Molecular cloning and functional characterization of two duplicated two-cysteine containing type I interferon genes in rock bream Oplegnathus fasciatus

Fish & Shellfish Immunology 33 (2012) 886e898

Contents lists available at SciVerse ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Molecular cloning and functional characterization of two duplicated two-cysteine containing type I interferon genes in rock bream Oplegnathus fasciatus Qiang Wan a, W.D. Niroshana Wicramaarachchi a, Ilson Whang a, Bong-Soo Lim b, Myung-Joo Oh c, Sung-Ju Jung c, Hyun Chul Kim d, Sang-Yeob Yeo e, Jehee Lee a, b, * a

Department of Marine Life Sciences, Jeju National University, Jeju 690-756, Republic of Korea Marine and Environmental Institute, Jeju National University, Jeju 690-814, Republic of Korea Department of Aqualife Medicine, Chonnam National University, Chonnam 550-749, Republic of Korea d Genetics & Breeding Research Center, National Fisheries Research & Development Institute, Geoje 656-842, Republic of Korea e Department of Biotechnology, Division of Applied Chemistry & Biotechnology, Hanbat National University, Daejeon 305-719, Republic of Korea b c

a r t i c l e i n f o

a b s t r a c t

Article history: Received 16 May 2012 Received in revised form 18 July 2012 Accepted 29 July 2012 Available online 7 August 2012

Two type I interferon (IFN) genes, designated as rbIFN1 and rbIFN2, have been cloned and characterized in rock bream. They are both comprised of 5 exons and 4 introns, and are closely linked on the rock bream chromosome in a unique head-to-head configuration. Both genes encode 183 amino acid (aa) precursor with a putative 17 aa signal peptide in the N-terminal. Only one amino acid divergence is present between two IFNs. Compared with the type I IFNs in higher vertebrates, two rock bream IFNs possess conserved alpha helical structure and share approximately 20% identity in aa sequence. The highest aa sequence homology (83.2%) was found with European seabass IFNs. Phylogenetic analysis grouped two rock bream IFNs into the subgroup-d of two-cysteine containing IFNs. The gene synteny analysis revealed that they are orthologous with the zebrafish IFN44 on chromosome-12 and paralogous to each other, which are likely derived from a gene duplication event followed by an inversion. A number of cis-regulatory elements associated with immune response including 15 IRF and 6 NF-kB binding sites are predicted in the shared 4.5 kb 5’-flanking region. Highest constitutive expression of two IFNs was detected in blood cells and skin. Their expression in blood cells and head kidney was up-regulated by lipopolysaccharide, poly I:C, Edwardsiella tarda, Streptococcus iniae and iridovirus. Furthermore, recombinant rbIFN1 protein produced by E. coli induced a rapid and transient expression of the interferon inducible Mx gene in head kidney cells. These results suggest that two duplicated type I IFN genes are involved in rock bream host response to both viral and bacterial pathogens. Ó 2012 Elsevier Ltd. All rights reserved.

Keywords: Type I interferon Rock bream Gene duplication Iridovirus Mx

1. Introduction Interferons (IFNs) are a large family of cytokines that play a pivotal role in host defence against virus infection. IFNs can induce the expression of an array of interferon stimulated genes (ISGs) to establish host antiviral state through JAK/STAT signaling pathway [1]. Apart from potent antiviral activity IFNs also function in the host response to other non-viral pathogens, as well as in broad physiological and cellular processes [2-5]. Mammalian IFNs have been studied in great detail and are divided into three groups (type I, type II and type III), on the basis of their receptor usage, genetic structure and functional properties [6]. Type I

* Corresponding author. Department of Marine Life Sciences, Jeju National University, 66 Jejudaehakno, Ara-dong Jeju 690-756, Republic of Korea. Tel.: þ82 64 754 3472; fax: þ82 64 756 3493. E-mail address: [email protected] (J. Lee). 1050-4648/$ e see front matter Ó 2012 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.fsi.2012.07.018

(predominantly IFN-a and -b) and type III IFNs (IFN-l) are expressed in most (if not all) types of virally infected cells and exert similar functions in innate antiviral defence [7], whilst type II IFNs (IFN-g) are primarily produced by natural killer cells (NK cells) and T lymphocytes in response to stimulation of both innate and adaptive immune system [8]. The first fish IFN gene was identified in 2003 by searching a zebrafish EST database [9]. Since then, several IFN genes and/or their receptors have been reported in a range of teleost species, as well as shark (see recent reviews [10, 11]). Based on their similarity with mammalian IFNs, fish IFNs were classified as type I and type II. Interestingly, fish type I IFN genes contain five exons and four introns as opposed to the intronless structure of higher vertebrate type I IFNs. Nevertheless, several lines of evidence have demonstrated that the type I IFNs in fish and higher vertebrates share a common ancestor [12-14]. Type I IFNs in the genome of most (if not all) fish are present in multiple copies, with the current record

Q. Wan et al. / Fish & Shellfish Immunology 33 (2012) 886e898

of 11 copies by Atlantic salmon [15]. In addition, transcript variants of type I IFN derived from alternative RNA splicing have also been reported in several species including zebrafish, fugu, catfish, Atlantic salmon and rainbow trout [16]. Fish type I IFNs can be further divided into 2 cysteine- (2C) and 4 cysteine- (4C) containing groups by the number of cysteine residues in the mature peptide. 2C group IFNs have been universally found in all teleost species examined, whilst 4C group IFNs known to date are present only in relatively primitive fish including salmonids, cyprinids and cartilaginous fish [15, 17]. Despite of low sequence homology with higher vertebrate IFNs, fish type I IFNs have been demonstrated to have similar capability of inducing expression of the antiviral proteins and increasing resistance against virus infection by several functional studies [9, 18, 19]. Rock bream (Oplegnathus fasciatus), also called striped beakperch, is one of the most important fish species in the mariculture industry of South Korea. However, the practical production of rock bream is considerably obstructed due to the infectious diseases cause by Streptococcus iniae, Edwardsiella tarda and iridovurs infection [20, 21]. Understanding of the immune response to these infectious diseases in rock bream is essential for efficient disease control and minimizing economic loss. Recently, several genes involved in IFN response pathway, such as Mx [22], PKR [23] and ISG15 [24], have been reported in rock bream; however, no IFN gene has been identified yet. In this study, a cDNA of type I IFN gene was first cloned by degenerate PCR and sequenced in rock bream head kidney. Thereafter, another IFN gene was identified while sequencing the BAC clone to determine the genomic organization. Two IFN genes of rock bream were shown adjacently arranged on chromosome in a head-to-head orientation. Expression of two IFNs was investigated in blood cells and head kidney tissues of rock bream after challenge with different immune stimuli from both bacterial (Edwardsiella. tarda, Streptococcus. iniae and LPS) and viral (iridovirus and poly I:C) origins. In addition, the induction effect of recombinant IFN protein on Mx gene expression in head kidney cells was also established. 2. Materials and methods 2.1. Experimental animals Healthy rock bream fish (average body weight of 50 g) were obtained from the Jeju Special Self-Governing Province Ocean and Fisheries Research Institute (Jeju, Republic of Korea). They were maintained in 40 L tanks with aerated and sand filtered seawater at a temperature of 24  1 oC and salinity of 34  1 psu. All fish were acclimatized to laboratory conditions for two weeks prior to any experiment, and no clinical signs of disease were observed. 2.2. Molecular cloning and sequencing of rock bream type I IFNs Total RNA was isolated from the head kidney of healthy rock bream using QIAzol Reagent (QIAGEN). Reverse transcription was carried out using PrimeScriptÔ 1st strand cDNA Synthesis Kit (Takara). A pair of degenerate primers was designed based on the conserved regions of type I IFN sequences from different fish species (Table. 1). To clone the partial sequence of rock bream type I IFN, head kidney cDNA was used as template for PCR amplification with the degenerated primers. PCR product was examined by 1.5% agarose gel electrophoresis. The target DNA fragment was purified using AccuPrepTM Gel Extraction Kit (Bioneer, Korea) and T-A cloned into pGEM-T Easy vector (Promega). Sequencing reactions were performed by Macrogen Inc (Korea). To obtain the complete cDNA sequences, 50 and 30 rapid amplification of cDNA ends (RACE) were performed with a SMART RACE cDNA Amplification kit

887

Table. 1 Primers used in the present study. Primer sequences (5’ -3’)

Primer description

TGGMKCTRCTGGABMASATGG

Degenerate cloning forward AWTTCYYYCCTGATSAGCTCCCA Degenerate cloning reverse TGTCAATGTTGTAACCCAGCAGGC BAC library screening forward/ 3’RACE-2 TGTGGCCCATCTGTTTGAGGACAT BAC library screening reverse/ rbIFN1 5’RACE-1 GTGAAAACTCTTTGGATCTACTGGACACG rbIFN1 qRT-PCR forward/3’RACE-1 GTGAAAACTCTTTGGATCTACTGGAGACA rbIFN2 qRT-PCR forward/3’RACE-1 GTGAAACCAAGTTTATCCTCAGCTGCTG Two IFNs qRT-PCR reverse/5’RACE-2 GAGAGAGAATTCGGCTCCTCGCTCAGCTGCA Sub-cloning forward GAGAGAAAGCTTTTAGTTGGTGGTGAGTAGAGATGAAACCAG Sub-cloning reverse CTGAGTTGTTGCTTGTTTACTCAGG rbIFN2 5’RACE-1 GCTGCAGGTCTGCTCCAACAC TSS confirmation TCATCACCATCGGCAATGAGAGGT b-actin qRT-PCR forward TGATGCTGTTGTAGGTGGTCTCGT b-actin qRT-PCR reverse AACCGCCAAGGCAAAGATCGAA Mx qRT-PCR forward AAACTGCTGCTGTAGGTCCTGT Mx qRT-PCR reverse

(Clontech Laboratories), using primers based on the partial sequences obtained above (Table.1). All RACE products were gelpurified, T-A cloned, and sequenced as described above. A BAC library of Oplegnathus fasciatus was constructed by using randomly sheared genomic DNA of rock bream (Lucigen, USA) and 92,160 independent clones with an average insert size of approximately 120 kb were recovered. Screening of the BAC-library was carried out with a PCR-based screening method following the manufacturer’s instructions. The primers used for screening were designed based on obtained partial cDNA sequence (Table. 1). BAC DNA from positive clone was isolated and purified by using QIAGEN Large-Construct Kit, and was subjected to sequencing by GS FLX (Roche). The rock bream type I IFN genomic sequences generated were deposited in the GenBank database under accession number JX020703. 2.3. Bioinformatics BLAST was used for identification of homologous IFN sequences in the GenBank databases. A multiple alignment of amino acid sequences of two rock bream IFNs and 6 most homological IFNs from other fish species was performed using the CLUSTALW program and decorated using GeneDoc (http://www.nrbsc.org/gfx/genedoc/index. html). Percent sequence identity between sequences were calculated using the AlignX program (Vector NTI). The motifs prediction was conducted by search in Conserved Domain Databases (CDD) at NCBI. The secondary structure was predicted by APSSP (http://imtech.res.in/raghava/apssp/). A phylogenetic tree containing protein sequences of type I IFNs from fish, amphibians, avians and mammals was constructed using the neighbor-joining method with the Mega 4 program [25]. The positions of exons and introns in genomic sequences of two rock bream IFNs were determined by Spidey (http://www.ncbi.nlm.nih.gov/IEB/Research/Ostell/Spidey/). The program MatInspector (Genomatix) was used to identify potential transcription factor binding sites in the 5’ flanking sequence

888

Q. Wan et al. / Fish & Shellfish Immunology 33 (2012) 886e898

of 3 kb. The threshold values for the core and matrix similarity parameters were set as 1.0 and 0.8. 2.4. Immune challenges and expression analysis The immune challenges were performed in time course experiment as described in previous studies [26]. Briefly, in challenge groups, rock breams were administered a single intraperitoneal (i.p.) injection of 100 mL LPS in phosphate buffered saline (PBS) (1.25 mg/mL, E. coli 055:B5; Sigma), 100 mL poly I:C in PBS (1.5 mg/mL; Sigma), 100 mL live Edwardsiella tarda (E. tarda) in PBS (5  103 CFU/ mL), 100 mL live Streptococcus iniae (S. iniae) in PBS (1  105 CFU/mL) and 100 mL rock bream iridovirus in PBS, respectively. A control group was injected with an equal volume (100 mL) of PBS. Rock bream blood cells and head kidney samples were collected from challenge and control groups at 3, 6, 12, 24 and 48 h post-injection (p.i.). Three replicate rock breams were obtained for each time point and the pooled tissues from each group were subjected to total RNA extraction and cDNA synthesis according to the procedure described in Section 2.2. The mRNA expression of two IFNs was analyzed by qRT-PCR using the Real Time System TP800 Thermal Cycler DiceÔ (TaKaRa, Japan). A 20 mL reaction volume contained 4 mL of diluted cDNA from the respective tissue, 10 mL of 2 TaKaRa Ex TaqÔ SYBR premix, 0.5 mL of each primer (10 pmol/mL) and 5 mL dH2O. The qRTPCR cycle profile included one cycle of 95 C for 10 s, followed by 35 cycles of 95 C for 5 s, 58 C for 10 s and 72 C for 20 s, and a final single cycle of 95 C for 15 s, 60 C for 30 s and 95 C for 15 s. The

baseline was set automatically by the Thermal Cycler DiceÔ RealTime System Software (version 2.00). Expression was determined by the 2DDCT method. The same qRT-PCR cycle profile was used for detection of the reference gene, rock bream b-actin (GenBank accession no. FJ975146). The primers used in this study are listed in Table 1. Statistical analysis was conducted by one-way analysis of variance (ANOVA) followed by Tukey’s multiple comparison tests as a post hoc comparison using the SPSS 16.0 program (USA). P values less than 0.05 were considered statistically significant. 2.5. Expression vector construction and production of recombinant rbIFN1 The pMAL-c2x vector (Novagen) was used in the recombinant expression of rbIFN1. The coding sequence of predicted rbIFN1 mature peptide was amplified by PCR using two cloning primers listed in Table.1. The PCR product was purified, digested with EcoRI and HindIII, and ligated into pMAL-c2x vector to produce a recombinant maltose binding protein (MBP)-tagged fusion protein. After sequence confirmation, the resulting vectors were respectively transformed into E. coli strain BL21(DE3)pLysS. A single colony was picked up on transformation plate and inoculated in 5 mL Luria-Bertani (LB) broth containing 100 mg/mL of ampicillin or chloramphenicol for an overnight incubation at 37oC. The overnight seed culture was again inoculated into 500 mL LB medium at a dilution of 1:100, and was grown until the OD600 reached to 0.8. Isopropyl-b-D-thiogalactoside (IPTG) was then added to the medium at a final concentration of 0.2 mM to

Fig. 1. Comparison of full-length cDNA and amino acid sequences of two duplicated type I IFN genes in rock bream The identical nucleotide and predicted amino acid (aa) sequences are shown in uppercase; the different sequences in rbIFN2 are shown in bold and lower case; and dashes (-) represent gaps in the alignment. Start (ATG) and stop (TAA) codons are in bold and italicized. The predicted signal peptide sequence is shown italicized and underlined. Two cysteine residues and potential N-linked glycosylation sites are denoted by open boxes and shaded boxes, respectively. The RNA instability motif (ATTTA) and the polyadenylation signal sequence (AATAAA) are underlined.

Q. Wan et al. / Fish & Shellfish Immunology 33 (2012) 886e898

889

induce recombinant protein expression at 20oC. After eight hours of IPTG-induction, the cells were cooled on ice for 30 min and were harvested by centrifugation at 4oC. Recombinant protein was purified by amylose affinity chromatography. To eliminate the potential contamination of bacterial endotoxins such as LPS during protein preparation, the purified recombinant protein was loaded onto a polymyxin B column (Sigma-Aldrich) and the flow-through fraction collected. The protein samples were stored at e80oC before use. The purity and molecular weight of the protein preparation was analyzed by SDS polyacrylamide gel electrophoresis (SDS e PAGE).

mL recombinant rbIFN1 for 0 (untreated control), 1, 3, 6, 9, 12 and 24 h at 22 C. The MBP protein with same concentration was used to stimulate the cells in the mock control group. 50 mg/ml poly I:C was used as a positive control for Mx induction. Mx expression at each time point was determined by qRT-PCR using the methods describe earlier (Section 2.4) and the primers listed in Table 1. Statistical analysis was conducted by t-test using the SPSS 16.0 program (USA). P values less than 0.05 were considered statistically significant.

2.6. Characterization of biological activity of rbIFN1

3.1. Identification of rock bream type I IFNs and sequence analysis

Biological activity assay of the recombinant rbIFN1 was performed in the rock bream head kidney primary cultures wherein the Mx gene, an important downstream effector of IFN response pathway, was used as a marker gene. Head kidney tissues were collected under sterile conditions from freshly killed rock bream (n ¼ 4) and minced into small pieces (approximately 1 mm3 in size). After washing three times in HBSS (sigma) containing antibiotics (400 IU/ml penicillin and 400 mg/ml streptomycin), the tissue pieces were digested in a solution of 0.2% collagenase II (sigma) for 2 hours at 20 C. The digestion mixture was filtered through a cell strainer (70 mm mesh size), centrifuged at 1000 rpm for 10 min, and then resuspended in Leibovitz’s L-15 medium supplemented with 20% FBS, 100 IU/ml penicillin and 100 mg/ml streptomycin. The head kidney cells were plated into 24-well cell culture plate with a concentration of 5x105 cell per well and then stimulated with 5 mg/

Two rock bream type I IFN genes (rbIFN1 and rbIFN2) have been identified and confirmed by PCR verification. The cDNA nucleotide (nt) and deduced amino acid (aa) sequences are shown in Fig. 1. rbIFN1 and rbIFN2 have similar length of cDNA and highly conserved 5’ untranslated region (5’UTR) and open reading frame (ORF). They both translate into 183-aa precursor molecules with a putative 17-aa signal peptide in the N-terminal, which is comparable to other type I IFNs. Only one divergence (aspartic acid /glutamic acid) at the 42th residue in aa sequence is present between rbIFN1 and rbIFN2. Two cysteine residues are found in the mature peptides of both genes, suggesting a classification of 2Cgroup IFN. Additionally, both mature peptides contain two glycosylation sites; and multiple mRNA instability motifs (ATTTA) are present in the AT-rich 3’-UTR. A polyadenylation signal is present 16 nt upstream of the poly (A) tail in both cDNA.

3. Results

Fig. 2. ClustalW multiple sequence alignment of the deduced amide acid sequences of two rock bream IFNs with other homological fish type I IFNs. The three levels of shading indicate 100%, 80% or 60% similar residues determined with GeneDoc program. The identical cysteines which are putatively involved in disulphide bond formation in the mature IFNs are marked with “¤”. The putative IFNAR1 binding sites and IFNAR2 binding sites are indicated with “#” and “x”, respectively. The secondary structure of rbIFNs is shown above the alignment. Five alpha helices, designated H1-5, are indicated with boxes. GenBank accession numbers of the selected sequences are shown as follows: European seabass, CBN81665; Gilthead seabream, CBN81665; Japanese flounder, AET71736; Nile tilapia, XP_003453447; Three-spined stickleback, CM31706; Japanese medaka, CAM32419; Fugu rubripes, CAM82750.

890

Q. Wan et al. / Fish & Shellfish Immunology 33 (2012) 886e898

78 42

91

98

83 90

93

93

32 96 41

35

37

93

IFN2 seabass IFN3 seabass 78 IFN1 seabass IFN3 seabream 28 IFN1 seabream 75 99 IFN2 seabream rbIFN1 33 rbIFN2 99 IFN grouper IFN3 stickleback 60 IFN1 stickleback 100 IFN2 stickleback d 60 IFN medaka IFN3 tilapia IFN1 tilapia 98 IFN2 tilapia 100 IFN1 flounder IFN2 flounder 2C-group 100 IFN Tetraodon IFN1 fugu 99 100 IFN2 fugu IFN5 trout IFN4 zebrafish 58 IFNa1 salmon 52 IFNa2 salmon 78 IFN1 trout 100 IFNa3 salmon IFN2 trout 100 IFN1 catfish a 100 IFN3 catfish IFN2 catfish IFN1 zebrafish 79 IFN mud carp 99 IFN common carp 56 IFN grass carp 100 96 IFNc2 salmon 100 IFNc3 salmon IFNc1 salmon c IFN3 zebrafish IFN2 zebrafish 4C-group 80 IFN3 trout IFN4 trout IFNb1 salmon b 100 IFNb2 salmon 53 88 IFNb3 salmon IFNa duck 51 IFNa parrot 100 IFNb chicken Avians IFNa turkey IFNa chicken 98 99 IFN1 frog Amphibian IFN2 frog IFN6 lizard 99 IFN1 lizard 99 IFN2 lizard IFN5 lizard Reptile IFN3 lizard IFN4 lizard 97 IFNa bov ine 50 73 IFNa horse 64 IFNa pig alpha 100 IFNa human IFNa mouse IFNa rat 100 Mammals 100 IFNb mouse IFNb rat IFNb human 99 beta IFNb horse 90 IFNb bov ine 70 IFNb pig 92 98

Teleosts

0.2

Fig. 3. Unrooted phylogenetic tree showing the relationships between rock bream IFNs and other known type I IFNs. The tree was constructed based on an alignment corresponding to full-length amino acid sequences by the Neighbour-Joining method using ClustalW and MEGA version 4. Bootstrapping was performed 1000 times. Two rock bream IFNs are labeled with triangles. GenBank accession numbers of the selected sequences are shown as follows: IFNa human, AET86952; IFNa mouse, AAA37886; IFNa rat, CAA25091; IFNa pig, NP_999558; IFNa horse, NP_001092911; IFNa bovine, NP_001017411; IFNb human, NP_002167; IFNb mouse, NP_034640; IFNb rat, NP_062000; IFNb pig, NP_001003923; IFNb horse, NP_001092910; IFNb bovine, NP_776775; IFNa duck, ABI18119; IFNa turkey, AAB40029; IFNa parrot, ADY38297; IFNa chicken, NP_990758; IFNb chicken, NP_001020007; IFN1 frog, CAO03085; IFN2 frog, CAO03086; IFN1-IFN6 lizard, AAWZ01002825; IFNa1 salmon, NP_00111718; IFNa2 salmon, NP_001117042; IFNa3 salmon, ACE75687; IFNb1 salmon, ACE75691; IFNb2 salmon, ACE75693; IFNb3 salmon, ACE75689; IFNc1 salmon, ACE75692; IFNc2 salmon, ACE75694; IFNc3 salmon, ACE75688; IFN1 trout, NP_001118003; IFN2 trout, NP_001153977; IFN3 trout, NP_001153974; IFN4 trout, NP_001158515; IFN5 trout, NP_001152811; IFN1 seabass, CBN81665; IFN2 seabass, CBN81666; IFN3 seabass, CBN81667; IFN1 seabream, CAP72358; IFN2 seabream, CAP72359; IFN3 seabream, CAT03222; IFN1 stickleback, CM31706; IFN2 stickleback, CM31707; IFN3 stickleback, CM31708; IFN1 flounder, AET71736; IFN2 flounder, BAH84776; IFN1 Fugu, CAM82750; IFN2 Fugu, CAM82751; IFN Teraodon, CAD67762; IFN mud carp, AAY56128; IFN grass carp, ACZ36480; IFN common carp, AAR20886; IFN1 catfish, NP_001187180; IFN2 catfish, NP_001187228; IFN3 catfish, NP_001187107; IFN4 catfish, AAV97700; IFN1 zebrafish, NP_997523; IFN2 zebrafish, NP_001104552; IFN3 zebrafish, NP_001104553; IFN4 zebrafish, NP_001155212.1; IFN medaka, CAM32419; IFN1 tilapia, XP_003453447; IFN2 tilapia, XP_003453448; IFN3 tilapia, XP_003448784; IFN grouper, BAJ79339.

Q. Wan et al. / Fish & Shellfish Immunology 33 (2012) 886e898

891

Fig. 4. Comparison of genomic organization among type I IFN genes in different species. (A). Schematic depictions of the exon-intron organization of teleostean type I IFNs from rock bream, fugu rubripes (AJ583023), three-spined stickleback (BN001087), zebrafish (NC_007114), Japanese medaka (BN001095), common carp (GQ168343), channel catfish (AY847297), Atlantic salmon (DQ354152) and rainbow trout (AM489415) are shown. Open boxes represent exons, shaded boxes represent UTRs, and lines represent introns. Each exon is numbered with a roman numeral. The number of nucleotide present within the exons and introns is shown. (B). Gene synteny analysis of vertebrate type I IFNs. Relative positions and orientation of IFN gene cluster and their adjacent genes in rock bream and other model animals are shown. Different genes are indicated with boxes filled different patterns. The gene names are cited from the human genome map.

892

Q. Wan et al. / Fish & Shellfish Immunology 33 (2012) 886e898

Q. Wan et al. / Fish & Shellfish Immunology 33 (2012) 886e898

893

Fig. 5. (continued).

Blast search analysis of the aa sequences of rock bream IFNs has confirmed that they are highly identical with other known 2Cgroup IFNs in fish. An alignment of precursor protein with seven selected 2C-group IFNs from different fish species was performed by CLUSTALW program (Fig. 2). These fish IFNs showed a high degree of similarity, including the same pattern of cysteines and putative IFN receptor binding sites in the mature peptide. The highest sequence homology (>80%) for rock bream IFNs was obtained with the type I IFNs from European seabass. As the consensus of type I IFNs, two rock bream IFNs also appear alpha helical structures with five alpha-helices. To analyze the phylogenetic relationship between rock bream IFNs and other type I IFNs in fish and higher vertebrates, we rebuilt a neighbor-joining phylogenetic tree using 70 different IFN sequences (Fig. 3). The tree illustrates that fish IFNs form a cluster separated from the IFNs in tetrapods, including both intron-containing IFNs from amphibian and intronless IFNs from amniotes. Furthermore, 45 fish IFNs are clearly separated into two main clusters representing 2C- and 4C-group IFNs, respectively. The tree also showed a further subdivision of each group into two subgroups as proposed by recent studies [12, 15]. Two rock bream IFN genes were ascribed to subgroup-d of 2C-IFNs with a significant bootstrap value. 3.2. Gene structure of rock bream type I IFNs The genomic sequences of rbIFN1 and rbIFN2 were determined by sequencing one positive clone of rbIFN1 in rock bream BAC library. Both genes contain five exons and four introns, and all intron/ exon splice junctions conformed to the GT/AG rule. As shown in Fig. 4-A, this organization is the common genomic structure of type I IFNs in fish, with the only exception in Japanese medeka. The length of each exon of different fish IFNs displays high degree of similarity,

whilst the intron lengths are quite variable even between two paralogous genes from the same species. Interestingly, the two rock bream type I IFN genes are located adjacent to each other in a headto-head configuration on chromosome, with their initiation codons separated by 4.5 k-bp intergenic region. To understand the evolutionary origin of rock bream IFNs, we conducted a gene synteny analysis by comparing the relative positions and orientation of IFN cluster and adjacent genes in rock bream and other model organisms (Fig. 4-B). Similar with the zebrafish IFN44 on chromosome-12, rock bream IFNs are adjacent to the genes of CD79b and SCN4Aa on the chromosome; however, only one IFN gene is present in zerbrafish chromosome-12. The above findings indicate that two rock bream IFNs are orthologous genes of zebrafish IFN44, and are most likely derived by a lineage gene duplication event after the divergence of Perciformes and Cypriniformes. The location of the transcription start site (TSS) of two rock bream IFNs was determined by the SMART 50 -RACE technique. For both gene, the 50 -end point is an adenine residue and located 65 nucleotides upstream from the translation start site (ATG) of the cDNA sequence. To verify the result, we performed PCR of cDNA using a specific forward primer of which 3’ end borders the TSS, and no amplification was detected (data not shown). 4.5 kb 5’ flanking sequence between TSS of two genes was analyzed. A TATA box sequence was identified in the immediate 5’ flanking sequence of each gene, but a potential CAAT binding site is only present in proximity to the TSS of rbIFN1 (Fig. 5). Six putative nuclear factor kappa B (NF-kB) and fifteen putative interferon regulatory factor (IRF) binding sites were identified. In addition, a number of cis-acting regulatory elements essential for promoter activation in host immune response, including STAT, NFAT, AP-1, GATA, CEBP, CREB and PRDM, are also present in the shared 5’ flanking region.

Fig. 5. Computer-aided analysis of the 5’ flanking region of two rock bream IFN genes. 4.5 kb intergenic nucleotide sequences between the first exons of two genes were analyzed. The transcription start sites (TSS) are marked with arrows, and the TSS of rbIFNb is assigned nucleotide position þ1. Putative transcription factor binding sites determined by MatInspector software V 8.0 are marked with solid line, broken line or arrow line. The putative TATA- and CAAT- boxes are marked with open boxes.

894

Q. Wan et al. / Fish & Shellfish Immunology 33 (2012) 886e898

3.3. Tissue distribution of two IFN transcripts in rock bream The constitutive expression levels of two IFNs were examined in different tissues including blood cells, gill, liver, spleen, head kidney, kidney, skin, muscle, heart, brain and intestine in healthy rock breams individuals (Fig. 6). The expression of IFNs for each tissue was normalized to that of b-actin and represented as relative fold compared with the expression of rbIFN2 in muscle. The transcripts of two IFNs were detected in all tissues examined, highlighting their significant physiological roles in multiple tissues. The tissue-specific pattern of two rbIFN1 and rbIFN2 share a high degree of similarity. The highest expression of both genes was found in skin and blood cells. Moderate expression level was detected in liver, and relatively low expression level was shown in the rest tissues. Compared with rbIFN2, rbIFN1 possesses much higher transcriptional levels (13-45 fold) in all the tissues, implying a dominating role between two genes. 3.4. Modulation of two rock bream IFNs in vivo expression by various immune stimuli To elucidate the function of rock bream IFNs, the kinetic mRNA expression levels of rbIFN1 and rbIFN2 in the blood cells and head kidney tissues following in vivo challenge of different immune stimuli were determined. The expression patterns between two IFN transcripts displayed a striking similarity. Significant (P < 0.05) induction was shown in two tissues after all the challenge (Fig. 7-8). Despite of lower transcript levels, the inducibility of rbIFN2 upon different challenge was shown more pronounced (about two-fold) than that of rbIFN1. In blood cells, LPS and poly I:C were exhibited as the best inducers of rock bream IFNs, with the highest induction of more than 7-fold change compared to PBS injection group (Fig. 7). The challenge of E. tarda, S. iniae and iridovirus also significantly elevated the expression of rock bream IFNs reaching peak levels of over 2-fold, except for rbIFN1 by E. tarda with only slight increase. After the stimulation of LPS, poly I:C or S. iniae, two IFNs responded rapidly with significant induction within 6 h and the expression peaked as early as 12 h post injection (p.i.). In contrast, their response to iridovirus was significantly lagged, with the highest expression at 48 h p.i.. In head kidney, the highest induction effect was found after stimulation of E. tarda with >20fold for rbIFN1 and >40-fold for rbIFN2, which was on the contrary of the weak effect of E. tarda in blood cells (Fig. 8). The stimulation of LPS, poly I:C and S. iniae showed intermediate induction levels of two IFNs, and the effect of iridovirus was the weakest amongst five challenges. The highest expression of rbIFN1 was recorded at 24 h p.i. for the stimulation of LPS, poly I:C or E. tarda and at 12 h and 3 h p.i. for S. iniae and iridovirus, respectively. While the expression peaks of rbIFN2 were shown identically at 12 h p.i. for all five challenges. Compared with the expression profiles in blood cells, fold-induction of two IFNs by LPS was significantly lower in head kidney. Additionally, the elevation of two IFN transcripts in response to iridovirus stimulation in head kidney was more rapid than that in blood cells, but a significant down-regulation was shown at 48 h. These results indicate a tissue specific response of rock bream IFNs to different immune stimuli. 3.5. Production of recombinant rbIFN1 and its bioactivity in vitro The recombinant rbIFN1 was expressed as MBP fusion protein in E. coli BL21(DE3) cells by IPTG induction. The purity and molecular weight of purified recombinant rbIFN1 protein were examined by 12.5% SDS-PAGE (Fig. 9-A). The apparent molecular mass of the recombinant protein was approximately 60 kDa, consistent with

the predicted value (MBP 42.5 kDa þ rbIFN1 18.7 kDa). We attempted to cleave the MBP tag off the fusion protein by factor Xa protease; however, no band representing rbIFN1 was shown in SDS-PAGE analysis (data not shown), which might be resulted from a rapid degradation of instable rbIFN1 untagged protein. Thus, the MBP fusion rbIFN1 was directly used for bioactivity assay. The bioactivity of rock bream IFN was determined by the induction effect on IFN-inducible Mx protein. Incubation of head kidney cells with 5 mg/ml rbIFN1 or 50 mg/ml poly I:C (positive control) strongly stimulated the expression of Mx as detected by qRT-PCR (Fig. 9). The time-course expression pattern revealed that the expression of Mx was transiently increased by rbIFN1 stimulation to a peak at 3 h post stimulation and declined to the baseline of control within 24 h. 4. Discussions Type I IFNs are one of the key components in vertebrate innate immune response against various microorganisms. In this present study, two type I IFN genes with only one amino acid residue difference were identified in rock bream. The genomic sequencing result reveals that two rock bream IFNs are closely linked on chromosome in a head-to-head conformation, indicating as gene duplication followed by an inversion. In fact, it is not unusual for identification of duplicated IFNs in fish with such high sequence homology. Among the sequences used for phylogenetic tree analysis, similar one amino acid divergence can be found between salmon IFNb2 and b3, salmon IFNc2 and c3, as well as seabass IFN2 and 3, while seabream IFN1 and 2 and flounder IFN1 and 2 possess two different residues. It is still unclear about the mechanism behind the multiplication of IFN genes in fish genome. A wellaccepted hypothesis is that they might arise from a teleost fish specific third round (3R) whole-genome duplication event followed by subsequent tandem gene or partial chromosome duplications in specific lineage [27]. The copy number of IFN gene displays significant variation amongst different species, with the highest record in Atlantic salmon genome. The high IFN multiplicity in salmonids was suggested to possess a selection advantage in respect of their anadromous characteristics, which require more delicate immune system to combat the viruses in different environments of both river and marine habitats [15]. To date, classification of the multiple type I IFN genes in fish is largely limited to sequence comparison. In addition to the earlier classification into two major groups based on cysteine patterns, fish type I IFNs fall into four subgroups by recent phylogenetic analysis. However, the evolutionary relationships amongst four subgroups are obscure. As shown in Fig. 3, subgroup-a contains the IFNs only from catfish, cyprinids and salmonids, while subgroup-d is composed of IFNs majorly from fish in the superorder acanthopterygii but also contains two genes from cyprinids and salmonids. On the other hand, two subgroups of 4C-IFNs were identified only in cyprinids and salmonids. Previous studies considered 4C-IFNs as the ancestor of type I IFNs since they possess the conserved C-terminal CAWE motif as the type I IFNs in higher vertebrates. Nevertheless, this viewpoint is arguable because two genes with respective homology to 2C- and 4C-IFNs (AAVX01158633.1 and AAVX01123948.1) coexist in the genome of elephant shark, which has not experienced the 3R whole-genome duplication [28]. Through comparison of avian and mammalian genomes, we interestingly identified a conserved gene cluster of SCN4A-CD79b-GH1-X-PLEKHM1-ARHGAP27 (Fig. 4-B). In zebrafish genome, however, this gene cluster is split into two loci on two different chromosomes as SCN4Aa-CD79b-X-PLEKHM1-ARHGAP27 on chromosome-12 and SCN4Ab-GH1-X-ARHGAP27 on chromosome-3, probably due to the teleost fish specific wholegenome duplication. All four zebrafish type I IFN genes known to

Q. Wan et al. / Fish & Shellfish Immunology 33 (2012) 886e898

2000 150 1500 100

50

500

Gi ll He ar t In tes tin e Sp lee n Br He ain ad ki dn ey Ki dn ey M us cle

0

Sk in Bl oo d Li ve r

0

Fig. 6. Tissue distribution of two IFN transcripts in rock bream. Relative mRNA expression of two rock bream IFNs was examined in 11 different tissues by qRT-PCR. Rock bream b-actin was used as a reference gene. The values of relative expression level were represented as relative fold compared with the expression of rbIFN2 in muscle. The results are represented as means (n¼3)  S.E.M.

Blood cells 14

0 3 6 12 24 48

e

rbIFN1 fold change from PBS control

Relative expression level of rbIFN1

200

1000

A

250

Relative expression level of rbIFN2

rbIFN1 rbIFN2

2500

895

12 10 8

d

d

c

c

6

c

b

3

d

2 ab

1

a a

b

b

a

a

cdabbc b d

b

b

ab

b b

a

a

c bc

0 LPS

Poly I:C

E. tarda

S. iniae

Iridovirus

Challenge

B

Blood cells d

0 3 6 12 24 48

20

rbIFN2 fold change from PBS control

date are inserted into these two loci. Similar gene synteny was also present in Atlantic salmon and rock bream although only one chromosome has been currently identified in each species. Taken together with the results of phylogenetic tree analysis, we can draw a better understanding about the evolutionary relationship of fish type I IFNs. A conserve SCN4A-CD79b-GH1-X-PLEKHM1ARHGAP27 gene cluster with insertion of both 2C- and 4C-IFNs could be present in the genome of ancient fish progenitor. As the relationship between zebrafish IFN41 and IFN44, the IFNs in subgroup-a and -d should be equivalent paralogs of the ancient 2CIFN diverged by whole-genome duplication event in ancestral teleost. On the other hand, the IFNs in subgroup-b and -c ought to be originated from the same ancient 4C-IFN gene and diverged by a lineage-specific gene duplication event in salmonids. Although it is still unclear about the evolutionary relationship between fish 2Cand 4C-IFNs, the IFN gene information from the chordate amphioxus genome project might be able to provide insights [29]. Our gene synteny analysis result has also supported the hypothesis that the intronless IFNs in higher vertebrates are likely originated from retroransposition of intron-containing 4C-IFN transcript into a new chromosome locus with simultaneous deletion of the original locus sometime prior to the divergence of amphibians and reptiles [30]. As for the multiple IFN gene copies with high sequence similarity expending in each subgroups, they should be generated by more recent tandem duplication events in specific species. It is noteworthy that only subgroup-d IFNs, which are supposed to be on a chromosome homologous to zebrafish chromosome-12, have been identified in acanthopterygii fish species. Such a clear discrimination in identification of IFN subtypes might be most likely due to deletion of partial chromosomal region or whole chromosome loss after the 3R whole genome duplication event. More genes of the subgroup-d IFN can be present in rock bream genome in accordance with the IFN copy numbers in close fish species like European seabass and gilthead seabream. rbIFN1 and rbIFN2 are arranged in a head-to-head fashion on chromosome with a shared 4.5 kb promoter region which may coordinately regulate their expression. In agreement with this feature, two genes showed certain similarities in the tissue distribution pattern and challenge-induced expression profiles. However, the constitutive expression level of rbIFN1 was found significantly higher than that of rbIFN2 in all the tissues examined. On the other hand, the induction level by different immune stimuli

b

d

15 c c

c

10 d

5 b

4 b

3

c bb

a

2 1

a a

a

a

a a a a

b

c b

aa

a a

bc c ab

0 LPS

Poly I:C

E. tarda

S. iniae

Iridovirus

Challenge Fig. 7. Expression of two rock bream IFNs in blood cells after LPS, poly I:C, E. tarda, S. iniae and iridovirus stimulation in vivo. The blood cells were collected at 3, 6, 12, 24 and 48 h post intraperitoneal injections of different immune stimuli and then used for RNA extraction. qRT-PCR was performed to determine gene expression using primers listed in Table 1. The expression of rbIFN1 (A) and rbIFN2 (B) was normalized to the expression of b-actin and expressed as fold change relative to the expression level of PBS group at each time point. Data is shown as the mean of three independent experiments and bars indicate the SEMs. Means with different letters are significantly different (P < 0.05).

of rbIFN2 showed approximately two times higher than that of rbIFN1. To unravel the molecular mechanisms underlying expression regulation of two duplicated genes, we analyzed their shared 5’ flanking region and surprisingly found out high sequence variation in the proximal 5’ flanking regions of two genes. In contrast to the high sequence homology in coding region, the conserved region is only till the first IRF3 binding site (-64 bp). rbIFN2 is absent of CAAT box in proximal promoter region, which might influence the transcription efficiency and hence the lower basal expression level. In addition, as a typical feature of cytokines, two rock bream IFN genes possess several mRNA instablization elements (ATTTA) in the 3’UTR of their cDNAs, which regulate gene expression via rapid deadenylation and subsequent degradation of the mRNA [31]. Compared with rbIFN1, two more ATTTA elements are present in rbIFN2, which may result in a shorter half-life of rbIFN2 mRNA and hence a lower abundance detected by RT-PCR. IRFs have been well

896

Q. Wan et al. / Fish & Shellfish Immunology 33 (2012) 886e898

A

Head kindey

rbIFN1 fold change from PBS control

24

0 3 6 12 24 48

d

22 20

A

18 c

6 e

5

e

4 3 2

bccd

d

d

c a

1

ab

a a a

a

c

c

b

bb

b

a

c

ab b

a

b

b b

a

0 LPS

Poly I:C

E. tarda

S. iniae

Iridovirus

Challenge

B 50

0 3 6 12 24 48

rbIFN2 fold change from PBS control

b b

45

40 d

16 14 12 10 8 6 4 2 0

d d c

c

c

b

b a

a

LPS

a a

Poly I:C

ab

a a a

a

E. tarda

ababbc

c

S. iniae

a

c bb

d

c a

Iridovirus

Challenge

B

Mx expression fold change from MBP control

Head kidney

e

7

d

6 5

c

4 3

documented as the most important transcription factors in the activation of mammalian IFNs [32]. In fish, IRF3 has been demonstrated to predominantly regulate the poly I:C-responsive transcriptional activity of type I IFNs in common carp and Japanese flounder [33, 34]. As the consensus of vertebrate IFNs, each rock bream IFN gene possesses one conserved IRF3 binding site immediately upstream of the TATA box, indicating a similar strict regulation by IRF3. The remaining 14 putative IRF binding sites in their shared promoter region are averagely distributed in a region of 1.52.0 kb upstream of TSS of each gene, except for a putative IRF7 binding site which is specifically located close to TSS of rbIFN2 (-252 bp). It is still unclear whether this IRF7 binding site is responsible to the different magnitudes of induction of two genes. In addition to IRFs, NF-kB is also thought to act cooperatively with IRFs on the activation of IFN promoter [35]. In mammals, the NF-kB mediated IFN-b activation is crucial in the early phase of antiviral defence where IRF3 activation is minimal [36]. NF-kB binding sites have been universally identified in most (if not all) promoters of

b

ab

2

a

a 1 0 0

Fig. 8. Expression of two rock bream IFNs in head kidney after LPS, poly I:C, E. tarda, S. iniae and iridovirus stimulation in vivo. The head kidney tissues were collected at 3, 6, 12, 24 and 48 h post intraperitoneal injections of different immune stimuli and then used for RNA extraction. qRT-PCR was performed to determine gene expression using primers listed in Table 1. The expression of rbIFN1 (A) and rbIFN2 (B) was normalized to the expression of b-actin and expressed as fold change relative to the expression level of PBS group at each time point. Data is shown as the mean of three independent experiments and bars indicate the SEMs. Means with different letters are significantly different (P < 0.05).

c

1

3

6

9

12

24

Poly I:C

Time post stimulation (h) Fig. 9. Bioactivity of rock bream IFN. (A). SDS-PAGE analysis of recombinant rbIFN1 expression and purification in E. coli system. Lane 1-5, total protein of uninduced E. coli cells, total protein of IPTG induced E. coli cells, insoluble protein, soluble protein and purified protein, respectively. Black arrow head indicates the position of purified rbIFN1. (B). Kinetics of Mx expression in rock bream head kidney cells after in vitro stimulation of recombinant rbIFN1 protein. The primary cultured head kidney cells from rock bream were stimulated with 5 mg/ml recombinant rbIFN1 for 1, 3, 6, 9, 12 and 24 h. MBP was used as mock control at each time point. 50 mg/ml poly I:C at 9 h was used as a positive control. The expression of Mx gene was analyzed by qRT-PCR. The expression data of Mx was normalized to the expression of b-actin and expressed as fold change relative to MBP group. Data is shown as the mean of three independent experiments and bars indicate the SEMs. Means with different letters are significantly different (P < 0.05).

fish IFNs studied, and the important role of NF-kB in activation of the salmon IFN has been suggested by previous studies [37, 38]. In rock bream, rbIFN1and rbIFN2 possess one and four putative NF-kB binding sites within 1-kb proximal promoter region, respectively. The higher number of NF-kB binding sites might account for the higher induction level of rbIFN2 upon different immune stimuli. Apart from positive regulatory elements, we also identified several PRDM/BLIMP-1 transcriptional repressor binding sites in the shared promoter region of rock bream IFNs, which are importantly involved in the postinduction repression of the mammalian IFNs via steric hindrance of transcription activators [39]. Accordingly, it is conceivable to assume that the five IRF binding sites and one CREB site in the shared promoter region, which are recognized by

Q. Wan et al. / Fish & Shellfish Immunology 33 (2012) 886e898

PRDM/BLIMP-1, might be the key cis-regulatory elements for promoter activation of rock bream IFNs. Tissue or cell type specific expression properties of different type I IFNs have been well documented in mammals. As two major subtypes, IFN-a is predominantly produced by plasmacytoid dendritic cells (pDCs) while IFN-b is synthesized by most cell types but especially in fibroblasts [40]. The previous investigation on tissue distribution of rainbow trout type I IFN genes has revealed that the 2C-group IFN2 are constitutively expressed in a wide range of tissues, whilst 4C-group IFN3 are selectively expressed in reproductive organs and leucocytes derived from the head kidney [17]. However, some IFN genes, such as carp IFN, were shown minimal constitutive expression in un-stimulated tissues [19]. In our study, two rock bream 2C-IFN transcripts showed universal distribution in all the tissue examined, with the highest constitutive expression in skin. Nevertheless, in the context of absolute expression level without beta-actin normalization, blood cells were shown as the primary expression site of two IFNs. Interestingly, the universal expression across tissue type of rock bream IFNs is similar with mammalian IFN-b, but its preference for blood leukocytes is identical to IFN-a. This finding is in agreement with the previously anticipated viewpoint that fish type I IFNs cannot be classified as either IFN-a or IFN-b [41]. The qRT-PCR analysis of two IFNs in blood cells and head kidney showed significant induction by various in vivo immune stimulation (Fig. 7 and Fig. 8), suggesting an important involvement in the host response to both viral and bacterial pathogens in rock bream. As the hallmark of type I IFNs, the rapid induction by viral infection and/or dsRNA poly I:C have been widely reported for all the characterized fish type I IFNs [9, 17, 19, 42-44]. Additionally, the implication of type I IFNs in bacterial infection has not been has been demonstrated in several fish species. Significant induction of both 2C- and 4C-IFNs by short term LPS stimulation was reported in rainbow trout RTS11 cells [12]. In the study of Japanese flounder, the type I IFN gene was up-regulated by Gram-negative bacteria E. tarda infection [45]. Another study in zebrafish found that the treatment of fish with 2C-group IFN41 protein was able to confer protection against Gram-possitive bacteria S. iniae infection [46]. However, the precise functional role of fish type I IFNs in the host response to bacterial infection is not fully understood. As suggested in mammals, the activity of type I IFNs can enhance cell-autonomous antibacterial immunity by increasing the production of several antibacterial effectors and IFN-g, but also can cause potentially harmful effects on host organisms [3]. It is noteworthy that the responses of both IFNs to the stimuli of LPS, E. tarda and iridovirus have displayed significant differences between two tissues examined. E. tarda challenge evoked dramatically higher induction in head kidney than in blood cells. On the contrary, the LPSinduced fold-change in head kidney was much lower than that in blood cells. As for iridovirus challenge, the IFN expression kinetics in two tissues was entirely different. Similarly, striking difference in expression properties in response to poly I:C and imiquimod stimulation between head kidney leukocytes and TO cells were reported in salmon IFNs [15]. In the study of rainbow trout IFNs, 4C-IFN transcript showed induction by poly I:C only in head kidney cells in contrast to the induction of 2C-IFN transcripts in both head kidney cells and fibroblast RTG-2 cell line [17]. These data suggest that activation of different fish IFN genes might be mediated with different tissue-specific signaling pathways. In mammals, the transcriptional regulation of type I IFNs in host response to pathogens has been demonstrated to be mediated by distinct signaling pathways via membrane-bound toll-like receptors (TLRs) and cytoplasmatic RIG-like receptors (RLRs) [47]. Emerging evidences suggest that fish may possess similar TLR and RLR mediated pathways in type I IFN induction [48-51], however,

897

the question how these pathways activate various fish IFNs in a tissue or cell type-specific manner upon different stimuli still needs to be addressed. Functional studies have been performed for many of the fish type I IFNs identified. Although, like mammalian type I IFNs recombinant fish IFNs of both 2C- and 4C-groups have demonstrated biological activities of induction of antiviral proteins and protection against various infectious viral diseases by in vivo and/or in vitro studies, the specific activities and the kinetics of inducing antiviral genes between two groups of IFNs have displayed significant differences [17, 46]. A recent study in zebrafish has revealed that two IFN groups actually bind two distinct receptor complexes [52]. 4C- and 2C-IFNs in zebrafish are believed to play complementary antiviral roles at early and late phases of virus infections, respectively [46]. Nonetheless, another question is raised about the IFN function in marine acanthopterygii fish species like rock bream, which probably possess only 2C-IFNs as discussed above. In our study, only rbIFN1 protein was recombinant expressed and examined for bioactivity in part because it is the dominant transcript in all the rock bream tissues. Moreover, the position with different residues between two IFNs is not a crucial receptor binding site, and similar amino acid substitution is present in several fish IFNs. Thus, the result of rbIFN1 can probably represent both IFNs in rock bream. In the earlier functional studies, recombinant IFN proteins were produced mainly by eukaryotic expression system or direct transfection of IFN expression plasmid, whereas prokaryotic E. coli system have been successfully used for recombinant protein expression in recent studies of zebrafish and salmon IFNs, as well as in this present study. The major concerns about using E. coli system for IFN production were due to the presence of putative N-linked glycosylation sites in all know fish IFNs except zebrafish IFNs. Although emerging lines of evidence indicate that glycosylation is not required for intrinsic activity of IFN protein [18, 53], it could be essential for the stability of IFN molecules [54]. Despite of two putative N-linked glycosylation sites present, recombinant rbIFN1 protein produced by E. coli rapidly induced the expression of Mx gene in head kidney cells with a similar induction-fold as that of poly I:C . In addition to Mx gene, we have also observed the rapid induction effects on other antiviral genes, IRFs as well as type I IFNs themselves (data not shown), implying that rbIFN1 can evoke an autocrine response via a IRF mediated positive feedback loop as in mammals [55]. The rapid and transient Mx induction pattern of rbIFN1 is somewhat more similar to that of the 4C-IFNs in zebrafish rather than its 2C-homologous IFN44, which may suggest the evolving IFN functions in acanthopterygii fish species. In conclusion, this study demonstrates the presence of two duplicated type I IFN genes in rock bream. Two rock bream IFNs appear to be the orthologs of the zebrafish IFN44 gene in subgroupd of 2C-group. More copies of subgroup-d IFNs are likely present in the genome of rock bream, whereas the deletion of other subtype IFNs in rock bream genome during evolution progress needs to be confirmed by further genome sequencing efforts. Two IFNs may serve important functions of both antiviral and antibacterial activities in rock bream host defence. To understand the molecular mechanisms underlying their tissue-specific response upon different immune stimuli, characterization of the TLR and RLR signaling pathways will be necessary in future study. The availability of rock bream type I IFN genes opens opportunities to perform the disease control and selective breeding of disease resistant fish in rock bream mariculture industry. Acknowledgements This research was supported by National Fisheries Research and Development Institute (RP- 2012-BT-022) grant.

898

Q. Wan et al. / Fish & Shellfish Immunology 33 (2012) 886e898

References [1] Platanias LC. Mechanisms of type-I- and type-II-interferon-mediated signalling. Nature reviews Immunology 2005;5:375e86. [2] Gonzalez-Navajas JM, Lee J, David M, Raz E. Immunomodulatory functions of type I interferons. Nature reviews Immunology 2012;12:125e35. [3] Decker T, Muller M, Stockinger S. The yin and yang of type I interferon activity in bacterial infection. Nature reviews Immunology 2005;5:675e87. [4] Clemens MJ, McNurlan MA. Regulation of cell proliferation and differentiation by interferons. The Biochemical journal 1985;226:345e60. [5] Takaoka A, Hayakawa S, Yanai H, Stoiber D, Negishi H, Kikuchi H, et al. Integration of interferon-alpha/beta signalling to p53 responses in tumour suppression and antiviral defence. Nature 2003;424:516e23. [6] Pestka S, Krause CD, Walter MR. Interferons, interferon-like cytokines, and their receptors. Immunological reviews 2004;202:8e32. [7] Zhou Z, Hamming OJ, Ank N, Paludan SR, Nielsen AL, Hartmann R. Type III interferon (IFN) induces a type I IFN-like response in a restricted subset of cells through signaling pathways involving both the Jak-STAT pathway and the mitogen-activated protein kinases. Journal of virology 2007;81:7749e58. [8] Zhang SY, Boisson-Dupuis S, Chapgier A, Yang K, Bustamante J, Puel A, et al. Inborn errors of interferon (IFN)-mediated immunity in humans: insights into the respective roles of IFN-alpha/beta, IFN-gamma, and IFN-lambda in host defense. Immunological reviews 2008;226:29e40. [9] Altmann SM, Mellon MT, Distel DL, Kim CH. Molecular and functional analysis of an interferon gene from the zebrafish, Danio rerio. Journal of virology 2003; 77:1992e2002. [10] Zhang YB, Gui JF. Molecular regulation of interferon antiviral response in fish. Developmental and comparative immunology 2012. [11] Zou J, Secombes CJ. Teleost fish interferons and their role in immunity. Developmental and comparative immunology 2011;35:1376e87. [12] Chang M, Nie P, Collet B, Secombes CJ, Zou J. Identification of an additional two-cysteine containing type I interferon in rainbow trout Oncorhynchus mykiss provides evidence of a major gene duplication event within this gene family in teleosts. Immunogenetics 2009;61:315e25. [13] Hamming OJ, Lutfalla G, Levraud JP, Hartmann R. Crystal structure of Zebrafish interferons I and II reveals conservation of type I interferon structure in vertebrates. Journal of virology 2011;85:8181e7. [14] Stein C, Caccamo M, Laird G, Leptin M. Conservation and divergence of gene families encoding components of innate immune response systems in zebrafish. Genome biology 2007;8:R251. [15] Sun B, Robertsen B, Wang Z, Liu B. Identification of an Atlantic salmon IFN multigene cluster encoding three IFN subtypes with very different expression properties. Developmental and comparative immunology 2009;33:547e58. [16] Purcell MK, Laing KJ, Woodson JC, Thorgaard GH, Hansen JD. Characterization of the interferon genes in homozygous rainbow trout reveals two novel genes, alternate splicing and differential regulation of duplicated genes. Fish & shellfish immunology 2009;26:293e304. [17] Zou J, Tafalla C, Truckle J, Secombes CJ. Identification of a second group of type I IFNs in fish sheds light on IFN evolution in vertebrates. J Immunol 2007;179: 3859e71. [18] Ooi EL, Verjan N, Hirono I, Nochi T, Kondo H, Aoki T, et al. Biological characterisation of a recombinant Atlantic salmon type I interferon synthesized in Escherichia coli. Fish & shellfish immunology 2008;24:506e13. [19] Kitao Y, Kono T, Korenaga H, Iizasa T, Nakamura K, Savan R, et al. Characterization and expression analysis of type I interferon in common carp Cyprinus carpio L. Molecular immunology 2009;46:2548e56. [20] Sohn SG, Choi DL, Do JW, Hwang GY, Park JW. Mass mortalities of cultured striped beakperch, Oplegnathus fasciatus by iridoviral infection. J Fish Pathol 2000;13:7. [21] Park SI. Disease control in Korean aquaculture. Fish Pathol 2009;24:5. [22] Zenke K, Kim KH. Molecular cloning and expression analysis of three Mx isoforms of rock bream, Oplegnathus fasciatus. Fish & shellfish immunology 2009;26:599e605. [23] Zenke K, Nam YK, Kim KH. Molecular cloning and expression analysis of doublestranded RNA-dependent protein kinase (PKR) in rock bream (Oplegnathus fasciatus). Veterinary immunology and immunopathology 2010;133:290e5. [24] Won Kim Ju, Gyeong Kwon Mun, Ae Park Myoung, Youn Hwang Jee, Jun Park Hyung, Wook Baeck Gun, et al. Molecular cloning and expression analysis of an interferon stimulated gene 15 from rock bream Oplegnathus fasciatus. JFish Pathol 2010;23:11. [25] Tamura K, Dudley J, Nei M, Kumar S. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Molecular biology and evolution 2007; 24:1596e9. [26] Whang I, Lee Y, Lee S, Oh MJ, Jung SJ, Choi CY, et al. Characterization and expression analysis of a goose-type lysozyme from the rock bream Oplegnathus fasciatus, and antimicrobial activity of its recombinant protein. Fish & shellfish immunology 2011;30:532e42. [27] Christoffels A, Brenner S, Venkatesh B. Tetraodon genome analysis provides further evidence for whole-genome duplication in the ray-finned fish lineage. Comparative biochemistry and physiology Part D. Genomics & proteomics 2006;1:13e9. [28] Venkatesh B, Kirkness EF, Loh YH, Halpern AL, Lee AP, Johnson J, et al. Survey sequencing and comparative analysis of the elephant shark (Callorhinchus milii) genome. PLoS biology 2007;5:e101.

[29] Dishaw LJ, Haire RN, Litman GW. The amphioxus genome provides unique insight into the evolution of immunity. Briefings in functional genomics 2012; 11:167e76. [30] Lutfalla G, Roest Crollius H, Stange-Thomann N, Jaillon O, Mogensen K, Monneron D. Comparative genomic analysis reveals independent expansion of a lineage-specific gene family in vertebrates: the class II cytokine receptors and their ligands in mammals and fish. BMC genomics 2003;4:29. [31] Chen CY, Shyu AB. AU-rich elements: characterization and importance in mRNA degradation. Trends in biochemical sciences 1995;20:465e70. [32] Sato M, Suemori H, Hata N, Asagiri M, Ogasawara K, Nakao K, et al. Distinct and essential roles of transcription factors IRF-3 and IRF-7 in response to viruses for IFN-alpha/beta gene induction. Immunity 2000;13:539e48. [33] Ohtani M, Hikima J, Hwang SD, Morita T, Suzuki Y, Kato G, et al. Transcriptional regulation of type I interferon gene expression by interferon regulatory factor-3 in Japanese flounder, Paralichthys olivaceus. Developmental and comparative immunology 2012;36:697e706. [34] Hu G, Yin X, Lou H, Xia J, Dong X, Zhang J, et al. Interferon regulatory factor 3 (IRF-3) in Japanese flounder, Paralichthys olivaceus: sequencing, limited tissue distribution, inducible expression and induction of fish type I interferon promoter. Developmental and comparative immunology 2011; 35:164e73. [35] Thanos D, Maniatis T. Virus induction of human IFN beta gene expression requires the assembly of an enhanceosome. Cell. 1995;83:1091e100. [36] Wang J, Basagoudanavar SH, Wang X, Hopewell E, Albrecht R, Garcia-Sastre A, et al. NF-kappa B RelA subunit is crucial for early IFN-beta expression and resistance to RNA virus replication. J Immunol 2010;185:1720e9. [37] Chen JY, You YK, Chen JC, Huang TC, Kuo CM. Organization and promoter analysis of the zebrafish (Danio rerio) interferon gene. DNA and cell biology 2005;24:641e50. [38] Bergan V, Steinsvik S, Xu H, Kileng O, Robertsen B. Promoters of type I interferon genes from Atlantic salmon contain two main regulatory regions. The FEBS journal 2006;273:3893e906. [39] Whittemore LA, Maniatis T. Postinduction repression of the beta-interferon gene is mediated through two positive regulatory domains. Proceedings of the National Academy of Sciences of the United States of America 1990;87: 7799e803. [40] Crow MK. Type I interferon in organ-targeted autoimmune and inflammatory diseases. Arthritis research & therapy 2010;12(Suppl 1):S5. [41] Robertsen B. The interferon system of teleost fish. Fish & shellfish immunology 2006;20:172e91. [42] Long S, Milev-Milovanovic I, Wilson M, Bengten E, Clem LW, Miller NW, et al. Identification and expression analysis of cDNAs encoding channel catfish type I interferons. Fish & shellfish immunology 2006;21:42e59. [43] Robertsen B, Bergan V, Rokenes T, Larsen R, Albuquerque A. Atlantic salmon interferon genes: cloning, sequence analysis, expression, and biological activity. Journal of interferon & cytokine research: the official journal of the International Society for Interferon and Cytokine Research 2003;23:601e12. [44] Yu FF, Zhang YB, Liu TK, Liu Y, Sun F, Jiang J, et al. Fish virus-induced interferon exerts antiviral function through Stat1 pathway. Molecular immunology 2010;47:2330e41. [45] Suzuki Y, Yasuike M, Kondo H, Aoki T, Hirono I. Molecular cloning and expression analysis of interferon regulatory factor 10 (IRF10) in Japanese flounder, Paralichthys olivaceus. Fish & shellfish immunology 2011;30: 67e76. [46] Lopez-Munoz A, Roca FJ, Meseguer J, Mulero V. New insights into the evolution of IFNs: zebrafish group II IFNs induce a rapid and transient expression of IFN-dependent genes and display powerful antiviral activities. J Immunol 2009;182:3440e9. [47] Honda K, Takaoka A, Taniguchi T. Type I interferon [corrected] gene induction by the interferon regulatory factor family of transcription factors. Immunity 2006;25:349e60. [48] Matsuo A, Oshiumi H, Tsujita T, Mitani H, Kasai H, Yoshimizu M, et al. Teleost TLR22 recognizes RNA duplex to induce IFN and protect cells from birnaviruses. J Immunol 2008;181:3474e85. [49] Biacchesi S, LeBerre M, Lamoureux A, Louise Y, Lauret E, Boudinot P, et al. Mitochondrial antiviral signaling protein plays a major role in induction of the fish innate immune response against RNA and DNA viruses. Journal of virology 2009;83:7815e27. [50] Sun F, Zhang YB, Liu TK, Shi J, Wang B, Gui JF. Fish MITA serves as a mediator for distinct fish IFN gene activation dependent on IRF3 or IRF7. J Immunol 2011;187:2531e9. [51] Li S, Sun F, Zhang YB, Gui JF, Zhang QY. Identification of DreI as an antiviral factor regulated by RLR signaling pathway. PloS one 2012;7:e32427. [52] Aggad D, Mazel M, Boudinot P, Mogensen KE, Hamming OJ, Hartmann R, et al. The two groups of zebrafish virus-induced interferons signal via distinct receptors with specific and shared chains. J Immunol 2009;183:3924e31. [53] van Pesch V, Lanaya H, Renauld JC, Michiels T. Characterization of the murine alpha interferon gene family. Journal of virology 2004;78:8219e28. [54] Ceaglio N, Etcheverrigaray M, Conradt HS, Grammel N, Kratje R, Oggero M. Highly glycosylated human alpha interferon: An insight into a new therapeutic candidate. Journal of biotechnology 2010;146:74e83. [55] Sun F, Zhang YB, Liu TK, Gan L, Yu FF, Liu Y, et al. Characterization of fish IRF3 as an IFN-inducible protein reveals evolving regulation of IFN response in vertebrates. J Immunol 2010;185:7573e82.