic sequence of LcIL-8, two primers were designed based on obtained LcIL-8 cDNA sequences. PCR was performed with IL-8OF1 and IL-8OR1 (Table 1) primers at an annealing temperature of 54 C and followed a nested PCR using IL-8OF2 (Table 1) and IL-8OR2 at the same condition and genomic DNA was used as a template for amplification. PCR products were gel-purified, cloned, and sequenced as described. Then the LcIL-8 genomic and cDNA sequences were aligned using bl2seq (http://blast.ncbi.nlm.nih.gov/ Blast.cgi) to verify intron/exon boundaries. 2.4. Amino acid sequence analysis, multiple sequence alignment and phylogenetic tree analysis Sequence homology analysis was performed using BLAST program (http://blast.ncbi.nlm.nih.gov/Blast.cgi). The deduced amino acid sequences were analyzed with the Expert Protein Analysis System (EXPASY) (http://www.expasy.org/) and the protein domain features were predicted by Simple Modular Architecture Reach Tool (SMART) (http://smart.embl-heidelberg.de/) [21]. Multiple alignments of IL-8 amino acid sequences of large yellow croaker with other species (Table 2) were performed using Clustal W (http:// www.ebi.ac.uk/clustalw/) and a phylogenetic tree of IL-8 protein was made by MEGA 4.1 (http://www.megasoftware.net). 2.5. Real-time PCR analysis of LcIL-8 mRNA expression The expression of LcIL-8 mRNA in the different tissues including the kidney, head-kidney, intestine, spleen, liver, gill, brain, skin, muscle, heart, stomach and blood cells, and the temporal expression in the spleen, head-kidney and liver challenged with LPS, poly I:C or V. parahaemolyticus were assessed using qRT-PCR (Real-Time Quantitative Reverse Transcription PCR) in an ABI 7500 Real-time Detection System (Applied Biosystems, USA). The housekeeping gene b-actin was used as an internal control for cDNA normalization. The primers b-actin-F and b-actin-R (Table 1) for b-actin gene were used to amplify a 107-bp fragment and LcIL-8 cDNA was amplified 142-bp fragment using the gene-specific primers IL-8QF and IL-8QR (Table 1). The PCR product was sequenced to verify the specificity of RT-PCR. The amplification was performed in a total volume of 20 ml, containing 10 ml of 2 SYBR Green I real-time PCR Master Mix (TOYOBO, Japan), 1 ml of the diluted cDNA, 0.5 ml of each primer (10 mM), and 8 ml of nuclease-free water. The real-time PCR program was 95 C for 1 min, followed by 40 cycles of 95 C for 15 s, 60 C for 60 s. Dissociation analysis of amplification products was performed at the end of each PCR reaction to confirm that only the special PCR product was amplified and detected. After the PCR program, data were analyzed with ABI 7500 SDS software. To maintain consistency, the baseline was set automatically by the software. The comparative CT method (2DDCT method) was used to analyze the expression level of LcIL-8 [22]. All data were given in terms of relative mRNA expression as means SE. The data obtained from six independent biological replicates were subjected to analysis of t-test. Differences were considered significant at p < 0.05 and supremely significant at p < 0.01. 2.6. Recombinant expression of LcIL-8
SSCP Recombinant expression
The cDNA encoding sequences of the putative mature peptide of LcIL-8 were amplified using gene-specific primers IL-8EF and IL-8ER, with BamHI and EcoRI sites respectively. The obtained
802
C. Li, C.-L. Yao / Fish & Shellfish Immunology 34 (2013) 799e809
Table 2 The IL-8 protein sequences used for multiple alignments and phylogenetic analysis. Species
Common name
Protein
Similarity (%)
Identity (%)
Accession no.
Latris lineata Oreochromis niloticus Dicentrarchus labrax Lateolabrax japonicus Acanthopagrus schlegelii Takifugu rubripes Cynoglossus semilaevis Melanogrammus aeglefinus Cyprinus carpio Salmo salar Gadus morhua Paralichthys olivaceus Xenopus tropicalis Gallus gallus Pelodiscus sinensis Homo sapiens Oryctolagus cuniculus Macaca mulatta
Trumpeter Tilapia European see bass Japanese sea perch Black porgy Fugu rubripes Tongue sole Haddock Common carp Atlantic salmon Atlantic cod Japanese flounder Western clawed frog Chicken Chinese soft-shelled turtle Human Rabbit Rhesus monkey
IL-8 IL-8-like IL-8 Putative IL-8 IL-8 IL-8 precursor IL-8 IL-8 IL-8 IL-8 precursor IL-8 IL-8 IL-8-like IL-8 precursor IL-8 IL-8 IL-8 precursor IL-8 precursor
90 100 88 97 90 92 92 79 97 96 78 90 95 82 82 75 91 75
60 59 60 54 58 52 54 56 47 51 55 49 39 42 44 44 36 43
ACQ99511.1 XP_003452249.1 CAM32186.1 DQ855621.1 AAY18807.1 NP_001027759.1 AEH59114.1 CAD97422.2 ABE47600.1 NP_001134182.1 CAD59734.2 AAL05442.1 XP_002942578.1 NP_990349.1 ACP28489.1 CAA77745.1 NP_001075762 NP_001028137.1
fragment was purified with DNA Purification System (Takara, Dalian) and digested with BamHI/EcoRI. The digested PCR products by the two restriction enzymes were subcloned into a prokaryotic expression vector pGEX-4T-2 (Pharmacia Co.). Sequencing was done to confirm the construction. Then, the recombinant plasmid pGEX-4T-2-IL8 was transformed into the E. coli BL21 (DE3) codon plus. A single bacterial colony was inoculated into 5 ml LB medium containing 50 mg ml1 Ampicillin. Cultures were grown at 37 C with shaking overnight. The overnight culture was transferred into fresh LB medium, incubation was continued until the culture reached an A600 between 0.6 and 0.8, at which point expression was induced by isopropylthiogalactopyranoside (IPTG). The cells were harvested by centrifugation and the cell pellet resuspended in ice-cold lysis buffer (50 mM Tris-Cl, pH 8.0; 200 mM NaCl; 10 mM b-mercaptoethanol; 10% glycerol, 0.1% NP-40, 1 mg/ml leupeptin and 1 mg/ml pepstatin). The recombinant protein was collected by centrifuging the bacterial lysate at 12,500 g for 20 min at 4 C and purified by a Glutathione Sepharose 4B affinity column according to the instructions of the manufacturer (GE Healthcare). The column was washed with elution buffer (50 mM TriseHCl, 10 mM reduced glutathione, 1 mg/ml leupeptin and 1 mg/ml pepstain, pH 8.0). Fractions with the target protein were pooled and purified again using ToxinEraserÔ endotoxin removal resin (Genscript, Nanjing) to get rid of endotoxin and dialyzed against PBS buffer with gradually reduced guanidineeHCl concentration at 4 C. The purity of the expressed protein was verified by 12% SDS-PAGE and Western blot, the monoclonal antibody of GST (EarthOx, USA, E022040) was used as the primary antibody for the detection of the Western blot. The fusion protein was digested with thrombin. The purified protein was saved at 80 C until use.
The deposits were solubilized in 120 ml, 2 M KOH and 140 ml DMSO. After homogenization of the contents in the wells, the extinction was read at 620 nm in a Synergy HT Multi-Detection Microplate Reader. 2.8. Fish collection, PCR amplification and-SSCP analysis In order to identify the SNPs in the LcIL-8 gene, genomic DNA sequences from 20 individuals (7 Dai-ju stock from Zhoushan, Zhejiang Province, 30170 N, 122100 E, 7 Min-yue stock from Ningde, Fujian Province 26 300 N, 119 36’E, and 6 hybrids cultured in Ningde, Fujian Province 2740 N, 120 440 E) were investigated (Fig. 1). Dorsal fin-clip was preserved in 95% alcohol for DNA extraction, prepared for the PCR-SSCP analysis. Genomic DNA was extracted from fin-clip using the standard phenol/chloroform method. PCR was performed with two gene-specific primers IL-8 SF and IL-8 SR (Table 1) and genomic DNA. PCR conditions were carried out at 94 C for 3 min, 30 cycles of 94 C 30 s, 57 C 30 s and 72 C 30 s, followed by an 8 min post-extension at 72 C. The PCR products were used for SSCP analysis to detect the existence of DNA variation. Five ml of each PCR product was mixed with 5 ml of denaturing solution (98% deionized formamide, 10 mmol/L EDTA (pH 8.0), 0.025% xylene cyanole FF and 0.025% bromophenol blue), heatdenatured for 10 min at 98 C, and then cooled immediately on ice for 10 min. The denatured DNA was separated by 12% nondenaturing polyacrylamide gel under the electrophoresis conditions of 250 V for 10 min, 150 V for 16 h. SSCP patterns on the gel were visualized by silver staining. The PCR products which showed polymorphism on the gel were sequenced by Invitrogen Corp (Shanghai, China). 2.9. Statistical analysis
2.7. Superoxide anion detection Superoxide anion was quantified by the method of Muñoz et al. and Ji et al. [23,24]. Briefly, PCK cells (large yellow croaker kidney cell strain) were cultured in a 96-well microtiter plate (Corning, costar 3599) with 1 ng and 10 ng recombinant LcIL-8. One ng and 10 ng BSA in the same buffer were used as control. The mediums were then eliminated and replaced by 100 ml of CM solution (2.63% NaCl, 0.042% KCl, 0.006% NaH2PO4$2H2O, 0.32% MgSO4$7H2O, 0.074% CaCl2$2H2O, 0.03% L-Glutamine pH 7.45). Then, 50 ml of 0.3% NBT working solution in the appropriate medium were immediately distributed to the wells. Following a 2-h-incubation, the supernatants were removed and the cells were fixed by the addition of 200 ml absolute methanol, washed twice with 70% methanol, then dried.
A multiple comparison (Tukey) test was performed to examine the significant differences among treatments using the SPSS 15.0 (SPSS, Chicago, IL, USA). For statistically significant differences, it was required that p < 0.05. One-way ANOVA was analyzed and the results were plotted to figures by Origin 8.0 software (Origin Lab Corporation, MS, USA). 3. Results 3.1. Characterization of the full-length cDNA of LcIL-8 BLASTX search indicated that a 372-bp cDNA fragment from our EST database had 61% identity with the IL-8 of European
C. Li, C.-L. Yao / Fish & Shellfish Immunology 34 (2013) 799e809
seabass (Dicentrarchus labrax). Then, by 30 RACE PCR, a fragment of 688-bp was obtained. Subsequently, 50 RACE PCR was carried out, and a 255-bp fragment was obtained, which contained an initial start codon for Met. As a result, a 931-bp nucleotide sequence representing the full-length cDNA of LcIL-8 was obtained by cluster analysis of the above fragments. BLASTX analysis suggested that LcIL-8 had high homology to other fish IL-8. The full-length cDNA sequence of LcIL-8 was deposited to GenBank (with accession number of JQ407041) which contained an ORF of 285 bp encoding a polypeptide of 94 amino acids residues, a 50 -UTR of 118 bp, and a 30 -UTR of 528 bp. In the 30 -UTR, there was an RNA instability motif (ATTTA), a 22-bp poly (A) tail and a canonical polyadenylation signal (ATTAAA) which located at the 19 bp upstream of the poly (A) tail (Fig. 2). 3.2. The structure of the LcIL-8 gene and sequence analysis Prediction of protein domains by SMART program revealed that LcIL-8 consisted of a signal peptide in the first 20 amino acids at the N-terminal and an SCY domain at the positions 27e88 (Fig. 2). The putative molecular weight (Mw) of LcIL-8 is 10.524 kDa, and the calculated Mw of deduced LcIL-8 mature peptide was 8.438 kDa and the isoelectric point was 9.80. The genome sequence of LcIL-8 was 1930 bp (JQ407042), including four exons and three introns (Fig. 3).
803
3.3. Multiple analysis and phylogenetic analysis of LcIL-8 Comparison of the LcIL-8 amino acid sequence with IL-8 from other species using the BLAST program indicated that LcIL-8 showed high homology to other IL-8 molecules (Table 2). Multiple alignments indicated that the four conservative cysteine residues were identified at nt 30, 32, 56, and 73 in LcIL-8 conforming to the CXC pattern, and a Leu-Leu-Arg (LLR) motif was predicted in SCY domain (Fig. 4). To assess the evolutionary relations among vertebrate IL-8 genes, phylogenetic tree was conducted using the NJ (Neighbor-Joining) method. The results revealed that the deduced amino acid sequence of the LcIL-8 was in the same subgroup with the IL-8 from other teleost and the closest relationship with IL-8 from tilapia (Oreochromis niloticus). IL-8 deduced protein sequences from amphibians, reptiles, birds and mammals were also used in this analysis and were clustered to their corresponding subgroups. The observed relationships within this cluster reflected the taxonomic positions of the species (Fig. 5). 3.4. Expression of LcIL-8 mRNA in tissues The tissue expression of LcIL-8 gene was examined in twelve tissues, including the kidney, head-kidney, intestine, spleen, liver, gill, brain, skin, muscle, heart, stomach and blood cells, from six healthy fish using qRT-PCR. The LcIL-8 transcripts were broadly expressed in all the detected tissues with the most predominant
Fig. 2. Nucleotide and deduced amino acid sequence of LcIL-8 cDNA. The start codon (ATG) and the stop codon (TGA) are bold. The polyadenylation signal motif (AATAAA) and the motif associated with mRNA instability (ATTTA) are bold italic. In the deduced amino acid sequence, signal peptide is marked by underline (1e20 aa). The SCY domain is shaded (27e88 aa). The LLR motif is shaded and underlined. The CXC motif and other two conserved cysteine residues are boxed.
804
C. Li, C.-L. Yao / Fish & Shellfish Immunology 34 (2013) 799e809
expression was found at 3 h (p < 0.05) and then a gradual recover from 6 to 12 h. However, it began to increase again from 24 h and reached the peak value at 48 h with 3.1-fold higher than that of control group (p < 0.05) and the significant high expression maintained to 72 h (p < 0.05). LcIL-8 transcripts in liver after immuno-stimulation are shown in Fig. 7C. The levels of LcIL-8 expression decreased significantly after all the three stimulations (p < 0.05). In the control, LcIL-8 also showed significant decrease after PBS injection. 3.6. Production and purification of recombinant LcIL-8 Recombinant LcIL-8 was produced in E. coli cells after cloning into the pGEX-4T-2 expression vector. Recombinant LcIL-8 was seen in the bacterial lysates after IPTG induction. Glutathione Sepharose 4B affinity chromatography and ToxinEraserÔ column were subsequently used to purify the recombinant protein. The size of purified GST-LcIL-8 was about 34 kDa and LcIL-8 was approximately 8 kDa. The expression and purification of LcIL-8 were detected by SDS-PAGE and Western blot (Fig. 8). The superoxide anion production in PCK cells increased significantly after 1 ng and 10 ng recombinant LcIL-8 stimulation (p < 0.05). However, the superoxide anion production in the control group did not show significant variation post-stimulation. No significant differences between 1 ng and 10 ng BSA stimulation group, therefore only the result of 10 ng BSA stimulation group was shown in Fig. 9. Fig. 3. Diagrammatic comparison of IL-8 gene from large yellow croaker, rainbow trout, fugu, Atlantic cod, channel catfish, chicken and human. Exons are represented by black boxes and lines represent introns; exon lengths are shown on the top of each figure and intron lengths are on the bottom.
expression in liver, followed by heart and skin. Expression of LcIL-8 in spleen of normal un-stimulated fish was very weak (Fig. 6). 3.5. Expression profiles of LcIL-8 mRNA after LPS, poly I:C and V. parahaemolyticus injection Transcriptional changing of LcIL-8 after immuno-stimulation in spleen is shown in Fig. 7A. LcIL-8 gene expression was up-regulated after challenge with LPS, poly I:C or V. parahaemolyticus. After injection with LPS, LcIL-8 expression level showed significant increase at 6 h and 72 h post-injection (p < 0.05) with the peak value of 6.0-fold higher than that of the control group at 6 h. After injection with poly I:C, LcIL-8 expression levels showed significant increase at 3 h and 6 h post-injection (p < 0.05) with the peak value of 2.8-fold higher than that of the control group at 3 h and then it recovered to that of the control level from 12 h to 72 h. In addition, LcIL-8 transcripts increased gradually from 3 h to 12 h after injection with V. parahaemolyticus with significant high expression at 12 h (p < 0.05). Then it returned to that of the control level from 24 to 72 h. The levels LcIL-8 expression did not show significant change after injection with PBS. Expression profiles of LcIL-8 in head-kidney after LPS, poly I:C or V. parahaemolyticus stimulation are shown in Fig. 7B. After LPS injection, LcIL-8 transcripts increased significantly at 6 h with the value of 3.8-fold higher than that of the control group (p < 0.05) and it recovered to that of the control level at 12 h. After poly I:C stimulation, LcIL-8 transcripts showed significant (p < 0.05) up-regulation from 12 h to 24 h with the value of 2.9- and 2.1-fold greater than that of the control group, respectively; then, it returned to that of the control level. After V. parahaemolyticus injection, four different phases could be distinguished from the expression profiles of LcIL-8: significant increase of LcIL-8
3.7. SSCP analysis The PCR-SSCP method was applied to detect part of the genomic sequence polymorphism of LcIL-8 gene. The PCR productions of primers IL-8 SF and IL-8 SR were denatured, and the polymorphism was found using polyacrylamide gel electrophoresis (Fig. 10a). Five mutations were identified in the genomic sequence 129e436 bp. Among them, four are in the intron 1 (C229T, 247T248 insertion or deletion, T289A, 322A323 insertion or deletion) and the last one in exon 2 (A352G), which did not lead to amino acid change (Fig. 10b). 4. Discussion In the present study, LcIL-8 was cloned and characterized from large yellow croaker. The full-length cDNA of LcIL-8 was 931 bp, including an ORF of 285 bp encoding a polypeptide of 94 amino acids. In the deduced amino acid sequence, four conservative cysteine residues were identified at position 30, 32, 56, and 73, which were typical structure in CXC chemokines. And a single glutamine residue (Gln32) separated the first two cysteine residues near the N-terminal. These characters are in correspondence with the CXC chemokines subfamily from other species [2]. Using SMART program, the first 20 N-terminal amino acids were predicted as a signal peptide and an SCY domain were found in LcIL-8, suggesting that LcIL-8 might be a secreted cytokine, similar structure was identified in other secreted chemokines [25,26]. Generally, a typical feature of the mammalian and birds CXC subfamily is the ELR motif which plays an important role in attracting neutrophils and angiogenic [3,27]. LcIL-8, like most bony fish such as lamprey, rainbow trout and flounder, doesn’t possess the ELR motif, which is found in the CXC chemokines attracting neutrophils via CXC-R1 or CXC-R2 [28]. However, an LLR motif was found in LcIL-8 instead. Interestingly, most bony fish IL-8 genes are lack the ELR motif which is replaced by a DLR [25], ELH [29] or other motifs (Fig. 4). It was demonstrated that a single amino acid mutation in ELR, for example ELR to DLR as present in the rainbow trout IL-8 molecule, resulted to a 100-fold decrease in biological activity [25,30]. However, the recombinant
C. Li, C.-L. Yao / Fish & Shellfish Immunology 34 (2013) 799e809
805
Fig. 4. Multiple alignments of LcIL-8 with other known IL-8 amino acids sequences, residues aligned by the CLUSTAL W program. Identical and similar sites were shown with sparks (*) and dots (. or ), respectively. The ELR motif, CXC motif and other two conserved cysteine residues are boxed, respectively. GenBank accession numbers of these genes are listed in Table 2.
IL-8 homolog of black sea bream (Acanthopagrus schlegelii) showed no significant difference in the induction of chemotaxis of fish blood neutrophils compared with the ELR mutant [31]. Therefore, the function of the LLR motif of LcIL-8 requires further study.
In the 30 UTR, only one RNA instability motifs (ATTTA) was found in LcIL-8. However, seven ATTTA motifs were identified in rainbow trout IL-8 [25] and five instability motifs were found in flounder IL-8 [9]. It was reported that five or six copies of the motif are
806
C. Li, C.-L. Yao / Fish & Shellfish Immunology 34 (2013) 799e809
Fig. 5. Phylogenetic tree of IL-8 sequence. Complete amino acids sequences were aligned by using CLUSTAL W, and the tree was constructed with NJ method in MEGA 4.1 and a bootstrap analysis was performed using 1000 replicates to test the relative support for particular clades. GenBank accession numbers of these genes are listed in Table 2.
required to destabilize an mRNA [32], suggesting that LcIL-8 mRNA might be more stable than that of other fish species. Four exons were identified from LcIL-8 genomic sequences, similar with the IL-8 gene structure from other fish, bird and human, suggesting that genomic organization of LcIL-8 gene was very conservative (Fig. 3). Phylogenetic analysis showed that LcIL-8
Fig. 6. Relative expression of LcIL-8 in different tissues of large yellow croaker, include spleen, brain, intestine, head-kidney, gill, stomach, kidney, blood, muscle, skin, heart and liver, respectively (n ¼ 6).
was grouped together with the IL-8 from other teleost, while IL-8 from the amphibians, reptiles, birds, mammals are clustered into the same subgroup, and the result is in line with the traditional classification (Fig. 5). LcIL-8 transcripts were broadly expressed in all the examined tissues of large yellow croaker. The greatest expression was found in liver, followed by heart and skin while the weakest expression was found in the spleen and brain (Fig. 6). According to the reported researches, IL-8 specific expression levels in different fishes are not highly consistent. In large yellow croaker, the highest-level expression was detected in liver, which was similar to that of the half-smooth tongue sole (Cynoglossus semilaevis) [11], conversely, the expression of IL-8 in spleen was very weak, which was different from other fish IL-8 [11,29]. Interesting, the transcripts of immunerelated gene Toll-like receptor3 [33] was also very low in spleen in normal un-stimulated large yellow croaker, as compared with other fish species, the difference might be due to the different fish species or different physiological status. It is well known that IL-8 plays important roles in inflammatory responses [34]. From previous studies, it is known that several bony fish IL-8 are up-regulated at transcription level by bacterial or LPS challenge [35,36]. In our study, the temporal expression profiles of LcIL-8 after LPS, poly I:C and V. parahaemolyticus injection were investigated in spleen, head-kidney and liver. Our results revealed that LcIL-8 expression levels were up-regulated in spleen and headkidney while down-regulated in liver after the three immunostimulations. In spleen, the peak value of LcIL-8 expression appeared at 6 h post-LPS-injection, with 6.0-fold higher than that of the control group (p < 0.05), similar to the results in Japanese sea perch (Lateolabrax japonicus) with the peak value 9.1-fold higher
C. Li, C.-L. Yao / Fish & Shellfish Immunology 34 (2013) 799e809
807
Fig. 8. The production and purification of recombinant LcIL-8 in E. coli. (a) Lane 1, pGEX-4T-2 vector containing GST gene without IPTG induction, lane 2, pGEX-4T-2-GST after IPTG induction. Lane 3, pGEX-4T-2 vector containing LcIL-8 gene without IPTG induction, lane 4. pGEX-4T-2 vector containing LcIL-8 gene after IPTG induction, lane 5, purified recombinant GST-LcIL-8, lane 6: Molecular standard. (Gel concentration: 12% SDS-PAGE). (b) Identification of recombinant LcIL-8 protein by Western blot (anti-GST was used as the primary antibody). Lane 1, pGEX-4T-2 vector containing GST gene without IPTG induction, lane 2, pGEX-4T-2-GST after IPTG induction. Lane 3, pGEX-4T2 vector containing LcIL-8 gene without IPTG induction, lane 4. pGEX-4T-2 vector containing LcIL-8 gene after IPTG induction, lane 5. purified recombinant GST-LcIL-8.
was also found after Vibrio injection, corresponding to the results in channel catfish [9] and haddock [38], which showed that IL-8 expression increased significantly after bacteria injection. IL-8 in spleen could be induced by both virus and bacteria stimulation, suggesting that IL-8 might play an important role in spleen by inducing some immune cell migration or activating immune
Fig. 7. Analysis of LcIL-8 expression in spleen (A), head-kidney (B) and liver (C) of the LPS, poly I:C and V. parahaemolyticus challenged group and the control group by realtime RT-PCR at 0, 3, 6, 12, 24, 48, 72 h post-injection. Data (mean SE, n ¼ 6) within the same post-injection time with different letters (a, b, c) are significantly different (p < 0.05) among the treatments.
than the control at 6 h [29]. In the same organ, LcIL-8 expression levels showed significant increase after injection with poly I:C. Similar to the results in rainbow trout that showed the peak value (3.6-fold) of IL-8 transcripts appeared at the first day during the detected 28 days [37]. Significant up-regulation of LcIL-8 transcripts
Fig. 9. Changes of superoxide anion production in PCK cells after stimulation with PBS (control), 1 ng and 10 ng recombinant LcIL-8. The samples were collected at 12 h after stimulation. Ten ng BSA in the same buffer were used as control. Data are expressed as mean SE of three replications. Bars with asterisk are significantly difference (p < 0.05) compare to control group.
808
C. Li, C.-L. Yao / Fish & Shellfish Immunology 34 (2013) 799e809
Fig. 10. SNP sites identification in LcIL-8 gene. (a) SSCP detection of PCR amplification using primers IL-8 SF and IL-8 SR from 20 fishes. Line 1e7, 7 fish of Dai-ju stock from Zhoushan, Zhejiang province; line 8e14, 7 fish of min-yue stock from Ningde, Fujian Province; 15-20, 6 fishes from hybrids cultured in Ningde, Fujian province. (b) Sequence of PCR amplification using primers IL-8 SF and IL-8 SR from 20 fishes for SSCP analysis. Five mutations were identified from the 20 fishes in the genomic sequence 129e436 bp, which were represented in bold letters, underlined, and dark gray. They were: C229T, 247T248 insertion or deletion (), T289A, 322A323 insertion or deletion () and A352G, which did not lead to amino acid change.
response. In head-kidney, the expression levels of LcIL-8 transcripts significantly increased after LPS stimulation, which were in contrast to the result of haddock [38]. In the same organ, LcIL-8 transcripts significantly up-regulated post-poly I:C-injection, similarly to what observed in Atlantic cod [35]. In addition, significant increases of LcIL-8 transcripts were found after V. parahaemolyticus injection, analogously to what reported in haddock [38] and halfsmooth tongue sole [10] after V. parahaemolyticus injection. Fish IL-8 was demonstrated to induce the stimulated migration of neutrophils, macrophages, head-kidney leukocytes, neutrophils, and peripheral blood leukocytes [10e12]. Our results suggested that IL-8 might play a crucial role in head-kidney of large yellow croaker by attracting some immune cells. However, LcIL-8 response was slower in head-kidney than that in spleen, suggesting that IL-8 related immune response in spleen could be induced faster than that in head-kidney. The level of LcIL-8 expression significantly decreased in liver after all the three stimulations and PBS mock injection, suggesting that IL-8 transcripts in liver could be inhibited in a transient systemic immune response to the stimulation inflicted by penetration of the needle and injection of heterogeneous substance [17,33]. In the present study, we also produced the recombinant IL-8 protein and demonstrated that the recombinant LcIL-8 could initiate superoxide anion production in PCK cells. Some previous studies indicated that the biological function of IL-8 was to promote recruitment and activation of neutrophils to areas of acute inflammation and induction of active oxygen reaction in neutrophils [1,4]. Similarly, the recombinant trout IL-8 induced the migration of head-kidney leukocytes, activated the respiratory burst in vitro and mainly attracted leukocytes into the peritoneal cavity in vivo of trout [12]. Our results showed that recombinant LcIL-8 could induce the production of superoxide anion in PCK cells. Superoxide anion production is produced during the respiratory burst of phagocytes and an indicator can be induced by a variety of phagocyte activation, which could be activated by a number of agents [24,39]. The increased superoxide agents might prime the cells for enhancing killing ability. Our results suggested that recombinant LcIL-8 might change the cell immune response ability by stimulation of active oxygen release.
Until to the present study, several SNPs have been identified in IL-8 that showed a close correlation with disease resistance in human [40]. Here, five SNPs were identified in the intron 1 and exon 2 region of LcIL-8 gene. There is no report for the synonymous mutation (A352G) at this position from previous studies on SNP detection in the fish IL-8 gene. These SNPs need further investigation in larger samples and large yellow croaker disease-resistant breeds to evaluate it potential application for disease-resistant traits. In conclusion, the putative protein and genomic structure of IL-8 were obtained from large yellow croaker. LcIL-8 transcripts were broadly expressed in all examined tissues with the highest expression in liver and the lowest level in spleen. The expression of LcIL-8 is induced in spleen and head-kidney and inhibited in liver after LPS, poly I:C, and V. parahaemolyticus injection. The recombinant LcIL-8 can increase the production of superoxide anion in PCK cells. In addition, five SNPs of LcIL-8 have been identified, which provide a potential application for anti-disease traits. Overall, these results indicate that LcIL-8 transcripts expression played an important role in fish immune response. Acknowledgments This research was supported by “973 Program” (2011CB111604) and NSFC (31101882) to C.L.Y. References [1] Baggiolini M, Imboden P, Detmers P. Neutrophil activation and the effects of interleukin-8/neutrophil-activating peptide 1 (IL-8/NAP-1). Cytokines 1992;4: 1e17. [2] Laing KJ, Secombes CJ. Chemokines. Dev Comp Immunol 2004;28(5):443e60. [3] Wuyts A, Proost P, Van Damme J. Interleukin-8 and other CXC chemokines. In: Thomson A, editor. The cytokine handbook. 3rd ed. London: Academic Press; 1998. p. 271e311. [4] Mukaida N, Harada A, Matsushima K. Interleukin-8 (IL-8) and monocyte chemotactic and activating factor (MCAF/MCP-1), chemokines essentially involved in inflammatory and immune reactions. Cytokine Growth Factor Rev 1998;9:9e23. [5] Goodman RB, Forstrom J, Osborn S, Chi E, Martin T. Identification of two neutrophil chemotactic peptides produced by porcine alveolar macrophages. J Biol Chem 1991;266:8455e63. [6] Gregory H, Young J, Schröder JM, Mrowietz U, Christophers E. Structure determination of a human lymphocyte derived neutrophil activating peptide (LYNAP). Biochem Biophys Res Commun 1988;151:883e90. [7] Nakamura H, Yoshimura K, Jaffe HA, Crystal R. Interleukin-8 gene expression in human bronchial epithelial cells. J Biol Chem 1991;266:19611e7. [8] Lee EY, Park HH, Kim Y, Chung JK, Choi TJ. Cloning and sequence analysis of the interleukin-8 gene from flounder (Paralichthys olivaceous). Gene 2001; 274:237e43. [9] Chen L, He C, Baoprasertkul P, Xu P, Li P, Serapion J, et al. Analysis of a catfish gene resembling interleukin-8: cDNA cloning, gene structure, and expression after infection with Edwardsiella ictaluri. Dev Comp Immunol 2005;29:135e42. [10] Sun JS, Zhao L, Sun L. Interleukin-8 of Cynoglossus semilaevis is a chemoattractant with immunoregulatory property. Fish Shellfish Immunol 2011;30: 1362e7. [11] Zhonghua C, Chunpin G, Yong Z, Kezhi X, Yaou Z. Cloning and bioactivity analysis of a CXC ligand in black seabream Acanthopagrus schlegelii: the evolutionary clues of ELRþCXC chemokines. BMC Immunol 2008;9:66. [12] Harun NO, Zou J, Zhang YA, Nie P, Secombes CJ. The biological effects of rainbow trout (Oncorhynchus mykiss) recombinant interleukin-8. Dev Comp Immunol 2008;32(6):673e81. [13] Andia DC, de Oliveira NFP, Letra AM, Nociti Jr FH, Line SRP, de Souza AP. Interleukin-8 gene promoter polymorphism (rs4073) may contribute to chronic periodontitis. J Periodontol 2011;82:893e9. [14] Angels N, Gaia L, Martin H, Kirk R, Hassan J, David M, et al. Innate immunity in ocular Chlamydia trachomatis infection: contribution of IL8 and CSF2 gene variants to risk of trachomatous scarring in Gambians. BMC Med Genet 10, 138. [15] Gu L, Jia H, Zhao Y, Liu N, Wang S, Cui B, et al. Association studies of interleukin-8 gene in Graves’ disease and Graves’ ophthalmopathy. Endocrine 2009;36:452e6. [16] Wang Z, Wang Y, Lin L, Khoo S, Okamoto N. Genetic polymorphisms in wild and cultured large yellow croaker Pseudosciaena crocea using AFLP fingerprinting. JFSC 2002;9:198e202.
C. Li, C.-L. Yao / Fish & Shellfish Immunology 34 (2013) 799e809 [17] Yao CL, Kong P, Wang ZY, Ji PF, Cai MY, Liu XD, et al. Cloning and expression analysis of two alternative splicing toll-like receptor 9 isoforms A and B in large yellow croaker, Pseudosciaena crocea. Fish Shellfish Immunol 2008;25: 648e56. [18] Yao CL, Kong P, Wang ZY, Ji PF, Liu XD, Cai MY, et al. Molecular cloning and expression of MyD88 in large yellow croaker, Pseudosciaena crocea. Fish Shellfish Immunol 2009;26:249e55. [19] Li S, Ao J, Chen X. Molecular and functional characterization of a cystatin analogue in large yellow croaker (Pseudosciaena crocea). Mol Immunol 2009; 46:1638e46. [20] Zhou L, Wang X, Liu Q, Wang Q, Zhao Y, Zhang Y. A novel multivalent vaccine based on secretary antigen-delivery induces protective immunity against Vibrio anguillarum and Aeromonas hydrophila. J Biotechnol 2010;146:25e30. [21] Letunic I, Copley RR, Pils B, Pinkert S, Schultz J, Bork P. SMART 5: domains in the context of genomes and networks. Nucleic Acids Res 2006;34(Database issue):D257e60. [22] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2-[Delta][Delta] CT method. Methods 2001;25:402e8. [23] Muñoz M, Cedeño R, Rodriguez J, van der Knaap WPW, Mialhe E, Bachère E. Measurement of reactive oxygen intermediate production in haemocyte of the penaeid shrimp (Penaeus vannamei). Aquaculture 2000;191:89e107. [24] Ji P, Yao CL, Wang ZY. Immune response and gene expression in shrimp (Litopenaeus vannamei) hemocytes and hepatopancreas against some pathogen-associated molecular patterns. Fish Shellfish Immunol 2009;27: 563e70. [25] Laing KJ, Zou JJ, Wang T, Bols N, Hirono I, Aoki T, et al. Identification and analysis of an interleukin 8-like molecule in rainbow trout Oncorhynchus mykiss. Dev Comp Immunol 2002;26:433e44. [26] Vaddi K, Keller M, Newton RC. The chemokine factsbook. London: Academic Press; 1997. [27] Strieter RM, Polverini PJ, Kunkel SL, Arenberg DA, Burdick MD, Kasper J, et al. The functional role of the ELR motif in CXC chemokine-mediated angiogenesis. J Biol Chem 1995;270:27348e57. [28] Bizzarri C, Beccari AR, Bertini R, Cavicchia MR, Giorgini S, Allegretti M. ELRþ CXC chemokines and their receptors (CXC chemokine receptor 1 and CXC
[29]
[30]
[31] [32] [33]
[34] [35]
[36]
[37]
[38]
[39] [40]
809
chemokine receptor 2) as new therapeutic targets. Pharmacol Ther 2006;112: 139e49. Qiu L, Zhang H, Yang K, Jiang S. Molecular cloning and mRNA expression analysis of interleukin-8 gene in Japanese sea perch (Lateolabrax japonicus). Mol Biol Rep 2009;36:1099e105. Hebert CA, Vitangcol R, Baker JB. Scanning mutagenesis of interleukin-8 identifies a cluster of residues required for receptor binding. J Biol Chem 1991;266:18989e94. Cai Z, Gao C, Zhang Y, Xing K. Functional characterization of the ELR motif in piscine ELRþCXC-like chemokine. Mar Biotechnol 2009;11:505e12. Clark AR, Dean JLE, Saklatvala J. Post-transcriptional regulation of gene expression by mitogen-activated protein kinase p38. FEBS Lett 2003;546:37e44. Huang XN, Wang ZY, Yao CL. Characterization of Toll-like receptor 3 gene in large yellow croaker, Pseudosciaena crocea. Fish Shellfish Immunol 2011;31: 98e106. Magnadóttir B. Innate immunity of fish (overview). Fish Shellfish Immunol 2006;20:137e51. Seppola M, Larsen AN, Steiro K, Robertsen B, Jensen I. Characterisation and expression analysis of the interleukin genes, IL-1 [beta], IL-8 and IL-10, in Atlantic cod (Gadus morhua L. Mol Immunol 2008;45:887e97. Sigh J, Lindenstrom T, Buchmann K. Expression of pro-inflammatory cytokines in rainbow trout (Oncorhynchus mykiss) during an infection with Ichthyophthirius multifiliis. Fish Shellfish Immunol 2004;17:75e86. Purcell MK, Kurath G, Garver KA, Herwig RP, Winton JR. Quantitative expression profiling of immune response genes in rainbow trout following infectious haematopoietic necrosis virus (IHNV) infection or DNA vaccination. Fish Shellfish Immunol 2004;17:447e62. Corripio-Miyar Y, Bird S, Tsamopoulos K, Secombe CJ. Cloning and expression analysis of two pro-inflammatory cytokines, IL-1 beta and IL-8, in haddock (Melanogrammus aeglefinus). Mol Immunol 2007;44:1361e73. Secombes CJ, Fletcher TC. The role of phagocytes in the protective mechanisms of fish. Ann Rev Fish Dis 1992;2:53e71. Heinzmann A, Ahlert I, Kurz T, Berner R, Deichmann KA. Association study suggests opposite effects of polymorphisms within IL8 on bronchial asthma and respiratory syncytial virus bronchiolitis. J Allergy Clin Immunol 2004;114: 671e6.