- Email: [email protected]
Cloning and characterization of a clip domain serine protease and its homolog (masquerade) from Eriocheir sinensis
Fish & Shellfish Immunology 35 (2013) 1155e1162
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Cloning and characterization of a clip domain serine protease and its homolog (masquerade) from Eriocheir sinensis Ying Huang, Yu-Ran Li, Liang An, Kai-Min Hui, Qian Ren*, Wen Wang* Jiangsu Key Laboratory for Biodiversity & Biotechnology and Jiangsu Key Laboratory for Aquatic Crustacean Diseases, College of Life Sciences, Nanjing Normal University, 1 Wenyuan Road, Nanjing 210046, PR China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 3 May 2013 Received in revised form 30 June 2013 Accepted 14 July 2013 Available online 21 July 2013
Serine proteinases (SPs) or SP homologs (SPHs) including clip domain SPs (cSPs) or SPHs (cSPHs) play critical roles in digestion, embryonic development, hemolymph coagulation, and melanization. In this study, one cSP (EscSP) and one SPH, similar to Drosophila masquerade (EsMas), were identified from hepatopancreas of the Chinese mittern crab Eriocheir sinensis. They both possess the clip domains at the N-terminal, EscSP has only one clip domain, but EsMas has seven clip domains. One SP or SP-like domain was at the C-terminal of EscSP and EsMas respectively. In contrast to EscSP, absence of a catalytic residue of Ser resulted in the loss of SP activity of EsMas. Tissue distribution analysis showed that EscSP mRNA was mainly expressed in hepatopancreas, nerve and eyestalk tissue; whereas the EsMas transcript was mainly distributed in eyestalk, muscle, nerve and hemocytes. EscSP in hemocytes showed significant increase after a lipopolysaccharide (LPS) or peptidoglycan (PGN) challenge. However, down-regulation of EsMas was observed in hemocytes challenged by LPS from 2 to 24 h, by contrast EsMas could be induced by PGN challenge at 2 and 24 h. All these findings indicated that EscSP and EsMas might be involved in the innate immune defenses in E. sinensis. Ó 2013 Elsevier Ltd. All rights reserved.
Keywords: Serine proteases Masquerade Innate immunity Clip domain
1. Introduction Serine proteinases (SPs) are a large family of proteases [1] and they play important roles by proteolytic cleavage of specific proteins [2]. SPs have a catalytic triad formed by three catalytic residues His (H), Asp (D) and Ser (S) [3]. When serine residue of this catalytic triad is replaced by glycine (H, D, G), these analogous SPs become inactive and are named serine proteinases homologs (SPHs). Upon losing the catalytic activity for protease precursors [4], SPHs assisted SPs as cofactors to perform their functions [5e7]. In mammals, SPs and SPHs are involved in various biological processes, for example, digestion, blood coagulation and the complement system [8]. SPs or SPHs can be divided into two groups, single domain SPs and multiple domain SPs [4,8]. Single domain SPs, such as trypsin and chymotrypsin, have less than 300 amino acids, and their fundamental role is digestion. Multiple domain SPs, include clip domain SPs or SPHs, and sophisticated domain SPs or SPHs that are associated with other domains [4]. The SPs and SPHs that contain
* Corresponding authors. Tel.: þ86 25 85891955; fax: þ86 25 85891526. E-mail addresses: [email protected] (Q. Ren), [email protected], [email protected] (W. Wang). 1050-4648/$ e see front matter Ó 2013 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.fsi.2013.07.025
one or more clip domains are called clip-SPs (cSPs) and clip-SPHs (cSPHs). The first cSP was identified in Drosophila melanogaster [9,10]. Since then, more and more cSPs and cSPHs (including Mas proteins) have been found in arthropods. It is worth noting that these cSPs and cSPHs molecules share common structural features that contain one or more clip domains, which are found at the Nterminal of the polypeptide chain; they consist of 37e55 amino acids including six strictly conserved residues arranged in three disulfide-bridge structures [11]. The clip domain may act as substrate or activator binding domains, catalytic domain repressors, or antimicrobial peptides [11,12]. These cSPs also have a catalytically active SP domain at the C terminus; while cSPHs have an inactive SP-like domain, which is the most significant difference between cSPs and cSPHs [11]. Recently, cDNAs of cSPs and cSPHs have been cloned and their roles in the innate immune system also have been researched in crabs and penaeid shrimps. For instance, a proclotting enzyme which is an intracellular cSP zymogen closely associated with an endotoxin sensitive hemolymph coagulation system was purified from hemocytes of the horseshoe crab Tachypleus tridentatus [12]. Another EscSP was reported that was higher expressed in muscle of the Chinese mitten crab Eriocheir sinensis, and which was involved in the processes of hostepathogen interaction probably as one of the proPO system members [13]. Five cSPs were found in the
1156
Y. Huang et al. / Fish & Shellfish Immunology 35 (2013) 1155e1162
hemocytes and eyestalk of the swimming crab Portunus trituberculatus and they were involved in the antibacterial defense mechanism [14,15]. Two novel cSPs (FcSP and FcSPH) were purified from gills of Chinese white shrimp, Fenneropenaeus chinensis. When a host is attacked by invading pathogens, they will be quickly cleaved and the shrimp initiates a defense reaction against the pathogens [16]. Moreover, cSPs or cSPHs also have been characterized from the kuruma shrimp, Marsupenaeus japonicus [17], and the black tiger shrimp, Penaeus monodon [7,18]. Masquerade is a novel, secreted serine protease-like molecule. It was first thought to be involved in D. melanogaster [19]. In recent years, Mas also was reported in crustaceans. Two masquerade-like SPH proteins similar to Drosophila masquerade were found in the crayfish, Pacifastacus leniusculus, which exhibit cell adhesion activity in vitro, pattern recognition, and opsonization [6,20]. In the black tiger shrimp, P. monodon, a masquerade-like SPH was previously cloned and its transcript expression levels found to be upregulated upon bacterial challenge with Vibrio harveyi [21]. One masquerade molecule (FcMas) was discovered in F. chinensis. It could be speculated that FcMas might function as a PPR and shrimp could inhibit bacteria or white spot syndrome virus (WSSV) entry into host by down-regulating the expression of FcMas [22]. In the present study, the complete cDNA sequence of a cSP and a cSPH (Mas) from the Chinese mitten crab E. sinensis (EscSP, EsMas) was identified and the responses of these clip domains to lipopolysaccharide (LPS) or peptidoglycan (PGN) challenge were also investigated. This research will very likely be potentially helpful in understanding the innate immune defense of economically important crabs. 2. Materials and methods 2.1. Experimental animals The Chinese mitten crab E. sinensis individuals (approximately 60e80 g in body weight), were obtained from a commercial farm in Yangzhou, China, and reared in laboratory tanks filled with filtered and UV-treated artificial freshwater with a controlled temperature (24e26 C) regime. Crabs were fed daily with a commercial diet daily at a rate of 8% body weight for 2 weeks before treatment. 2.2. Immune challenge by LPS and PGN Forty-five crabs were employed for the immune challenge experiment, and they were randomly divided into 3 groups (LPS group, PGN group and control group). For the crabs in two experiment groups, about 50 ml LPS (0.5 mg/ml) or 100 ml PGN (0.5 mg/ml) were injected into each crab; and for the control group, other crabs were inoculated with 100 ml physiological saline. After 0, 2, 6, 12 and 24 h post-injection, two samples of haemolymph from the second pereiopod for each group of crabs were respectively collected using a 2-ml sterile syringe preloaded with an equal volume of improved anticoagulant buffer (ACD-B) (Glucose, 1.47 g; citric acid, 0.48 g; trisodium citrate, 1.32 g; double distilled water was added to 100 ml, pH 7.3) [23]. The hemolymph was centrifuged immediately at 2000 rpm at 4 C for 5 min to isolate the haemocytes. Other tissues, such as hepatopancreas, gills, intestine, muscle, nerve, eyestalk and heart were also collected from untreated crabs for tissue distribution studies and RNA extraction. 2.3. Total RNA extraction and cDNA synthesis Total RNAs from the above mentioned tissues were extracted according to the manufacturer’s instruction for Unizol reagent (Biostar, Shanghai, China). The first strand cDNA synthesis of
different samples for qRT-PCR analysis using an M-MLV First Strand Kit (Invitrogen, Shanghai, China) with the primer oligo (dT)20. The first-strand cDNA synthesis was performed following the manufacture’s instruction using 50 -CDS Primer A and SMARTer ⅡA oligo (50 -RACE Ready cDNA) and 30 -CDS Primer A (30 -RACE-Ready cDNA). The first-strand cDNA was also synthesized using 30 RACE Adaptor of 30 Full RACE Core Set Ver. 2.0 (Takara, Dalian, China) and the detailed methods was according to the manufacturer’s protocol. The primer sequences are shown in Table 1. 2.4. Gene cloning of EscSP and EsMas The two expressed sequence tag (EST) sequences with 1095 and 762 bp similar to SP and Masquerade gene respectively were obtained from transcriptome sequencing of a cDNA library constructed from the hepatopancreas of Chinese mitten crab. According to those sequences, two pairs of gene-specific primers (EscSP-F, EscSP-R and EsMas-F, EsMas-R) were designed to obtain full length of the EscSP and EsMas genes. The full length of EscSP and EsMas genes were cloned using the 30 and 50 Rapid Amplification cDNA End (RACE) methods. The 50 fragments of EscSP and EsMas and the 30 fragment of EsMas were obtained using a Clontech SMARTerÔ RACE cDNA Amplification Kit from Takara (Dalian, China) with gene specific primers and UPM primer. The 30 fragment of EscSP was amplified using 30 RACE Out Primer and EscSP-F. The detailed methods were based on a previous study [24]. The full length of EscSP and EsMas cDNAs was obtained by overlapping the 50 and 30 fragments. All primers are listed in Table 1. 2.5. Sequence and phylogenetic analysis Similar analysis was accomplished using the online program BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Translation of EscSP and EsMas and prediction of the deduced protein were performed with the Expert Protein Analysis System (http://www.au.expasy. org/). Signal sequence and domain prediction were conducted with the Simple Modular Architecture Research Tool (http://smart. embl-heidelberg.de/). The Molecular Evolutionary Genetics Analysis (MEGA 5.0) and GENEDOC software were used for multiple alignments of EscSP with other clip domain serine proteases and EsMas with masquerades in other species. Phylogenetic analysis was conducted with MEGA 5.0 using Neighbor-Joining (NJ) method, and the reliability of the branching was tested by bootstrap resampling (1000 pseudo-replicates). The clip domain, SP or SP-like
Table 1 Primer sequences used in this study. Primers name
Sequence (50 e30 )
EscSP-F EscSP-R EsMas-F EsMas-R EscSP-RT-F EscSP-RT-R EsMas-RT-F EsMas-RT-R Es-Actin-F Es-Actin-R 30 RACE Outer Primer UPM Long
AGGCGGCGGATGCTTTCAGTAGAAC CCGCACAGGAAGTCAGGCTTATTGG GTGTCAGGGCATCTCGCAGACCAAC CAAGTGTCATAAGGAACGACGGGTAGAG ATAAGCCTGACTTCCTGTGCG GTTTGCCGTAATCTGGGTGTT CCGTCGTTCCTTATGACACTT TACAGCTCGTAGCGGTTATTG GCATCCACGAGACCACTTACA CTCCTGCTTGCTGATCCACATC TACCGTCGTTCCACTAGTGATTT
Short 50 -CDS Primer A SMARTerⅡA oligo 30 -CDS primer A
CTAATACGACTCACTATAGGGCAAGCAGTG GTATCAACGCAGAGT CTAATACGACTCACTATAGGGC T25VN AAGCAGTGGTATCAACGCAGAGTACXXXXX AAGCAGTGGTATCAACGCAGAGTAC(T)30VN
Y. Huang et al. / Fish & Shellfish Immunology 35 (2013) 1155e1162
1157
domain and catalytic residues of EscSP and EsMas were predicted via homologous sequences alignment. Calculated molecular weight and predicted isoelectric point of EscSP and EsMas were obtained through ExPASy (http://web.expasy.org/compute_pi/). 2.6. Tissue distribution and expression pattern analysis of EscSP and EsMas upon LPS or PGN challenge Quantitative real-time PCR (qRT-PCR) was used to investigate the mRNA expression levels of EscSP and EsMas in various tissues, including hemocytes, hepatopancreas, gills, intestine, muscle, nerve, eyestalk and heart of untreated crabs, as well as the temporal expression of EscSP and EsMas transcripts in hemocytes of crabs challenged with LPS or PGN at 2, 6, 12, and 24 h. The qRT-PCRs were performed following the manufacturer’s protocol of the kit of SYBR Premix Ex Taq (Takara, Japan) with a real-time thermal cycler (BioRad, Hercules, CA) [1]. Two pairs of specific primers (EscSP-RT-F, EscSP-RT-R and EsMas-RT-F, EsMas-RT-R) were used to amplify the corresponding products of EscSP and EsMas from each cDNA template in the qRT-PCR analysis, and the PCR product was sequenced to verify the specificity of qRT-PCR. Moreover, two primers Es-actin F and Es-actin R were used to amplify b-actin, which serves as the reference house-keeping gene for internal standardization to verify the successful transcription and to normalize the level of expression between the samples [25]. The qRT-PCR was carried out in a total volume of 10 ml, containing 5 ml of 2 SYBR Premix Ex TaqTM, 1 ml cDNA (1:100 diluted), and 2 ml of each forward and reverse primers (1 mmol/L). The qRT-PCR was programmed at 95 C for 3 min, followed by 40 cycles of 94 C for 15 s, and 60 C for 30 s. To confirm that only one fragment was amplified, a dissociation curve was also analyzed for the amplification products, and was performed at the end of each PCR reaction. Then, the qRT-PCR data from the three biological replicated experiments, which were used to ensure the accuracy and validity of experimental results, were analyzed with ABI7300 SDS software V2.0 (Applied Biosystems). The expression level of EscSP or EsMas was determined using the comparative CT method. In this method, the discrepancy between the CT for the EscSP or EsMas and b-actin (OOCT) was calculated to normalize the variation in the amount of cDNA in each reaction. The expression level of EscSP or EsMas was then calculated by 2eOOCT methods [26] and subjected to statistical analysis. All data were given as mean standard error (S.E) in terms of relative mRNA expression. Unpaired sample t-test was performed as a statistical analysis, and differences were considered significant if P < 0.05. The prime sequences are shown in Table 1. 3. Result 3.1. Gene cloning of EscSP and EsMas from Chinese mitten crab Partial cDNA sequences of EscSP and EsMas in Chinese mitten crab were obtained based on analysis of expressed sequence tags from hepatopancreas cDNA libraries. Afterwards, 50 and 30 RACE methods were respectively performed to obtain the full cDNA sequences of EscSP and EsMas. The full length of EscSP is 2888 bp, including a 84 bp of 50 untranslated region (UTR), a 1065 bp open reading frame (ORF) encoding a 354-amino acids polypeptide with a 17-amino acid signal peptide, and a 1739 bp 30 untranslated region with a poly (A) tail. EscSP protein has two domains, including a
Fig. 1. Nucleotide (above) and deduced amino acid sequences (below) of EscSP(A) and EsMas(B) cDNAs from E. sinensis. Deduced amino acid residues are numbered on the right. Signal peptides of EscSP and EsMas are labeled in italics. The clip domain of EscSP
and EsMas, located behind the signal peptide, are underlined. The SP domain of EscSP and SP-like domain of EsMas are shaded. The sites of the catalytic triad of serine protease (H 147, D 207, S 302) and of serine protease homolog (H 476, D 526, G 627) are in bold.
1158
Y. Huang et al. / Fish & Shellfish Immunology 35 (2013) 1155e1162
clip domain of 41 bp amino acids interlinked by three disulfide pairs at the C-terminal, and by a serine protease domain of 249 bp amino acids at the N-terminal. In addition to the above domains, a linked region between the two domains also exists. Sequence alignment of the EscSP with SP or SPH in other arthropod animals suggests that it has three active sites (H 147, D 207, S 302) (Fig. 1A). The calculated molecular weight of EscSP is 38.6 kDa, and it has a predicted isoelectric point of 5.17. The clip domain has a molecular weight of 4.49 kDa and a pI of 6.08, and the SP-like domain is 27.3 kDa and 5.19. The full length of EsMas is 2340 bp, including a 30 bp 50 untranslated region, a 2082 bp ORF and a 228 bp 30 untranslated region with a poly (A) tail. The ORF encodes a 339-amino acid polypeptide with a 21-amino acid signal peptide. EsMas has low similarity in sequences and structure with EscSP. It has seven clip domains and one SP-like domain, and the catalytic triad (H 476, D 526 and G 627) only has two identical residues with EscSP, due to a substitution of Ser to Gly (Fig. 1B). So, loss of Ser catalytic residue made EsMas a catalytically inactive serine protease, and it was also termed as serine protease homolog. Molecular weight and isoelectric point of EsMas are 74.8 kDa and 5.21, respectively. The clip1 to clip7 domains have molecular weight of 5.8, 5.3, 4.22, 4.85, 4.23, 3.88 and 4.14 kDa, and pI of 4.66, 5.31, 3.96, 4.83, 4.41, 4.72 and 5.32, respectively. The molecular weight and isolectric point of the SPlike domain are 27.2 kDa and 7.67. 3.2. Multiple alignments and phylogenic analysis of EscSP and EsMas with other SPs The multiple alignments of the serine protease domain of EscSP with cSPs from other species and of EsMas with PlMas show that nearly all SP or SP-like domains starts with R and end with WI, including three conserved motifs around the catalytic residues. EscSP has a reactive serine residue. Furthermore, around this catalytic residue there is a conserved motif called the GDSGGP region, while EsMas has no serine residue. It is replaced by glycine, so this motif is GDGGGP, which is also conserved. Another conserved motif within EscSP and EsMas is the TAAHC region. Asp (D) is necessary for serine protease activity and is also present prior to an IAL sequence. A motif of DIAL exists in EscSP. DIAL possesses the least sequence conservation in contrast to the two other motifs. In EsMas, there is a motif of DVAV (Fig. 2). It’s worth noting that the alignment of the clip domains of EsMas and PlMas provide some interesting results. Under normal circumstances, there are one to five clip domains in Mas from different species. But in EsMas and PlMas, seven clip domains exist at the N-terminal. Among all these clip domains, the first, second, third, fifth and sixth cysteine residues are well conserved (Fig. 3). Phylogenic analysis performed using MEGA 5.0 software showed that the EscSP together with P. monodon clip domain serine proteinase 1 and 2, P. monodon prophenoloxidase-activating enzyme 2, P. trituberculatus serine proteinase, P. trituberculatus clip domain serine proteinase, Litopenaeus vannamei serine protease 1 and 2, and F. chinensis serine protease 1 and 2 are clustered into one group, whereas others belong to another group (Fig. 4). Only EsMas together with PlMas belong to one cluster (Fig. 5). Furthermore EsMas has no glycine repeat region found in other masquerade proteins. It seems that EsMas is a new member of clip domain serine protease homologs. 3.3. Tissue distribution and expression pattern analysis of EscSP and EsMas in crab injected with LPS or PGN Fig. 1. (continued).
The qRT-PCR was used to investigate the tissue distribution of EscSP and EsMas transcripts. Results showed that the EscSP was
Y. Huang et al. / Fish & Shellfish Immunology 35 (2013) 1155e1162
1159
Fig. 2. Multiple alignments of the serine protease domain of EscSP with cSPs from other species (A) and of EsMas with PlMas (B). PmcSP1 and PmcSP2: clip domain serine proteinase 1 and 2 from P. monodon (ACP19562.1, ACP19561.1); PmPPAE2: prophenoloxidase-activating enzyme 2 from P. monodon (ACP19559.1); PtSP: serine proteinase from P. trituberculatus (AFC61247.1); PtcSP: clip domain serine proteinase from P. trituberculatus (AFA42362.1); LvSP1 and LvSP2: serine protease 1 and 2 from L. vannamei (AFW98995.1; AFW98996.1); FcSP1 and FcSP2: serine protease 1 and 2 from F. chinensis (AFW98988.1; AFW98989.1); PlMas: masquerade-like protein from P. leniusculus (CAA72032.2).
distributed in all tissues examined, including hemocytes, hepatopancreas, gills, intestine, muscle, nerve, eyestalk and heart of untreated crab. The expression level of EscSP is relatively higher in hepatopancreas, nerve and eyestalk (Fig. 6A). EsMas was mainly expressed in hemocytes, muscle, nerve and eyestalk of the untreated crabs, and was also detected in hepatopancreas, gills, intestine and heart (Fig. 6B). To investigate the roles of EscSP and EsMas in innate immunity of crab, qRT-PCR analysis was performed
in hemocytes. The results showed that EscSP was significant upregulated in 2 h, then down-regulated from 6 to 24 h in LPS challenge, but it was still higher than the expression level at 0 h (Fig. 7A). EscSP increased to the highest level at 2 h after PGN challenge and then gradually declined from 6 to 24 h (Fig. 7B). EsMas was first down-regulated after 2 h post-LPS challenge, and from 6 to 24 h quickly declined down to the level of almost no expression (Fig. 8A). However, it was up-regulated at 2 h post PGN
Fig. 3. Multiple alignments of the clip domains of EsMas and PlMas. PlMas: masquerade-like protein from P. leniusculus (CAA72032.2).
1160
Y. Huang et al. / Fish & Shellfish Immunology 35 (2013) 1155e1162
Fig. 4. Phylogenic analysis of EscSP and other clip domain SPs. PmcSP1 and PmcSP2: clip domain serine proteinase 1 and 2 from P. monodon (ACP19562.1, ACP19561.1); PmPPAE2: prophenoloxidase-activating enzyme 2 from P. monodon (ACP19559.1); PtcSP: clip domain serine proteinase from P. trituberculatus (AFA42362.1); LvSP1 and LvSP2: serine protease 1 and 2 from L. vannamei (AFW98995.1; AFW98996.1); FcSP1 and FcSP2: serine protease 1 and 2 from F. chinensis (AFW98988.1; AFW98989.1); HdPPAE1: pro-phenoloxidase activating enzyme 1 precursor from Holotrichia diomphalia (BAA34642.1); PhcTRY: tripsin from Pediculus humanus corporis (XP_002430853.1); PtSP: serine proteinase from P. trituberculatus (AFC61247.1); AfSPE: serine protease easter-like from Apis florea (XP_003696359.1); NvSP16: serine protease 16 precursor from Nasonia vitripennis (NP_001155077.1); TcHP5: similar to hemolymph proteinase 5 from Tribolium castaneum (XP_972679.1); DmMP1: melanization protease 1, isoform C from D. melanogaster (NP_001138002.1); GmmSP: fat body serine protease from Glossina morsitans morsitans (ADD18853.1); AmSPE: serine protease easter from Apis mellifera (XP_001122037.2) NvSP22: serine protease 22 precursor from N. vitripennis (NP_001155043.1); CqSP: serine protease from Culex quinquefasciatus (XP_001842728.1); AgSP: serine protease 14D from Anopheles gambiae (AAB62929.1); MrSPE: serine protease easter-like from Megachile rotundata (XP_003707384.1); AaSP: serine protease from Aedes aegypti (XP_001647865.1); BbPAP1: prophenoloxidase activating proteinase 1 from Biston betularia (ADF43208.1).
challenge, followed by a decline down to the lowest level at 6 h, and then recovered from 12 to 24 h (Fig. 8B). 4. Discussion In recent years, an increasing amount of SPs and SPHs have been identified from crustaceans, and they are proven to be involved in a series of innate immune responses including digestion, development and immune defense [8]. Discovering novel SPs and SPHs from crabs and investigating their immune mechanism will very likely be useful in understanding the structural and functional diversity of crustacean SPs. In the present study, new SP (EscSP) and SPH (EsMas) were identified from the Chinese mitten crab E. sinensis. EscSP contains only one clip domain, in which six
Fig. 5. Phylogenic analysis of EsMas marked by a triangle and other Mas in different species. DmMas: masquerade from D. melanogaster (AAC46512.1); DmMasB and DmMasC: masquerade, isoform B and isoform C from D. melanogaster (NP_523919.1, NP_001261408.1); CqMas: masquerade from C. quinquefasciatus (EDS42125.1); AaMas: masquerade from A. aegypti (XP_001654730.1); IsMas: masquerade, putative from Ixodes scapularis (EEC08239.1); PmPPAF: prophenoloxidase activating factor from P. monodon (ABE03741.1); BmMas: masquerade-like serine proteinase homolog from Bombyx mori (AAN77090.1); PlSPH1: serine proteinase-like protein 1 from P. leniusculus (AAX55746.1); TmMas: masquerade-like serine proteinase homologue from Tenebrio molitor (BAC15605.1); PlMas: masquerade-like protein from P. leniusculus (CAA72032.2); TmPPAF: prophenoloxidase activating factor from T. molitor (CAC12696.1); HdPPAF and HdPPAF-III: prophenoloxidase activating factor and factor-III from H. diomphalia (CAC12665.1, BAC15604.1); HdproPO-I and HdproPOII: prophenoloxidase-I and prophenoloxidase-II from H. diomphalia (BAC15602.1, BAC15603.1).
conserved cysteine residues formed three disulfide bridges, considered to be important for serine-type endopeptidase activity. The clip domain always consists of 37e55 residues [11] and EscSP has 41 amino acids in length, which is similar with other clip domains reported so far. This domain is also restricted to the Arthropoda and found in varying copy numbers (from one to five in Drosophila proteins). But we found that EsMas has seven clip domains at the N-terminal, and those domains are 52, 48, 42, 46, 42, 37 and 40 amino acids in length, respectively. These are all within the normal range. At the C-terminal of EscSP, there is a serine protease domain, which is active and thus conserved. In this SP domain, three catalytic residues (H, D and S) which form a catalytic triad were identified. And around those catalytic residues three conserved motifs (GDSGGP, TAAHC, and DIAL) are present. EsMas do not exhibit any proteolytic activity due to replacement of the essential serine residue by glycine [27]. So the region around the active aspartic acid residue is less conserved than EscSP. There are only two conserved motifs (GDSGGP, TAAHC) and another variable motif of DVAV around the catalytic residue Asp. EscSP is a putative catalytically active protease predicted through SMART analysis, while EsMas is a catalytically inactive SP, known as Mas. A phylogenetic tree of EscSP and SPs containing the clip domain was divided into two clusters, and clearly confirmed different clades between crustacean SPs and insect SPs. It suggests that EscSP shares high similarity with other crustacean SPs, while EscSP is also fairly distinct from those insect SPs. However, EscSP and SPs in crustaceans (including P. monodon clip domain serine proteinase 1 and 2, P. monodon prophenoloxidase-activating
Y. Huang et al. / Fish & Shellfish Immunology 35 (2013) 1155e1162
Fig. 6. Tissue distribution of EscSP(A) and EsMas(B) cDNAs from E. sinensis in hemocytes, hepatopancreas, gills, intestine, muscle, nerve, eyestalk and heart using qPCR methods.
Fig. 7. Time-course analysis of EscSP expression pattern in hemocytes in response to LPS(A) and PGN(B) at 0, 2, 6, 12 and 24 h post-injection by real-time PCR. The mRNA levels of EscSP were analyzed and standardized according to the b-actin mRNA levels. Each bar represents the value from three independent PCR amplifications and quantifications with the standard error maraker. Statistical significance is indicated by asterisks (*P < 0.05, **P < 0.01, ***P < 0.001) compared with that of the control.
1161
Fig. 8. Time-course analysis of EsMas expression pattern in hemocytes in response to LPS(A) and PGN(B) at 0, 2, 6, 12 and 24 h post-injection by real-time PCR. The mRNA levels of EsMas were analyzed and standardized according to the b-actin mRNA levels. Each bar represents the value from three independent PCR amplifications and quantifications with the standard error maraker. Statistical significance is indicated by asterisks (*P < 0.05, **P < 0.01, ***P < 0.001) compared with that of the control.
enzyme 2, P. trituberculatus serine proteinase, P. trituberculatus clip domain serine proteinase, L. vannamei serine protease 1 and 2, and F. chinensis serine protease 1 and 2) are not clearly classified into one group. This may indicate that ten SPs might not have a single origin in gene evolution. Similarly, phylogenetic analysis of EsMas with other Mas in different species shows that EsMas is similar to PlMas and, likewise, is so related with Mas from other detected species; whereas, EsMas is only 30.11% identical with PlMas, as analyzed with the software DNAMAN. And the structure of EcMas is also different from PlMas. PlMas has seven repeats of a predicted disulfide-knotted motif which is similar with EsMas, but a region of seven repeats of a glycine-rich sequence which does not appear in EsMas [6]. All these results illustrated that EscSP and EsMas were two novel SPs in E. sinensis. QRT-PCR results showed that EscSP and EsMas mRNA were widely expressed in all detected tissues, but the level of mRNA expression differs between tissues. The mRNA transcripts of PtcSPs and PtcSPH could also be detected widely in all the examined tissues with remarkably different expression levels [28]. EscSP was strongly expressed in hepatopancreas, nerve and eyestalk as compared to other tissues. Hepatopancreas is an important organ involved in crustacean immunity, it plays a crucial role in the immune response [29]. In recently reports, a SPH identified from F. chinensis (FcSPH2) was only found in hepatopancreas [22]. Whereas EsMas was mostly distributed in hemocytes, muscle, nerve and eyestalk and its expression level was lower in hepatopancreas, gills, intestine and heart. It could be speculated that EscSP and EsMas have different immune mechanisms. We conducted expression analysis of the genes following an immune-challenge at different time points with LPS and PGN to understand the possible biological function of EscSP and EsMas. The transcription of EscSP in hemocytes was substantially up-regulated at 2 h post LPS and PGN challenge, then gradually down-regulated
1162
Y. Huang et al. / Fish & Shellfish Immunology 35 (2013) 1155e1162
from 6 to 24 h. This is similar with P. monodon prophenoloxidaseactivating enzyme 1, which was up-regulated at 3 h followed by down-regulation at 6e48 h after V. harveyi injection [30]. PmPPAE1 is likely to function in the proPO system and is an important component in shrimp immunity [31]. So EscSP serves as an acutephase defense molecule and might play crucial roles in frontline immune defense tissues for antibacterial responses in crab. EsMas was down-regulated by LPS and PGN challenge in hemocytes; and, moreover, P. monodon serine protease homolog was also downregulated after a yellow head virus (YHV) challenge [18]. In previous reports, masquerade has been considered to participate in induction of prophenoloxidase [32] and cellular adhesion activity [7]. It also has been identified as a binding protein of YHV [18] and a PPR, which can recognize Gram-negative bacteria, i.e., Escherichia coli, Pemphigus vulgaris, Shigella flexneri, and yeast, Saccharomyces cerevisiae and clearance of microorganisms in crayfish [20]. Therefore, it could be speculated that EsMas might also function as a PPR. Crabs could prevent bacterial invasion by down-regulating the expression of EsMas. In conclusion, the cDNA of EscSP and EsMas were cloned from E. sinensis. Tissue distribution and expression pattern of EscSP and EsMas after LPS and PGN challenge were investigated through qRTPCR. From the molecular characterization and expression pattern, it could be deduced that EscSP and EsMas might play an important role in crab innate immunity. However, further research is needed to clarify the more precise role and immune functions of EscSP and EsMas in crab immune defense. Acknowledgments We appreciate Professor O. Roger Anderson (Columbia University) for editing the manuscript. The current study was supported by the National Natural Science Foundation of China (Grant No. 31101926, 31170120; 31272686), the Startup Scientific Research Fund from Jiangsu University for Advanced Professionals (Grant No. 10JDG122), the Open Project of Key Laboratory of Ministry of Education for Medicinal Resources, and Natural Pharmaceutical Chemistry of Shanxi Normal University (Grant No. MR&NPC2010001), the Jiangsu Planned Projects for Postdoctoral Research Funds (Grant No. 1002011B) and China Postdoctoral Science Foundation (20110491362) and the project funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD). Jiangsu Agriculture Science and Technology Innovation Fund (JASTIF) CX (12)3066, and Project for Aquaculture in Jiangsu Province (No. PJ2011-65; Y2013-45; D20135-3; D2013-5-4). References [1] Shi XZ, Zhao XF, Wang JX. Molecular cloning and expression analysis of chymotrypsin-like serine protease from the Chinese shrimp, Fenneropenaeus chinensis. Fish Shellfish Immunol 2008;25:589e97. [2] Rawlings ND, Barrett AJ. Families of serine peptidases. Methods Enzymol 1994;244:19e61. [3] Wu QY, Kuo HC, Deng GG. Serine proteases and cardiac function. Biochim Biophys Acta 2005;1751:82e94. [4] Ross J, Jiang H, Kanost MR, Wang Y. Serine proteases and their homologs in the Drosophila melanogaster genome: an initial analysis of sequence conservation and phylogenetic relationships. Gene 2003;304:117e31. [5] Kim MS, Baek MJ, Lee MH, Park JW, Lee SY, Soderhall K, et al. A new eastertype serine protease cleaves a masquerade-like protein during prophenoloxidase activation in Holotrichia diomphalia larvae. J Biol Chem 2002;277: 39999e40004. [6] Huang TS, Wang H, Lee SY, Johansson MW, Soderhall K, Cerenius L. A cell adhesion protein from the crayfish Pacifastacus leniusculus, a serine proteinase homologue similar to Drosophila masquerade. J Biol Chem 2000;275:9996e10001.
[7] Lin CY, Hu KY, Ho SH, Song YL. Cloning and characterization of a shrimp clip domain serine protease homolog (c-SPH) as a cell adhesion molecule. Dev Comp Immunol 2006;30:1132e44. [8] Zou Z, Lopez DL, Kanost MR, Evans JD, Jiang H. Comparative analysis of serine protease-related genes in the honey bee genome: possible involvement in embryonic development and innate immunity. Insect Mol Biol 2006;15:603e14. [9] Morisato D, Anderson KV. Signaling pathways that establish the dorsal-ventral pattern of the Drosophila embryo. Annu Rev Genet 1995;29:371e99. [10] Anderson KV. Pinning down positional information: dorsaleventral polarity in the Drosophila embryo. Cell 1998;95:439e42. [11] Jiang HB, Kanost MR. The clip-domain family of serine protease in arthropods. Insect Biochem Mol Biol 2000;30:95e105. [12] Muta T, Hashimoto R, Miyata T, Nishimura H, Toh Y, Iwanaga S. Proclotting enzyme from horseshoe crab hemocytes. cDNA cloning, disulfide locations, and subcellular localization. J Biol Chem 1990;265:22426e33. [13] Gai YC, Qiu LM, Wang LL, Song LS, Mu CK, Zhao JM, et al. A clip domain serine protease (cSP) from the Chinese mitten crab Eriocheir sinensis: cDNA characterization and mRNA expression. Fish Shellfish Immunol 2009;27:670e7. [14] Cui Z, Liu Y, Wu D, Luan W, Wang S, Li Q, et al. Molecular cloning and characterization of a serine proteinase homolog prophenoloxidase-activating factor in the swimming crab Portunus trituberculatus. Fish Shellfish Immunol 2010;29:679e86. [15] Liu Y, Cui Z, Song C, Wang S, Li Q. Multiple isoforms of immune-related genes from hemocytes and eyestalk cDNA libraries of swimming crab Portunus trituberculatus. Fish Shellfish Immunol 2011;31:29e42. [16] Ren Q, Xu ZL, Wang XW, Zhao XF, Wang JX. Clip domain serine protease and its homolog respond to Vibrio challenge in Chinese white shrimp, Fenneropenaeus chinensis. Fish Shellfish Immunol 2009;26:787e98. [17] Rattanachai A, Hirono I, Ohira T, Takahashi Y, Aoki T. Peptidoglycan inducible expression of a serine proteinase homologue from kuruma shrimp (Marsupenaeus japonicus). Fish Shellfish Immunol 2005;18:39e48. [18] Sriphaijit T, Flegel TW, Senapin S. Characterization of a shrimp serine protease homolog, a binding protein of yellow head virus. Dev Comp Immunol 2007;31:1145e58. [19] Murugasu-Oei B, Rodrigues V, Yang X, Chia W. Masquerade: a novel secreted serine protease-like molecule is required for somatic muscle attachment in the Drosophila embryo. Genes Dev 1995;9:139e54. [20] Lee SY, Söderhäll K. Characterization of a pattern recognition protein, a masquerade-like protein, in the freshwater crayfish Pacifastacus leniusculus. J Immunol 2001;166:7319e26. [21] Amparyup P, Jitvaropas R, Pulsook N, Tassanakajon A. Molecular cloning, characterization and expression of a masquerade-like serine proteinase homologue from black tiger shrimp Penaeus monodon. Fish Shellfish Immunol 2007;22:535e46. [22] Ren Q, Zhao XF, Wang JX. Identification of three different types of serine proteases (one SP and two SPHs) in Chinese white shrimp. Fish Shellfish Immunol 2011;30:456e66. [23] Meng Q, Li W, Liang T, Jiang X, Gu W, Wang W. Identification of adhesin-like protein ALP41 from Spiroplasma eriocheiris and induction immune response of Eriocheir sinensis. Fish Shellfish Immunol 2010;29:587e93. [24] Ren Q, Li M, Du J, Zhang CY, Wang W. Immune response of four dual-CRD Ctype lectins to microbial challenges in giant freshwater prawn Macrobrachium rosenbergii. Fish Shellfish Immunol 2012;33:155e67. [25] Cui Z, Liu Y, Luan W, Li Q, Wu D, Wang S. Molecular cloning and characterization of a heat shock protein 70 gene in swimming crab (Portunus trituberculatus). Fish Shellfish Immunol 2010;28:56e64. [26] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using realtime quantitative PCR and the 2(eOOC(T)) method. Methods 2001;25: 402e8. [27] Cerenius L, Söderhäll K. The prophenoloxidase-activating system in invertebrates. Immunol Rev 2004;198:116e26. [28] Li QQ, Cui ZX, Liu Y, Wang SY, Song CW. Three clip domain serine proteases (cSPs) and one clip domain serine protease homologue (cSPH) identified from haemocytes and eyestalk cDNA libraries of swimming crab Portunus trituberculatus. Fish Shellfish Immunol 2012;32:565e71. [29] Ji PF, Yao CL, Wang ZY. Immune response and gene expression in shrimp (Litopenaeus vannamei) hemocytes and hepatopancreas against some pathogen-associated molecular patterns. Fish Shellfish Immunol 2009;27: 563e70. [30] Amparyup P, Wiriyaukaradecha K, Charoensapsri W, Tassanakajon A. A clip domain serine proteinase plays a role in antibacterial defense but is not required for prophenoloxidase activation in shrimp. Dev Comp Immunol 2010;34:168e76. [31] Charoensapsri W, Amparyup P, Hirono I, Aoki T, Tassanakajon A. Gene silencing of a prophenoloxidase activating enzyme in the shrimp, Penaeus monodon, increases susceptibility to Vibrio harveyi infection. Dev Comp Immunol 2009;33:811e20. [32] Kwon TH, Kim MS, Choi HW, Joo CH, Cho MY, Lee BL. A masquerade-like serine proteinase homologue is necessary for phenoloxidase activity in the coleopteran insect, Holotrichia diomphalia larvae. Eur J Biochem 2000;267: 6188e96.
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Cloning and characterization of a clip domain serine protease and its homolog (masquerade) from Eriocheir sinensis Ying Huang, Yu-Ran Li, Liang An, Kai-Min Hui, Qian Ren*, Wen Wang* Jiangsu Key Laboratory for Biodiversity & Biotechnology and Jiangsu Key Laboratory for Aquatic Crustacean Diseases, College of Life Sciences, Nanjing Normal University, 1 Wenyuan Road, Nanjing 210046, PR China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 3 May 2013 Received in revised form 30 June 2013 Accepted 14 July 2013 Available online 21 July 2013
Serine proteinases (SPs) or SP homologs (SPHs) including clip domain SPs (cSPs) or SPHs (cSPHs) play critical roles in digestion, embryonic development, hemolymph coagulation, and melanization. In this study, one cSP (EscSP) and one SPH, similar to Drosophila masquerade (EsMas), were identified from hepatopancreas of the Chinese mittern crab Eriocheir sinensis. They both possess the clip domains at the N-terminal, EscSP has only one clip domain, but EsMas has seven clip domains. One SP or SP-like domain was at the C-terminal of EscSP and EsMas respectively. In contrast to EscSP, absence of a catalytic residue of Ser resulted in the loss of SP activity of EsMas. Tissue distribution analysis showed that EscSP mRNA was mainly expressed in hepatopancreas, nerve and eyestalk tissue; whereas the EsMas transcript was mainly distributed in eyestalk, muscle, nerve and hemocytes. EscSP in hemocytes showed significant increase after a lipopolysaccharide (LPS) or peptidoglycan (PGN) challenge. However, down-regulation of EsMas was observed in hemocytes challenged by LPS from 2 to 24 h, by contrast EsMas could be induced by PGN challenge at 2 and 24 h. All these findings indicated that EscSP and EsMas might be involved in the innate immune defenses in E. sinensis. Ó 2013 Elsevier Ltd. All rights reserved.
Keywords: Serine proteases Masquerade Innate immunity Clip domain
1. Introduction Serine proteinases (SPs) are a large family of proteases [1] and they play important roles by proteolytic cleavage of specific proteins [2]. SPs have a catalytic triad formed by three catalytic residues His (H), Asp (D) and Ser (S) [3]. When serine residue of this catalytic triad is replaced by glycine (H, D, G), these analogous SPs become inactive and are named serine proteinases homologs (SPHs). Upon losing the catalytic activity for protease precursors [4], SPHs assisted SPs as cofactors to perform their functions [5e7]. In mammals, SPs and SPHs are involved in various biological processes, for example, digestion, blood coagulation and the complement system [8]. SPs or SPHs can be divided into two groups, single domain SPs and multiple domain SPs [4,8]. Single domain SPs, such as trypsin and chymotrypsin, have less than 300 amino acids, and their fundamental role is digestion. Multiple domain SPs, include clip domain SPs or SPHs, and sophisticated domain SPs or SPHs that are associated with other domains [4]. The SPs and SPHs that contain
* Corresponding authors. Tel.: þ86 25 85891955; fax: þ86 25 85891526. E-mail addresses: [email protected] (Q. Ren), [email protected], [email protected] (W. Wang). 1050-4648/$ e see front matter Ó 2013 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.fsi.2013.07.025
one or more clip domains are called clip-SPs (cSPs) and clip-SPHs (cSPHs). The first cSP was identified in Drosophila melanogaster [9,10]. Since then, more and more cSPs and cSPHs (including Mas proteins) have been found in arthropods. It is worth noting that these cSPs and cSPHs molecules share common structural features that contain one or more clip domains, which are found at the Nterminal of the polypeptide chain; they consist of 37e55 amino acids including six strictly conserved residues arranged in three disulfide-bridge structures [11]. The clip domain may act as substrate or activator binding domains, catalytic domain repressors, or antimicrobial peptides [11,12]. These cSPs also have a catalytically active SP domain at the C terminus; while cSPHs have an inactive SP-like domain, which is the most significant difference between cSPs and cSPHs [11]. Recently, cDNAs of cSPs and cSPHs have been cloned and their roles in the innate immune system also have been researched in crabs and penaeid shrimps. For instance, a proclotting enzyme which is an intracellular cSP zymogen closely associated with an endotoxin sensitive hemolymph coagulation system was purified from hemocytes of the horseshoe crab Tachypleus tridentatus [12]. Another EscSP was reported that was higher expressed in muscle of the Chinese mitten crab Eriocheir sinensis, and which was involved in the processes of hostepathogen interaction probably as one of the proPO system members [13]. Five cSPs were found in the
1156
Y. Huang et al. / Fish & Shellfish Immunology 35 (2013) 1155e1162
hemocytes and eyestalk of the swimming crab Portunus trituberculatus and they were involved in the antibacterial defense mechanism [14,15]. Two novel cSPs (FcSP and FcSPH) were purified from gills of Chinese white shrimp, Fenneropenaeus chinensis. When a host is attacked by invading pathogens, they will be quickly cleaved and the shrimp initiates a defense reaction against the pathogens [16]. Moreover, cSPs or cSPHs also have been characterized from the kuruma shrimp, Marsupenaeus japonicus [17], and the black tiger shrimp, Penaeus monodon [7,18]. Masquerade is a novel, secreted serine protease-like molecule. It was first thought to be involved in D. melanogaster [19]. In recent years, Mas also was reported in crustaceans. Two masquerade-like SPH proteins similar to Drosophila masquerade were found in the crayfish, Pacifastacus leniusculus, which exhibit cell adhesion activity in vitro, pattern recognition, and opsonization [6,20]. In the black tiger shrimp, P. monodon, a masquerade-like SPH was previously cloned and its transcript expression levels found to be upregulated upon bacterial challenge with Vibrio harveyi [21]. One masquerade molecule (FcMas) was discovered in F. chinensis. It could be speculated that FcMas might function as a PPR and shrimp could inhibit bacteria or white spot syndrome virus (WSSV) entry into host by down-regulating the expression of FcMas [22]. In the present study, the complete cDNA sequence of a cSP and a cSPH (Mas) from the Chinese mitten crab E. sinensis (EscSP, EsMas) was identified and the responses of these clip domains to lipopolysaccharide (LPS) or peptidoglycan (PGN) challenge were also investigated. This research will very likely be potentially helpful in understanding the innate immune defense of economically important crabs. 2. Materials and methods 2.1. Experimental animals The Chinese mitten crab E. sinensis individuals (approximately 60e80 g in body weight), were obtained from a commercial farm in Yangzhou, China, and reared in laboratory tanks filled with filtered and UV-treated artificial freshwater with a controlled temperature (24e26 C) regime. Crabs were fed daily with a commercial diet daily at a rate of 8% body weight for 2 weeks before treatment. 2.2. Immune challenge by LPS and PGN Forty-five crabs were employed for the immune challenge experiment, and they were randomly divided into 3 groups (LPS group, PGN group and control group). For the crabs in two experiment groups, about 50 ml LPS (0.5 mg/ml) or 100 ml PGN (0.5 mg/ml) were injected into each crab; and for the control group, other crabs were inoculated with 100 ml physiological saline. After 0, 2, 6, 12 and 24 h post-injection, two samples of haemolymph from the second pereiopod for each group of crabs were respectively collected using a 2-ml sterile syringe preloaded with an equal volume of improved anticoagulant buffer (ACD-B) (Glucose, 1.47 g; citric acid, 0.48 g; trisodium citrate, 1.32 g; double distilled water was added to 100 ml, pH 7.3) [23]. The hemolymph was centrifuged immediately at 2000 rpm at 4 C for 5 min to isolate the haemocytes. Other tissues, such as hepatopancreas, gills, intestine, muscle, nerve, eyestalk and heart were also collected from untreated crabs for tissue distribution studies and RNA extraction. 2.3. Total RNA extraction and cDNA synthesis Total RNAs from the above mentioned tissues were extracted according to the manufacturer’s instruction for Unizol reagent (Biostar, Shanghai, China). The first strand cDNA synthesis of
different samples for qRT-PCR analysis using an M-MLV First Strand Kit (Invitrogen, Shanghai, China) with the primer oligo (dT)20. The first-strand cDNA synthesis was performed following the manufacture’s instruction using 50 -CDS Primer A and SMARTer ⅡA oligo (50 -RACE Ready cDNA) and 30 -CDS Primer A (30 -RACE-Ready cDNA). The first-strand cDNA was also synthesized using 30 RACE Adaptor of 30 Full RACE Core Set Ver. 2.0 (Takara, Dalian, China) and the detailed methods was according to the manufacturer’s protocol. The primer sequences are shown in Table 1. 2.4. Gene cloning of EscSP and EsMas The two expressed sequence tag (EST) sequences with 1095 and 762 bp similar to SP and Masquerade gene respectively were obtained from transcriptome sequencing of a cDNA library constructed from the hepatopancreas of Chinese mitten crab. According to those sequences, two pairs of gene-specific primers (EscSP-F, EscSP-R and EsMas-F, EsMas-R) were designed to obtain full length of the EscSP and EsMas genes. The full length of EscSP and EsMas genes were cloned using the 30 and 50 Rapid Amplification cDNA End (RACE) methods. The 50 fragments of EscSP and EsMas and the 30 fragment of EsMas were obtained using a Clontech SMARTerÔ RACE cDNA Amplification Kit from Takara (Dalian, China) with gene specific primers and UPM primer. The 30 fragment of EscSP was amplified using 30 RACE Out Primer and EscSP-F. The detailed methods were based on a previous study [24]. The full length of EscSP and EsMas cDNAs was obtained by overlapping the 50 and 30 fragments. All primers are listed in Table 1. 2.5. Sequence and phylogenetic analysis Similar analysis was accomplished using the online program BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Translation of EscSP and EsMas and prediction of the deduced protein were performed with the Expert Protein Analysis System (http://www.au.expasy. org/). Signal sequence and domain prediction were conducted with the Simple Modular Architecture Research Tool (http://smart. embl-heidelberg.de/). The Molecular Evolutionary Genetics Analysis (MEGA 5.0) and GENEDOC software were used for multiple alignments of EscSP with other clip domain serine proteases and EsMas with masquerades in other species. Phylogenetic analysis was conducted with MEGA 5.0 using Neighbor-Joining (NJ) method, and the reliability of the branching was tested by bootstrap resampling (1000 pseudo-replicates). The clip domain, SP or SP-like
Table 1 Primer sequences used in this study. Primers name
Sequence (50 e30 )
EscSP-F EscSP-R EsMas-F EsMas-R EscSP-RT-F EscSP-RT-R EsMas-RT-F EsMas-RT-R Es-Actin-F Es-Actin-R 30 RACE Outer Primer UPM Long
AGGCGGCGGATGCTTTCAGTAGAAC CCGCACAGGAAGTCAGGCTTATTGG GTGTCAGGGCATCTCGCAGACCAAC CAAGTGTCATAAGGAACGACGGGTAGAG ATAAGCCTGACTTCCTGTGCG GTTTGCCGTAATCTGGGTGTT CCGTCGTTCCTTATGACACTT TACAGCTCGTAGCGGTTATTG GCATCCACGAGACCACTTACA CTCCTGCTTGCTGATCCACATC TACCGTCGTTCCACTAGTGATTT
Short 50 -CDS Primer A SMARTerⅡA oligo 30 -CDS primer A
CTAATACGACTCACTATAGGGCAAGCAGTG GTATCAACGCAGAGT CTAATACGACTCACTATAGGGC T25VN AAGCAGTGGTATCAACGCAGAGTACXXXXX AAGCAGTGGTATCAACGCAGAGTAC(T)30VN
Y. Huang et al. / Fish & Shellfish Immunology 35 (2013) 1155e1162
1157
domain and catalytic residues of EscSP and EsMas were predicted via homologous sequences alignment. Calculated molecular weight and predicted isoelectric point of EscSP and EsMas were obtained through ExPASy (http://web.expasy.org/compute_pi/). 2.6. Tissue distribution and expression pattern analysis of EscSP and EsMas upon LPS or PGN challenge Quantitative real-time PCR (qRT-PCR) was used to investigate the mRNA expression levels of EscSP and EsMas in various tissues, including hemocytes, hepatopancreas, gills, intestine, muscle, nerve, eyestalk and heart of untreated crabs, as well as the temporal expression of EscSP and EsMas transcripts in hemocytes of crabs challenged with LPS or PGN at 2, 6, 12, and 24 h. The qRT-PCRs were performed following the manufacturer’s protocol of the kit of SYBR Premix Ex Taq (Takara, Japan) with a real-time thermal cycler (BioRad, Hercules, CA) [1]. Two pairs of specific primers (EscSP-RT-F, EscSP-RT-R and EsMas-RT-F, EsMas-RT-R) were used to amplify the corresponding products of EscSP and EsMas from each cDNA template in the qRT-PCR analysis, and the PCR product was sequenced to verify the specificity of qRT-PCR. Moreover, two primers Es-actin F and Es-actin R were used to amplify b-actin, which serves as the reference house-keeping gene for internal standardization to verify the successful transcription and to normalize the level of expression between the samples [25]. The qRT-PCR was carried out in a total volume of 10 ml, containing 5 ml of 2 SYBR Premix Ex TaqTM, 1 ml cDNA (1:100 diluted), and 2 ml of each forward and reverse primers (1 mmol/L). The qRT-PCR was programmed at 95 C for 3 min, followed by 40 cycles of 94 C for 15 s, and 60 C for 30 s. To confirm that only one fragment was amplified, a dissociation curve was also analyzed for the amplification products, and was performed at the end of each PCR reaction. Then, the qRT-PCR data from the three biological replicated experiments, which were used to ensure the accuracy and validity of experimental results, were analyzed with ABI7300 SDS software V2.0 (Applied Biosystems). The expression level of EscSP or EsMas was determined using the comparative CT method. In this method, the discrepancy between the CT for the EscSP or EsMas and b-actin (OOCT) was calculated to normalize the variation in the amount of cDNA in each reaction. The expression level of EscSP or EsMas was then calculated by 2eOOCT methods [26] and subjected to statistical analysis. All data were given as mean standard error (S.E) in terms of relative mRNA expression. Unpaired sample t-test was performed as a statistical analysis, and differences were considered significant if P < 0.05. The prime sequences are shown in Table 1. 3. Result 3.1. Gene cloning of EscSP and EsMas from Chinese mitten crab Partial cDNA sequences of EscSP and EsMas in Chinese mitten crab were obtained based on analysis of expressed sequence tags from hepatopancreas cDNA libraries. Afterwards, 50 and 30 RACE methods were respectively performed to obtain the full cDNA sequences of EscSP and EsMas. The full length of EscSP is 2888 bp, including a 84 bp of 50 untranslated region (UTR), a 1065 bp open reading frame (ORF) encoding a 354-amino acids polypeptide with a 17-amino acid signal peptide, and a 1739 bp 30 untranslated region with a poly (A) tail. EscSP protein has two domains, including a
Fig. 1. Nucleotide (above) and deduced amino acid sequences (below) of EscSP(A) and EsMas(B) cDNAs from E. sinensis. Deduced amino acid residues are numbered on the right. Signal peptides of EscSP and EsMas are labeled in italics. The clip domain of EscSP
and EsMas, located behind the signal peptide, are underlined. The SP domain of EscSP and SP-like domain of EsMas are shaded. The sites of the catalytic triad of serine protease (H 147, D 207, S 302) and of serine protease homolog (H 476, D 526, G 627) are in bold.
1158
Y. Huang et al. / Fish & Shellfish Immunology 35 (2013) 1155e1162
clip domain of 41 bp amino acids interlinked by three disulfide pairs at the C-terminal, and by a serine protease domain of 249 bp amino acids at the N-terminal. In addition to the above domains, a linked region between the two domains also exists. Sequence alignment of the EscSP with SP or SPH in other arthropod animals suggests that it has three active sites (H 147, D 207, S 302) (Fig. 1A). The calculated molecular weight of EscSP is 38.6 kDa, and it has a predicted isoelectric point of 5.17. The clip domain has a molecular weight of 4.49 kDa and a pI of 6.08, and the SP-like domain is 27.3 kDa and 5.19. The full length of EsMas is 2340 bp, including a 30 bp 50 untranslated region, a 2082 bp ORF and a 228 bp 30 untranslated region with a poly (A) tail. The ORF encodes a 339-amino acid polypeptide with a 21-amino acid signal peptide. EsMas has low similarity in sequences and structure with EscSP. It has seven clip domains and one SP-like domain, and the catalytic triad (H 476, D 526 and G 627) only has two identical residues with EscSP, due to a substitution of Ser to Gly (Fig. 1B). So, loss of Ser catalytic residue made EsMas a catalytically inactive serine protease, and it was also termed as serine protease homolog. Molecular weight and isoelectric point of EsMas are 74.8 kDa and 5.21, respectively. The clip1 to clip7 domains have molecular weight of 5.8, 5.3, 4.22, 4.85, 4.23, 3.88 and 4.14 kDa, and pI of 4.66, 5.31, 3.96, 4.83, 4.41, 4.72 and 5.32, respectively. The molecular weight and isolectric point of the SPlike domain are 27.2 kDa and 7.67. 3.2. Multiple alignments and phylogenic analysis of EscSP and EsMas with other SPs The multiple alignments of the serine protease domain of EscSP with cSPs from other species and of EsMas with PlMas show that nearly all SP or SP-like domains starts with R and end with WI, including three conserved motifs around the catalytic residues. EscSP has a reactive serine residue. Furthermore, around this catalytic residue there is a conserved motif called the GDSGGP region, while EsMas has no serine residue. It is replaced by glycine, so this motif is GDGGGP, which is also conserved. Another conserved motif within EscSP and EsMas is the TAAHC region. Asp (D) is necessary for serine protease activity and is also present prior to an IAL sequence. A motif of DIAL exists in EscSP. DIAL possesses the least sequence conservation in contrast to the two other motifs. In EsMas, there is a motif of DVAV (Fig. 2). It’s worth noting that the alignment of the clip domains of EsMas and PlMas provide some interesting results. Under normal circumstances, there are one to five clip domains in Mas from different species. But in EsMas and PlMas, seven clip domains exist at the N-terminal. Among all these clip domains, the first, second, third, fifth and sixth cysteine residues are well conserved (Fig. 3). Phylogenic analysis performed using MEGA 5.0 software showed that the EscSP together with P. monodon clip domain serine proteinase 1 and 2, P. monodon prophenoloxidase-activating enzyme 2, P. trituberculatus serine proteinase, P. trituberculatus clip domain serine proteinase, Litopenaeus vannamei serine protease 1 and 2, and F. chinensis serine protease 1 and 2 are clustered into one group, whereas others belong to another group (Fig. 4). Only EsMas together with PlMas belong to one cluster (Fig. 5). Furthermore EsMas has no glycine repeat region found in other masquerade proteins. It seems that EsMas is a new member of clip domain serine protease homologs. 3.3. Tissue distribution and expression pattern analysis of EscSP and EsMas in crab injected with LPS or PGN Fig. 1. (continued).
The qRT-PCR was used to investigate the tissue distribution of EscSP and EsMas transcripts. Results showed that the EscSP was
Y. Huang et al. / Fish & Shellfish Immunology 35 (2013) 1155e1162
1159
Fig. 2. Multiple alignments of the serine protease domain of EscSP with cSPs from other species (A) and of EsMas with PlMas (B). PmcSP1 and PmcSP2: clip domain serine proteinase 1 and 2 from P. monodon (ACP19562.1, ACP19561.1); PmPPAE2: prophenoloxidase-activating enzyme 2 from P. monodon (ACP19559.1); PtSP: serine proteinase from P. trituberculatus (AFC61247.1); PtcSP: clip domain serine proteinase from P. trituberculatus (AFA42362.1); LvSP1 and LvSP2: serine protease 1 and 2 from L. vannamei (AFW98995.1; AFW98996.1); FcSP1 and FcSP2: serine protease 1 and 2 from F. chinensis (AFW98988.1; AFW98989.1); PlMas: masquerade-like protein from P. leniusculus (CAA72032.2).
distributed in all tissues examined, including hemocytes, hepatopancreas, gills, intestine, muscle, nerve, eyestalk and heart of untreated crab. The expression level of EscSP is relatively higher in hepatopancreas, nerve and eyestalk (Fig. 6A). EsMas was mainly expressed in hemocytes, muscle, nerve and eyestalk of the untreated crabs, and was also detected in hepatopancreas, gills, intestine and heart (Fig. 6B). To investigate the roles of EscSP and EsMas in innate immunity of crab, qRT-PCR analysis was performed
in hemocytes. The results showed that EscSP was significant upregulated in 2 h, then down-regulated from 6 to 24 h in LPS challenge, but it was still higher than the expression level at 0 h (Fig. 7A). EscSP increased to the highest level at 2 h after PGN challenge and then gradually declined from 6 to 24 h (Fig. 7B). EsMas was first down-regulated after 2 h post-LPS challenge, and from 6 to 24 h quickly declined down to the level of almost no expression (Fig. 8A). However, it was up-regulated at 2 h post PGN
Fig. 3. Multiple alignments of the clip domains of EsMas and PlMas. PlMas: masquerade-like protein from P. leniusculus (CAA72032.2).
1160
Y. Huang et al. / Fish & Shellfish Immunology 35 (2013) 1155e1162
Fig. 4. Phylogenic analysis of EscSP and other clip domain SPs. PmcSP1 and PmcSP2: clip domain serine proteinase 1 and 2 from P. monodon (ACP19562.1, ACP19561.1); PmPPAE2: prophenoloxidase-activating enzyme 2 from P. monodon (ACP19559.1); PtcSP: clip domain serine proteinase from P. trituberculatus (AFA42362.1); LvSP1 and LvSP2: serine protease 1 and 2 from L. vannamei (AFW98995.1; AFW98996.1); FcSP1 and FcSP2: serine protease 1 and 2 from F. chinensis (AFW98988.1; AFW98989.1); HdPPAE1: pro-phenoloxidase activating enzyme 1 precursor from Holotrichia diomphalia (BAA34642.1); PhcTRY: tripsin from Pediculus humanus corporis (XP_002430853.1); PtSP: serine proteinase from P. trituberculatus (AFC61247.1); AfSPE: serine protease easter-like from Apis florea (XP_003696359.1); NvSP16: serine protease 16 precursor from Nasonia vitripennis (NP_001155077.1); TcHP5: similar to hemolymph proteinase 5 from Tribolium castaneum (XP_972679.1); DmMP1: melanization protease 1, isoform C from D. melanogaster (NP_001138002.1); GmmSP: fat body serine protease from Glossina morsitans morsitans (ADD18853.1); AmSPE: serine protease easter from Apis mellifera (XP_001122037.2) NvSP22: serine protease 22 precursor from N. vitripennis (NP_001155043.1); CqSP: serine protease from Culex quinquefasciatus (XP_001842728.1); AgSP: serine protease 14D from Anopheles gambiae (AAB62929.1); MrSPE: serine protease easter-like from Megachile rotundata (XP_003707384.1); AaSP: serine protease from Aedes aegypti (XP_001647865.1); BbPAP1: prophenoloxidase activating proteinase 1 from Biston betularia (ADF43208.1).
challenge, followed by a decline down to the lowest level at 6 h, and then recovered from 12 to 24 h (Fig. 8B). 4. Discussion In recent years, an increasing amount of SPs and SPHs have been identified from crustaceans, and they are proven to be involved in a series of innate immune responses including digestion, development and immune defense [8]. Discovering novel SPs and SPHs from crabs and investigating their immune mechanism will very likely be useful in understanding the structural and functional diversity of crustacean SPs. In the present study, new SP (EscSP) and SPH (EsMas) were identified from the Chinese mitten crab E. sinensis. EscSP contains only one clip domain, in which six
Fig. 5. Phylogenic analysis of EsMas marked by a triangle and other Mas in different species. DmMas: masquerade from D. melanogaster (AAC46512.1); DmMasB and DmMasC: masquerade, isoform B and isoform C from D. melanogaster (NP_523919.1, NP_001261408.1); CqMas: masquerade from C. quinquefasciatus (EDS42125.1); AaMas: masquerade from A. aegypti (XP_001654730.1); IsMas: masquerade, putative from Ixodes scapularis (EEC08239.1); PmPPAF: prophenoloxidase activating factor from P. monodon (ABE03741.1); BmMas: masquerade-like serine proteinase homolog from Bombyx mori (AAN77090.1); PlSPH1: serine proteinase-like protein 1 from P. leniusculus (AAX55746.1); TmMas: masquerade-like serine proteinase homologue from Tenebrio molitor (BAC15605.1); PlMas: masquerade-like protein from P. leniusculus (CAA72032.2); TmPPAF: prophenoloxidase activating factor from T. molitor (CAC12696.1); HdPPAF and HdPPAF-III: prophenoloxidase activating factor and factor-III from H. diomphalia (CAC12665.1, BAC15604.1); HdproPO-I and HdproPOII: prophenoloxidase-I and prophenoloxidase-II from H. diomphalia (BAC15602.1, BAC15603.1).
conserved cysteine residues formed three disulfide bridges, considered to be important for serine-type endopeptidase activity. The clip domain always consists of 37e55 residues [11] and EscSP has 41 amino acids in length, which is similar with other clip domains reported so far. This domain is also restricted to the Arthropoda and found in varying copy numbers (from one to five in Drosophila proteins). But we found that EsMas has seven clip domains at the N-terminal, and those domains are 52, 48, 42, 46, 42, 37 and 40 amino acids in length, respectively. These are all within the normal range. At the C-terminal of EscSP, there is a serine protease domain, which is active and thus conserved. In this SP domain, three catalytic residues (H, D and S) which form a catalytic triad were identified. And around those catalytic residues three conserved motifs (GDSGGP, TAAHC, and DIAL) are present. EsMas do not exhibit any proteolytic activity due to replacement of the essential serine residue by glycine [27]. So the region around the active aspartic acid residue is less conserved than EscSP. There are only two conserved motifs (GDSGGP, TAAHC) and another variable motif of DVAV around the catalytic residue Asp. EscSP is a putative catalytically active protease predicted through SMART analysis, while EsMas is a catalytically inactive SP, known as Mas. A phylogenetic tree of EscSP and SPs containing the clip domain was divided into two clusters, and clearly confirmed different clades between crustacean SPs and insect SPs. It suggests that EscSP shares high similarity with other crustacean SPs, while EscSP is also fairly distinct from those insect SPs. However, EscSP and SPs in crustaceans (including P. monodon clip domain serine proteinase 1 and 2, P. monodon prophenoloxidase-activating
Y. Huang et al. / Fish & Shellfish Immunology 35 (2013) 1155e1162
Fig. 6. Tissue distribution of EscSP(A) and EsMas(B) cDNAs from E. sinensis in hemocytes, hepatopancreas, gills, intestine, muscle, nerve, eyestalk and heart using qPCR methods.
Fig. 7. Time-course analysis of EscSP expression pattern in hemocytes in response to LPS(A) and PGN(B) at 0, 2, 6, 12 and 24 h post-injection by real-time PCR. The mRNA levels of EscSP were analyzed and standardized according to the b-actin mRNA levels. Each bar represents the value from three independent PCR amplifications and quantifications with the standard error maraker. Statistical significance is indicated by asterisks (*P < 0.05, **P < 0.01, ***P < 0.001) compared with that of the control.
1161
Fig. 8. Time-course analysis of EsMas expression pattern in hemocytes in response to LPS(A) and PGN(B) at 0, 2, 6, 12 and 24 h post-injection by real-time PCR. The mRNA levels of EsMas were analyzed and standardized according to the b-actin mRNA levels. Each bar represents the value from three independent PCR amplifications and quantifications with the standard error maraker. Statistical significance is indicated by asterisks (*P < 0.05, **P < 0.01, ***P < 0.001) compared with that of the control.
enzyme 2, P. trituberculatus serine proteinase, P. trituberculatus clip domain serine proteinase, L. vannamei serine protease 1 and 2, and F. chinensis serine protease 1 and 2) are not clearly classified into one group. This may indicate that ten SPs might not have a single origin in gene evolution. Similarly, phylogenetic analysis of EsMas with other Mas in different species shows that EsMas is similar to PlMas and, likewise, is so related with Mas from other detected species; whereas, EsMas is only 30.11% identical with PlMas, as analyzed with the software DNAMAN. And the structure of EcMas is also different from PlMas. PlMas has seven repeats of a predicted disulfide-knotted motif which is similar with EsMas, but a region of seven repeats of a glycine-rich sequence which does not appear in EsMas [6]. All these results illustrated that EscSP and EsMas were two novel SPs in E. sinensis. QRT-PCR results showed that EscSP and EsMas mRNA were widely expressed in all detected tissues, but the level of mRNA expression differs between tissues. The mRNA transcripts of PtcSPs and PtcSPH could also be detected widely in all the examined tissues with remarkably different expression levels [28]. EscSP was strongly expressed in hepatopancreas, nerve and eyestalk as compared to other tissues. Hepatopancreas is an important organ involved in crustacean immunity, it plays a crucial role in the immune response [29]. In recently reports, a SPH identified from F. chinensis (FcSPH2) was only found in hepatopancreas [22]. Whereas EsMas was mostly distributed in hemocytes, muscle, nerve and eyestalk and its expression level was lower in hepatopancreas, gills, intestine and heart. It could be speculated that EscSP and EsMas have different immune mechanisms. We conducted expression analysis of the genes following an immune-challenge at different time points with LPS and PGN to understand the possible biological function of EscSP and EsMas. The transcription of EscSP in hemocytes was substantially up-regulated at 2 h post LPS and PGN challenge, then gradually down-regulated
1162
Y. Huang et al. / Fish & Shellfish Immunology 35 (2013) 1155e1162
from 6 to 24 h. This is similar with P. monodon prophenoloxidaseactivating enzyme 1, which was up-regulated at 3 h followed by down-regulation at 6e48 h after V. harveyi injection [30]. PmPPAE1 is likely to function in the proPO system and is an important component in shrimp immunity [31]. So EscSP serves as an acutephase defense molecule and might play crucial roles in frontline immune defense tissues for antibacterial responses in crab. EsMas was down-regulated by LPS and PGN challenge in hemocytes; and, moreover, P. monodon serine protease homolog was also downregulated after a yellow head virus (YHV) challenge [18]. In previous reports, masquerade has been considered to participate in induction of prophenoloxidase [32] and cellular adhesion activity [7]. It also has been identified as a binding protein of YHV [18] and a PPR, which can recognize Gram-negative bacteria, i.e., Escherichia coli, Pemphigus vulgaris, Shigella flexneri, and yeast, Saccharomyces cerevisiae and clearance of microorganisms in crayfish [20]. Therefore, it could be speculated that EsMas might also function as a PPR. Crabs could prevent bacterial invasion by down-regulating the expression of EsMas. In conclusion, the cDNA of EscSP and EsMas were cloned from E. sinensis. Tissue distribution and expression pattern of EscSP and EsMas after LPS and PGN challenge were investigated through qRTPCR. From the molecular characterization and expression pattern, it could be deduced that EscSP and EsMas might play an important role in crab innate immunity. However, further research is needed to clarify the more precise role and immune functions of EscSP and EsMas in crab immune defense. Acknowledgments We appreciate Professor O. Roger Anderson (Columbia University) for editing the manuscript. The current study was supported by the National Natural Science Foundation of China (Grant No. 31101926, 31170120; 31272686), the Startup Scientific Research Fund from Jiangsu University for Advanced Professionals (Grant No. 10JDG122), the Open Project of Key Laboratory of Ministry of Education for Medicinal Resources, and Natural Pharmaceutical Chemistry of Shanxi Normal University (Grant No. MR&NPC2010001), the Jiangsu Planned Projects for Postdoctoral Research Funds (Grant No. 1002011B) and China Postdoctoral Science Foundation (20110491362) and the project funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD). Jiangsu Agriculture Science and Technology Innovation Fund (JASTIF) CX (12)3066, and Project for Aquaculture in Jiangsu Province (No. PJ2011-65; Y2013-45; D20135-3; D2013-5-4). References [1] Shi XZ, Zhao XF, Wang JX. Molecular cloning and expression analysis of chymotrypsin-like serine protease from the Chinese shrimp, Fenneropenaeus chinensis. Fish Shellfish Immunol 2008;25:589e97. [2] Rawlings ND, Barrett AJ. Families of serine peptidases. Methods Enzymol 1994;244:19e61. [3] Wu QY, Kuo HC, Deng GG. Serine proteases and cardiac function. Biochim Biophys Acta 2005;1751:82e94. [4] Ross J, Jiang H, Kanost MR, Wang Y. Serine proteases and their homologs in the Drosophila melanogaster genome: an initial analysis of sequence conservation and phylogenetic relationships. Gene 2003;304:117e31. [5] Kim MS, Baek MJ, Lee MH, Park JW, Lee SY, Soderhall K, et al. A new eastertype serine protease cleaves a masquerade-like protein during prophenoloxidase activation in Holotrichia diomphalia larvae. J Biol Chem 2002;277: 39999e40004. [6] Huang TS, Wang H, Lee SY, Johansson MW, Soderhall K, Cerenius L. A cell adhesion protein from the crayfish Pacifastacus leniusculus, a serine proteinase homologue similar to Drosophila masquerade. J Biol Chem 2000;275:9996e10001.
[7] Lin CY, Hu KY, Ho SH, Song YL. Cloning and characterization of a shrimp clip domain serine protease homolog (c-SPH) as a cell adhesion molecule. Dev Comp Immunol 2006;30:1132e44. [8] Zou Z, Lopez DL, Kanost MR, Evans JD, Jiang H. Comparative analysis of serine protease-related genes in the honey bee genome: possible involvement in embryonic development and innate immunity. Insect Mol Biol 2006;15:603e14. [9] Morisato D, Anderson KV. Signaling pathways that establish the dorsal-ventral pattern of the Drosophila embryo. Annu Rev Genet 1995;29:371e99. [10] Anderson KV. Pinning down positional information: dorsaleventral polarity in the Drosophila embryo. Cell 1998;95:439e42. [11] Jiang HB, Kanost MR. The clip-domain family of serine protease in arthropods. Insect Biochem Mol Biol 2000;30:95e105. [12] Muta T, Hashimoto R, Miyata T, Nishimura H, Toh Y, Iwanaga S. Proclotting enzyme from horseshoe crab hemocytes. cDNA cloning, disulfide locations, and subcellular localization. J Biol Chem 1990;265:22426e33. [13] Gai YC, Qiu LM, Wang LL, Song LS, Mu CK, Zhao JM, et al. A clip domain serine protease (cSP) from the Chinese mitten crab Eriocheir sinensis: cDNA characterization and mRNA expression. Fish Shellfish Immunol 2009;27:670e7. [14] Cui Z, Liu Y, Wu D, Luan W, Wang S, Li Q, et al. Molecular cloning and characterization of a serine proteinase homolog prophenoloxidase-activating factor in the swimming crab Portunus trituberculatus. Fish Shellfish Immunol 2010;29:679e86. [15] Liu Y, Cui Z, Song C, Wang S, Li Q. Multiple isoforms of immune-related genes from hemocytes and eyestalk cDNA libraries of swimming crab Portunus trituberculatus. Fish Shellfish Immunol 2011;31:29e42. [16] Ren Q, Xu ZL, Wang XW, Zhao XF, Wang JX. Clip domain serine protease and its homolog respond to Vibrio challenge in Chinese white shrimp, Fenneropenaeus chinensis. Fish Shellfish Immunol 2009;26:787e98. [17] Rattanachai A, Hirono I, Ohira T, Takahashi Y, Aoki T. Peptidoglycan inducible expression of a serine proteinase homologue from kuruma shrimp (Marsupenaeus japonicus). Fish Shellfish Immunol 2005;18:39e48. [18] Sriphaijit T, Flegel TW, Senapin S. Characterization of a shrimp serine protease homolog, a binding protein of yellow head virus. Dev Comp Immunol 2007;31:1145e58. [19] Murugasu-Oei B, Rodrigues V, Yang X, Chia W. Masquerade: a novel secreted serine protease-like molecule is required for somatic muscle attachment in the Drosophila embryo. Genes Dev 1995;9:139e54. [20] Lee SY, Söderhäll K. Characterization of a pattern recognition protein, a masquerade-like protein, in the freshwater crayfish Pacifastacus leniusculus. J Immunol 2001;166:7319e26. [21] Amparyup P, Jitvaropas R, Pulsook N, Tassanakajon A. Molecular cloning, characterization and expression of a masquerade-like serine proteinase homologue from black tiger shrimp Penaeus monodon. Fish Shellfish Immunol 2007;22:535e46. [22] Ren Q, Zhao XF, Wang JX. Identification of three different types of serine proteases (one SP and two SPHs) in Chinese white shrimp. Fish Shellfish Immunol 2011;30:456e66. [23] Meng Q, Li W, Liang T, Jiang X, Gu W, Wang W. Identification of adhesin-like protein ALP41 from Spiroplasma eriocheiris and induction immune response of Eriocheir sinensis. Fish Shellfish Immunol 2010;29:587e93. [24] Ren Q, Li M, Du J, Zhang CY, Wang W. Immune response of four dual-CRD Ctype lectins to microbial challenges in giant freshwater prawn Macrobrachium rosenbergii. Fish Shellfish Immunol 2012;33:155e67. [25] Cui Z, Liu Y, Luan W, Li Q, Wu D, Wang S. Molecular cloning and characterization of a heat shock protein 70 gene in swimming crab (Portunus trituberculatus). Fish Shellfish Immunol 2010;28:56e64. [26] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using realtime quantitative PCR and the 2(eOOC(T)) method. Methods 2001;25: 402e8. [27] Cerenius L, Söderhäll K. The prophenoloxidase-activating system in invertebrates. Immunol Rev 2004;198:116e26. [28] Li QQ, Cui ZX, Liu Y, Wang SY, Song CW. Three clip domain serine proteases (cSPs) and one clip domain serine protease homologue (cSPH) identified from haemocytes and eyestalk cDNA libraries of swimming crab Portunus trituberculatus. Fish Shellfish Immunol 2012;32:565e71. [29] Ji PF, Yao CL, Wang ZY. Immune response and gene expression in shrimp (Litopenaeus vannamei) hemocytes and hepatopancreas against some pathogen-associated molecular patterns. Fish Shellfish Immunol 2009;27: 563e70. [30] Amparyup P, Wiriyaukaradecha K, Charoensapsri W, Tassanakajon A. A clip domain serine proteinase plays a role in antibacterial defense but is not required for prophenoloxidase activation in shrimp. Dev Comp Immunol 2010;34:168e76. [31] Charoensapsri W, Amparyup P, Hirono I, Aoki T, Tassanakajon A. Gene silencing of a prophenoloxidase activating enzyme in the shrimp, Penaeus monodon, increases susceptibility to Vibrio harveyi infection. Dev Comp Immunol 2009;33:811e20. [32] Kwon TH, Kim MS, Choi HW, Joo CH, Cho MY, Lee BL. A masquerade-like serine proteinase homologue is necessary for phenoloxidase activity in the coleopteran insect, Holotrichia diomphalia larvae. Eur J Biochem 2000;267: 6188e96.