- Email: [email protected]
Genomic structure and promoter functional analysis of GnRH3 gene in large yellow croaker (Larimichthys crocea)
Gene 576 (2016) 458–465
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
Research paper
Genomic structure and promoter functional analysis of GnRH3 gene in large yellow croaker (Larimichthys crocea) Wei Huang, Jianshe Zhang, Zhi Liao, Zhenming Lv, Huifei Wu, Aiyi Zhu, Changwen Wu ⁎ National Engineering Research Center of Marine Facilities Aquaculture, College of Marine Science and Technology, Zhejiang Ocean University, Zhoushan, Zhejiang 316022, PR China
a r t i c l e
i n f o
Article history: Received 22 August 2015 Received in revised form 9 October 2015 Accepted 24 October 2015 Available online 28 October 2015 Keywords: GnRH3 Genomic structure Promoter analysis Larimichthys crocea
a b s t r a c t Gonadotropin-releasing hormone III (GnRH3) is considered to be a key neurohormone in fish reproduction control. In the present study, the cDNA and genomic sequences of GnRH3 were cloned and characterized from large yellow croaker Larimichthys crocea. The cDNA encoded a protein of 99 amino acids with four functional motifs. The full-length genome sequence was composed of 3797 nucleotides, including four exons and three introns. Higher identities of amino acid sequences and conserved exon–intron organizations were found between LcGnRH3 and other GnRH3 genes. In addition, some special features of the sequences were detected in partial species. For example, two specific residues (V and A) were found in the family Sciaenidae, and the unique 75–72 bp type of the open reading frame 2 and 3 existed in the family Cyprinidae. Analysis of the 2576 bp promoter fragment of LcGnRH3 showed a number of transcription factor binding sites, such as AP1, CREB, GATA-1, HSF, FOXA2, and FOXL1. Promoter functional analysis using an EGFP reporter fusion in zebrafish larvae presented positive signals in the brain, including the olfactory region, the terminal nerve ganglion, the telencephalon, and the hypothalamus. The expression pattern was generally consistent with the endogenous GnRH3 GFP-expressing transgenic zebrafish lines, but the details were different. These results indicate that the structure and function of LcGnRH3 are generally similar to the other teleost GnRH3 genes, but there exist some distinctions among them. © 2015 Elsevier B.V. All rights reserved.
1. Introduction Gonadotropin-releasing hormone III (GnRH3), also known as salmonGnRH, is a specific decapeptide discovered in teleost fishes. It is one form of the gonadotropin-releasing hormones, which act on the pituitary to stimulate the synthesis and secretion of gonadotropins (Oka, 2009; Zohar et al., 2010; Clarke and Parkington, 2014). Like other GnRH forms, GnRH3 of diverse teleosts have been declared to share a common structure of 4 exons and 3 introns, in which the coding regions are highly conserved, and the upstream and downstream regions and intron sequences are distinctively divergent (González-Martínez et al., 2001; Torgersen et al., 2002; Guilgur et al., 2007; Kavanaugh et al., 2008; Zhou et al., 2012; Sukhan et al., 2013). Whereas, no report has attempted to distinguish the noncoding regions. Hence, many estimates of GnRH3
Abbreviations: GnRH3, gonadotropin-releasing hormone III; LCGnRH3, Larimichthys crocea GnRH3; GFP, green fluorescent protein; EGFP, enhanced green fluorescent protein; UTR, untranslated region; ORF, open reading frame; GAP, GnRH associated pepetide; AP1, activator protein 1; CREB, cAMP response element binding protein; C/ EBP, CCAAT/enhancer binding protein; GATA-1, GATA binding protein-1; Oct-1, octamer transcription factor-1; RXR, retinoid-x recept; SOX, SRY-related HMG-box family members; HSF, heat shock factor; Brn, POU domain transcription factor family members; AREB, ABA-responsive element binding factor; Fox, forkhead/winged helix-box family members; TNg, terminal nerve ganglion. ⁎ Corresponding author.
http://dx.doi.org/10.1016/j.gene.2015.10.063 0378-1119/© 2015 Elsevier B.V. All rights reserved.
genomic sequences may be requested, because the differences of noncoding sequences often link with the phylogenetic classification between the different teleost species (White and Fernald, 1998; Gelfman et al., 2012). GnRH3 is synthesized and released from a small number of hypothalamic neurons within the brain (Pandolfi et al., 2002; Lethimonier et al., 2004; Kuo et al., 2005). Migration is an essential feature of developing GnRH3 neurons as demonstrated in zebrafish and medaka, in which the GnRH3 neurons tagged with the green fluorescent protein (GFP) in fetal olfactory region were transplanted to the hypothalamicpreoptic area region and trigeminal ganglion (Okubo et al., 2006; Abraham et al., 2008; Zhao et al., 2013). In addition, an active tissue specificity of the silver sea bream GnRH3 promoter was validated in zebrafish larvae with transgenic technology (Hu et al., 2008). These results show that zebrafish can be used as an efficient model organism to assay the activity of a particular GnRH3 promoter sequence. Large yellow croaker, Larimichthys crocea, is a commercially important marine fish and cultured on a large scale in China. The great demands for breeding services encourage further studies on its reproductive system (Lin et al., 1992; You and Lin, 1997; You et al., 2001; Chen et al., 2007; Ma et al., 2012; Pu et al., 2013). In the present study, we cloned the GnRH3 gene of large yellow croaker (LcGnRH3), and compared its exonintron organizations with other teleost GnRH3 genes. The promoter activity of LcGnRH3 was evaluated using an EGFP reporter fusion in zebrafish since transgenic technology has not been sufficiently developed with high efficiency in large yellow croaker. Potential regulatory motifs in
W. Huang et al. / Gene 576 (2016) 458–465
the promoters of different teleost GnRH3 were also analyzed and aligned, aiming to detect the core promoter sequences for regulatory. 2. Materials and methods 2.1. Total RNA extraction and SMART cDNA synthesis Large yellow croakers were obtained from the mari-culture farm at Dongji island, Zhoushan city, China. The entire brain was collected from a 2-year-old female and immediately dipped in RNA Later™ (Qiagen) at room temperature for 1 h. Then, the sample was stored at − 20 °C until use for total RNA isolation. Total RNA was extracted using TRIzol reagent (Invitrogen). The RNA quality and purity were measured by spectrophotometry (Eppendorf Biometer) and by electrophoresis on 1% agarose gels. SMART cDNAs were synthesized from 50 ng of total RNA using the SMART cDNA Library Construction Kit following commercial protocol (Clontech, USA). 2.2. RACE analysis and cloning of LcGnRH3 To obtain the GnRH3 cDNA fragment of L. crocea, degenerate sense and antisense primers (Table 1) were designed based on amino acid sequences which are highly conserved among fishes got from the NCBI website. PCR was performed in a 25 μl reaction mix containing 1 μl brain cDNA as template DNA, 0.2 μM each primer, 0.5 U taq polymerase (MBI, Fermentas), 0.1 μM of each dNTP, 1 × buffer for Taq polymerase (MBI, Fermentas). Amplification condition was: 94 °C, 20 s; 55 °C, 30 s; and 72 °C, 1 min for 32 cycles. A PCR fragment, homologous to GnRH3, was then used as the template for design of the following gene-specific rapid amplification of cDNA ends (RACE) PCR primers. The 3′-RACE was performed by common SMART3′-primer and RaceF primer (Table 1). For 5′-RACE, primers were common SMART 5′-primer and RaceR primer (Table 1). PCR conditions for RACE were as follows: 94 °C, 20 s; 61 °C, 30 s; and 72 °C, 50 s for 32 cycles. All the expected PCR products were directly subcloned into pMD18-T simple vector (Takara) and sequenced. The full-length cDNA sequence was amplified with two gene-specific primers (GnRH-w-F and GnRH-w-R). 2.3. Genomic DNA amplification and cloning The genomic DNA fragment and its upstream region of the large yellow croaker GnRH3 gene were cloned with the Universal GenomeWalker™ Kit (BD, Biosciences), according to the user manual protocol. In brief, the genomic DNA was isolated from large yellow croaker tail fin using standard phenol/chloroform alcohol extraction method as described by Li and Gui (2008). Then, aliquots of genomic DNA (2.5 μg) Table 1 Primers used in this study. Name
Sequence (5′–3′)
Remark
Sense Antisense RaceR RaceF GnRH-w-F GnRH-w-R GSP1a GSP1b GSP2a GSP2b GSP3a GSP3b AP1 AP2
ATGGTGCAGGTGTTGTTGTTG TGACTGGAATCATCATTAAT ATCATTAATTACATTGTATGG TGTTGTTGTTGGCGTTGGC ATGCTAACAAGACAAATAC ACATGATAATGTCAGTACTCTGC TACTCTGCACTCGATCCATC TCTGCACTCGATCCATCACTGGTG AAGTAAGCAGAAGCCTTGC ATGTCAGAGTTCCCTTCCTTG TAGTAATGCATTTCAAGTAG TAGGTAAAGTTGGACTACAG GTAATACGACTCACTATAGGGC ACTATAGGGCACGCGTGGT
Wholelength-F9
CCAAGCTTTGTGATGTGGTTGCTG
Trans-R
CGGGATCCATTATTAGCGAACCTTTC
Fragment PCR Fragment PCR 5′ RACE PCR 3′ RACE PCR Full-length cDNA PCR Full-length cDNA PCR Genome walking step 1 Genome walking step 1 Genome walking step 2 Genome walking step 2 Genome walking step 3 Genome walking step 3 Supplied with Kit Supplied with Kit Whole length PCR, containing Hind III site transgenic vector construct, containing BamH I site
459
were digested at 37 °C for 16 h with one of four different restriction enzymes (80 units of Dra I, EcoR V, Pvu II, or Stu I), and the digested blunt end DNAs were purified by phenol extraction and ethanol precipitation. Then, each batch of DNA (100 ng) was separately ligated to the Genome Walker Adaptor at 16 °C overnight. The reaction was stopped by incubating each sample at 70 °C for 5 min and adding 10 volumes of TE (pH 7.5). The primary round “genome walking” PCR was respectively performed from the constructed GenomeWalker libraries by the genespecific primer GSP1a and the kit's outer adapter primer AP1, and followed by a nested second amplification with gene-specific primer GSP1b and the kit's nested adapter primer AP2 according to the manufacturer's protocol as described by Huang et al. (2009). The PCR products were separated and purified in 1% agarose gel. Then, the purified fragments were cloned into pMD18-T simple vector (Takara) and sequenced. The resultant DNA fragment contained only a short piece of the 5′-flanking region. Therefore, a second and a third round of nested “genomewalking” PCRs were conducted sequentially with primers GSP2a and GSP2b, GSP3a and GSP3b, respectively, and the amplified fragments were cloned and sequenced. To isolate the entire 5′-flanking region of LcGnRH3, one forward primer Wholelength-F9, which was also used in the following expression vector constructs, was designed according to the third-round amplified sequence. Consequently, the entire 5′-flanking region of LcGnRH3 was amplified from a high-quality genomic DNA by the pair of primers Wholelength-F9 and GSP1a, and cloned and sequenced as described above. All primers used in these amplifications are listed in Table 1. 2.4. Genomic structure and sequence analysis The nucleotide and deduced amino acid sequences of LcGnRH3 cDNA was analyzed with BioEdit 7.0.1 and Expasy search program (http://au. expasy.org/tools/). Genomic structure was analyzed by CLUSTAL W version 2.0. The nucleotide and amino acid sequences homology were analyzed using the programs BLASTN and BLASTP at heep://www.ncbi. nlm.nih.gov/BLAST. The genomic DNA and protein sequences of GnRH3 from different species were collected from the GenBank/EMBL Database of the National Center of Biotechnology Information (NCBI). Multiple sequence alignments and the phylogenetic tree were performed using the program GENEDOC version 2.6 and MEGA version 4.0 under default settings. The potential transcription factor binding sites were identified by MatInspector (http://www.genomatix.de) and TFSEARCH (http:// www.cbrc.jp/research/db/TFSEARCH.html). 2.5. Construction of LcGnRH3:EGFP transgenic vectors A 3602 bp genomic fragment containing 2576 bp of the LcGnRH3 5′flanking region and 1026 bp of the three introns and four exons, except the 3′-untranslated region (UTR), was amplified by the pair primers of Wholelength-F9 and Trans-R from large yellow croaker genomic DNA. The product was subcloned into pMD18-T simple vector. The resulting clone was then digested with Hind III and BamH I, and the insert was ligated into Hind III/BamH I-cut enhanced green fluorescent protein expression vector, pEGFP-1 (Clontech). All of these fragments were sequenced to ensure their correct orientation. Plasmid DNA for microinjection was purified with an E.Z.N.A.™ Plasmid Mini Kit (OMEGA). Plasmid quantity and purity were determined with 1% agarose gel electrophoresis. 2.6. Microinjection and transient expression in zebrafish Transient expression of the LcGnRH3:EGFP constructs was obtained by microinjection of zebrafish embryos as described (Palevitch et al., 2007; Xia et al., 2014). Approximately 2 nl were injected into the cytoplasm of one- or two-cell-stage wildtype zebrafish zygotes using a micromanipulator and microinjection apparatus (Harvard Apparatus, PL1-100, Holliston, MA). The constructs were injected separately (200 ng/μl)
460
W. Huang et al. / Gene 576 (2016) 458–465
into more than 400 embryos. Injected embryos were kept under light/ dark (12 h:12 h) cycles and repeatedly observed on days 1–35 pf. Green fluorescence in live embryos was detected using an Olympus dissecting microscope (SZX12) equipped with appropriate filter sets.
was also presented between these three species by the phylogenetic analysis, which belong to the family Sciaenidae (Fig. 2b).
3. Results
Four exons and three introns were identified by comparing the LcGnRH3 cDNA sequence to the genomic DNA frgaments. The lengths of exons 1, 2, 3, and 4 were 23, 143, 81, and 246 bp, while introns 1, 2, and 3 were 191, 239, and 298 bp, respectively (Fig. 3). Exon 1 encoded the most part of 5′-UTR; exon 2 encoded a small part of 5′-UTR, the signal peptide, GKR, and the N-terminus of GAP; exon 3 encoded the middle portion of GAP, and exon 4 contained the C-terminus of GAP and the 3′-UTR. Comparison of the nucleotide sequence of LcGnRH3 with the counterparts of other teleosts revealed that a high degree of similarity existed in the exon–intron organizations. As shown in Fig. 3, each GnRH3 gene spanned four exons and three introns, and the location of exon–intron junction sites were conserved. Slight distinctions existed in the 5′-UTRs and the ORF-encoding regions, and the main difference was the dynamic sizes of the introns and the 3′-UTRs. Further analysis displayed that all of the first ORF-encoding regions were at the same size of 138 bp, while the ORF-encoding regions 2 and 3 were divided into two classes of sizes, 81–54 bp type in the first seven species, and 75–72 bp type in goldfish Carassius auratus, common carp Cyprinus carpio and zebrafish, respectively. The near-unanimous sizes were observed between Burton's mouthbrooder Haplochromis burtoni, Nile tilapia, goldfish, and common carp.
3.1. Identification of LcGnRH3 gene Initially, a partial fragment of 218 bp was amplified from the wholebrain cDNA using two degenerated primers. The remaining regions of LcGnRH3 cDNA were subsequently obtained by 5′ and 3′ RACE approaches. Overlapping sequences of all fragments yielded a full-length cDNA with 30 bp of 5′-untranslated region (UTR), 192 bp of 3′-untranslated region and 273 bp of the open reading frame (ORF). The typical polyadenylation signal sequence (AATAAA) was located at 14 nt upstream of the poly (A) tail. The complete ORF encoded a protein of 91 amino acids with a calculated molecular weight of 10 kDa, which contained a 23 aa putative signal peptide, a conserved GnRH decapeptide, a 3 aa proteolytic cleavage site GKR, and a 55 aa GnRH-associated pepetide (GAP) (GenBank accession no. KM819573) (Fig. 1). BLASTP analysis revealed that the deduced amino acid sequence of LcGnRH3 was strikingly homologous to other teleost GnRH3 proteins (Fig. 2a). The identities were 98%, 97%, 92%, 91%, 90%, and 84% with those of red drum Sciaenops ocellatus, Atlantic croaker Micropogonias undulatus, flathead mullet Mugil cephalus, black sea bass Centropristis striata, Mozambique tilapia Oreochromis mossambicus, and threespined stickleback Gasterosteus aculeatus, respectively. Alignment analysis showed that all of GnRH3 proteins were composed of four functional domains (F1, F2, F3, and F4) (Fig. 2a), of which two conserved residues (V and A) were specific in the signal peptide domain of large yellow croaker, red drum, and atlantic croaker. A closer relationship
3.2. Genomic analysis of LcGnRH3
3.3. Sequence and characterization of LcGnRH3 promoter A total of 2576 bp 5′-flanking sequence of LcGnRH3 gene was obtained from the genomic DNA of large yellow croaker by three rounds of nested PCRs using the GenomeWalker™ Universal Kit. It included a
Fig. 1. Genomic sequences of LcGnRH3 (GenBank accession no. KM819573). The open reading frame (ORF) is underlined and the deduced amino acid residues are represented as singleletter abbreviations. The stop codon is marked by an asterisk. The conserved GnRH decapeptide and the 3 aa proteolytic cleavage site GKR are boxed with dotted and solid lines, respectively. The 5′−/3′- untranslated regions (UTRs) are shadow. Consensus sequences of the TATA box and the AATAAA are in bold.
W. Huang et al. / Gene 576 (2016) 458–465
461
Fig. 2. (a) Multiple amino acid alignment of the deduced LcGnRH3 protein with other teleost GnRH3 proteins. Identical amino acid residues are emphasized in black and gray. Putative functional domains are indicated (F1, the putative signal peptides; F2, the conserved GnRH decapeptide; F3, the GKR proteolytic cleavage site; F4, the GnRH-associated peptide). Specific residues of the family Sciaenidae GnRH3 proteins are marked by black triangles. And, the percentages of identities are shown at the end of their amino acid sequences. The accession numbers for the protein sequences are as follows: red drum (Sciaenops ocellatus) AAT80329, Atlantic croaker (Micropogonias undulatus) AAQ16503, flathead mullet (Mugil cephalus) AAQ83268, black sea bass (Centropristis striata) AHB89706, Mozambique tilapia (Oreochromis mossambicus) AAO11648, three-spined stickleback (Gasterosteus aculeatus) AFY12650. (b) Phylogenetic tree of the above GnRH3 peptide sequences based on neighbor-joining (NJ) method. The phylogeny is presented as an unrooted transformed cladogram for best presentation.
consensus TATA box motif at the adenosine 23 bp upstream of the transcription initiation site and had been deposited into the GenBank database with accession number KM819573. Potential regulatory motifs analysis using MatInspector and TFSEARCH revealed a number of transcription factor binding sites for activator protein 1 (AP 1), cAMP response element binding protein (CREB), CCAAT/enhancer binding protein (C/EBP), GATA binding protein-1 (GATA-1), octamer transcription factor-1 (Oct-1), retinoid-x recept (RXR), SRY-related HMG-box
family members (SOX), heat shock factor (HSF), POU domain transcription factor family members (Brn), ABA-responsive element binding factor (AREB), and forkhead/winged helix-box family members (FOX) (Fig. 4). When the promoter sequence of LcGnRH3 was compared to other GnRH3 promoters, high identities from 77% to 45% were revealed. For example, the LcGnRH3 promoter was 77% identical to the silver sea bream, 71% to the black rockfish, 51% to the medaka, and 45% to the
Fig. 3. Comparison of the exon–intron organization of teleost GnRH3 genes. The boxes and bars represent the exons and introns, respectively. The blank boxes present UTRs, and the shadow boxes present ORFs. Numbers above each line refer to the sizes (bp) of corresponding exons or introns. The conserved regions among different species are marked by the red or blue rectangles. The accession numbers for the genomic sequences are as follows: grass puffer (Takifugu niphobles) AB531129, black rockfish (Sebastes schlegelii) JQ247584, half-smooth tongue sole (Cynoglossus semilaevis) JQ028869, Japanese medaka (Oryzias latipes) AB041335, Burton's mouthbrooder (Haplochromis burtoni) AF076963, Nile tilapia (Oreochromis niloticus) AB104863, goldfish (Carassius auratus) AB020242, common carp (Cyprinus carpio) AY186621, and zebrafish (Danio rerio) AF490354.
462
W. Huang et al. / Gene 576 (2016) 458–465
Nile tilapia. Whereas, lower identity 23% was found to the zebrafish GnRH3 promoter, and the potential regulatory motifs were just overlapped partially, except the motif of TATA box (Fig. s). 3.4. In vivo functional assay of LcGnRH3 promoter Zebrafish were used to evaluate the function of LcGnRH3 promoter because its optical accessibility at the embryonic and larval stages allow for easy imaging. As revealed above, some regulatory motifs in the promoter sequences were conserved between large yellow croaker and zebrafish. Microinjection of LcGnRH3:EGFP resulted in the transient expression of GFP in 31% of the embryos. We found that the large yellow croaker GnRH3 promoter was tissue-specific during zebrafish early developmental stages. As shown in Fig. 5, GFP expression was restricted to the brain area of the injected embryos. At 3 dpf, GFP was clearly visible as bilateral dots in the transitional area between the olfactory organ and olfactory bulb (Fig. 5a). During the next 2 days, green fluorescence in GnRH3 neurone perikarya was extending along the optic commissure (Fig. 5b). By 6 dpf, the positive expressions were backward to cross the presumptive terminal nerve ganglion (TNg), and the migration continued along the ventral aspects of the telencephalon (Fig. 5c). Later on, these projections crossed the telencephalon, and then entered the hypothalamus at 12 dpf (Fig. 5d). The fluorescence remained unchanged in the next stages. 4. Discussion
Fig. 4. Schematic representation of putative regulatory motifs in the promoter of LcGnRH3 gene. The scale bar refers to a nucleotide sequence distance of 100 bp.
The GnRH3 decapeptide is highly conserved among teleosts (Karigo and Oka, 2013). This conservation allowed us to use a simple method to clone the GnRH3 gene from large yellow croaker. As all known GnRH3 genes, the LcGnRH3 comprises four exons and three introns, and its decapeptide is coded by exon 2, and the GAP by exons 2, 3, and 4 (Fig. 1). The prepro-LcGnRH3 consists of four functional domains, and the sequence shows higher identities with those homologs previously cloned from other fish species (Fig. 2a). These conservative features are common to GnRH3, and consistent with the previous results in European sea bass, Japanese medaka, zebrafish, tilapia, red drum, and half-smooth tongue sole, and so on (González-Martínez et al., 2001; Okubo et al., 2002; Steven et al., 2003; Kitahashi et al., 2005; Mohamed and Khan, 2006; Zhou et al., 2012). Notably, some new elements out of the conservation of teleost GnRH3 are provided by the present study. For instance, two specific residues (V and A) are special in the list of GnRH3 proteins of Sciaenidae, which are different with other teleosts (Fig. 2a). The result of phylogenetic analysis also indicates a closer homologous relationship between the family of Sciaenidae (Fig. 2b). In addition, two major groups are revealed by the comparison of genomic organizations in ten teleost species, which GnRH3 genomic sequences are available publicly in the GenBank database. As shown in Fig. 3, the GnRH3 genes are grouped into two distinct types according to the sizes of exon1, ORF2, and ORF3, ie., a 5-138-81-54 bp type and a 7-138-75-72 bp type. Especially, higher degree of conservation are viewed in the species of family Cichlidae, and family Cyprinidae, which have more similar sizes in the corresponding exons and introns. These results suggest that familylevel variations exist in the genomic sequences and organizations of GnRH3, although the conservative structure of four exons and three introns have been described in the previous studies (Okubo and Nagahama, 2008; Roch et al., 2011). Analyzing the LcGnRH3 promoter sequence presents a number of potential binding sites for the transcriptional factors, such as AP1, CREB, C/EBP, GATA-1, Oct-1, RXR, SOX, and Brn gene families (Fig. 4). The first five factors and SOX family have been identified for their roles in regulating the expression of GnRH genes via interacting with the enhancers and promoters (Dong et al., 1993; Belsham and Mellon, 2000; Chen et al., 2001; Lawson et al., 2002; Rave-Harel et al., 2004; Kitahashi et al., 2005; Hu et al., 2008; Kim et al., 2011). RXR and Brn
W. Huang et al. / Gene 576 (2016) 458–465
463
Fig. 5. GFP expression in a representative zebrafish larval expressing the LcGnRH3-EGFP construct. Dorsal views (A–D) of bright-field, (a–d) of fluorescent, and (E–H) of merged images of the head. (A, a, E) Bilateral expressions of enchanced green fluorescent protein (white arrowheads) are within the area between the olfactory organ and olfactory bulb at 3 dpf. (B, b, F) Neurons expressing EGFP send perikarya (white arrowheads) toward the developing brain at 4 dpf. (C, c, G) The positive expressions cross the presumptive terminal nerve ganglion (arrows) and migrate along the ventral aspects of the telencephalon (dashed rectangle) at 6 dpf. (D, d, H) The positive expressions cross the telencephalon, and enter the hypothalamus (real line rectangle) at 12 dpf. Scale bar = 40 μM. Olf, olfactory organ; OB, olfactory bulb; TNg, terminal nerve ganglion.
families were also found in the GnRH3 promoters of tilapia, medaka, silver sea bream, and half-smooth tongue sole, playing important roles in tissue-specific expression (Wolfe et al., 2002; Kitahashi et al., 2005; Hu et al., 2008; Shi et al., 2010; Zhou et al., 2012). These factors are conserved among the promoters of teleost GnRH genes, suggesting that they may participate in the transcriptional regulation of LcGnRH3.
Three putative HSF, one putative FOXA 2. and seven putative FOXL 1 binding sites are also found in the LcGnRH3 promoter for the first time (Fig. 4). The heat shock factors (HSF) are thought to be concerned with the breeding of teleost. Kitahashi et al., 2005 have mentioned but failed to find them in the promoters of the tilapia GnRH genes. The family of forkhead box (FOX) transcription factors are characterized by a
464
W. Huang et al. / Gene 576 (2016) 458–465
distinct DNA-binding forkhead domain and play critical roles in the regulation of gonadotropins, luteinizing hormone (LH), and folliclestimulating hormone (FSH) in mouse (Thackray, 2014). In addition, some transcriptional factors found in other teleost species do not present in the sequence of LcGnRH3 promoter, such as Olf-1, USF, GR, and ER (Paech et al., 1997; Kramer et al., 2000; Fan et al., 2010; Zambrano et al., 2014). Meanwhile, varying degrees of identity from 75% to 25% are revealed between the LcGnRH3 promoter sequence and other GnRH3 promoters in Fig. s. Therefore, it is possible that the LcGnRH3 gene has a distinct regulation by these characteristic transcriptional factors. The neurons of GnRH3 expressing fluorescence derived by the endogenous promoter have been visible in vivo in the transgenic zebrafish and medaka lines (Torgersen et al., 2002; Wayne et al., 2005). Palevitch et al., 2007 and Abraham et al., 2008 have reported that zebrafish GnRH3:EGFP expressed originally in the olfactory placode at 3 dpf, and migrated caudally to the terminal nerve ganglion (TNg) and the telencephalon at 6 dpf, then backward to target the hypothalamus. In this study, the GFP green signals in the developing zebrafish brain derived by LcGnRH3 promoter exhibit the presumed migrational tract including the olfactory region, the TNg, the telencephalon, and the hypothalamus (Fig. 5). These results are generally consistent with previous reports mentioned above, demonstrating the conservation roles of GnRH3 between large yellow croaker and zebrafish. Whereas, two defects are observed from the LcGnRH3:EGFP expression pattern as compared to that of transgenic zebrafish lines, even if the longest regulatory sequence of 3602 bp were used. The first is that the LcGnRH3:EGFP positive route is discontinuous in this study, but the continuum could be formed by the GnRH3 cells from the olfactory bulb through the TNg, into the telencephalon since 8 dpf in the previous studies (Palevitch et al., 2007; Palevitch et al., 2010; Kuo et al., 2014). The second, Abraham et al., 2008 have described that GnRH3 neurons reached the hypothalamus at 12 dpf and remained clearly visible throughout the entire migrational route even at 30 dpf. However, the bilateral fluorescence getting to the hypothalamus at 12 dpf in this study is weaker, and no longer extends within the later days. Similar phenomenon has been observed in silver sea bream. The silver sea bream GnRH3 promoter (3.8 kb) could show tissue specificity in zebrafish during the early 2–3 days, but the EGFP within the later development stages was not supplied by the report (Hu et al., 2008). What accounts for these defects between the species? Cabrera-Wrooman et al., 2013 have demonstrated that the cell-specific expression of human GnRH receptor could be influenced by the regulatory motifs in rat counterpart sequence. Therefore, we suppose that some particular transcriptional factors or distinct regulatory manners of GnRH3 might exist in the different teleost families. In summary, the present study has isolated the full-length cDNA and the genomic sequences of GnRH3 from L. crocea and analyzed its conservative characteristics by investigating the genomic organization, expression pattern, and promoter activity. The results indicated that the LcGnRH3 had similar functions to other teleost GnRH3 genes. Meanwhile, evidences of the genomic organizations, the potential transcriptional factors, and the GFP expression patterns in zebrafish larvae suggested that some distinctions existed in the different teleost families. Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.gene.2015.10.063.
Acknowledgements This work was supported by the grants from the National Key Technology R&D Program Foundation of China (2012AA10A403), and Zhejiang Provincial Program Foundation for Selective Breeding and Development of New Agricultural Varieties (2012C12907).
References Abraham, E., Palevitch, O., Ijiri, S., Du, S.J., Gothilf, Y., Zohar, Y., 2008. Early development of forebrain gonadotrophin-releasing hormone (GnRH) neurons and the role of GnRH as an autocrine migration factor. J. Neuroendocrinol. 20, 394–405. Belsham, D.D., Mellon, P.L., 2000. Transcription factors Oct-1 and C/EBP beta (CCAAT/ enhancer-binding protein-beta) are involved in the glutamate/nitric oxide/ cyclicguanosine 5′-monophosphate-mediated repression of mediated repression of gonadotropin-releasing hormone gene expression. Mol. Endocrinol. 14, 212–228. Cabrera-Wrooman, A., Janovick, J.A., Conn, P.M., 2013. Species sequence differences determine the interaction of GnRH receptor with the cellular quality control system. Mol. Cell. Endocrinol. 381, 1–7. Chen, A., Laskar-Levy, O., Ben-Aroya, N., Koch, Y., 2001. Transcriptional regulation of the human GnRH II gene is mediated by a putative cAMP response element. Endocrinology 142, 3483–3492. Chen, H., Chen, W., Lin, G.W., Liu, Z.K., Xie, Y.Q., Gao, Z.G., 2007. The morphological characteristics and growth pattern of cagecultured large yellow croaker (Larimichthys crocea) in Guanjing-Yang population. Hai Yang Ke Xue 29, 331–336. Clarke, I.J., Parkington, H.C., 2014. Gonadotropin inhibitory hormone (GnIH) as a regulator of gonadotropes. Mol. Cell. Endocrinol. 385, 36–44. Dong, K.W., Yu, K.L., Roberts, J.L., 1993. Identification of a major up-stream transcription start site for the human progonadotropin-releasing hormone gene used in reproductive tissues and cell lines. Mol. Endocrinol. 7, 1654–1666. Fan, C.H., Lu, C.L., Yang, J.L., Hu, X.Q., Ren, Y., Cai, H., Chen, M., Hu, Z.Y., Gao, F., Liu, Y.X., 2010. Signal pathway of GnRH-III inhibiting FSH-induced steroidogenesis in granulosa cells. Front. Biosci. 2, 1218–1226. Gelfman, S., Burstein, D., Penn, O., Savchenko, A., Amit, M., Schwartz, S., Pupko, T., Ast, G., 2012. Changes in exon–intron structure during vertebrate evolution affect the splicing pattern of exons. Genome Res. 22, 35–50. González-Martínez, D., Madigou, T., Zmora, N., Anglade, I., Zanuy, S., Zohar, Y., Elizur, A., Muñoz-Cueto, J.A., Kah, O., 2001. Differential expression of three different preproGnRH (gonadotrophin-releasing hormone) messengers in the brain of the European sea bass (Dicentrarchus labrax). J. Comp. Neurol. 429, 144–155. Guilgur, L.G., Ortí, G., Strobl-Mazzulla, P.H., Fernandino, J.I., Miranda, L.A., Somoza, G.M., 2007. Characterization of the cDNAs encoding three GnRH forms in the pejerrey fish Odontesthes bonariensis (Atheriniformes) and the evolution of GnRH precursors. J. Mol. Evol. 64, 614–627. Hu, S.Y., Chen, M.H., Lin, Y.C., Lin, G.H., Gong, H.Y., Yang, T.H., Wu, J.L., 2008. Cloning and functional analysis of the proximal promoter region of the three GnRH genes from the silver sea bream (Sparus sarba). Comp. Biochem. Physiol. B Biochem. Mol. Biol. 151, 373–380. Huang, W., Zhou, L., Li, Z., Gui, J.F., 2009. Expression pattern, cellular localization and promoter activity analysis of ovarian aromatase (Cyp19a1a) in protogynous hermaphrodite red-spotted grouper. Mol. Cell. Endocrinol. 307, 224–236. Karigo, T., Oka, Y., 2013. Neurobiological study of fish brains gives insights into the nature of gonadotropin-releasing hormone 1–3 neurons. Front. Endocrinol. 4, 177. Kavanaugh, S.I., Nozaki, M., Sower, S.A., 2008. Origins of gonadotropin-releasing hormone (GnRH) in vertebrates: identification of a novel GnRH in a basal vertebrate, the sea lamprey. Endocrinology 149, 3860–3869. Kim, H.D., Choe, H.K., Chung, S., Kim, M., Seong, J.Y., Son, G.H., Kim, K., 2011. Class-C SOX transcription factors control GnRH gene expression via the intronic transcriptional enhancer. Mol. Endocrinol. 7, 1184–1196. Kitahashi, T., Sato, H., Sakuma, Y., Parhar, I.S., 2005. Cloning and functional analysis of promoters of three GnRH genes in a cichlid. Biochem. Biophys. Res. Commun. 336, 536–543. Kramer, P.R., Guerrero, G., Krishnamurthy, R., Mitchell, P.J., Wray, S., 2000. Ectopic expression of luteinizing hormone-releasing hormone and peripherin in the respiratory epithelium of mice lacking transcription factor AP-2alpha. Mech. Dev. 94, 79–94. Kuo, M.W., Lou, S.W., Postlethwait, J., Chung, B.C., 2005. Chromosomal organization, evolutionary relationship, and expression of zebrafish GnRH family members. J. Biomed. Sci. 12, 629–639. Kuo, M.W., Luo, S.W., Chung, B.C., 2014. Hedgehog-PKA signaling and gnrh3 regulate the development of zebrafish gnrh3 neurons. PLoS ONE 9 (5), e95545. Lawson, M.A., Macconell, L.A., Kim, J., Powl, B.T., Nelson, S.B., Mellon, P.L., 2002. Neuronspecific expression in vivo by defined transcription regulatory elements of the GnRH gene. Endocrinology 143, 1404–1412. Lethimonier, C., Madigou, T., Munoz-Cueto, J.A., Lareyre, J.J., Kah, O., 2004. Evolutionary aspects of GnRHs, GnRH neuronal systems and GnRH receptors in teleost fish. Gen. Comp. Endocrinol. 135, 1–16. Li, F.B., Gui, J.F., 2008. Clonal diversity and genealogical relationships of gibel carp in four hatcheries. Anim. Genet. 39, 28–33. Lin, D., Zhang, J., Luo, J., Zheng, Z.Y., Shi, X.W., 1992. Studies on the gonadal development and the annual reproductive cycle of the cultured large yellow croaker, Pseudosciaena crocea (Richardson). J. Fujian Normal Univ. (Nat. Sci.) 8, 81–87. Ma, X.X., Zhu, J.Q., Zhou, H., Yang, W.X., 2012. The formation of zona radiata in Pseudosciaena crocea revealed by light and transmission electron microscopy. Micron 43, 435–444. Mohamed, J.S., Khan, I.A., 2006. Molecular cloning and differential expression of three GnRH mRNAs in discrete brain areas and lymphocytes in red drum. J. Endocrinol. 188, 407–416. Oka, Y., 2009. Three types of gonadotrophin-releasing hormone neurons and steroidsensitive sexually dimorphic kisspeptin neurons in teleosts. J. Neuroendocrinol. 21, 334–338. Okubo, K., Nagahama, Y., 2008. Structural and functional evolution of gonadotropinreleasing hormone in vertebrates. Acta Physiol. 193, 3–15.
W. Huang et al. / Gene 576 (2016) 458–465 Okubo, K., Mitani, H., Naruse, K., Kondo, M., Shima, A., Tanaka, M., Asakawa, S., Shimizu, N., Yoshiura, Y., Aida, K., 2002. Structural characterization of GnRH loci in the medaka genome. Gene 293, 181–189. Okubo, K., Sakai, F., Lau, E.L., Yoshizaki, G., Takeuchi, Y., Naruse, K., Aida, K., Nagahama, Y., 2006. Forebrain gonadotropin-releasing hormone neuronal development: insights from transgenic medaka and the relevance to X-linked Kallmann syndrome. Endocrinology 147, 1076–1084. Paech, K., Webb, P., Kuiper, G.G., Nilsson, S., Gustafsson, J., Kushner, P.J., Scanlan, T.S., 1997. Differential ligand activation of estrogen receptors ER alpha and ER beta at AP1 sites. Science 277, 1508–1510. Palevitch, O., Kight, K., Abraham, E., Wray, S., Zohar, Y., Gothilf, Y., 2007. Ontogeny of the GnRH systems in zebrafish brain: in situ hybridization and promoter-reporter expression analyses in intact animals. Cell Tissue Res. 327, 313–322. Palevitch, O., Abraham, E., Borodovsky, N., Levkowitz, G., Zohar, Y., Gothilf, Y., 2010. Cxcl12a-Cxcr4b signaling is important for proper development of the forebrain GnRH system in zebrafish. Gen. Comp. Endocrinol. 165, 262–268. Pandolfi, M., Parhar, I.S., Ravaglia, M.A., Meijide, F.J., Maggese, M.C., Paz, D.A., 2002. Ontogeny and distribution of gonadotropin-releasing hormone (GnRH) neuronal systems in the brain of the cichlid fish Cichlasoma dimerus. Anat. Embryol. 205, 271–281. Pu, L., Han, K., Xie, F., Zou, Z., Close, D., Zhang, Z., Wang, Y., 2013. Molecular cloning, characterization, and gene expression of the androgen receptor in the large yellow croaker, Larimichthys crocea. Fish Physiol. Biochem. 39, 309–324. Rave-Harel, N., Givens, M.L., Nelson, S.B., Duong, H.A., Coss, D., Clark, M.E., Hall, S.B., Kamps, M.P., Mellon, P.L., 2004. TALE homeodomain proteins regulate gonadotropin-releasing hormone gene expression independently and via interactions with Oct-1. J. Biol. Chem. 279, 30287–30297. Roch, G.J., Busby, E.R., Sherwood, N.M., 2011. Evolution of GnRH: diving deeper. Gen. Comp. Endocrinol. 171, 1–16. Shi, G., Sohn, K.C., Choi, D.K., Kim, Y.J., Kim, S.J., Ou, B.S., Piao, Y.J., Lee, Y.H., Yoon, T.J., Lee, Y., Seo, Y.J., Kim, C.D., Lee, J.H., 2010. Brn2 is a transcription factor regulating keratinocyte differentiation with a possible role in the pathogenesis of lichen planus. PLoS ONE 5, e13216. Steven, C., Lehnen, N., Kight, K., Ijiri, S., Klenke, U., Harris, W.A., Zohar, Y., 2003. Molecular characterization of the GnRH system in zebrafish (Danio rerio): cloning of chicken GnRH-II, adult brain expression patterns and pituitary content of salmon GnRH and chicken GnRH-II. Gen. Comp. Endocrinol. 133, 27–37. Sukhan, Z.P., Kitano, H., Selvaraj, S., Yoneda, M., Yamaguchi, A., Matsuyama, M., 2013. Identification and distribution of three gonadotropin-releasing hormone (GnRH) isoforms in the brain of a clupeiform fish, Engraulis japonicus. Zool. Sci. 30, 1081–1091.
465
Thackray, V.G., 2014. Fox tales: regulation of gonadotropin gene expression by forkhead transcription factors. Mol. Cell. Endocrinol. 385, 62–70. Torgersen, J., Nourizadeh-Lillabadi, R., Husebye, H., Aleström, P., 2002. In silico and in situ characterization of the zebrafish (Danio rerio) gnrh3 (sGnRH) gene. BMC Genomics 3, 25–37. Wayne, N.L., Kuwahara, K., Aida, K., Nagahama, Y., Okubo, K., 2005. Whole-cell electrophysiology of gonadotropin-releasing hormone neurons that express green fluorescent protein in the terminal nerve of transgenic medaka (Oryzias latipes). Biol. Reprod. 73, 1228–1234. White, R.B., Fernald, R.D., 1998. Genomic structure and expression sites of three gonadotropin-releasing hormone genes in one species. Gen. Comp. Endocrinol. 112, 17–25. Wolfe, A., Kim, H.H., Tobet, S., Stafford, D.E., Radovick, S., 2002. Identification of a discrete promoter region of the human GnRH gene that is sufficient for directing neuronspecific expression: a role for POU homeodomain transcription factors. Mol. Endocrinol. 16, 435–449. Xia, W., Smith, O., Zmora, N., Xu, S., Zohar, Y., 2014. Comprehensive analysis of GnRH2 neuronal projections in zebrafish. Sci. Rep. 14, 3676. You, Y.L., Lin, D.J., 1997. The ultrastructure of the spermatozoon of the teleost, Pseudosciaena crocea (Richardson). Acta Zool. Sin. 43, 119–126. You, Y.L., Lin, D.J., Chen, L.Y., 2001. Spermatogenesis of teleosts, Pseudosciaena crocea. Zool. Res. 22, 461–466. Zambrano, E., Guzmán, C., Rodríguez-González, G.L., Durand-Carbajal, M., Nathanielsz, P.W., 2014. Fetal programming of sexual development and reproductive function. Mol. Cell. Endocrinol. 382, 538–549. Zhao, Y., Lin, M.C., Farajzadeh, M., Wayne, N.L., 2013. Early development of the gonadotropin-releasing hormone neuronal network in transgenic zebrafish. Front. Endocrinol. 4, 107. Zhou, X., Yi, Q., Zhong, Q., Li, C., Muhammad, S., Wang, X., Wang, Z., Qi, J., Yu, H., Zhang, Q., 2012. Molecular cloning, tissue distribution, and ontogeny of gonadotropin-releasing hormone III gene (GnRH-III) in half-smooth tongue sole (Cynoglossus semilaevis). Comp. Biochem. Physiol. B Biochem. Mol. Biol. 163, 59–64. Zohar, Y., Muñoz-Cueto, J.A., Elizur, A., Kah, O., 2010. Neuroendocrinology of reproduction in teleost fish. Gen. Comp. Endocrinol. 165, 438–455.
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
Research paper
Genomic structure and promoter functional analysis of GnRH3 gene in large yellow croaker (Larimichthys crocea) Wei Huang, Jianshe Zhang, Zhi Liao, Zhenming Lv, Huifei Wu, Aiyi Zhu, Changwen Wu ⁎ National Engineering Research Center of Marine Facilities Aquaculture, College of Marine Science and Technology, Zhejiang Ocean University, Zhoushan, Zhejiang 316022, PR China
a r t i c l e
i n f o
Article history: Received 22 August 2015 Received in revised form 9 October 2015 Accepted 24 October 2015 Available online 28 October 2015 Keywords: GnRH3 Genomic structure Promoter analysis Larimichthys crocea
a b s t r a c t Gonadotropin-releasing hormone III (GnRH3) is considered to be a key neurohormone in fish reproduction control. In the present study, the cDNA and genomic sequences of GnRH3 were cloned and characterized from large yellow croaker Larimichthys crocea. The cDNA encoded a protein of 99 amino acids with four functional motifs. The full-length genome sequence was composed of 3797 nucleotides, including four exons and three introns. Higher identities of amino acid sequences and conserved exon–intron organizations were found between LcGnRH3 and other GnRH3 genes. In addition, some special features of the sequences were detected in partial species. For example, two specific residues (V and A) were found in the family Sciaenidae, and the unique 75–72 bp type of the open reading frame 2 and 3 existed in the family Cyprinidae. Analysis of the 2576 bp promoter fragment of LcGnRH3 showed a number of transcription factor binding sites, such as AP1, CREB, GATA-1, HSF, FOXA2, and FOXL1. Promoter functional analysis using an EGFP reporter fusion in zebrafish larvae presented positive signals in the brain, including the olfactory region, the terminal nerve ganglion, the telencephalon, and the hypothalamus. The expression pattern was generally consistent with the endogenous GnRH3 GFP-expressing transgenic zebrafish lines, but the details were different. These results indicate that the structure and function of LcGnRH3 are generally similar to the other teleost GnRH3 genes, but there exist some distinctions among them. © 2015 Elsevier B.V. All rights reserved.
1. Introduction Gonadotropin-releasing hormone III (GnRH3), also known as salmonGnRH, is a specific decapeptide discovered in teleost fishes. It is one form of the gonadotropin-releasing hormones, which act on the pituitary to stimulate the synthesis and secretion of gonadotropins (Oka, 2009; Zohar et al., 2010; Clarke and Parkington, 2014). Like other GnRH forms, GnRH3 of diverse teleosts have been declared to share a common structure of 4 exons and 3 introns, in which the coding regions are highly conserved, and the upstream and downstream regions and intron sequences are distinctively divergent (González-Martínez et al., 2001; Torgersen et al., 2002; Guilgur et al., 2007; Kavanaugh et al., 2008; Zhou et al., 2012; Sukhan et al., 2013). Whereas, no report has attempted to distinguish the noncoding regions. Hence, many estimates of GnRH3
Abbreviations: GnRH3, gonadotropin-releasing hormone III; LCGnRH3, Larimichthys crocea GnRH3; GFP, green fluorescent protein; EGFP, enhanced green fluorescent protein; UTR, untranslated region; ORF, open reading frame; GAP, GnRH associated pepetide; AP1, activator protein 1; CREB, cAMP response element binding protein; C/ EBP, CCAAT/enhancer binding protein; GATA-1, GATA binding protein-1; Oct-1, octamer transcription factor-1; RXR, retinoid-x recept; SOX, SRY-related HMG-box family members; HSF, heat shock factor; Brn, POU domain transcription factor family members; AREB, ABA-responsive element binding factor; Fox, forkhead/winged helix-box family members; TNg, terminal nerve ganglion. ⁎ Corresponding author.
http://dx.doi.org/10.1016/j.gene.2015.10.063 0378-1119/© 2015 Elsevier B.V. All rights reserved.
genomic sequences may be requested, because the differences of noncoding sequences often link with the phylogenetic classification between the different teleost species (White and Fernald, 1998; Gelfman et al., 2012). GnRH3 is synthesized and released from a small number of hypothalamic neurons within the brain (Pandolfi et al., 2002; Lethimonier et al., 2004; Kuo et al., 2005). Migration is an essential feature of developing GnRH3 neurons as demonstrated in zebrafish and medaka, in which the GnRH3 neurons tagged with the green fluorescent protein (GFP) in fetal olfactory region were transplanted to the hypothalamicpreoptic area region and trigeminal ganglion (Okubo et al., 2006; Abraham et al., 2008; Zhao et al., 2013). In addition, an active tissue specificity of the silver sea bream GnRH3 promoter was validated in zebrafish larvae with transgenic technology (Hu et al., 2008). These results show that zebrafish can be used as an efficient model organism to assay the activity of a particular GnRH3 promoter sequence. Large yellow croaker, Larimichthys crocea, is a commercially important marine fish and cultured on a large scale in China. The great demands for breeding services encourage further studies on its reproductive system (Lin et al., 1992; You and Lin, 1997; You et al., 2001; Chen et al., 2007; Ma et al., 2012; Pu et al., 2013). In the present study, we cloned the GnRH3 gene of large yellow croaker (LcGnRH3), and compared its exonintron organizations with other teleost GnRH3 genes. The promoter activity of LcGnRH3 was evaluated using an EGFP reporter fusion in zebrafish since transgenic technology has not been sufficiently developed with high efficiency in large yellow croaker. Potential regulatory motifs in
W. Huang et al. / Gene 576 (2016) 458–465
the promoters of different teleost GnRH3 were also analyzed and aligned, aiming to detect the core promoter sequences for regulatory. 2. Materials and methods 2.1. Total RNA extraction and SMART cDNA synthesis Large yellow croakers were obtained from the mari-culture farm at Dongji island, Zhoushan city, China. The entire brain was collected from a 2-year-old female and immediately dipped in RNA Later™ (Qiagen) at room temperature for 1 h. Then, the sample was stored at − 20 °C until use for total RNA isolation. Total RNA was extracted using TRIzol reagent (Invitrogen). The RNA quality and purity were measured by spectrophotometry (Eppendorf Biometer) and by electrophoresis on 1% agarose gels. SMART cDNAs were synthesized from 50 ng of total RNA using the SMART cDNA Library Construction Kit following commercial protocol (Clontech, USA). 2.2. RACE analysis and cloning of LcGnRH3 To obtain the GnRH3 cDNA fragment of L. crocea, degenerate sense and antisense primers (Table 1) were designed based on amino acid sequences which are highly conserved among fishes got from the NCBI website. PCR was performed in a 25 μl reaction mix containing 1 μl brain cDNA as template DNA, 0.2 μM each primer, 0.5 U taq polymerase (MBI, Fermentas), 0.1 μM of each dNTP, 1 × buffer for Taq polymerase (MBI, Fermentas). Amplification condition was: 94 °C, 20 s; 55 °C, 30 s; and 72 °C, 1 min for 32 cycles. A PCR fragment, homologous to GnRH3, was then used as the template for design of the following gene-specific rapid amplification of cDNA ends (RACE) PCR primers. The 3′-RACE was performed by common SMART3′-primer and RaceF primer (Table 1). For 5′-RACE, primers were common SMART 5′-primer and RaceR primer (Table 1). PCR conditions for RACE were as follows: 94 °C, 20 s; 61 °C, 30 s; and 72 °C, 50 s for 32 cycles. All the expected PCR products were directly subcloned into pMD18-T simple vector (Takara) and sequenced. The full-length cDNA sequence was amplified with two gene-specific primers (GnRH-w-F and GnRH-w-R). 2.3. Genomic DNA amplification and cloning The genomic DNA fragment and its upstream region of the large yellow croaker GnRH3 gene were cloned with the Universal GenomeWalker™ Kit (BD, Biosciences), according to the user manual protocol. In brief, the genomic DNA was isolated from large yellow croaker tail fin using standard phenol/chloroform alcohol extraction method as described by Li and Gui (2008). Then, aliquots of genomic DNA (2.5 μg) Table 1 Primers used in this study. Name
Sequence (5′–3′)
Remark
Sense Antisense RaceR RaceF GnRH-w-F GnRH-w-R GSP1a GSP1b GSP2a GSP2b GSP3a GSP3b AP1 AP2
ATGGTGCAGGTGTTGTTGTTG TGACTGGAATCATCATTAAT ATCATTAATTACATTGTATGG TGTTGTTGTTGGCGTTGGC ATGCTAACAAGACAAATAC ACATGATAATGTCAGTACTCTGC TACTCTGCACTCGATCCATC TCTGCACTCGATCCATCACTGGTG AAGTAAGCAGAAGCCTTGC ATGTCAGAGTTCCCTTCCTTG TAGTAATGCATTTCAAGTAG TAGGTAAAGTTGGACTACAG GTAATACGACTCACTATAGGGC ACTATAGGGCACGCGTGGT
Wholelength-F9
CCAAGCTTTGTGATGTGGTTGCTG
Trans-R
CGGGATCCATTATTAGCGAACCTTTC
Fragment PCR Fragment PCR 5′ RACE PCR 3′ RACE PCR Full-length cDNA PCR Full-length cDNA PCR Genome walking step 1 Genome walking step 1 Genome walking step 2 Genome walking step 2 Genome walking step 3 Genome walking step 3 Supplied with Kit Supplied with Kit Whole length PCR, containing Hind III site transgenic vector construct, containing BamH I site
459
were digested at 37 °C for 16 h with one of four different restriction enzymes (80 units of Dra I, EcoR V, Pvu II, or Stu I), and the digested blunt end DNAs were purified by phenol extraction and ethanol precipitation. Then, each batch of DNA (100 ng) was separately ligated to the Genome Walker Adaptor at 16 °C overnight. The reaction was stopped by incubating each sample at 70 °C for 5 min and adding 10 volumes of TE (pH 7.5). The primary round “genome walking” PCR was respectively performed from the constructed GenomeWalker libraries by the genespecific primer GSP1a and the kit's outer adapter primer AP1, and followed by a nested second amplification with gene-specific primer GSP1b and the kit's nested adapter primer AP2 according to the manufacturer's protocol as described by Huang et al. (2009). The PCR products were separated and purified in 1% agarose gel. Then, the purified fragments were cloned into pMD18-T simple vector (Takara) and sequenced. The resultant DNA fragment contained only a short piece of the 5′-flanking region. Therefore, a second and a third round of nested “genomewalking” PCRs were conducted sequentially with primers GSP2a and GSP2b, GSP3a and GSP3b, respectively, and the amplified fragments were cloned and sequenced. To isolate the entire 5′-flanking region of LcGnRH3, one forward primer Wholelength-F9, which was also used in the following expression vector constructs, was designed according to the third-round amplified sequence. Consequently, the entire 5′-flanking region of LcGnRH3 was amplified from a high-quality genomic DNA by the pair of primers Wholelength-F9 and GSP1a, and cloned and sequenced as described above. All primers used in these amplifications are listed in Table 1. 2.4. Genomic structure and sequence analysis The nucleotide and deduced amino acid sequences of LcGnRH3 cDNA was analyzed with BioEdit 7.0.1 and Expasy search program (http://au. expasy.org/tools/). Genomic structure was analyzed by CLUSTAL W version 2.0. The nucleotide and amino acid sequences homology were analyzed using the programs BLASTN and BLASTP at heep://www.ncbi. nlm.nih.gov/BLAST. The genomic DNA and protein sequences of GnRH3 from different species were collected from the GenBank/EMBL Database of the National Center of Biotechnology Information (NCBI). Multiple sequence alignments and the phylogenetic tree were performed using the program GENEDOC version 2.6 and MEGA version 4.0 under default settings. The potential transcription factor binding sites were identified by MatInspector (http://www.genomatix.de) and TFSEARCH (http:// www.cbrc.jp/research/db/TFSEARCH.html). 2.5. Construction of LcGnRH3:EGFP transgenic vectors A 3602 bp genomic fragment containing 2576 bp of the LcGnRH3 5′flanking region and 1026 bp of the three introns and four exons, except the 3′-untranslated region (UTR), was amplified by the pair primers of Wholelength-F9 and Trans-R from large yellow croaker genomic DNA. The product was subcloned into pMD18-T simple vector. The resulting clone was then digested with Hind III and BamH I, and the insert was ligated into Hind III/BamH I-cut enhanced green fluorescent protein expression vector, pEGFP-1 (Clontech). All of these fragments were sequenced to ensure their correct orientation. Plasmid DNA for microinjection was purified with an E.Z.N.A.™ Plasmid Mini Kit (OMEGA). Plasmid quantity and purity were determined with 1% agarose gel electrophoresis. 2.6. Microinjection and transient expression in zebrafish Transient expression of the LcGnRH3:EGFP constructs was obtained by microinjection of zebrafish embryos as described (Palevitch et al., 2007; Xia et al., 2014). Approximately 2 nl were injected into the cytoplasm of one- or two-cell-stage wildtype zebrafish zygotes using a micromanipulator and microinjection apparatus (Harvard Apparatus, PL1-100, Holliston, MA). The constructs were injected separately (200 ng/μl)
460
W. Huang et al. / Gene 576 (2016) 458–465
into more than 400 embryos. Injected embryos were kept under light/ dark (12 h:12 h) cycles and repeatedly observed on days 1–35 pf. Green fluorescence in live embryos was detected using an Olympus dissecting microscope (SZX12) equipped with appropriate filter sets.
was also presented between these three species by the phylogenetic analysis, which belong to the family Sciaenidae (Fig. 2b).
3. Results
Four exons and three introns were identified by comparing the LcGnRH3 cDNA sequence to the genomic DNA frgaments. The lengths of exons 1, 2, 3, and 4 were 23, 143, 81, and 246 bp, while introns 1, 2, and 3 were 191, 239, and 298 bp, respectively (Fig. 3). Exon 1 encoded the most part of 5′-UTR; exon 2 encoded a small part of 5′-UTR, the signal peptide, GKR, and the N-terminus of GAP; exon 3 encoded the middle portion of GAP, and exon 4 contained the C-terminus of GAP and the 3′-UTR. Comparison of the nucleotide sequence of LcGnRH3 with the counterparts of other teleosts revealed that a high degree of similarity existed in the exon–intron organizations. As shown in Fig. 3, each GnRH3 gene spanned four exons and three introns, and the location of exon–intron junction sites were conserved. Slight distinctions existed in the 5′-UTRs and the ORF-encoding regions, and the main difference was the dynamic sizes of the introns and the 3′-UTRs. Further analysis displayed that all of the first ORF-encoding regions were at the same size of 138 bp, while the ORF-encoding regions 2 and 3 were divided into two classes of sizes, 81–54 bp type in the first seven species, and 75–72 bp type in goldfish Carassius auratus, common carp Cyprinus carpio and zebrafish, respectively. The near-unanimous sizes were observed between Burton's mouthbrooder Haplochromis burtoni, Nile tilapia, goldfish, and common carp.
3.1. Identification of LcGnRH3 gene Initially, a partial fragment of 218 bp was amplified from the wholebrain cDNA using two degenerated primers. The remaining regions of LcGnRH3 cDNA were subsequently obtained by 5′ and 3′ RACE approaches. Overlapping sequences of all fragments yielded a full-length cDNA with 30 bp of 5′-untranslated region (UTR), 192 bp of 3′-untranslated region and 273 bp of the open reading frame (ORF). The typical polyadenylation signal sequence (AATAAA) was located at 14 nt upstream of the poly (A) tail. The complete ORF encoded a protein of 91 amino acids with a calculated molecular weight of 10 kDa, which contained a 23 aa putative signal peptide, a conserved GnRH decapeptide, a 3 aa proteolytic cleavage site GKR, and a 55 aa GnRH-associated pepetide (GAP) (GenBank accession no. KM819573) (Fig. 1). BLASTP analysis revealed that the deduced amino acid sequence of LcGnRH3 was strikingly homologous to other teleost GnRH3 proteins (Fig. 2a). The identities were 98%, 97%, 92%, 91%, 90%, and 84% with those of red drum Sciaenops ocellatus, Atlantic croaker Micropogonias undulatus, flathead mullet Mugil cephalus, black sea bass Centropristis striata, Mozambique tilapia Oreochromis mossambicus, and threespined stickleback Gasterosteus aculeatus, respectively. Alignment analysis showed that all of GnRH3 proteins were composed of four functional domains (F1, F2, F3, and F4) (Fig. 2a), of which two conserved residues (V and A) were specific in the signal peptide domain of large yellow croaker, red drum, and atlantic croaker. A closer relationship
3.2. Genomic analysis of LcGnRH3
3.3. Sequence and characterization of LcGnRH3 promoter A total of 2576 bp 5′-flanking sequence of LcGnRH3 gene was obtained from the genomic DNA of large yellow croaker by three rounds of nested PCRs using the GenomeWalker™ Universal Kit. It included a
Fig. 1. Genomic sequences of LcGnRH3 (GenBank accession no. KM819573). The open reading frame (ORF) is underlined and the deduced amino acid residues are represented as singleletter abbreviations. The stop codon is marked by an asterisk. The conserved GnRH decapeptide and the 3 aa proteolytic cleavage site GKR are boxed with dotted and solid lines, respectively. The 5′−/3′- untranslated regions (UTRs) are shadow. Consensus sequences of the TATA box and the AATAAA are in bold.
W. Huang et al. / Gene 576 (2016) 458–465
461
Fig. 2. (a) Multiple amino acid alignment of the deduced LcGnRH3 protein with other teleost GnRH3 proteins. Identical amino acid residues are emphasized in black and gray. Putative functional domains are indicated (F1, the putative signal peptides; F2, the conserved GnRH decapeptide; F3, the GKR proteolytic cleavage site; F4, the GnRH-associated peptide). Specific residues of the family Sciaenidae GnRH3 proteins are marked by black triangles. And, the percentages of identities are shown at the end of their amino acid sequences. The accession numbers for the protein sequences are as follows: red drum (Sciaenops ocellatus) AAT80329, Atlantic croaker (Micropogonias undulatus) AAQ16503, flathead mullet (Mugil cephalus) AAQ83268, black sea bass (Centropristis striata) AHB89706, Mozambique tilapia (Oreochromis mossambicus) AAO11648, three-spined stickleback (Gasterosteus aculeatus) AFY12650. (b) Phylogenetic tree of the above GnRH3 peptide sequences based on neighbor-joining (NJ) method. The phylogeny is presented as an unrooted transformed cladogram for best presentation.
consensus TATA box motif at the adenosine 23 bp upstream of the transcription initiation site and had been deposited into the GenBank database with accession number KM819573. Potential regulatory motifs analysis using MatInspector and TFSEARCH revealed a number of transcription factor binding sites for activator protein 1 (AP 1), cAMP response element binding protein (CREB), CCAAT/enhancer binding protein (C/EBP), GATA binding protein-1 (GATA-1), octamer transcription factor-1 (Oct-1), retinoid-x recept (RXR), SRY-related HMG-box
family members (SOX), heat shock factor (HSF), POU domain transcription factor family members (Brn), ABA-responsive element binding factor (AREB), and forkhead/winged helix-box family members (FOX) (Fig. 4). When the promoter sequence of LcGnRH3 was compared to other GnRH3 promoters, high identities from 77% to 45% were revealed. For example, the LcGnRH3 promoter was 77% identical to the silver sea bream, 71% to the black rockfish, 51% to the medaka, and 45% to the
Fig. 3. Comparison of the exon–intron organization of teleost GnRH3 genes. The boxes and bars represent the exons and introns, respectively. The blank boxes present UTRs, and the shadow boxes present ORFs. Numbers above each line refer to the sizes (bp) of corresponding exons or introns. The conserved regions among different species are marked by the red or blue rectangles. The accession numbers for the genomic sequences are as follows: grass puffer (Takifugu niphobles) AB531129, black rockfish (Sebastes schlegelii) JQ247584, half-smooth tongue sole (Cynoglossus semilaevis) JQ028869, Japanese medaka (Oryzias latipes) AB041335, Burton's mouthbrooder (Haplochromis burtoni) AF076963, Nile tilapia (Oreochromis niloticus) AB104863, goldfish (Carassius auratus) AB020242, common carp (Cyprinus carpio) AY186621, and zebrafish (Danio rerio) AF490354.
462
W. Huang et al. / Gene 576 (2016) 458–465
Nile tilapia. Whereas, lower identity 23% was found to the zebrafish GnRH3 promoter, and the potential regulatory motifs were just overlapped partially, except the motif of TATA box (Fig. s). 3.4. In vivo functional assay of LcGnRH3 promoter Zebrafish were used to evaluate the function of LcGnRH3 promoter because its optical accessibility at the embryonic and larval stages allow for easy imaging. As revealed above, some regulatory motifs in the promoter sequences were conserved between large yellow croaker and zebrafish. Microinjection of LcGnRH3:EGFP resulted in the transient expression of GFP in 31% of the embryos. We found that the large yellow croaker GnRH3 promoter was tissue-specific during zebrafish early developmental stages. As shown in Fig. 5, GFP expression was restricted to the brain area of the injected embryos. At 3 dpf, GFP was clearly visible as bilateral dots in the transitional area between the olfactory organ and olfactory bulb (Fig. 5a). During the next 2 days, green fluorescence in GnRH3 neurone perikarya was extending along the optic commissure (Fig. 5b). By 6 dpf, the positive expressions were backward to cross the presumptive terminal nerve ganglion (TNg), and the migration continued along the ventral aspects of the telencephalon (Fig. 5c). Later on, these projections crossed the telencephalon, and then entered the hypothalamus at 12 dpf (Fig. 5d). The fluorescence remained unchanged in the next stages. 4. Discussion
Fig. 4. Schematic representation of putative regulatory motifs in the promoter of LcGnRH3 gene. The scale bar refers to a nucleotide sequence distance of 100 bp.
The GnRH3 decapeptide is highly conserved among teleosts (Karigo and Oka, 2013). This conservation allowed us to use a simple method to clone the GnRH3 gene from large yellow croaker. As all known GnRH3 genes, the LcGnRH3 comprises four exons and three introns, and its decapeptide is coded by exon 2, and the GAP by exons 2, 3, and 4 (Fig. 1). The prepro-LcGnRH3 consists of four functional domains, and the sequence shows higher identities with those homologs previously cloned from other fish species (Fig. 2a). These conservative features are common to GnRH3, and consistent with the previous results in European sea bass, Japanese medaka, zebrafish, tilapia, red drum, and half-smooth tongue sole, and so on (González-Martínez et al., 2001; Okubo et al., 2002; Steven et al., 2003; Kitahashi et al., 2005; Mohamed and Khan, 2006; Zhou et al., 2012). Notably, some new elements out of the conservation of teleost GnRH3 are provided by the present study. For instance, two specific residues (V and A) are special in the list of GnRH3 proteins of Sciaenidae, which are different with other teleosts (Fig. 2a). The result of phylogenetic analysis also indicates a closer homologous relationship between the family of Sciaenidae (Fig. 2b). In addition, two major groups are revealed by the comparison of genomic organizations in ten teleost species, which GnRH3 genomic sequences are available publicly in the GenBank database. As shown in Fig. 3, the GnRH3 genes are grouped into two distinct types according to the sizes of exon1, ORF2, and ORF3, ie., a 5-138-81-54 bp type and a 7-138-75-72 bp type. Especially, higher degree of conservation are viewed in the species of family Cichlidae, and family Cyprinidae, which have more similar sizes in the corresponding exons and introns. These results suggest that familylevel variations exist in the genomic sequences and organizations of GnRH3, although the conservative structure of four exons and three introns have been described in the previous studies (Okubo and Nagahama, 2008; Roch et al., 2011). Analyzing the LcGnRH3 promoter sequence presents a number of potential binding sites for the transcriptional factors, such as AP1, CREB, C/EBP, GATA-1, Oct-1, RXR, SOX, and Brn gene families (Fig. 4). The first five factors and SOX family have been identified for their roles in regulating the expression of GnRH genes via interacting with the enhancers and promoters (Dong et al., 1993; Belsham and Mellon, 2000; Chen et al., 2001; Lawson et al., 2002; Rave-Harel et al., 2004; Kitahashi et al., 2005; Hu et al., 2008; Kim et al., 2011). RXR and Brn
W. Huang et al. / Gene 576 (2016) 458–465
463
Fig. 5. GFP expression in a representative zebrafish larval expressing the LcGnRH3-EGFP construct. Dorsal views (A–D) of bright-field, (a–d) of fluorescent, and (E–H) of merged images of the head. (A, a, E) Bilateral expressions of enchanced green fluorescent protein (white arrowheads) are within the area between the olfactory organ and olfactory bulb at 3 dpf. (B, b, F) Neurons expressing EGFP send perikarya (white arrowheads) toward the developing brain at 4 dpf. (C, c, G) The positive expressions cross the presumptive terminal nerve ganglion (arrows) and migrate along the ventral aspects of the telencephalon (dashed rectangle) at 6 dpf. (D, d, H) The positive expressions cross the telencephalon, and enter the hypothalamus (real line rectangle) at 12 dpf. Scale bar = 40 μM. Olf, olfactory organ; OB, olfactory bulb; TNg, terminal nerve ganglion.
families were also found in the GnRH3 promoters of tilapia, medaka, silver sea bream, and half-smooth tongue sole, playing important roles in tissue-specific expression (Wolfe et al., 2002; Kitahashi et al., 2005; Hu et al., 2008; Shi et al., 2010; Zhou et al., 2012). These factors are conserved among the promoters of teleost GnRH genes, suggesting that they may participate in the transcriptional regulation of LcGnRH3.
Three putative HSF, one putative FOXA 2. and seven putative FOXL 1 binding sites are also found in the LcGnRH3 promoter for the first time (Fig. 4). The heat shock factors (HSF) are thought to be concerned with the breeding of teleost. Kitahashi et al., 2005 have mentioned but failed to find them in the promoters of the tilapia GnRH genes. The family of forkhead box (FOX) transcription factors are characterized by a
464
W. Huang et al. / Gene 576 (2016) 458–465
distinct DNA-binding forkhead domain and play critical roles in the regulation of gonadotropins, luteinizing hormone (LH), and folliclestimulating hormone (FSH) in mouse (Thackray, 2014). In addition, some transcriptional factors found in other teleost species do not present in the sequence of LcGnRH3 promoter, such as Olf-1, USF, GR, and ER (Paech et al., 1997; Kramer et al., 2000; Fan et al., 2010; Zambrano et al., 2014). Meanwhile, varying degrees of identity from 75% to 25% are revealed between the LcGnRH3 promoter sequence and other GnRH3 promoters in Fig. s. Therefore, it is possible that the LcGnRH3 gene has a distinct regulation by these characteristic transcriptional factors. The neurons of GnRH3 expressing fluorescence derived by the endogenous promoter have been visible in vivo in the transgenic zebrafish and medaka lines (Torgersen et al., 2002; Wayne et al., 2005). Palevitch et al., 2007 and Abraham et al., 2008 have reported that zebrafish GnRH3:EGFP expressed originally in the olfactory placode at 3 dpf, and migrated caudally to the terminal nerve ganglion (TNg) and the telencephalon at 6 dpf, then backward to target the hypothalamus. In this study, the GFP green signals in the developing zebrafish brain derived by LcGnRH3 promoter exhibit the presumed migrational tract including the olfactory region, the TNg, the telencephalon, and the hypothalamus (Fig. 5). These results are generally consistent with previous reports mentioned above, demonstrating the conservation roles of GnRH3 between large yellow croaker and zebrafish. Whereas, two defects are observed from the LcGnRH3:EGFP expression pattern as compared to that of transgenic zebrafish lines, even if the longest regulatory sequence of 3602 bp were used. The first is that the LcGnRH3:EGFP positive route is discontinuous in this study, but the continuum could be formed by the GnRH3 cells from the olfactory bulb through the TNg, into the telencephalon since 8 dpf in the previous studies (Palevitch et al., 2007; Palevitch et al., 2010; Kuo et al., 2014). The second, Abraham et al., 2008 have described that GnRH3 neurons reached the hypothalamus at 12 dpf and remained clearly visible throughout the entire migrational route even at 30 dpf. However, the bilateral fluorescence getting to the hypothalamus at 12 dpf in this study is weaker, and no longer extends within the later days. Similar phenomenon has been observed in silver sea bream. The silver sea bream GnRH3 promoter (3.8 kb) could show tissue specificity in zebrafish during the early 2–3 days, but the EGFP within the later development stages was not supplied by the report (Hu et al., 2008). What accounts for these defects between the species? Cabrera-Wrooman et al., 2013 have demonstrated that the cell-specific expression of human GnRH receptor could be influenced by the regulatory motifs in rat counterpart sequence. Therefore, we suppose that some particular transcriptional factors or distinct regulatory manners of GnRH3 might exist in the different teleost families. In summary, the present study has isolated the full-length cDNA and the genomic sequences of GnRH3 from L. crocea and analyzed its conservative characteristics by investigating the genomic organization, expression pattern, and promoter activity. The results indicated that the LcGnRH3 had similar functions to other teleost GnRH3 genes. Meanwhile, evidences of the genomic organizations, the potential transcriptional factors, and the GFP expression patterns in zebrafish larvae suggested that some distinctions existed in the different teleost families. Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.gene.2015.10.063.
Acknowledgements This work was supported by the grants from the National Key Technology R&D Program Foundation of China (2012AA10A403), and Zhejiang Provincial Program Foundation for Selective Breeding and Development of New Agricultural Varieties (2012C12907).
References Abraham, E., Palevitch, O., Ijiri, S., Du, S.J., Gothilf, Y., Zohar, Y., 2008. Early development of forebrain gonadotrophin-releasing hormone (GnRH) neurons and the role of GnRH as an autocrine migration factor. J. Neuroendocrinol. 20, 394–405. Belsham, D.D., Mellon, P.L., 2000. Transcription factors Oct-1 and C/EBP beta (CCAAT/ enhancer-binding protein-beta) are involved in the glutamate/nitric oxide/ cyclicguanosine 5′-monophosphate-mediated repression of mediated repression of gonadotropin-releasing hormone gene expression. Mol. Endocrinol. 14, 212–228. Cabrera-Wrooman, A., Janovick, J.A., Conn, P.M., 2013. Species sequence differences determine the interaction of GnRH receptor with the cellular quality control system. Mol. Cell. Endocrinol. 381, 1–7. Chen, A., Laskar-Levy, O., Ben-Aroya, N., Koch, Y., 2001. Transcriptional regulation of the human GnRH II gene is mediated by a putative cAMP response element. Endocrinology 142, 3483–3492. Chen, H., Chen, W., Lin, G.W., Liu, Z.K., Xie, Y.Q., Gao, Z.G., 2007. The morphological characteristics and growth pattern of cagecultured large yellow croaker (Larimichthys crocea) in Guanjing-Yang population. Hai Yang Ke Xue 29, 331–336. Clarke, I.J., Parkington, H.C., 2014. Gonadotropin inhibitory hormone (GnIH) as a regulator of gonadotropes. Mol. Cell. Endocrinol. 385, 36–44. Dong, K.W., Yu, K.L., Roberts, J.L., 1993. Identification of a major up-stream transcription start site for the human progonadotropin-releasing hormone gene used in reproductive tissues and cell lines. Mol. Endocrinol. 7, 1654–1666. Fan, C.H., Lu, C.L., Yang, J.L., Hu, X.Q., Ren, Y., Cai, H., Chen, M., Hu, Z.Y., Gao, F., Liu, Y.X., 2010. Signal pathway of GnRH-III inhibiting FSH-induced steroidogenesis in granulosa cells. Front. Biosci. 2, 1218–1226. Gelfman, S., Burstein, D., Penn, O., Savchenko, A., Amit, M., Schwartz, S., Pupko, T., Ast, G., 2012. Changes in exon–intron structure during vertebrate evolution affect the splicing pattern of exons. Genome Res. 22, 35–50. González-Martínez, D., Madigou, T., Zmora, N., Anglade, I., Zanuy, S., Zohar, Y., Elizur, A., Muñoz-Cueto, J.A., Kah, O., 2001. Differential expression of three different preproGnRH (gonadotrophin-releasing hormone) messengers in the brain of the European sea bass (Dicentrarchus labrax). J. Comp. Neurol. 429, 144–155. Guilgur, L.G., Ortí, G., Strobl-Mazzulla, P.H., Fernandino, J.I., Miranda, L.A., Somoza, G.M., 2007. Characterization of the cDNAs encoding three GnRH forms in the pejerrey fish Odontesthes bonariensis (Atheriniformes) and the evolution of GnRH precursors. J. Mol. Evol. 64, 614–627. Hu, S.Y., Chen, M.H., Lin, Y.C., Lin, G.H., Gong, H.Y., Yang, T.H., Wu, J.L., 2008. Cloning and functional analysis of the proximal promoter region of the three GnRH genes from the silver sea bream (Sparus sarba). Comp. Biochem. Physiol. B Biochem. Mol. Biol. 151, 373–380. Huang, W., Zhou, L., Li, Z., Gui, J.F., 2009. Expression pattern, cellular localization and promoter activity analysis of ovarian aromatase (Cyp19a1a) in protogynous hermaphrodite red-spotted grouper. Mol. Cell. Endocrinol. 307, 224–236. Karigo, T., Oka, Y., 2013. Neurobiological study of fish brains gives insights into the nature of gonadotropin-releasing hormone 1–3 neurons. Front. Endocrinol. 4, 177. Kavanaugh, S.I., Nozaki, M., Sower, S.A., 2008. Origins of gonadotropin-releasing hormone (GnRH) in vertebrates: identification of a novel GnRH in a basal vertebrate, the sea lamprey. Endocrinology 149, 3860–3869. Kim, H.D., Choe, H.K., Chung, S., Kim, M., Seong, J.Y., Son, G.H., Kim, K., 2011. Class-C SOX transcription factors control GnRH gene expression via the intronic transcriptional enhancer. Mol. Endocrinol. 7, 1184–1196. Kitahashi, T., Sato, H., Sakuma, Y., Parhar, I.S., 2005. Cloning and functional analysis of promoters of three GnRH genes in a cichlid. Biochem. Biophys. Res. Commun. 336, 536–543. Kramer, P.R., Guerrero, G., Krishnamurthy, R., Mitchell, P.J., Wray, S., 2000. Ectopic expression of luteinizing hormone-releasing hormone and peripherin in the respiratory epithelium of mice lacking transcription factor AP-2alpha. Mech. Dev. 94, 79–94. Kuo, M.W., Lou, S.W., Postlethwait, J., Chung, B.C., 2005. Chromosomal organization, evolutionary relationship, and expression of zebrafish GnRH family members. J. Biomed. Sci. 12, 629–639. Kuo, M.W., Luo, S.W., Chung, B.C., 2014. Hedgehog-PKA signaling and gnrh3 regulate the development of zebrafish gnrh3 neurons. PLoS ONE 9 (5), e95545. Lawson, M.A., Macconell, L.A., Kim, J., Powl, B.T., Nelson, S.B., Mellon, P.L., 2002. Neuronspecific expression in vivo by defined transcription regulatory elements of the GnRH gene. Endocrinology 143, 1404–1412. Lethimonier, C., Madigou, T., Munoz-Cueto, J.A., Lareyre, J.J., Kah, O., 2004. Evolutionary aspects of GnRHs, GnRH neuronal systems and GnRH receptors in teleost fish. Gen. Comp. Endocrinol. 135, 1–16. Li, F.B., Gui, J.F., 2008. Clonal diversity and genealogical relationships of gibel carp in four hatcheries. Anim. Genet. 39, 28–33. Lin, D., Zhang, J., Luo, J., Zheng, Z.Y., Shi, X.W., 1992. Studies on the gonadal development and the annual reproductive cycle of the cultured large yellow croaker, Pseudosciaena crocea (Richardson). J. Fujian Normal Univ. (Nat. Sci.) 8, 81–87. Ma, X.X., Zhu, J.Q., Zhou, H., Yang, W.X., 2012. The formation of zona radiata in Pseudosciaena crocea revealed by light and transmission electron microscopy. Micron 43, 435–444. Mohamed, J.S., Khan, I.A., 2006. Molecular cloning and differential expression of three GnRH mRNAs in discrete brain areas and lymphocytes in red drum. J. Endocrinol. 188, 407–416. Oka, Y., 2009. Three types of gonadotrophin-releasing hormone neurons and steroidsensitive sexually dimorphic kisspeptin neurons in teleosts. J. Neuroendocrinol. 21, 334–338. Okubo, K., Nagahama, Y., 2008. Structural and functional evolution of gonadotropinreleasing hormone in vertebrates. Acta Physiol. 193, 3–15.
W. Huang et al. / Gene 576 (2016) 458–465 Okubo, K., Mitani, H., Naruse, K., Kondo, M., Shima, A., Tanaka, M., Asakawa, S., Shimizu, N., Yoshiura, Y., Aida, K., 2002. Structural characterization of GnRH loci in the medaka genome. Gene 293, 181–189. Okubo, K., Sakai, F., Lau, E.L., Yoshizaki, G., Takeuchi, Y., Naruse, K., Aida, K., Nagahama, Y., 2006. Forebrain gonadotropin-releasing hormone neuronal development: insights from transgenic medaka and the relevance to X-linked Kallmann syndrome. Endocrinology 147, 1076–1084. Paech, K., Webb, P., Kuiper, G.G., Nilsson, S., Gustafsson, J., Kushner, P.J., Scanlan, T.S., 1997. Differential ligand activation of estrogen receptors ER alpha and ER beta at AP1 sites. Science 277, 1508–1510. Palevitch, O., Kight, K., Abraham, E., Wray, S., Zohar, Y., Gothilf, Y., 2007. Ontogeny of the GnRH systems in zebrafish brain: in situ hybridization and promoter-reporter expression analyses in intact animals. Cell Tissue Res. 327, 313–322. Palevitch, O., Abraham, E., Borodovsky, N., Levkowitz, G., Zohar, Y., Gothilf, Y., 2010. Cxcl12a-Cxcr4b signaling is important for proper development of the forebrain GnRH system in zebrafish. Gen. Comp. Endocrinol. 165, 262–268. Pandolfi, M., Parhar, I.S., Ravaglia, M.A., Meijide, F.J., Maggese, M.C., Paz, D.A., 2002. Ontogeny and distribution of gonadotropin-releasing hormone (GnRH) neuronal systems in the brain of the cichlid fish Cichlasoma dimerus. Anat. Embryol. 205, 271–281. Pu, L., Han, K., Xie, F., Zou, Z., Close, D., Zhang, Z., Wang, Y., 2013. Molecular cloning, characterization, and gene expression of the androgen receptor in the large yellow croaker, Larimichthys crocea. Fish Physiol. Biochem. 39, 309–324. Rave-Harel, N., Givens, M.L., Nelson, S.B., Duong, H.A., Coss, D., Clark, M.E., Hall, S.B., Kamps, M.P., Mellon, P.L., 2004. TALE homeodomain proteins regulate gonadotropin-releasing hormone gene expression independently and via interactions with Oct-1. J. Biol. Chem. 279, 30287–30297. Roch, G.J., Busby, E.R., Sherwood, N.M., 2011. Evolution of GnRH: diving deeper. Gen. Comp. Endocrinol. 171, 1–16. Shi, G., Sohn, K.C., Choi, D.K., Kim, Y.J., Kim, S.J., Ou, B.S., Piao, Y.J., Lee, Y.H., Yoon, T.J., Lee, Y., Seo, Y.J., Kim, C.D., Lee, J.H., 2010. Brn2 is a transcription factor regulating keratinocyte differentiation with a possible role in the pathogenesis of lichen planus. PLoS ONE 5, e13216. Steven, C., Lehnen, N., Kight, K., Ijiri, S., Klenke, U., Harris, W.A., Zohar, Y., 2003. Molecular characterization of the GnRH system in zebrafish (Danio rerio): cloning of chicken GnRH-II, adult brain expression patterns and pituitary content of salmon GnRH and chicken GnRH-II. Gen. Comp. Endocrinol. 133, 27–37. Sukhan, Z.P., Kitano, H., Selvaraj, S., Yoneda, M., Yamaguchi, A., Matsuyama, M., 2013. Identification and distribution of three gonadotropin-releasing hormone (GnRH) isoforms in the brain of a clupeiform fish, Engraulis japonicus. Zool. Sci. 30, 1081–1091.
465
Thackray, V.G., 2014. Fox tales: regulation of gonadotropin gene expression by forkhead transcription factors. Mol. Cell. Endocrinol. 385, 62–70. Torgersen, J., Nourizadeh-Lillabadi, R., Husebye, H., Aleström, P., 2002. In silico and in situ characterization of the zebrafish (Danio rerio) gnrh3 (sGnRH) gene. BMC Genomics 3, 25–37. Wayne, N.L., Kuwahara, K., Aida, K., Nagahama, Y., Okubo, K., 2005. Whole-cell electrophysiology of gonadotropin-releasing hormone neurons that express green fluorescent protein in the terminal nerve of transgenic medaka (Oryzias latipes). Biol. Reprod. 73, 1228–1234. White, R.B., Fernald, R.D., 1998. Genomic structure and expression sites of three gonadotropin-releasing hormone genes in one species. Gen. Comp. Endocrinol. 112, 17–25. Wolfe, A., Kim, H.H., Tobet, S., Stafford, D.E., Radovick, S., 2002. Identification of a discrete promoter region of the human GnRH gene that is sufficient for directing neuronspecific expression: a role for POU homeodomain transcription factors. Mol. Endocrinol. 16, 435–449. Xia, W., Smith, O., Zmora, N., Xu, S., Zohar, Y., 2014. Comprehensive analysis of GnRH2 neuronal projections in zebrafish. Sci. Rep. 14, 3676. You, Y.L., Lin, D.J., 1997. The ultrastructure of the spermatozoon of the teleost, Pseudosciaena crocea (Richardson). Acta Zool. Sin. 43, 119–126. You, Y.L., Lin, D.J., Chen, L.Y., 2001. Spermatogenesis of teleosts, Pseudosciaena crocea. Zool. Res. 22, 461–466. Zambrano, E., Guzmán, C., Rodríguez-González, G.L., Durand-Carbajal, M., Nathanielsz, P.W., 2014. Fetal programming of sexual development and reproductive function. Mol. Cell. Endocrinol. 382, 538–549. Zhao, Y., Lin, M.C., Farajzadeh, M., Wayne, N.L., 2013. Early development of the gonadotropin-releasing hormone neuronal network in transgenic zebrafish. Front. Endocrinol. 4, 107. Zhou, X., Yi, Q., Zhong, Q., Li, C., Muhammad, S., Wang, X., Wang, Z., Qi, J., Yu, H., Zhang, Q., 2012. Molecular cloning, tissue distribution, and ontogeny of gonadotropin-releasing hormone III gene (GnRH-III) in half-smooth tongue sole (Cynoglossus semilaevis). Comp. Biochem. Physiol. B Biochem. Mol. Biol. 163, 59–64. Zohar, Y., Muñoz-Cueto, J.A., Elizur, A., Kah, O., 2010. Neuroendocrinology of reproduction in teleost fish. Gen. Comp. Endocrinol. 165, 438–455.