Molecular cloning and characterization of glycogen synthase in Eriocheir sinensis

Comparative Biochemistry and Physiology, Part B 214 (2017) 47–56

Contents lists available at ScienceDirect

Comparative Biochemistry and Physiology, Part B journal homepage: www.elsevier.com/locate/cbpb

Molecular cloning and characterization of glycogen synthase in Eriocheir sinensis

MARK

Ran Lia, Li-Na Zhua, Li-Qi Rena, Jie-Yang Wenga, Jin-Sheng Suna,b,⁎ a b

Tianjin Key Laboratory of Animal and Plant Resistance, College of Life Science, Tianjin Normal University, Tianjin, People's Republic of China Tianjin Center for Control and Prevention of Aquatic Animal Infectious Disease, Tianjin, People's Republic of China

A R T I C L E I N F O

A B S T R A C T

Keywords: Eriocheir sinensis Glycogen synthase (GS) Moulting cycle Glucosyltransferase activity Glycogen

Glycogen plays an important role in glucose and energy homeostasis at cellular and organismal levels. In glycogen synthesis, glycogen synthase (GS) is a rate-limiting enzyme catalysing the addition of α-1,4-linked glucose units from (UDP)3-glucose to a nascent glycogen chain using glycogenin (GN) as a primer. While studies on mammalian liver GS (GYS2) are numerous, enzymes from crustaceans, which also use glycogen and glucose as their main energy source, have received less attention. In the present study, we amplified full-length GS cDNA from Eriocheir sinensis. Tissue expression profiling revealed the highest expression of GS in the hepatopancreas. During moulting, GS expression and activity declined, and glycogen levels in the hepatopancreas were reduced. Recombinant GS was expressed in Escherichia coli Rosetta (DE3), and induction at 37 °C or 16 °C yielded EsGS in insoluble inclusion bodies (EsGS-I) or in soluble form (EsGS-S), respectively. Enzyme activity was measured in a cell-free system containing glucose-6-phosphate (G6P), and both forms possessed glycosyltransferase activity, but refolded EsGS-I was more active. Enzyme activity of both GS and EsGS-I in the hepatopancreas was optimum at 25 °C, which is coincident with the optimum growth temperature of Chinese mitten crab, and higher (37 °C) or lower (16 °C) temperatures resulted in lower enzyme activity. Taken together, the results suggest that GS may be important for maintaining normal physiological functions such as growth and reproduction.

1. Introduction Glucose is stored as glycogen in many cell types when intracellular carbon is abundant. Glycogen therefore plays an important role in glucose and energy homeostasis at both cellular and organismal levels. Glycogen is a branched polysaccharide of (UDP)3-glucose joined through α-1,4-glycosidic linkages with intersecting α-1,6-linked glucose residues that serve as branch points (Roach et al., 2012). Glycogen is synthesized through the cooperative action of glycogen synthase (GS), glycogenin (GN), and glycogen-branching enzyme (GBE) (Roach, 2002). The rate-limiting enzyme for glycogen synthesis is GS, which catalyzes the addition of α-1,4-linked glucose units from (UDP)3-glucose to a nascent glycogen chain (Ferrer et al., 2003). In mammals, there are two GS isoforms: muscle GS (GYS1), which is abundantly expressed in skeletal and cardiac muscle and universally expressed in other tissues (Browner et al., 1989), and liver GS (GYS2), which is expressed only in the liver (Irimia et al., 2010). Although the two isoforms share 70% sequence identity, the similarity in amino and

carboxyl terminal regions is only 50% (Bai et al., 1990), and the Cterminal domain of GYS2 is shorter (Hanashiro and Roach, 2002). GS is controlled by a complex interaction between the allosteric activator glucose-6-phosphate (G6P) and reversible phosphorylation through glycogen synthase kinase-3 (GSK-3) and protein phosphatase 1 (PP1) (Von Wilamowitz-Moellendorff et al., 2013). Reversible phosphorylation of regulatory sites in GYS1 occurs at Ser8 and Ser11 in the N-terminal region, and at Ser641, Ser645, Ser649, Ser653, Ser657, Ser697 and Ser710 in the C-terminal region. Unlike GYS1, the shorter GYS2 lacks Ser697 and Ser710 (Ros et al., 2009). Furthermore, these phosphorylation sites on GS can be phosphorylated by several kinases including cAMP-dependent protein kinase (cAMP-PK), protein kinase C (PKC), phosphorylase kinase (PK), and GSK-3 (Roach, 1990). When hepatocytes are stimulated by hormones such as adrenaline and glucagon, GYS2 is inhibited by phosphorylation at several sites (Ros et al., 2009). Moreover, the GBE adds short stretches of glucose residues via α-1,6-glycosidic links to the glycogen chain to yield a branched polymer with increased water solubility (Lee et al., 2011).

Abbreviations: GS, glycogen synthase; GN, glycogenin; G6P, glucose-6-phosphate; GSK-3, glycogen synthase kinase-3; PP1, protein phosphatase-1; UDP, uridine diphosphate; EsGS, E. sinensis hepatopancreas GS; EsGS-I, EsGS in inclusion bodies; EsGS-S, EsGS in soluble form; GBE, glycogen branching enzyme; RACE, rapid amplification of cDNA ends; SDS-PAGE, sodium dodecylsulfate polyacrylamide gel electrophoresis; GCS, enzymatic activity of GS; GT-A, glycosyltransferase superfamily-A; IMAC, immobilized metal affinity chromatography ⁎ Corresponding author at: Tianjin Key Laboratory of Animal and Plant Resistance, College of Life Science, Tianjin Normal University, Tianjin 300387, People's Republic of China. E-mail address: [email protected] (J.-S. Sun). http://dx.doi.org/10.1016/j.cbpb.2017.09.004 Received 30 June 2017; Received in revised form 27 August 2017; Accepted 19 September 2017 Available online 22 September 2017 1096-4959/ © 2017 Elsevier Inc. All rights reserved.

Comparative Biochemistry and Physiology, Part B 214 (2017) 47–56

R. Li et al.

Table 1 Primers used for the GS cloning. Underlined characters indicate the restriction sites. Primer name

Length (bp)

Direction

Sequences

Restriction enzyme

GS 5′ R GS 3′ F GS F GS R Q-GS-F Q-GS-R β-Actin-F β-Actin-R

24 23 33 29 22 22 22 19

R F F R F R F R

GGTCAGAGGCGAGTGAGATGGAAA CTGCTGGACTGGAGGATACTTGG GGAATTCCATATGATGTCCCGGGTAGCTAAACG CCCAAGCTTCCTGCTGCTGACGGTACTGC CTGTCACCAAGTCTTTACGGGA CAACAGTTCTTCAGACTCGGGA GGTTGCCGCCCTGGTTGTGGAC TTCTCCATGTCGTCCCAGT

Nde I Hind III

Description Targeting the 5′-untranslated region of the EsGS Targeting the 3′-untranslated region of the EsGS Forward primer used for EsGS ORF cloning Reverse primer used for EsGS ORF cloning Forward primer used for quantitative PCR of GS Reverse primer used for quantitative PCR of GS forward primer used for quantitative PCR of β-Actin reverse primer used for quantitative PCR of β-Actin

in weight were purchased from a local market in Tianjin, China. The crabs were acclimatised to the laboratory culture environment and maintained in aerated water at 24–26 °C for one week before the experiment. All animal studies were performed with the approval of Tianjin Normal University Animal Ethics Committee.

In mammals, although a small amount of glycogen may be present in most tissues, liver and muscle are the main storage sites (Huang et al., 2015). In glucose homeostasis, the liver stores excess carbohydrates in the form of glycogen, and this store can be rapidly mobilised when blood sugar levels are low (Wang et al., 2008). While the mammalian enzyme is well studied, glycogen synthase (GS) from crustaceans, which also use glycogen and glucose as their main energy source, has received less attention. The Chinese mitten crab Eriocheir sinensis is one of the most economically important aquaculture species in China, due to its desirable taste and high nutritional value. This species is found in coastal estuaries from North Korea to the Fujian province of China in the south (Li et al., 2016). The economic and biological importance of Chinese mitten crab is attracting the attention of researchers, and the genetics of this organism are being explored (Uawisetwathana et al., 2011). Similar to the mammalian liver, the hepatopancreas of crustaceans plays a role in carbohydrate and lipid metabolism, physiological balance, and energy storage and use (Bollen et al., 1998). In addition, a large amount of energy is stored in the hepatopancreas in preparation for glucose metabolism, reproduction, limb regeneration and other physiological processes including moulting (Bélanger et al., 2011; Ghafoory et al., 2013). In recent years, moulting in crustaceans has received increasing attention. Moulting is the process of shedding the old exoskeleton and forming a new one during growth and development. The moulting cycle can be divided into Ecdysis (E stage), Postmoult (AB stage), Intermoult (C stage) and Premoult (D stage) (McConaugha, 1982; Drach and Tchernigovtzeff, 1967). The moulting process is regulated by the ecdysone and is closely correlated with external ecological factors such as salinity, light and nutrition (Drach and Tchernigovtzeff, 1967). The Chinese mitten crab undergoes 20 ± 1 moulting cycles during its lifespan, which may be slow or fast. By passing through a number of moults, crabs increase in size, undergo essential morphological changes and regenerate limbs when required (Skinner, 1985). In the present study, we cloned the GS enzyme of E. sinensis and performed tissue expression profiling, revealing that the highest expression of GS in the hepatopancreas. The relative expression and viability of GS in the hepatopancreas during different moulting stages were also assessed, as were changes in GS activity at different temperature. During moulting, GS expression and activity declined, accompanied by the glycogen levels reduced in the hepatopancreas. The recombinant GS possessed glycosyltransferase activity, but refolded EsGS-I (EsGS in insoluble inclusion bodies) was more active. Enzyme activity of both GS and EsGS-I in the hepatopancreas was optimum at 25 °C, which is coincident with the optimum growth temperature of Chinese mitten crab, and higher (37 °C) or lower (16 °C) temperatures resulted in lower enzyme activity. The results provide a theoretical basis for further study of the mechanism of glucose metabolism during the growth and development of E. sinensis.

2.2. Cloning of glycogen synthase (EsGS) cDNA Total RNA was extracted from Eriocheir sinensis hepatopancreas using TRIzol reagent according to the manufacturer's instruction (Invitrogen, Carlsbad, CA, USA) and resuspended in RNase-free water. Then 2 μg of high-quality DNase I-treated (Promega, Madison, WI, USA) total RNA was reverse transcribed using M-MLV reverse transcriptase according to the manufacturer's protocol (Promega). The synthesized first-strand cDNA was used for the rapid amplification of cDNA ends (RACE), to clone full length of EsGS. In our previous study, to identify the downstream effector molecule in glucose metabolism regulated by CHH, the transcriptome of E. sinensis hepatopancreas was revealed by Illumina RNA-Seq and DGE analysis. All gene-specific primers were designed based on this transcriptome, which included complete ORF fragments of EsGS. Genespecific primers targeting the 5′- and 3′-untranslated regions of the EsGS were designed based on the transcriptome sequence (GS 5′ R, GS 3′ F, and GS F/R, Table 1). Polymerase chain reaction (PCR) was performed using the cDNAs synthesized from the hepatopancreas of E. sinensis as a template. The PCR products were separated by electrophoresis on a 1% agarose gel and then purified, cloned into the pMD18T vector (TaKaRa, China). After transformation into E.coli DH5α, inserted nucleotide sequences of the recombinant plasmids were confirmed by Sanger DNA sequencing in Invitrogen (Invitrogen, Carlsbad, CA, USA). During the following sequence analysis, the full length of EsGS cDNA was assembled with DNA-Star 5.01.

2.3. Analysis of nucleotide and amino acid sequences The obtained full-length EsGS cDNA and amino acid sequences were blasted against the GenBank database at the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/blast). Then the sequences were aligned using an online sequence alignment constructed including Homo sapiens and Eriocheir sinensis (http://www.biosoft.net/sms/index.html). Moreover, the homology analyses were carried out using ClustalW (http://www.genome.jp/tools/clustalw/). A rooted neighbor-joining (NJ) tree was constructed to determine the phylogenetic relationship using MEGA 6.0 software. Bootstrap trials were replicated 1000 times to derive confidence values for the phylogenetic analysis (Bai et al., 1990). Protein functions were analyzed using the simple modular architecture research tool (SMART) program (http://www.smart.emblheidelberg.de/), the molecular weight (Mw) were calculated with an online software program (http://web.expasy.org/compute_pi/).

2. Materials and methods 2.1. Animals Chinese mitten crabs (E. sinensis) approximately 15 ± 5 g (n = 8) 48

Comparative Biochemistry and Physiology, Part B 214 (2017) 47–56

R. Li et al.

2.4. Analysis of EsGS tissue expression

2.7. Western blotting

Eight crabs were placed on ice for 5 −10 min prior to tissue collection, and hepatopancreas, gut, stomach, heart, thoracic ganglia, thoracic muscle, gill, eye, brain, ovary and testis tissue samples were dissected and immediately frozen in liquid nitrogen for further use. Total RNA and proteins were extracted using TRIzol reagent according to the manufacturer's instructions and resuspended in RNase-free water. After first-strand cDNA synthesis, quantitative PCR was performed in a 25 μl reaction volume containing cDNA sample derived from 50 ng of total RNA. There were two primer sets: one for GS and the other for βactin (GenBank accession no. HM053699.1), which served as a reference for normalisation of real-time PCR products (Leelatanawit et al., 2012; Sellars et al., 2007). GS and β-actin expression levels in different tissues were measured using a 7500 Fast Real-Time PCR system (BioRad) with FastStart Universal SYBR Green Master (Rox) (Roche, Basel, Switzerland). Primers are listed in Table 1. Cycling parameters were 5 min at 95 °C followed by 40 cycles of 10 s at 95 °C and 30 s at 60 °C. Dissociation curve analysis of amplified products was performed at the end of each reaction to confirm the specificity of amplification. The 2ΔΔCt method was used to analyse data and generate relative gene expression levels, using β-actin as the reference gene. The expression of GS in different tissues was investigated using western blotting. Total proteins were transferred onto a PVDF (polyvinylidene fluoride) membrane (Millipore, Billerica, MA, USA) using standard methods and incubated overnight at 4 °C with anti-GS antibody (1:1000 dilution; Beijing Protein Innovation Co., Beijing, China) or anti-tubulin antibody (1:1000; Beyotime Institute of Biotechnology, Jiangsu, China). Membranes were then incubated with either antirabbit or anti-mouse HRP-conjugated secondary antibody for 1.5 h at room temperature. After washing three times with TBST (TRIS-buffered saline with Tween-20) (20 mM TRIS, 150 mM NaCl, 0.05% Tween-20), antibody binding was assessed using ECL Plus (Beyotime Institute of Biotechnology, Jiangsu, China) and visualised with Eastman Kodak Co. film according to the manufacturer's instructions.

Tissue homogenates were boiled in 2× loading buffer and separated by 10% SDS-PAGE. Proteins were transferred onto PVDF membranes (Millipore, Billerica, MA, USA) using standard methods. Following methanol activation, membranes were blocked in 5% skimmed milk for 2 h at room temperature, and then incubated overnight at 4 °C with GS rabbit polyclonal antibody (1:1000; Beijing Protein Innovation Co., Beijing, China), Phospho-GSK (S9) rabbit polyclonal antibody (1:1000; Cell Signaling Technology, USA) or tubulin mouse monoclonal antibody (1:1000; Beyotime Institute of Biotechnology, Jiangsu, China). After washing twice with TBST and blocking using 2.5% skimmed milk, membranes were incubated with either anti-rabbit or anti-mouse HRP-conjugated secondary antibody for 1.5 h. After washing three times with TBST, antibody binding was determined using ECL Plus (Beyotime Institute of Biotechnology, Jiangsu, China) and visualised with Eastman Kodak Co. film according to the manufacturer's instructions. 2.8. Measurement of GS activity in the hepatopancreas at different temperatures Hepatopancreas tissue from eight crabs (covering all moulting stages) was resuspended in GS extraction solution. After homogenisation, samples were centrifuged at 8000g for 10 min at 4 °C and supernatants were divided into eight groups and incubated at five different temperatures (10, 16, 25, 37 or 45 °C) for 15 min. The glycogen content and GS activity at the different temperatures were then determined using an assay kit (Suzhou Comin Biotechnology Co., Suzhou, China) according to the manufacturer's instructions. Multiple group comparison was performed by one-way ANOVA followed by Duncan's analysis using SPSS software version 17.0. Results are presented as means ± standard deviation from triplicate experiments. Differences were considered significant at p < 0.05. 2.9. Recombinant plasmid construction of EsGS

2.5. Determination of the moulting cycle stage

The PCR primers used for the EsGS cloning were designed (Table 1) according to the nucleotide sequence and added restriction sites of Hind III and Nde I, which were separately introduced to the forward or reverse primers. The specific target DNA fragments were amplified on a thermocycler (Mastercycler personal, Eppendorf) using the following program: 94 °C for 4 min, followed by 94 °C for 15 s, 67 °C for 15 s, 72 °C for 2 min for 30 cycles and 72 °C for10 min. Prime STAR HS DNA Polymerase (Takara) was used to ensure high fidelity and accuracy during amplification. The amplified fragment of EsGS was digested with Hind III and Nde I and then inserted into the pET-21a(+) vector, which had been digested with the same enzymes. The recombinant plasmid was transformed into competent Rosetta (DE3) (Biovector 610,066) cells for recombinant protein expression. Positive clones were screened by PCR and confirmed by nucleotide sequencing.

The distal ends of the third jaw foot were removed using anatomical scissors, and the ventral surface was placed on a glass slide with fresh water, and visualised and photographed using a CRT5000 microscope (Leica, Germany) at 10× magnification. The morphological characteristics of each moult stage were recorded and described in detail, with the main focus on the thickness and structural features of the epidermis, and the morphological changes of the bristles (Drach and Tchernigovtzeff, 1967; McConaugha, 1982).

2.6. Determination of glycogen content and GS activity in the hepatopancreas during different moulting stages

2.10. Expression and purification of the recombinant EsGS protein

After determination of the moulting period, eight crabs from each moulting stage were quickly dissected on ice. Hepatopancreas tissues were homogenized, homogenates were centrifuged at 8000g for 10 min at 4 °C, and the supernatants were stored on ice. The supernatants were then divided in two; one for glycogen extraction and the other for GS extraction. The glycogen content and GS activity were determined using an assay kit (Suzhou Comin Biotechnology Co., Suzhou, China) according to the manufacturer's instructions. The absorbance at 620 and 340 nm was measured using a microplate reader. Multiple group comparison was performed by one-way ANOVA followed by Duncan's analysis using SPSS software version 17.0 (IBM, Ammonke, NY, USA). Data are presented as means ± standard deviation from triplicate experiments. Differences were considered significant at p < 0.05.

The recombinant plasmid was generated in Rosetta (DE3) and cultures were grown in LB medium at 37 °C until an OD of 0.3–0.5 was reached, at which point expression was induced by adding 0.1 mM Isopropyl-β-D-thiogalactopyranoside (IPTG) to the culture. In order to harvest the GS protein in the supernatant (EsGS-S), after incubation on a rotary shaker at 16 °C overnight, the cells were centrifugated at 10,000g for 10 min at 4 °C and lysed by ultrasound sonication in lysis buffer (50 mM Tris pH 7.4, 100 mM NaCl, 0.5% (w/v) TritonX-10, and 1 mg/ml lysozyme), centrifuged at 10,000g for 10 min at 4 °C, and the supernatant was carefully removed and stored on ice. At the same time, to yield the GS protein in the inclusion body (EsGS-I), cells were

49

Comparative Biochemistry and Physiology, Part B 214 (2017) 47–56

R. Li et al.

2.13. Analysis of phosphorylation sites

cultured and induced at 37 °C for 6 h. Following the lysis and centrifugation, the pellet was washed in wash buffer (300 mM NaCl, 5 mM imidazole, 50 mM phosphate, 2 M urea) three times. After a final centrifugation, the pellet was dissolved in Wash I (500 mM NaCl, 20 mM imidazole, 20 mM phosphate, 8 M urea). Hi Trap™ Chelating HP columns and IMAC Sepharose 6 Fast Flow columns (GE Healthcare, Little Chalfont, UK) containing 1 ml of resin were prepared according to the manufacturer's instructions using the AKTA Prime Protein Purification System. The resins which contained 0.1 M NiSO4 were equilibrated with 20% ethanol. Samples containing EsGS were loaded onto the columns and the columns were then washed with Wash II (500 mM NaCl, 40 mM imidazole, 20 mM phosphate, 8 M urea). Bound proteins were eluted with elution buffer (500 mM NaCl, 500 mM imidazole, 20 mM phosphate, 8 M urea). The presence of EsGS protein was detected by SDS-PAGE electrophoresis and Coomassie staining.

EsGS was separated by SDS-PAGE and stained with colloidal Coomassie staining solution. Slices containing the protein bands were cut from the gel, decolorized twice with 100 mM MNH4HCO3 in 30% ACN (200–400 μl) for 30 min each, washed with 100 mM DTT, and incubated at 56 °C for 30 min. After the addition of 200 mM IAA for 20 min in the dark, the gel slice was lyophilized and digested with 2.5–10 ng/μl trypsin for 20 h at 37 °C. The next day, the gel was suspended in 100 μl extract buffer (0.1% TFA in 60% ACN) and reconstituted with 60 μl 0.1% FA solution. Samples were loaded onto a Trap column using the autosampler of Thermo Scientific Q Exactive (Shanghai Applied Protein Technology, China). 2.14. Determining the optimum temperature for EsGS-I activity Using the cell-free system described above, it was confirmed that EsGS-I possessed higher glycosyltransferases activity than EsGS-S at 25 °C. A coupled spectrophotometric assay was therefore developed to determine the temperature optimum of EsGS-I activity by monitoring the conversion of NADH to NAD+. Reaction buffers contained 50 mM Tris pH 7.4, 100 mM KCl, 2 mM MgCl2, 1 mM phosphoenolpyruvate, 0.02% (w/v) BSA, 2 mM 2-mercaptoethanol, 3 mM G6P, 20 U/ml pyruvate kinase, and 2 U/ml lactate dehydrogenase. EsGS-I (1 mM) was pre-incubated for 15 min at five different temperatures (16 °C, 20 °C, 25 °C, 30 °C, and 37 °C) before the assay and then the enzyme was added to the reaction buffers that have different concentration of substrate (UDPG). At the same time, we examined the temperature stability of EsGS-I. EsGS-I was incubated at five different temperatures (10 °C, 16 °C, 25 °C, 37 °C, and 45 °C) for 15 min, then the enough UDPG (4 mM) was added to the same reaction system as described above. Three replicates were set at each temperature. The figure of EsGS-I activity versus temperature was plotted using non-linear regression in Origin 8.0.

2.11. Refolding of EsGS-I Refolding of EsGS-I was done by urea gradient dialysis. A 60 ml volume of solubilized denatured EsGS-I was loaded into a dialysis bag with a membrane molecular weight cut off of 10,000 Da and dialyzed against a 50-fold greater volume of refolding buffer (50 mM Tris, 5 mM L(+)-cysteine, 8 M urea, pH 7.4) at 4 °C for 4–6 h. Denatured protein was slowly removed by performing a series of equilibrations with buffers of decreasing urea concentration. The urea concentration was reduced as follows: 8 M → 6 M → 4 M → 3 M → 2 M → 1 M → PBS (0.21 g KH2PO3, 9 g NaCl, 0.97 g NaHPO4▪12H2O, pH 7.4) (Tan et al., 1998.). After refolding of the EsGS-I, protein concentrations were determined using the BCA Protein Assay Kit (TIANGEN BIOTECH CO., LTD).

2.12. Spectrophotometric EsGS activity assay 3. Results EsGS-S and EsGS-I were obtained by inducing expression at 37°C or 16°C as described above, and GS enzymatic activity was determined using a coupled spectrophotometric assay to monitor the decrease in absorbance at 340 nm that accompanies the conversion of NADH to NAD+. The reaction buffer contained 50 mM Tris pH 7.4, 100 mM KCl, 2 mM MgCl2, 1 mM phosphoenolpyruvate, 0.02% (w/v) BSA, 2 mM 2mercaptoethanol, 3 mM G6P, 20 U/ml pyruvate kinase, and 2 U/ml lactate dehydrogenase. An equal concentration (1 mM) of refolded EsGS-I or EsGS-S was pre-incubated for 15 min at 25 °C prior to the assay. Reactions were performed at 37 °C and started by the addition of different concentrations of UDPG. The absorbance at 340 nm (A340) was measured over a 10 min period. Nine concentrations of UDPG were tested (0.1 mM, 0.3 mM, 0.4 mM, 0.5 mM, 0.6 mM, 1 mM, 2 mM, 3 mM, and 4 mM). Results are expressed as U/ml (GS only, not total protein), where 1 U = 1 μmol of UDP formed per min at 37 °C, assuming ε340 [NADH] = 6.22 mM− 1 cm− 1 (Hunter et al., 2015). The enzymatic activity of GS (1 ml), defined as the consumption of 1 mmol of NADH in 1 min, is given by the following equation:

3.1. Cloning and sequence analyses of EsGS from Eriocheir sinensis Four specific primers (Table 1) were designed to clone the fulllength EsGS cDNA using E. sinensis hepatopancreas cDNA as template via the 3′ and 5′ rapid amplification of cDNA ends (RACE) approach. The EsGS cDNA consists of 2414 nucleotides with a 55 bp 5′ untranslated region (UTR), 265 bp 3′ UTR, and 2094 bp open reading frame (ORF) putatively encoding a protein with 697 amino acid residues, an isoelectric point of 5.9, and a predicted molecular weight of 79 kDa. Analysis by BLASTX indicated that EsGS belongs to glycosyltransferase superfamily A (GT-A) and includes a characteristic glycosyltransferase domain. The EsGS cDNA sequence had not been reported or characterized previously, and has been deposited in the GeneBank database under accession numbers KX834232. Alignment of the EsGS amino acid sequence revealed high homology with orthologues in Daphnia pulex, but less homology with mammalian species (Homo sapiens, Oryctolagus cuniculus, and Mus musculus) than other crustaceans. In mammals, numerous phosphorylation sites have been identified in GS, and mutants (Ser8, Ser11, Ser641, Ser645, Ser649, Ser653, and Ser657) have been biochemically characterized (Xu et al., 2016). Comparison of EsGS and human liver GS amino acid sequences (Fig. 1) revealed many differences. Ser8 is absent in EsGS, and only Ser11 is present in the N-terminal region. These two sites are putatively phosphorylated by cAMP-PK, PKC, and AMP-stimulated protein kinase in liver cells stimulated by insulin. Compared with the N-terminus, the C-terminal regions are more highly conserved. For example, the sites of G6P allosteric regulation appear to be identical, as do the GSK-3β putative phosphorylation sites, although Ser653 is absent in EsGS.

GCS (U mlof protein) = [ΔA × V ÷ (ε × d) × 109] ÷ (V1 × Cpr) ÷ T = 3215 × ΔA ÷ Cpr ÷ T where V is the total reaction volume of 2 × 10− 4 l, ε is the molar extinction coefficient of NADH (6.2 × 103 l/mol/cm), d is the optical path of the 96-well plate (0.5 cm), V1 is the volume of the sample added to the reaction (0.01 ml), T is the reaction time, Cpr is the sample protein concentration in mg/mL, and ΔA = A1–A2 (the absorbance at 340 nm at the beginning of the experiment minus the absorbance after 1 min). 50

Comparative Biochemistry and Physiology, Part B 214 (2017) 47–56

R. Li et al.

Fig. 1. Sequence alignment of EsGS and Homo sapiens GS. Sequence coverage is highlighted by shading, important phosphorylation sites are indicated by an asterisk, and G6Pbinding sites are delineated by a red box. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

mRNA expression was measured by the fluorescence quantitative PCR method. The results showed that expression was much higher in the hepatopancreas than other tissues (Fig. 3A). To confirm this, total protein extracted from hepatopancreas, gut, stomach, heart, thoracic ganglia, thoracic muscle, gill and eye tissue was immunoblotted. GS protein levels were also highest in the hepatopancreas, and expression was also evident in thoracic muscle, while low levels were observed in gut, heart and gill (Fig. 3B), suggesting that hepatopancreas and muscle are important tissues for glycogen storage.

3.2. Phylogenetic analysis of EsGS To probe the evolutionary relationship between EsGS and human GYS2, phylogenetic analysis was carried out using Clustal W and Mega 5.2. The amino acid sequences of EsGS and 12 other species were compared. Protein sequences were used for the rooted phylogenetic tree, which was constructed by the neighbor-joining method. As shown in Fig. 2, EsGS clustered together with GYS2 from Arthropoda (Daphnia pulex; GeneBank accession number: EFX74238.1). BLAST analysis revealed 68% sequence identity between EsGS and the D. pulex enzyme, indicating high homology among Arthropoda sequences. Additionally, EsGS formed a sister group with GYS2 proteins from other Arthropoda, including Leptinotarsa decemlineata (ALE20545.1), Locusta migratoria (ACM78946.1), Danaus plexippus (OWR45581.1), Harpegnathos saltator (XP_011138536.1), and Culex quinquefasciatus (XM_001846844.1).

3.4. Glycogen content and EsGS activity in the hepatopancreas during different moult stages Based on morphological changes of the bristles at the end of the third jaw foot, moulting stage was divided into Intermoult (C stage), Premoult (D stage), Ecdysis (E stage) and Postmoult (AB stage). The D stage can be further subdivided into D0, D1 and D3 − 4 substages. After identification of the moulting stage, we used the glycogen content determination kit and GS activity assay kit to determine the glycogen content and GS activity, respectively. The glycogen content was highest in the hepatopancreas during the Intermoult and early Premoult (D0

3.3. Expression of EsGS in different tissues Using cDNAs from hepatopancreas, gut, stomach, heart, thoracic ganglia, thoracic muscle, gill, eye, brain, ovary and testis tissue as a template, and the β-actin gene as an internal reference gene, EsGS 51

Comparative Biochemistry and Physiology, Part B 214 (2017) 47–56

R. Li et al.

Fig. 2. Phylogenetic tree of GS from arthropods and mammals. The tree was constructed using the neighbor-joining algorithm in the Mega 4.0 program based on multiple sequence alignment by Clustal W. Bootstrap values of 1000 replicates (%) are indicated at branch points. The bar (0.05) indicates genetic distance. GS proteins included in the phylogenetic analysis were as follows: ant (Harpegnathos saltator: XP_011138536.1), bee (Bombus impatiens: XP_003493758.1), migratory locust (Locusta migratoria: ACM78946.1), beetle (Leptinotarsa decemlineata: ALE20545.1), beet army worm (Spodoptera exigua: ADA53796.1), butterfly (Danaus plexippus: OWR45581.1), fruit fly (Drosophila melanogaster: NP_731967.2), mosquito (Culex quinquefasciatus: XM_001846844.1), daphnia (Daphnia pulex: EFX74238.1), European rabbit (Oryctolagus cuniculus: AF017114.1), human (Homo sapiens: S70004.1), and rat (Mus musculus: NM_145572.2).

stages, western blotting was performed using hepatopancreas tissue samples (Fig. 4C). The results showed that expression of GS was downregulated in E and AB stages. Expression of phospho-GSK(S9) began to decline during the D1 stage. Since GSK phosphorylates and de-activates GS, down-regulation of phospho-GSK(S9) indicates that GSK is mostly active. Therefore, GS expression and activity were lowest during Ecdysis and Postmoult. 3.6. GS activity in the hepatopancreas at different temperatures To investigate the effect of temperature on GS activity, hepatopancreatic GS was incubated at different temperatures (10, 16, 25, 37 and 45 °C), and GS activity was measured using the assay kit (Fig. 5). The results showed that the activity of GS was 14.2 U/g at 10 °C, and activity gradually increased with increasing temperature, peaking at 25 °C (34.7 U/g). However, GS activity decreased with increasing temperature above 25 °C, and was only 9.1 U/g at 45 °C. The optimum temperature at which the effect on synthetic glycogen was most pronounced was therefore 25 °C. 3.7. Expression, purification, and refolding of target protein For expression of recombinant EsGS in E.coli Rosetta (DE3), various conditions were tested, including IPTG concentration, temperature, and culture agitation (rotation speed). Expression at 220 rpm, 37 °C, and induction with 1 mM IPTG resulted in EsGS being expressed mainly in inclusion bodies. However, shaking at 150 rpm and induction overnight at 16 °C with 0.1 mM IPTG resulted in the expression of a soluble form of EsGS, although some protein remained in inclusion bodies (Fig. 6A). Target proteins were purified by immobilized metal affinity chromatography (IMAC) using a Ni Sepharose Fast Flow column, and proteins were confirmed to be > 95% pure by SDS-PAGE (Fig. 6A). EsGS-I was refolded and dialyzed along with EsGS-S (separately) in PBS to give samples with a protein concentration of 0.5 mg/ml and 0.3 mg/ml, respectively. Proteins were evaluated by mass spectrometry and confirmed to be GS (data not shown).

Fig. 3. Tissue expression of EsGS determined by Q-PCR and western blotting. (A) Quantitative real-time PCR analysis of EsGS mRNA expression in healthy Chinese mitten crab hepatopancreas (Hep), thoracic muscle (Mu), brain (Bra), ovary (Ova), gill (Gil), heart (Hea), stomach (Sto), gut (Gut), thoracic ganglion (Gan) and testis (Tes) dissected from animals (average, 100 ± 10 g). Relative gene expression of EsGS was evaluated by quantitative real-time PCR with β-actin as an internal reference gene. Results in this and subsequent figures are means ± standard deviations of triplicate determinations from one representative experiment. Similar results were obtained in all three replicates. (B) Western blotting of GS expression in different tissues. Total protein (100 μg) from different crab tissues was hybridised with GS antibody. GS expression is clearly evident in Hep, Gut, Sto, Hea, Gan, Mus, Gil and Eye. Tubulin levels were also probed as a measure of protein loading.

and D1) and reached 7.2 mg/g, but declined during the late Premoult D3–4 period. During moulting, the glycogen content remained low and was only half that of the Intermoult (~ 3.5 mg/g; Fig. 4A). By contrast, GS activity began to decline earlier, and the difference was statistically significant at the Premoult (D1) stage. Moreover, GS activity was lowest (7.5 U/g) during Ecdysis and Postmoult, reaching only one-sixth that during Intermoult (Fig. 4B).

3.8. EsGS is stoichiometrically phosphorylated at key regulatory sites Sequences of EsGS-I and EsGS-S were measured by tandem mass spectrometry (MS/MS), followed by prediction of phosphorylation sites within the protein. Sequence coverage was 76.9% and 71.88%, respectively. Identified phosphorylation sites and their corresponding peptides were “446-RKTLPPITtHNVCDDAVDPVLSAL-466”. Only one well-characterized phosphorylation site (Thr454) was identified in the C-terminal regions of EsGS-I, but EsGS-S was not phosphorylated. So in

3.5. Expression of GS and phospho-GSK(S9) during different moult stages To investigate changes in GS expression during different moult 52

Comparative Biochemistry and Physiology, Part B 214 (2017) 47–56

R. Li et al.

Fig. 4. Glycogen content and glycosyltransferase activity of GS in different moulting stages. (A) Glycogen concentration in the hepatopancreas during different moulting stages measured using the Anthrone method. (B) Glycosyltransferase activity of GS measured using a coupled spectrophotometric assay. (C) Expression levels of GS and P-GSK(S9) in different moulting stages determined by immunoblotting. Results are presented as means ± standard deviation (n = 8). Different letters indicate significant differences (p < 0.05) among treatments.

concentration. The enzyme activity of ESGS-I under optimum conditions reached 35 U/ml. Meanwhile, the enzymatic activity of EsGS-S was only 9 U/ml at a UDPG concentration of 0.1 mM, and activity was not increased at UDPG concentrations above 1 mM. The enzyme activity of ESGS-S under optimum conditions reached 23 U/ml. Therefore, we concluded that, while both EsGS-I and EsGS-S possessed high glycosyltransferase activity, the activity of EsGS-I was significantly higher. 3.10. EsGS-I catalytic activity at different temperatures To investigate the temperature sensitivity of EsGS-I, assays were performed at 16 °C, 20 °C, 25 °C, 30 °C, and 37 °C. Prior to addition to the reaction mixture, EsGS-I was incubated at these five temperatures for 30 min. After addition of the enzyme, NADH consumption was quantified by measuring the change in absorbance at 340 nm. The results showed a clear effect of temperature on enzyme activity (Fig. 6C). Activity was lowest at 16 °C (about 25 U/ml), and activity increased with increasing temperature to reach 40 U/ml at the temperature optimum of 25− 30 °C, but decreased upon a further temperature to 37 °C. To verify the optimum temperature, EsGS-I was tested at 10 °C, 16 °C, 25 °C, 37 °C, and 45 °C after incubation for 15 min. The result showed that the enzyme activity was highest at 25 °C (Fig. 6D), comparing with other groups.

Fig. 5. Optimum temperature of GS activity. Results are presented as means ± standard deviation from triplicate experiments. Differences were considered significant at p < 0.05.

prokaryotic expression system, neither EsGS-I nor EsGS-S was phosphorylated at Ser8, Ser11, Ser641, Ser645, Ser649, Ser653, or Ser657, unlike the mammalian GS that can be phosphorylated at all of these sites.

4. Discussion In the present study, GS from E. sinensis was cloned, and recombinant enzymes were expressed in an E. coli prokaryotic expression system and purified by IMAC following incorporation of a hexahistidine affinity tag at the cloning stage. In mammals, hepatic GS is regulated both allosterically by G6P, and by phosphorylation at multiple serine residues in the N- and C-terminal regions by GSK-3β and the glycogenassociated form of PP1 (Ferrer et al., 2003; Kelsall et al., 2007). The Nterminal region of EsGS contains two putative 2 and 2a phosphorylation sites (Ser8 and Ser11). In the mammalian enzyme, Ser8 is phosphorylated by PKC, AMP-activated PK, PK, cAMP-PK, and MAP kinase 2 (MAPK-2). However, Ser11 can only be identified and phosphorylated by casein kinase 1 (CK-1). CK-1 can identify and phosphorylate Ser11 after phosphorylation of Ser8 by cAMP-PKA, and this inactivates GS (Flotow and Roach, 1989). Conventional phosphorylation sites in the C-

3.9. Enzymatic activity of EsGS-I and EsGS-S in a cell-free system The glycosyltransferase activity of EsGS-S and EsGS-I was assessed using a coupled spectrophotometric assay that measured the conversion of NADH to NAD+ in real time by coupling to pyruvate kinase/lactate dehydrogenase. As predicted, after addition of G6P, both EsGS-I and EsGS-S displayed enzymatic activity (Fig. 6B). At 1 min after the start of the reaction, the absorbance value was significantly lower, due to the consumption of NADH. At a UDPG concentration of 0.1 mM, the enzyme activity of EsGS-I reached 12 U/ml (calculated as described in the Materials and Methods above), but the result at 2 mM UDPG showed no further change in absorbance value upon increasing the UDPG 53

Comparative Biochemistry and Physiology, Part B 214 (2017) 47–56

R. Li et al.

Fig. 6. Determination of the glycosyltransferase activity of EsGS. (A) Expression, purification and refolding of recombinant EsGS. Proteins were visualised by SDS-PAGE following by staining with Coomassie brilliant blue R-250. Lane M, protein molecular weight standards. Expression, purification and refolding of EsGS. Lane 1, crude EsGS-S; Lane 2, purified EsGS-S (> 95% pure); Lane 3, EsGS-S after dialysis in PBS (0.3 mg/ml); Lane 4, EsGS expressed in inclusion bodies; Lane 5, purified EsGS-I; Lane 6, EsGS-I after refolding (0.5 mg/ml). (B) Glycosyltransferase activity of EsGS-I and EsGS-S measured using a spectrophotometer. EsGS-I and EsGS-S were pre-incubated as described in the Materials and Methods, and glycosyltransferase activity was determined after addition of UDP-glucose (0 − 4 mM) in the presence of 10 mM G6P. (C) EsGS-I was incubated at 16, 20, 25, 30 or 37 °C for 30 min, and glycosyltransferase activity was determined after addition of UDP-glucose (0 − 4 mM) in the presence of 10 mM G6P. (D) The temperature stability of EsGS-I following the addition of UDPG (4 mM). Results are presented as means ± standard deviation from triplicate experiments. Differences were considered significant at p < 0.05. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

The results showed that both were down-regulated, suggesting that GSK3β is most active during E and AB stages, during which GSK3β phosphorylates GS to inhibit GS activity. GSK3β is involved in a variety of metabolic pathways and energy supply processes. Uptake of GSK3β in the activated state is likely to be a natural regulatory mechanism for coping with the challenge of moulting. To confirm that GS was indeed inhibited by GSK3β during this period, the glycosyltransferase activity of GS was measured using a coupled spectrophotometric assay, and the results showed that GS was indeed inactive. The Chinese mitten crab is an economically important aquaculture species in China. This species has a large appetite and strong digestive capacity, and crabs store excess nutrients in the hepatopancreas (Wang et al., 2014). Although crabs can survive over a large temperature range, the optimum growth temperature is 20 − 30 °C, and temperatures outside this range can inhibit feeding, moulting and growth. When the water temperature is below 5 °C, the metabolic rate is lowered and the feeding intensity decreases, although E. sinensis can survive for long periods at 10 °C without eating (Chapelle et al., 1977). The glycogen content can reach 10− 20% of the hepatopancreas, but only 4% in muscle tissue. To investigate whether there is a correlation between the glycogen content and the temperature, and whether temperature can affect GS activity, we measured the activity of hepatopancreatic GS at different temperatures. The result showed that the optimum temperature for GS is 25 °C, which is also the optimum temperature for the growth of the Chinese mitten crab. Researchers have successfully co-expressed human GYS with GSTtagged GN1 in insect Spodoptera frugiperda (SF9) cells (Hunter et al., 2015.), but expression was extremely low in a prokaryotic expression system, which is unfortunate because such systems have several advantages over eukaryotic systems, including a shorter generation time and a potentially higher protein yield (Schmidt, 2004). Furthermore, GS obtained from a eukaryotic expression system may be phosphorylated at key regulatory sites by endogenous kinases, and the resulting enzyme may be essentially inactive under standard assay conditions in the absence of G6P (Sun et al., 2014). Fortunately, dephosphorylation with PP1c or the presence of saturating G6P resulted in a substantial increase in activity to 30 U/mg (Bai et al., 1990). In comparison, one potential problem of prokaryotic expression systems is rapid folding of the target protein. Additionally, prokaryotic expression systems do not

terminal region are 3a, b, c, 4, and 5 (corresponding to Ser641, Ser645, Ser649, Ser653, and Ser657), and these sites are phosphorylated by GSK-3 (McManus et al., 2005). Previous studies showed that Arg579, Arg580, Arg582, Arg586, ArgR588, and Arg591 are essential for G6Pmediated activation of GYS2 (Roach et al., 2012). Comparison of the amino acid sequences of EsGS and human liver GS revealed that Ser8 is absent in EsGS, which has only Ser11 in this N-terminal region. The Cterminal regions are more highly conserved. For example, putative G6P allosteric regulation sites are identical, as are putative GSK phosphorylation sites, although Ser653 is absent in EsGS. In insulin signaling in mammals, the action of insulin on its receptor triggers the phosphorylation of Ser8 by PKC, AMP-activated PK, PK, cAMP-PK, and MAPK-2. However, crustaceans such as E. sinensis do not have a typical insulin signaling pathway, which may explain the absence of this residue that is highly conserved among mammalian GS enzymes. The relevance of the absence of Ser8 and Ser653 to GS phosphorylation-related regulation requires further verification. EsGS was much more highly expressed in the hepatopancrea. It also expressed at lower levels in muscle and other tissues, unlike the expression of GYS 2 in mammals, which is expressed only in the liver (Kaslow et al., 1985; Nuttall et al., 1994). GYS1 and GYS2 share low amino acid sequence identity (Wang et al., 2012). Therefore, we speculated that the amino acid sequence of muscle GS and hepatopancreatic GS of E. sinensis should be similar, and the regulatory mechanisms may also be similar, but this needs to be confirmed by further investigation. The Chinese mitten crab moults 20 ± 1 times throughout its life. Three-quarters of each moult cycle is spent in the C stage, and actual moulting lasts only ~ 10 min (Stevens, 2012). The experimental results showed that blood glucose levels and glycogen content in the hepatopancreas declined and remained low in the E and AB stages, suggesting that moulting is an energy-consuming process. This is consistent with the increased expression of genes associated with energy metabolism during moulting, in the swimming crab Portunus pelagicus (Kuballa et al., 2011). Additionally, we observed that moulting crabs do not eat, which may lower blood glucose levels and induce rapid degradation of hepatopancreatic glycogen into glucose to maintain normal physiological activity. To determine whether glycogen synthesis was inhibited during moulting, GS and phospho-GSK(S9) expression was measured. 54

Comparative Biochemistry and Physiology, Part B 214 (2017) 47–56

R. Li et al.

astrocyte-neuron metabolic cooperation. Cell Metab. 14, 724–738. Bollen, M., Keppens, S., Stalmans, W., 1998. Specific features of glycogen metabolism in the liver. Biochem. J. 336, 19–31. Browner, M.F., Nakano, K., Bang, A.G., Fletterick, R.J., 1989. Human muscle glycogen synthase cDNA sequence: a negatively charged protein with an asymmetric charge distribution. PNAS 86, 1443–1447. Chapelle, S., Meister, R., Brichon, G., Zwingelstein, G., 1977. Influence of temperature on the phospholipid metabolism of various tissues from the crab Carcinus maenas. Comp. Biochem. Physiol. 58, 413–417. Drach, P., Tchernigovtzeff, C., 1967. Surla method determination desstadesd intermuetson application generale aux Crustaces. Biol. Mar. 18, 595–610. Ferrer, J.C., Favre, C., Gomis, R.R., Fernández-Novell, J.M., García-Rocha, M., de la Iglesia, N., Cid, E., Guinovart, J.J., 2003. Control of glycogen deposition. FEBS Lett. 546, 127–132. Flotow, H., Roach, P.J., 1989. Synergistic phosphorylation of rabbit muscle glycogen synthase by cyclic AMP—dependent protein kinase and casein kinase I. Implications for hormonal regulation of glycogen synthase. J. Biol. Chem. 264, 9126–9128. Ghafoory, S., Breitkopf-Heinlein, K., Li, Q., Scholl, C., Dooley, S., Wölfl, S., 2013. Zonation of nitrogen and glucose metabolism gene expression upon acute liver damage in mouse. PLoS One 8, e0078262. Hanashiro, I., Roach, P.J., 2002. Mutations of muscle glycogensynthase that disable activation by glucose 6-phosphate. Arch. Biochem. Biophys. 397, 286–292. Huang, S., Wang, J., Yue, W., Chen, J., Gaughan, S., Lu, W., Lu, G., Wang, C., 2015. Transcriptomic variation of hepatopancreas reveals the energy metabolism and biological processes associated with molting in Chinese mitten crab, Eriocheir sinensis. Sci. Rep. 5, 14015. Hunter, R.W., Zeqiraj, E., Morrice, N., Sicheri, F., Sakamoto, K., 2015. Expression and purification of functional human glycogen synthase-1:glycogenin-1 complex in insect cells. Protein Expr. Purif. 108, 23–29. Irimia, J.M., Meyer, C.M., Peper, C.L., Zhai, L., Bock, C.B., Previs, S.F., McGuinness, O.P., DePaoli-Roach, A., Roach, P.J., 2010. Impaired glucose tolerance and predisposition to the fasted state in liver glycogen synthase knock-outmice. J. Biol. Chem. 285, 12851–12861. Kaslow, H.R., Lesikar, D.D., Antwi, D., Tan, A.W., 1985. L-type glycogen synthase - tissue distribution and electrophoretic mobility. J. Biol. Chem. 260, 9953–9956. Kelsall, I.R., Munro, S., Hallyburton, I., Treadway, J.L., Cohen, P.T., 2007. The hepatic PP1 glycogen-targeting subunit interaction with phosphorylase a can be blocked by C-terminal tyrosine deletion or an indole drug. FEBS Lett. 581, 4749–4753. Kuballa, A.V., Holton, T.A., Paterson, B., Elizur, A., 2011. Moult cycle specific differential gene expression profiling of the crab Portunus pelagicus. BMC Genomics 12, 147. Lee, Y.C., Chang, C.J., Bali, D., Chen, Y.T., Yan, Y.T., 2011. Glycogen-branching enzyme deficiency leads to abnormal cardiac development: novel insights into glycogen storage disease IV. Hum. Mol. Genet. 20, 455–465. Leelatanawit, R., Klanchui, A., Uawisetwathana, U., Karoonuthaisiri, N., 2012. Validation of reference genes for real-time PCR of reproductive system in the black tiger shrimp. PLoS One 7 (12), e52677. Li, J., Geng, X., Chen, L., Sun, J., 2016. Identification and characterization of thirty novel microsatellite DNA markers from the Chinese mitten crab Eriocheir sinensis expressed sequence tags. BMC Res. Notes 9, 105. Lian, K., Leiros, H.K., Moe, E., 2015. MutT from the fish pathogen Aliivibrio salmonicida is a cold-active nucleotide-pool sanitization enzyme with unexpectedly high thermostability. FEBS Open Bio 5, 107–116. McConaugha, J.R., 1982. Regulation of crustacean morphogenesis in larvae of the crab Rhithropanopeus harriss. J. Exp. Zool. 223, 155–163. McManus, E.J., Sakamoto, K., Armit, L.J., Ronaldson, L., Shpiro, N., Marquez, R., Alessi, D.R., 2005. Role that phosphorylation of GSK3 plays in insulin and Wnt signalling defined by knockin analysis. EMBO J. 24, 1571–1583. Nuttall, F.Q., Gannon, M.C., Bai, G., Lee, E.Y., 1994. The primary structure of rat liver glycogen synthase deduced by cdna cloning. Arch. Biochem. Biophys. 311, 443–449. Roach, P.J., 1990. Control of glycogen synthase by hierarchal protein phosphorylation. FASEB J. 4, 2961–2968 (September). Roach, P.J., 2002. Glycogen and its metabolism. Curr. Mol. Med. 2, 101–120. Roach, P.J., Depaoli-Roach, A.A., Hurley, T.D., Tagliabracci, V.S., 2012. Glycogen and its metabolism: some new developments and oldthemes. Biochem. J. 441, 763–787. Ros, S., García-Rocha, M., Domínguez, J., Ferrer, J.C., Guinovart, J.J., 2009. Control of liver glycogen synthase activity and intracellular distribution by phosphorylation. J. Biol. Chem. 284, 6370–6378. Schmidt, F.R., 2004. Recombinant expression systems in the pharmaceutical industry. Appl. Microbiol. Biotechnol. 65, 363–372. Sellars, M.J., Vuocolo, T., Leeton, L.A., Coman, G.J., Degnan, B.M., Preston, N.P., 2007. Real-time RT-PCR quantification of Kuruma shrimp transcripts: a comparison of relative and absolute quantification procedures. J. Biotechnol. 129, 391–399. Skinner, D.M., 1985. Interaction factors in the control of the crustacean molt cycle. Am. Zool. 25, 275–284. Stevens, B.G., 2012. Growth of juvenile red king crabs, Paralithodes camtschaticus, through sequential molts in the laboratory. J. Crustac. Biol. 32, 215–222. Sun, H., Wu, G.M., Chen, Y.Y., Tian, Y., Yue, Y.H., Zhang, G.L., 2014. Expression, production, and renaturation of a functional single-chain variable antibody fragment (scFv) against human ICAM-1. BJMBR 47, 540–547. Tan, P.H., Sandmaier, B.M., Stayton, P.S., 1998. Contributions of a highly conserved VH/ VL hydrogen bonding interaction to scFv folding stability and refolding efficiency. Biophys. J. 75, 1473–1482. Uawisetwathana, U., Leelatanawit, R., Klanchui, A., Prommoon, J., Klinbunga, S., Karoonuthaisiri, N.K., 2011. Insights into eyestalk ablation mechanism to induce ovarian maturation in the black tiger shrimp. PLoS One 6, e24427. Von Wilamowitz-Moellendorff, A., Hunter, R.W., García-Rocha, M., Kang, L., López-

usually contain enzymes that can post-translationally modify eukaryotic proteins. The pET expression system is widely used to over express recombinant proteins. We first attempted to use the pET-21a plasmid to express soluble EsGS, but, despite extensive efforts, target proteins were mainly expressed in inclusion bodies, and only a small portion of the protein was expressed in the supernatant. Purification from inclusion bodies, subsequent refolding, and dialysis into PBS resulted in a refolded form (EsGS-I) that possessed greater catalytic activity than the soluble form (EsGS-S). In the present study, the optimum temperature for EsGS-I activity was also 25 °C. At temperatures higher or lower than 25 °C, the activity of EsGS-I was reduced, further demonstrating that the optimum activity temperature of GS is 25 °C. Similarly, the optimal temperature for the physiological enzyme activity also showed a consistency with the living temperature of organisms in some marine species. For instance, the transglutaminase purified from cold-adapted Antarctic krill was optimally active at 0–10 °C (Zhang et al., 2017). In the fish pathogen Aliivibrio salmonicida, an important nucleotide-pool sanitization enzyme MutT was found to be highly active at 4 °C, indicating that this enzyme was adapted for function at its naturally low temperature environment (Lian et al., 2015). In the long course of evolution, the adaption of the crab to changes in its environment probably led to the optimum temperature of GS activity observed today. This also indicates that GS may be important for maintaining normal physiological functions such as growth and reproduction. 5. Conclusions While it has long been proposed that GS plays a key role in glycogen biosynthesis in muscle and liver in mammalian cells, studies on crustacean enzyme are scarce. In the present study, our data demonstrated that in Eriocheir sinensis, GS protein levels were highest in the hepatopancreas, and also evident in muscle. GS expression and activity were lowest during Ecdysis and Postmoult, indicating that moulting is an energy-consuming process. We developed a prokaryotic expression system for the large-scale preparation of GS from E. sinensis (EsGS). The optimum activity temperature of both hepatic GS and recombinant EsGS is 25 °C, which mirrored the optimum growth temperature of this species. In summary, we conclude that GS activity is very important for the moulting and growth processes. These enzymes will be subjected to further biochemical characterization to investigate energy storage and utilization in this important aquaculture species. Contribution statement R.L. and J.S.S. conceived and designed the research. R.L. and L.N.Z. performed the experiments and analyzed the data. R.L., L.N.Z., L.Q.R., J.Y.W., and J.S.S. interpreted the results of the experiments. L.N.Z. prepared the figures. R.L. and J.S.S. edited and revised the manuscript. Funding This work was financially supported by grants of National Natural Science Foundation of China [grant no. 31302168]; Natural Science Foundation of Tianjin [grant no. 14JCYBJC30700]; Key Laboratory of freshwater aquaculture germplasm resources of Ministry of Agriculture: National Key Technology Program [grant no. 2012BAD26B00] and Science and PhD Start-up Fund of Tianjin Normal University [grant no. 52XB1303]. References Bai, G., Zhang, Z.J., Werner, R., Nuttall, F.Q., Tan, A.W., Lee, E.Y., 1990. The primary structure of rat liver glycogen synthase deduced by cDNA cloning: absence of phosphorylation sites 1a and 1b. J. Biol. Chem. 265, 7843–7848. Bélanger, M., Allaman, I., Magistretti, P.J., 2011. Brain energy metabolism: focus on

55

Comparative Biochemistry and Physiology, Part B 214 (2017) 47–56

R. Li et al.

Wang, W., Wu, X., Liu, Z., Zheng, H., Cheng, Y., 2014. Insights into hepatopancreatic functions for nutrition metabolism and ovarian development in the crab Portunus trituberculatus: gene discovery in the comparative transcriptome of different hepatopancreas stages. PLoS One 6, e84921. Xu, Q., Song, Y., Liu, R., Chen, Y., Zhang, Y., Li, Y., Zhao, W., Chang, G., Chen, G., 2016. The dopamine β-hydroxylase gene in Chinese goose (Anas cygnoides): cloning, characterization, and expression during the reproductive cycle. BMC Genet. 17, 48. Zhang, Y., He, S., Simpson, B.K., 2017. A cold active transglutaminase from Antarctic krill (Euphausia superba): purification, characterization and application in the modification of cold-set gelatin gel. Food Chem. 232, 155–162.

Soldado, I., Lantier, L., Patel, K., Peggie, M.W., Martínez-Pons, C., Voss, M., Calbó, J., Cohen, P.T., Wasserman, D.H., Guinovart, J.J., Sakamoto, K., 2013. Glucose-6phosphate-mediated activation of liver glycogen synthase plays a key role in hepatic glycogen synthesis. Diabetes 62, 4070–4082. Wang, L., Yan, B., Liu, N., Li, Y., Wang, Q., 2008. Effects of cadmium on glutathione synthesis in hepatopancreas of freshwater crab, Sinopotamon yangtsekiense. Chemosphere 74, 51–56. Wang, L., Xiong, Y., Zuo, B., Lei, M., Ren, Z., Xu, D., 2012. Molecular and functional characterization of glycogen synthase in the porcine satellite cells under insulin treatment. Mol. Cell. Biochem. 360, 169–180.

56