- Email: [email protected]
Multiplex real-time polymerase chain reaction for the differential detection of porcine circovirus 2 and 3
Journal of Virological Methods 250 (2017) 11–16
Contents lists available at ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
Multiplex real-time polymerase chain reaction for the differential detection of porcine circovirus 2 and 3
MARK
Hye-Ryung Kima, Yu-Ri Parka, Da-Rae Lima, Min-Ji Parka, Ji-Young Parkb, Seong-Hee Kimb, ⁎ Kyoung-Ki Leeb, Young S. Lyooc, Choi-Kyu Parka, a b c
College of Veterinary Medicine & Animal Disease Intervention Center, Kyungpook National University, Daegu 41566, Republic of Korea Animal Disease Diagnostic Division, Animal and Plant Quarantine Agency, Gimcheon 39660, Republic of Korea College of Veterinary Medicine Konkuk University, Seoul 05029, Republic of Korea
A R T I C L E I N F O
A B S T R A C T
Keywords: Porcine circovirus 2 PCV3 Capsid gene Multiplex Real-time PCR
A multiplex quantitative real-time polymerase chain reaction (mqPCR) assay was developed for the rapid and differential detection of porcine circovirus 2 (PCV2) and PCV3. Each of the capsid genes of PCV2 and PCV3 were amplified using specific primers and probe sets, while no other porcine pathogen genes were detected. Limit of detection of the assay was below 50 copies of the target genes of PCV2 and PCV3, and was comparable to that of previously described methods The assay showed high repeatability and reproducibility, with coefficients of intra-assay and inter-assay variation of less than 4.0%. Clinical evaluation using tissue samples from a domestic pig farm showed that PCV2 and PCV3 co-circulated at the farm. Moreover, singular infection rates of PCV2 or PCV3 were 21.7% (10/46) or 6.5% (3/46), respectively, while the co-infection rate of PCV3 with PCV2 was 28.3% (13/46). PCV3 DNA was detected by the mqPCR in respiratory diseased piglet tissue samples and aborted fetal tissue samples, suggesting that PCV3 infection is associated with porcine respiratory disease and reproductive failure in the pig farm. This mqPCR method is a rapid and reliable differential diagnostic tool for the monitoring and surveillance of PCV2 and PCV3 in the field.
1. Introduction Porcine circovirus (PCV), which belongs to the genus Circovirus of the family Circoviridae, is a non-enveloped, spherical, single-stranded DNA virus (Tischer et al., 1982). Before 2016, two types of PCV were reported to infect pigs: PCV1 and PCV2 (Allan et al., 2012). PCV1 was initially discovered in 1974 as a permanent contaminant of continuous cell culture PK-15 and was considered non-pathogenic (Tischer et al., 1982). In contrast, PCV2 was first identified from post-weaning multisystemic wasting syndrome-affected pigs in Canada in the early 1990s. PCV2 is now considered a major pathogen of porcine circovirus associated disease (PCVAD), which is characterized by several clinical conditions, including post-weaning multi-systemic wasting syndrome, porcine dermatitis and nephropathy syndrome (PDNS), reproductive disorders, enteritis, proliferative and necrotizing pneumonia, and porcine respiratory disease complex (Opriessnig et al., 2007; Segalés, 2012). Recently, a novel porcine circovirus, designated as PCV3, was identified in pigs with PDNS, reproductive failure, and cardiac and
multi-systemic inflammation in the US and China (Palinski et al., 2017; Phan et al., 2016). More recently, PCV3 was identified in pen-based oral fluid samples from Korean pig farms (Kwon et al., 2017b). Based on additional prevalence studies, PCV3 was suggested to commonly circulate within pig populations in the US, China, and Korea (Ku et al., 2017; Kwon et al., 2017b; Palinski et al., 2017) and that the new circovirus might cause clinical disease on swine farms. The clinical presentations of PCV3 are similar to those of PCV2 and to coinfection with PCV2 and PCV3 in pig populations in the US, China, and Korea; therefore, a rapid and reliable diagnostic assay is needed for the differential detection of PCV2 and PCV3 in the field (Ku et al., 2017; Kwon et al., 2017b; Palinski et al., 2017). However, there is no specific single assay capable of differentiating PCV2 infection from PCV3 infection. Such an assay would enable the accurate diagnosis of suspected clinical cases and encourage further epidemiological studies for its control. Therefore, in the present study, we developed and evaluated a rapid multiplex quantitative real-time polymerase chain reaction (mqPCR) assay using primer sets capable of detecting and typing PCV2 and PCV3 in clinical samples.
⁎ Corresponding author at: College of Veterinary Medicine & Animal Disease Intervention Center, Kyungpook National University, 80 Daehak-ro, Bukgu, Daegu 41566, Republic of Korea. E-mail address: [email protected] (C.-K. Park).
http://dx.doi.org/10.1016/j.jviromet.2017.09.021 Received 17 August 2017; Received in revised form 19 September 2017; Accepted 19 September 2017 Available online 21 September 2017 0166-0934/ © 2017 Elsevier B.V. All rights reserved.
Journal of Virological Methods 250 (2017) 11–16
H.-R. Kim et al.
PCV3 isolate (PCK3-1701 strain, GenBank accession number MF611876.1) using a pair of specific primers (forward, 5′- ATG ACGTATCCAAGGAGGCG-3′ and reverse, 5′-TTAGGGTTTAAGTGGGGGG TC-3′ for PCV2, or forward, 5′-TGAGACA CAG AGCTATATTC-3′ and reverse, 5′-TTCACTTAGAGAACGGACTT-3′ for PCV3, respectively). PCR was carried out using a commercial kit (Excel TB 2X Taq premix; Inclone, Korea) in 25-μL reaction mixtures containing 12.5 μL of 2 × premix, 0.4 μM of each primer, and 5 μL of PCV2 or PCV3 DNA as template, according to the manufacturer’s instructions. Amplification was carried out using a thermal cycler (Applied Biosystems, USA) under the following conditions: initial denaturation at 94 °C for 5 min; 35 cycles at 94 °C for 30 s, 55 °C for 30 s, 72 °C for 1 min; and a final extension at 72 °C for 10 min. Each amplified product was purified and cloned into the pTOP TA V2 vector (TOPcloner™ TA core Kit; Enzynomics, Korea), which was transformed into Escherichia coli competent cells according to the manufacturer’s instructions (DH5α Chemically Competent E. coli; Enzynomics, Korea). Plasmids containing the PCV2 or PCV3 capsid gene were purified using a commercial kit (GeneAll Expin™ Combo GP 200 miniprep kit, GeneAll, Seoul, Korea). The concentrations of each plasmid sample were determined by measuring the absorbance at 260 nm using a NanoDrop Lite (Thermo Scientific, Waltham, MA, USA), and the copy numbers of each cloned gene were quantified as previously described: copies/μL = concentration of plasmid (g/μL)/[(plasmid length × 660) × (6.022 × 1023)] (Parida et al., 2011). Ten-fold dilutions of the standard PCV2 or PCV3 DNA sample (from 106 to 100 copies/μL) were stored at −80 °C and used as standards for PCV2 or PCV3 quantitation of diagnostic samples.
Table 1 Specificity of, multiplex quantitative real-time PCR using PCV2 or PCV3-specific primers and probe set. Pathogen
Sourcea
Strain
Porcine circovirus 1 Porcine circovirus 2 Porcine circovirus 3 PRRS virus, genotype 1 PRRS virus, genotype 2 Classical swine fever virus Porcine parvovirus ST cell PK-15 cell
Amplification of target gene PCV2 (FAM)
PCV3 (ROX)
Field strain PCK0201 Field strain Lelystad virus LMY strain LOM strain
ADIC ADIC ADIC APQA APQA APQA
– + – – – –
– – + – – –
NADL-2 – –
APQA ADIC ADIC
– – –
– – –
a APQA, Animal and Plant Quarantine Agency, Korea; ADIC, Animal Disease Intervention Center, Kyungpook National University, Korea.
2. Materials and methods 2.1. Viruses and samples A PCV2 Korean field isolate (PCK0201 strain) (Park et al., 2004) and a PCV3-positive clinical sample were used to optimize the mqPCR conditions. The PCV3-positive tissue sample was collected from a PCV3infected pig farm and confirmed as PCV3-positive using a previously described qPCR assay (Palinski et al., 2017). Other porcine viral pathogens, including PCV1 (positive PK-15 cell culture), type 1 porcine reproductive and respiratory syndrome virus (PRRSV, Lelystad virus), type 2 PRRSV (LMY strain), classical swine fever virus (LOM strain), and porcine parvovirus (NADL-2 strain) were obtained from the Animal and Plant Quarantine Agency or Animal Disease Intervention Center for the assay’s specificity test (Table 1). All pathogen samples were allocated and stored at −80 °C until use. For clinical evaluation of the mqPCR, 46 tissue samples (17 aborted fetuses and 29 respiratory diseased piglets) were collected from a PCV2 and PCV3-infected pig farm located in Kyungpook province, in the southern part of Korea, where PCV2 was endemically infected and regularly vaccinated with commercial PCV2 vaccine in the sow and piglet groups, and PCV3 infection was confirmed early in 2017 by qPCR, as previously described (Palinski et al., 2017). The tissue samples were homogenized and diluted 10-fold with phosphate-buffered saline (0.1 M, pH 7.4). All samples were frozen and thawed twice, vortexed for 5 min, and centrifuged at 10,000 × g (Hanil, Korea) for 10 min at 4 °C. The supernatants were used for DNA extraction immediately or stored at −80 °C until use.
2.3. Primers and probes for mqPCR For the differential detection of PCV2 and PCV3, two sets of primers and probes were used for mqPCR. Primers and probes for PCV2 were used as described in a previous report (Olvera et al., 2004), with some base modifications to reflect the genetic variation of the target gene sequences among the different genotypes of PCV2 strains in Korea (Kwon et al., 2017a). Two qPCR assays have been developed to detect and quantify PCV3 DNA in previous studies (Palinski et al., 2017; Wang et al., 2017). These qPCR assays used a primers/probe set designed based on a limited number of US and Chinese PCV3 sequences that were available in GenBank when the assay was developed. In this study, primers and the probe for PCV3 were newly designed using Primer Express software (version 3.0) (Applied Biosystems, USA) based on a total of 32 PCV3 genome sequences, including five US, 16 Chinese, 9 Korean, and two Brazilian strains, available in National Center for Biotechnology Information (NCBI). To facilitate the establishment of multiplex qPCR, the sequences of the primers/probe for PCV3 were carefully selected so that their melting temperatures were similar to those of the PCV2 primers and probe. The lengths of amplicons for PCV2 and PCV3 were 99 and 118 base pairs (bp), respectively (Table 2). A BLAST search (http://blast.ncbi.nlm.nih.gov/Blast.cgi) was performed to check the specificity of the primers and probe. Each
2.2. Reference gene construction The complete capsid gene of PCV2 or PCV3 was amplified by PCR from a Korean field isolate (PCK0201 strain) (Park et al., 2004) or a Table 2 Primers and probes used in this study. Virus
Primer/Probe
Sequence (5′−3′)a
Positionb
Tm (°C)
Amplicon (bp)
Reference
PCV3
PCV3F PCV3R PCV3P
CGGTGGGGTCATATGTGTTG CACAGCCGTTACTTCACC ROX-CTTTGTCCTGGGTGAGCGCTGGTAG-BHQ2
1443–1462 1543–1560 1496–1520
62.5 60 69.6
118
In this study
PCV2
PCV2F PCV2R PCV2P
CCAGGAGGGCGTTSTGACT CGYTACCGYTGGAGAAGGAA FAM-AATGGCATCTTCAACACCCGCCTCT-TAMRA
1535–1553 1614–1633 1612–1592
61.3 58.3 68.0
99
Olvera et al. (2004), modified
a
Bold text in sequences of PCV2F and PCV2R primers represent a degenerative base: S, C or G; Y, C or T, respectively. Genome position of primer- and probe-binding sequences according to the complete genome sequence of PCV2 KU-1601 strain and PCV3 29160 strain (GenBank accession no. KX828228.1 and NC-031753.1, respectively). b
12
Journal of Virological Methods 250 (2017) 11–16
H.-R. Kim et al.
viral standard gene tested. The concentrations of capsid genes of PCV2 and PCV3 were 106, 104, and 102 copies/μL. For intra-assay variability, each dilution was analyzed in triplicate on the same day, while for inter-assay variability, each dilution was analyzed in six independent experiments performed by two different operators on different days in accordance with MIQE guidelines (Bustin et al., 2009). The coefficient of variation for the Ct values was determined based on the intra-assay or inter-assay results.
primer and probe sequence for PCV2 or PCV3 used in this study showed 100% homology with the corresponding sequences of the virus. In addition, we evaluated the specificity of the qPCR assay using each primers/probe set in silico using FastPCR software, version 5.4 (PrimerDigital Ltd., Finland), following the developer’s instructions (Kalendar et al., 2011). The predictive success rate of the pPCR with each primers/probe sets was 99.4% (1870/1882) for PCV2 and 100% (32/32) for PCV3 with the complete gene available in NCBI, respectively, showing that the qPCR assay with the selected primers/probe sets is highly specific and can applied to detect PCV2 and PCV3. For accurate differential detection of PCV2 and PCV3 by mqPCR it is essential that the sequence-specific probes are labeled with reporter dyes whose fluorescence spectra are distinct or show only minimal overlap (Navarro et al., 2015). In this study, for the simultaneous and differential detection of the capsid genes of PCV2 and PCV3 in a single reaction, probes for the capsid genes were labeled differently at the 5′ and 3′ ends with 6-carboxyfluorescein (FAM) and 6-carboxytetramethylrhodamine (TAMRA) for PCV2, and 6-carboxy-X-rhodamine (ROX) and Black Hole Quencher 2 (BHQ2) for PCV3, according to the manufacturer’s guidelines (Bioneer, Daejeon, Korea) (Table 2).
2.7. Clinical evaluation of mqPCR Evaluation of field samples was performed by mqPCR using the clinical samples described in Section 2.1 (Table 4). For clinical samples, monoplex qPCR and mqPCR were performed as described in Sections 2.3 and 2.4 using DNAs extracted from the samples and compared with the results of previously reported qPCR assays for PCV2 (Olvera et al., 2004) and PCV3 (Palinski et al., 2017) using a commercial qPCR kit (Premix Ex Taq™ Probe qPCR, Takara, Shiga, Japan) and CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). 3. Results
2.4. mqPCR conditions 3.1. Interpretation of mqPCR Before optimization of the mqPCR, a monoplex qPCR assay with each PCV2 or PCV3 primer and probe set was carried out using a commercial qPCR kit (Premix Ex Taq™ Probe qPCR, Takara, Shiga, Japan) and CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). The 25-μL reaction mixture contained 12.5 μL of 2 × Premix Ex Taq buffer with enzyme, 0.4 μM of each primer and probe, and 5 μL of cloned PCV2 or PCV3 DNA (106 copies/μL), and was prepared according to the manufacturer’s instructions. To optimize the mqPCR conditions, the concentrations of the two sets of primers and probe were optimized, while other reaction components were the same as those used for monoplex qPCR. The monoplex qPCR and mqPCR programs were the same and comprised 3 min at 95 °C for initial denaturation, followed by 40 cycles of 95 °C for 10 s and 60 °C for 30 s for amplification. FAM and ROX fluorescence signals were obtained at the end of each annealing step. To interpret the monoplex and mqPCR results, samples producing a cycle threshold (Ct) of less than 37 were considered positive, while those with a higher Ct value (> 37) were considered negative, according to previously described guidelines (Broeders et al., 2014).
The fluorescent signals of FAM or ROX were detected for PCV2 or PCV3 using monoplex qPCR, respectively (Supplemental Fig. 1A and B). For the simultaneous and differential detection of ORF2 genes of PCV2 and PCV3 in a single reaction tube, two sets of primers and probes for mqPCR were used with the same PCR conditions in a multiplex format (Supplemental Fig. 1C). The results of mqPCR using the optimized primer concentration (0.4 μM of each primer and 0.4 μM of each probe for PCV2 and PCV3, respectively) showed that two fluorescent signals of FAM and ROX could be detected simultaneously by the mqPCR assay (Supplemental Fig. 1C). These results demonstrated that mqPCR could successfully amplify the two target genes of PCV and PCV3 in a single reaction without spurious amplification or significant crosstalk between the two fluorescent reporter dyes. 3.2. Specificity of mqPCR The PCV2 and PCV3 primer and probe sets detected the DNA of their respective virus only. No positive results were obtained for any of the other swine pathogens and two swine-origin cell cultures (Table 1). As expected, capsid genes of PCV2 and PCV3 were co-amplified from a mixed sample of PCV2 and PCV3 (Supplemental Fig. 1C). The results indicated that the mqPCR assay is specific for the simultaneous and differential detection of PCV2 and PCV3.
2.5. Specificity and sensitivity of mqPCR To test the specificity of the mqPCR assay, the assay was performed with total nucleic acids extracted from seven viral samples (PCV1, PCV2, PCV3, type 1 and 2 PRRSV, classical swine fever virus, and porcine parvovirus) and two PCV3 non-infected porcine-origin cell cultures (ST cell and PK-15 cell) as negative controls. Assay sensitivities (mqPCR and its corresponding monoplex assay for PCV2 and PCV3) were determined in triplicate using serial dilutions (from 106 to 100 copies/μL) of each plasmid DNA containing the entire PCV2 or PCV3 capsid gene. For data analysis, CFX96 Touch™ Real-Time PCR Detection software (Bio-Rad) was used to create a standard curve with the threshold cycle (Ct) values of the 10-fold dilutions PCV2 or PCV3 capsid DNA (from 106 to 100 copies/μL). The detection software also calculated the correlation coefficient (R2) of the standard curve, the standard deviations of the results, and the PCV2 or PCV3 DNA copy number of the samples based on the standard curve.
3.3. Sensitivity of mqPCR In terms of capsid gene copy number, the limits of detection (LODs) of mqPCR were below 50 gene copies for PCV2 and PCV3, which were similar to that of each monoplex qPCR (Fig. 1 and Supplemental Fig. 1). To determine the linearity of the reaction and PCR efficiency, standard curves for the target genes were generated by plotting their Ct numbers versus their dilution factors. High correlation values (R2 > 0.99) between the Ct values and the dilution factors were calculated for the monoplex qPCR and mqPCR assays (Fig. 1). 3.4. Precision of mqPCR To assess the intra-assay repeatability and inter-assay reproducibility, three different concentrations (high, medium, and low) of each standard DNA were tested in triplicate in six different runs performed by two distinct operators on different days. The coefficients of variation within runs (intra-assay variability) ranged from 0.14% to 0.78% for
2.6. Precision of mqPCR Repeatability (intra-assay precision) and reproducibility (interassay precision) of the mqPCR assay for PCV2 or PCV3 was determined using three different concentrations (high, medium, and low) of each 13
Journal of Virological Methods 250 (2017) 11–16
H.-R. Kim et al.
Table 4 Comparison of diagnostic results for clinical samples by multiplex quantitative real-time PCR (mqPCR) and previously reported qPCR assays for PCV2 and PCV3. Method
mqPCR (PCV2/3) Monoplex qPCR (PCV2) Monoplex qPCR (PCV3) Olvera’s qPCR (PCV2) Palinski’s qPCR (PCV3)
No. tested
Results of different methodsa
Detection rate (%)
PCV2
PCV3
PCV2/3
Negative
46
10
3
13
20
56.5
46
10
–
13
23
50.0
46
–
3
13
30
34.8
46
10
–
13
23
50.0
46
–
3
13
30
34.8
a PCV3 DNAs were detected by mqPCR from 15 of 29 piglet tissue samples, and two of 17 fetal tissue samples, respectively.
or PCV3-positive (10 PCV2-positive, three PCV3 positive, and 13 PCV2 and PCV3 positive), and the results agreed with those of the monoplex qPCR assay (Table 4). PCV3 ORF2 DNAs were detected by mqPCR in 15 of 29 piglet tissue samples and in two of 17 fetal tissue samples. The coinfection rate of PCV3 with PCV2 was 28.3% (13/46) according to the mqPCR assay developed in this study. The detection rates of PCV2 and PCV3 by mqPCR were 50.0% (23/46) and 34.8% (16/46), and agreed with those of Olvera’s PCV2 qPCR method or Palinski’s PCV3 qPCR method, respectively (Table 4). These results demonstrated that mqPCR is applicable for the differential diagnosis of PCV2 and PCV3 in field samples, with high sensitivity and specificity. 4. Discussion PCV2 is one of the most devastating swine viral pathogens, causing PCVAD worldwide (Allan et al., 2012). Five PCV2 genotypes (PCV2a, 2b, 2c, 2d, and 2e) have been identified, of which PCV2a and PCV2b are the major genotypes associated with PCVAD worldwide (Gagnon et al., 2007; Olvera et al., 2007). The novel genotype PCV2d was first reported in Switzerland in 1999, and its incidence has subsequently increased in several countries (Grierson et al., 2004; Kwon et al., 2017a; Wang et al., 2009; Xiao et al., 2012). Moreover, PCV2d causes more severe clinical signs in pigs than the PCV2a and b strains (Grierson et al., 2004; Guo et al., 2010; Shiou et al., 2012). PCV3 has recently been identified in various clinical cases in the US, China, and Korea (Kwon et al., 2017b; Palinski et al., 2017; Phan et al., 2016). Infection with PCV3 may be associated with PDNS and reproductive failure (Palinski et al., 2017; Ku et al., 2017), cardiac and multi-systemic inflammation (Phan et al., 2016), and respiratory disease complex (Shen et al., 2017). Moreover, PCV3 prevalence is relatively high in the US (Palinski et al., 2017), China (Ku et al., 2017), and Korea (Kwon et al., 2017b), suggesting that PCV3 is already widely distributed on pig farms in these countries. Based on these findings, it is likely that single infection of PCV3 or coinfection of PCV2 and PCV3 could cause various diseases in pig populations, although the virus has not been isolated, and pathogenesis studies using isolated virus have not been conducted. A reliable diagnostic method is essential to simultaneously detect PCV2 and PCV3 in clinical samples for epidemiological and clinical studies, and to establish control strategies for PCV2 and PCV3 infection. Several qPCR assays have been reported to detect the PCV2 capsid gene (Brunborg et al., 2004; Chang et al., 2010; Olvera et al., 2004; Rovira et al., 2002; Zhao et al., 2010). Recently, two qPCR assays were developed to detect and quantify PCV3 DNA (Palinski et al., 2017; Wang et al., 2017). However, there is no specific single assay capable of
Fig. 1. Standard curves for each quantitative real-time PCR (qPCR) assay using standard plasmid DNA of PCV2 and/or PCV3 ORF2 genes. A and B, monoplex qPCR for PCV2 and PCV3; C, multiplex qPCR for PCV2 and PCV3. Each qPCR assay was performed using 10fold serial dilutions of viral DNA in triplicate. Serial 10-fold dilutions of viral DNA standard (from 5 × 106.0 to 100 copies) were plotted against the threshold cycle (Ct). The coefficient of determination (R2) and the equation of the regression curve (y) were calculated using CFX Manager Software (Bio-Rad).
Table 3 Intra- and inter-assay coefficient of variation of multiplex quantitative real-time PCR (mqPCR). Dilution (copies/μL)
High (106) Medium (104) Low (102)
Coefficient of variation (%) for PCVs Porcine circovirus 2
Porcine circovirus 3
Intra-assay
Inter-assay
Intra-assay
Inter-assay
0.78 0.14 0.61
3.16 2.60 1.92
0.52 0.13 0.94
2.86 2.71 2.23
PCV2 and 0.13% to 0.94% for PCV3, respectively. The inter-assay variability ranged from 1.92% to 3.16% for PCV2 and 2.23% to 2.86%, respectively (Table 3). 3.5. Clinical evaluation of mqPCR The mqPCR assay detected 26 of 46 clinical samples as PCV2- and/ 14
Journal of Virological Methods 250 (2017) 11–16
H.-R. Kim et al.
Appendix A. Supplementary data
differentiating infection by PCV2 and PCV3. Therefore, a rapid mqPCR assay for the differential detection of PCV2 and PCV3 in clinical samples was developed in this study. The monoplex qPCR assay with PCV2- or PCV3-specific primers/ probe successfully amplified the 99-bp PCV2 or 118-bp PCV3 capsid gene. Furthermore, the mqPCR assay with two sets of PCV2- and PCV3specific primers/probe simultaneously and differentially detected PCV2 and PCV3 DNA in a single reaction, with similar sensitivity to the corresponding monoplex qPCR assay (Supplemental Fig. 1 and Fig. 1). The LOD of the mqPCR assay for the PCV2 capsid gene was below 50 copies/reaction (Supplemental Fig. 1), which is comparable to that of previously reported qPCR assays, which ranged from 10 to 100 copies/ reaction (Brunborg et al., 2004; Chang et al., 2010). The LOD of the mqPCR assay for PCV3 capsid gene was also below 50 copies/reaction (Supplemental Fig. 1 and Fig. 1) and was similar to that found previously (Wang et al., 2017). Thus, the sensitivity of the mqPCR assay is sufficient to detect PCV2 and PCV3 in clinical samples, provided the viruses are present at more than 50 copies/sample. In 2017, PCV3 was first identified on Korean pig farms by our research team and further surveillance studies showed that PCV3 commonly circulates in a number of Korean pig farms (Kwon et al., 2017b). We collected 46 swine tissue samples from a PCV2 and PCV3-infected domestic pig farm to clinically evaluate the mqPCR assay. The singular infection rates of PCV2 and PCV3 were 21.7% (10/46) and 6.5% (3/ 46), respectively, while the co-infection rate of PCV3 with PCV2 was 28.3% (13/46) (Table 4). PCV3 DNAs were detected by mqPCR in respiratory diseased piglet tissue samples and aborted fetal tissue samples, suggesting that PCV3 infection is associated with respiratory disease and reproductive failure at the tested pig farm, as previously suggested (Ku et al., 2017; Palinski et al., 2017; Wang et al., 2017). These results demonstrated that mixed infections, as well as PCV2 and PCV3 singular infections, are common in the Korean pig population, and are consistent with previous reports from the US (Palinski et al., 2017), China (Ku et al., 2017; Wang et al., 2017), and Korea (Kwon et al., 2017a,b). Although animal experiments with PCV3 isolates have not been conducted, PCV3 has been identified as a potential pathogen associated with a variety of clinical symptoms that are similar to those of PCV2 infection, suggesting that singular infection of PCV3 and mixed infection of PCV3 and PCV2 play an etiological role in PCVAD. The mqPCR assay allows the detection of PCV2 or PCV3 in field samples with a sensitivity level comparable to those obtained with each monoplex qPCR, and also allow simultaneous and differential detection of both target viruses in a single reaction, which makes it less time- and cost-consuming. In view of the prevalence of co-infection of PCV2 and PCV3 in the field, the mqPCR will be valuable tool to diagnose and control PCV2 and PCV3 infection. In conclusion, the developed mqPCR assay for the differential detection and quantification of PCV2 and PCV3 DNA with high specificity, sensitivity, and reliability will be useful in epidemiological and etiological studies, as well as clinical diagnosis.
Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.jviromet.2017.09.021. References Allan, G., Krakowka, S., Ellis, J., Charreyre, C., 2012. Discovery and evolving history of two genetically related but phenotypically different viruses, porcine circoviruses 1 and 2. Virus Res. 64, 4–9. Broeders, S., Huber, I., Grohmann, L., Berben, G., Taverniers, I., Mazzara, M., Roosens, N., Morisset, D., 2014. Guidelines for validation of qualitative real-time PCR methods. Trends Food Sci. Technol. 37, 115–126. Brunborg, I.M., Moldal, T., Jonassen, C.M., 2004. Quantitation of porcine circovirus type 2 isolated from serum/plasma and tissue samples of healthy pigs and pigs with postweaning multisystemic wasting syndrome using a TaqMan-based real-time PCR. J. Virol. Methods 122, 171–178. Bustin, S.A., Benes, V., Garson, J.A., Hellemans, J., Huggett, J., Kubista, M., Mueller, R., Nolan, T., Pfaffl, M.W., Shipley, G.L., Vandesompele, J., Wittwer, C.T., 2009. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 55, 611–622. Chang, G.N., Hwang, J.F., Chen, J.T., Tsen, H.Y., Wang, J.J., 2010. Fast diagnosis and quantification for porcine circovirus type 2 (PCV-2) using real-time polymerase chain reaction. J. Microbiol. Immunol. Infect. 43, 85–92. Gagnon, C.A., Tremblay, D., Tijssen, P., Venne, M.H., Houde, A., Elahi, S.M., 2007. The emergence of porcine circovirus 2b genotype (PCV-2b) in swine in Canada. Can. Vet. J. 48, 811–819. Grierson, S.S., King, D.P., Wellenberg, G.J., Banks, M., 2004. Genome sequence analysis of 10 Dutch porcine circovirus type 2 (PCV-2) isolates from a PMWS case-control study. Res. Vet. Sci. 77, 265–268. Guo, L.J., Lu, Y.H., Wei, Y.W., Huang, L.P., Liu, C.M., 2010. Porcine circovirus type 2 (PCV2): genetic variation and newly emerging genotypes in China. Virol. J. 7, 1–12. Kalendar, R., Lee, D., Schulman, A.H., 2011. Java web tools for PCR, in silico PCR, and oligonucleotide assembly and analysis. Genomics 98, 137–144. Ku, X., Chen, F., Li, P., Wang, Y., Yu, X., Fan, S., Qian, P., Wu, M., He, Q., 2017. Identification and genetic characterization of porcine circovirus type 3 in China. Transbound. Emerg. Dis. 64, 703–708. Kwon, T., Lee, D.U., Yoo, S.J., Je, S.H., Shin, J.Y., Lyoo, Y.S., 2017a. Genotypic diversity of porcine circovirus type 2 (PCV2) and genotype shift to PCV2d in Korean pig population. Virus Res. 228, 24–29. Kwon, T., Yoo, S.J., Park, C.K., Lyoo, Y.S., 2017b. Prevalence of novel porcine circovirus 3 in Korean pig populations. Vet. Microbiol. 207, 178–180. Navarro, E., Serrano-Heras, G., Castañoa, M.J., Solera, J., 2015. Real-time PCR detection chemistry. Clin. Chim. Acta 439, 231–250. Olvera, A., Sibila, M., Calsamiglia, M., Segalés, J., Domingo, M., 2004. Comparison of porcine circovirus type 2 load in serum quantified by a real time PCR in postweaning multisystemic wasting syndrome and porcine dermatitis and nephropathy syndrome naturally affected pigs. J. Virol. Methods 117, 75–80. Olvera, A., Cortey, M., Segales, J., 2007. Molecular evolution of porcine circovirus type 2 genomes: phylogeny and clonality. Virology 357, 175–185. Opriessnig, T., Meng, X.J., Halbur, P.G., 2007. Porcine circovirus type 2 associated disease: update on current terminology, clinical manifestations, pathogenesis, diagnosis, and intervention strategies. J. Vet. Diagn. Invest. 19, 591–615. Palinski, R., Pineyro, P., Shang, P., Yuan, F., Guo, R., Fang, Y., Byers, E., Hause, B.M., 2017. A novel porcine circovirus distantly related to known circoviruses is associated with porcine dermatitis and nephropathy syndrome and reproductive failure. J. Virol. 91. Parida, M., Shukla, J., Sharma, S., Santhosh, S.R., Ravi, V., Mani, R., Thomas, M., Khare, S., Rai, A., Ratho, R.K., Pujari, S., Mishra, B., Rao, P.V.L., Vijayaraghavan, R., 2011. Development and evaluation of reverse transcription loop-mediated isothermal amplification assay for rapid and real-time detection of the swine-origin influenza A H1N1 virus. J. Mol. Diagn. 13, 100–107. Park, C.K., Lee, K.K., Kim, H.S., 2004. Genetic characterization of porcine circovirus 2 Korean isolates. Korean J. Vet. Res. 44, 571–579. Phan, T.G., Giannitti, F., Rossow, S., Marthaler, D., Knutson, T., Li, L., Deng, X., Resende, T., Vannucci, F., Delwart, E., 2016. Detection of a novel circovirus PCV3 in pigs with cardiac and multi-systemic inflammation. Virol. J. 13, 184. Rovira, A., Balasch, M., Segales, J., Garcia, L., Plana-Duran, J., Rosell, C., Ellerbrok, H., Mankertz, A., Domingo, M., 2002. Experimental inoculation of conventional pigs with porcine reproductive and respiratory syndrome virus and porcine circovirus 2. J. Virol. 76, 3232–3239. Segalés, J., 2012. Porcine circovirus type 2 (PCV2) infections: clinical signs, pathology and laboratory diagnosis. Virus Res. 164, 10–19. Shen, H., Liu, X., Zhang, P., Wang, L., Liu, Y., Zhang, L., Liang, P., Song, C., 2017. Genome characterization of a porcine circovirus type 3 in South China. Transbound. Emerg. Dis. 1–3. Shiou, M.T., Lin, C.N., Yang, C.Y., Su, G.S., Lin, C.F., Chang, T.C., 2012. Genotypic change and phylogenetic analysis of porcine circovirus type 2 in Taiwanese pig herds. J. Vet. Med. Sci. 74, 1303–1310. Tischer, I., Gelderblom, H., Vettermann, W., Koch, M.A., 1982. A very small porcine virus with circular single-stranded DNA. Nature 295, 64–66. Wang, F., Guo, X., Ge, X., Wang, Z., Chen, Y., Cha, Z., Yang, H., 2009. Genetic variation analysis of Chinese strains of porcine circovirus type 2. Virus Res. 145, 151–156. Wang, J., Zhang, Y., Wang, J., Liu, L., Pang, X., Yuan, W., 2017. Development of a
Conflicts of interest statement The authors declare that they have no competing interests.
Acknowledgments This research was supported by the Golden Seed Project [Project No. PJ01281801 and 213010051SB610], Next-Generation BioGreen 21 Program [Project No. PJ01181601], and Research of Animal and Plant Quarantine Agency [Project No. Z-1543082-2017-18-01], Rural Development Administration (RDA), Ministry of Agriculture, Food and Rural Affairs (MAFRA), Republic of Korea.
15
Journal of Virological Methods 250 (2017) 11–16
H.-R. Kim et al.
States. J. Virol. 86, 12469. Zhao, K., Han, F., Zou, Y., Zhu, L., Li, C., Xu, Y., Zhang, C., Tan, F., Wang, J., Tao, S., He, X., Zhou, Z., Tang, X., 2010. Rapid detection of porcine circovirus type 2 using a TaqMan-based real-time PCR. Virol. J. 7, 374.
TaqMan-based real-time PCR assay for the specific detection of porcine circovirus 3. J. Virol. Methods 248, 177–180. Xiao, C.T., Halbur, P.G., Opriessnig, T., 2012. Complete genome sequence of a novel porcine circovirus type 2b variant present in cases of vaccine failures in the United
16
Contents lists available at ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
Multiplex real-time polymerase chain reaction for the differential detection of porcine circovirus 2 and 3
MARK
Hye-Ryung Kima, Yu-Ri Parka, Da-Rae Lima, Min-Ji Parka, Ji-Young Parkb, Seong-Hee Kimb, ⁎ Kyoung-Ki Leeb, Young S. Lyooc, Choi-Kyu Parka, a b c
College of Veterinary Medicine & Animal Disease Intervention Center, Kyungpook National University, Daegu 41566, Republic of Korea Animal Disease Diagnostic Division, Animal and Plant Quarantine Agency, Gimcheon 39660, Republic of Korea College of Veterinary Medicine Konkuk University, Seoul 05029, Republic of Korea
A R T I C L E I N F O
A B S T R A C T
Keywords: Porcine circovirus 2 PCV3 Capsid gene Multiplex Real-time PCR
A multiplex quantitative real-time polymerase chain reaction (mqPCR) assay was developed for the rapid and differential detection of porcine circovirus 2 (PCV2) and PCV3. Each of the capsid genes of PCV2 and PCV3 were amplified using specific primers and probe sets, while no other porcine pathogen genes were detected. Limit of detection of the assay was below 50 copies of the target genes of PCV2 and PCV3, and was comparable to that of previously described methods The assay showed high repeatability and reproducibility, with coefficients of intra-assay and inter-assay variation of less than 4.0%. Clinical evaluation using tissue samples from a domestic pig farm showed that PCV2 and PCV3 co-circulated at the farm. Moreover, singular infection rates of PCV2 or PCV3 were 21.7% (10/46) or 6.5% (3/46), respectively, while the co-infection rate of PCV3 with PCV2 was 28.3% (13/46). PCV3 DNA was detected by the mqPCR in respiratory diseased piglet tissue samples and aborted fetal tissue samples, suggesting that PCV3 infection is associated with porcine respiratory disease and reproductive failure in the pig farm. This mqPCR method is a rapid and reliable differential diagnostic tool for the monitoring and surveillance of PCV2 and PCV3 in the field.
1. Introduction Porcine circovirus (PCV), which belongs to the genus Circovirus of the family Circoviridae, is a non-enveloped, spherical, single-stranded DNA virus (Tischer et al., 1982). Before 2016, two types of PCV were reported to infect pigs: PCV1 and PCV2 (Allan et al., 2012). PCV1 was initially discovered in 1974 as a permanent contaminant of continuous cell culture PK-15 and was considered non-pathogenic (Tischer et al., 1982). In contrast, PCV2 was first identified from post-weaning multisystemic wasting syndrome-affected pigs in Canada in the early 1990s. PCV2 is now considered a major pathogen of porcine circovirus associated disease (PCVAD), which is characterized by several clinical conditions, including post-weaning multi-systemic wasting syndrome, porcine dermatitis and nephropathy syndrome (PDNS), reproductive disorders, enteritis, proliferative and necrotizing pneumonia, and porcine respiratory disease complex (Opriessnig et al., 2007; Segalés, 2012). Recently, a novel porcine circovirus, designated as PCV3, was identified in pigs with PDNS, reproductive failure, and cardiac and
multi-systemic inflammation in the US and China (Palinski et al., 2017; Phan et al., 2016). More recently, PCV3 was identified in pen-based oral fluid samples from Korean pig farms (Kwon et al., 2017b). Based on additional prevalence studies, PCV3 was suggested to commonly circulate within pig populations in the US, China, and Korea (Ku et al., 2017; Kwon et al., 2017b; Palinski et al., 2017) and that the new circovirus might cause clinical disease on swine farms. The clinical presentations of PCV3 are similar to those of PCV2 and to coinfection with PCV2 and PCV3 in pig populations in the US, China, and Korea; therefore, a rapid and reliable diagnostic assay is needed for the differential detection of PCV2 and PCV3 in the field (Ku et al., 2017; Kwon et al., 2017b; Palinski et al., 2017). However, there is no specific single assay capable of differentiating PCV2 infection from PCV3 infection. Such an assay would enable the accurate diagnosis of suspected clinical cases and encourage further epidemiological studies for its control. Therefore, in the present study, we developed and evaluated a rapid multiplex quantitative real-time polymerase chain reaction (mqPCR) assay using primer sets capable of detecting and typing PCV2 and PCV3 in clinical samples.
⁎ Corresponding author at: College of Veterinary Medicine & Animal Disease Intervention Center, Kyungpook National University, 80 Daehak-ro, Bukgu, Daegu 41566, Republic of Korea. E-mail address: [email protected] (C.-K. Park).
http://dx.doi.org/10.1016/j.jviromet.2017.09.021 Received 17 August 2017; Received in revised form 19 September 2017; Accepted 19 September 2017 Available online 21 September 2017 0166-0934/ © 2017 Elsevier B.V. All rights reserved.
Journal of Virological Methods 250 (2017) 11–16
H.-R. Kim et al.
PCV3 isolate (PCK3-1701 strain, GenBank accession number MF611876.1) using a pair of specific primers (forward, 5′- ATG ACGTATCCAAGGAGGCG-3′ and reverse, 5′-TTAGGGTTTAAGTGGGGGG TC-3′ for PCV2, or forward, 5′-TGAGACA CAG AGCTATATTC-3′ and reverse, 5′-TTCACTTAGAGAACGGACTT-3′ for PCV3, respectively). PCR was carried out using a commercial kit (Excel TB 2X Taq premix; Inclone, Korea) in 25-μL reaction mixtures containing 12.5 μL of 2 × premix, 0.4 μM of each primer, and 5 μL of PCV2 or PCV3 DNA as template, according to the manufacturer’s instructions. Amplification was carried out using a thermal cycler (Applied Biosystems, USA) under the following conditions: initial denaturation at 94 °C for 5 min; 35 cycles at 94 °C for 30 s, 55 °C for 30 s, 72 °C for 1 min; and a final extension at 72 °C for 10 min. Each amplified product was purified and cloned into the pTOP TA V2 vector (TOPcloner™ TA core Kit; Enzynomics, Korea), which was transformed into Escherichia coli competent cells according to the manufacturer’s instructions (DH5α Chemically Competent E. coli; Enzynomics, Korea). Plasmids containing the PCV2 or PCV3 capsid gene were purified using a commercial kit (GeneAll Expin™ Combo GP 200 miniprep kit, GeneAll, Seoul, Korea). The concentrations of each plasmid sample were determined by measuring the absorbance at 260 nm using a NanoDrop Lite (Thermo Scientific, Waltham, MA, USA), and the copy numbers of each cloned gene were quantified as previously described: copies/μL = concentration of plasmid (g/μL)/[(plasmid length × 660) × (6.022 × 1023)] (Parida et al., 2011). Ten-fold dilutions of the standard PCV2 or PCV3 DNA sample (from 106 to 100 copies/μL) were stored at −80 °C and used as standards for PCV2 or PCV3 quantitation of diagnostic samples.
Table 1 Specificity of, multiplex quantitative real-time PCR using PCV2 or PCV3-specific primers and probe set. Pathogen
Sourcea
Strain
Porcine circovirus 1 Porcine circovirus 2 Porcine circovirus 3 PRRS virus, genotype 1 PRRS virus, genotype 2 Classical swine fever virus Porcine parvovirus ST cell PK-15 cell
Amplification of target gene PCV2 (FAM)
PCV3 (ROX)
Field strain PCK0201 Field strain Lelystad virus LMY strain LOM strain
ADIC ADIC ADIC APQA APQA APQA
– + – – – –
– – + – – –
NADL-2 – –
APQA ADIC ADIC
– – –
– – –
a APQA, Animal and Plant Quarantine Agency, Korea; ADIC, Animal Disease Intervention Center, Kyungpook National University, Korea.
2. Materials and methods 2.1. Viruses and samples A PCV2 Korean field isolate (PCK0201 strain) (Park et al., 2004) and a PCV3-positive clinical sample were used to optimize the mqPCR conditions. The PCV3-positive tissue sample was collected from a PCV3infected pig farm and confirmed as PCV3-positive using a previously described qPCR assay (Palinski et al., 2017). Other porcine viral pathogens, including PCV1 (positive PK-15 cell culture), type 1 porcine reproductive and respiratory syndrome virus (PRRSV, Lelystad virus), type 2 PRRSV (LMY strain), classical swine fever virus (LOM strain), and porcine parvovirus (NADL-2 strain) were obtained from the Animal and Plant Quarantine Agency or Animal Disease Intervention Center for the assay’s specificity test (Table 1). All pathogen samples were allocated and stored at −80 °C until use. For clinical evaluation of the mqPCR, 46 tissue samples (17 aborted fetuses and 29 respiratory diseased piglets) were collected from a PCV2 and PCV3-infected pig farm located in Kyungpook province, in the southern part of Korea, where PCV2 was endemically infected and regularly vaccinated with commercial PCV2 vaccine in the sow and piglet groups, and PCV3 infection was confirmed early in 2017 by qPCR, as previously described (Palinski et al., 2017). The tissue samples were homogenized and diluted 10-fold with phosphate-buffered saline (0.1 M, pH 7.4). All samples were frozen and thawed twice, vortexed for 5 min, and centrifuged at 10,000 × g (Hanil, Korea) for 10 min at 4 °C. The supernatants were used for DNA extraction immediately or stored at −80 °C until use.
2.3. Primers and probes for mqPCR For the differential detection of PCV2 and PCV3, two sets of primers and probes were used for mqPCR. Primers and probes for PCV2 were used as described in a previous report (Olvera et al., 2004), with some base modifications to reflect the genetic variation of the target gene sequences among the different genotypes of PCV2 strains in Korea (Kwon et al., 2017a). Two qPCR assays have been developed to detect and quantify PCV3 DNA in previous studies (Palinski et al., 2017; Wang et al., 2017). These qPCR assays used a primers/probe set designed based on a limited number of US and Chinese PCV3 sequences that were available in GenBank when the assay was developed. In this study, primers and the probe for PCV3 were newly designed using Primer Express software (version 3.0) (Applied Biosystems, USA) based on a total of 32 PCV3 genome sequences, including five US, 16 Chinese, 9 Korean, and two Brazilian strains, available in National Center for Biotechnology Information (NCBI). To facilitate the establishment of multiplex qPCR, the sequences of the primers/probe for PCV3 were carefully selected so that their melting temperatures were similar to those of the PCV2 primers and probe. The lengths of amplicons for PCV2 and PCV3 were 99 and 118 base pairs (bp), respectively (Table 2). A BLAST search (http://blast.ncbi.nlm.nih.gov/Blast.cgi) was performed to check the specificity of the primers and probe. Each
2.2. Reference gene construction The complete capsid gene of PCV2 or PCV3 was amplified by PCR from a Korean field isolate (PCK0201 strain) (Park et al., 2004) or a Table 2 Primers and probes used in this study. Virus
Primer/Probe
Sequence (5′−3′)a
Positionb
Tm (°C)
Amplicon (bp)
Reference
PCV3
PCV3F PCV3R PCV3P
CGGTGGGGTCATATGTGTTG CACAGCCGTTACTTCACC ROX-CTTTGTCCTGGGTGAGCGCTGGTAG-BHQ2
1443–1462 1543–1560 1496–1520
62.5 60 69.6
118
In this study
PCV2
PCV2F PCV2R PCV2P
CCAGGAGGGCGTTSTGACT CGYTACCGYTGGAGAAGGAA FAM-AATGGCATCTTCAACACCCGCCTCT-TAMRA
1535–1553 1614–1633 1612–1592
61.3 58.3 68.0
99
Olvera et al. (2004), modified
a
Bold text in sequences of PCV2F and PCV2R primers represent a degenerative base: S, C or G; Y, C or T, respectively. Genome position of primer- and probe-binding sequences according to the complete genome sequence of PCV2 KU-1601 strain and PCV3 29160 strain (GenBank accession no. KX828228.1 and NC-031753.1, respectively). b
12
Journal of Virological Methods 250 (2017) 11–16
H.-R. Kim et al.
viral standard gene tested. The concentrations of capsid genes of PCV2 and PCV3 were 106, 104, and 102 copies/μL. For intra-assay variability, each dilution was analyzed in triplicate on the same day, while for inter-assay variability, each dilution was analyzed in six independent experiments performed by two different operators on different days in accordance with MIQE guidelines (Bustin et al., 2009). The coefficient of variation for the Ct values was determined based on the intra-assay or inter-assay results.
primer and probe sequence for PCV2 or PCV3 used in this study showed 100% homology with the corresponding sequences of the virus. In addition, we evaluated the specificity of the qPCR assay using each primers/probe set in silico using FastPCR software, version 5.4 (PrimerDigital Ltd., Finland), following the developer’s instructions (Kalendar et al., 2011). The predictive success rate of the pPCR with each primers/probe sets was 99.4% (1870/1882) for PCV2 and 100% (32/32) for PCV3 with the complete gene available in NCBI, respectively, showing that the qPCR assay with the selected primers/probe sets is highly specific and can applied to detect PCV2 and PCV3. For accurate differential detection of PCV2 and PCV3 by mqPCR it is essential that the sequence-specific probes are labeled with reporter dyes whose fluorescence spectra are distinct or show only minimal overlap (Navarro et al., 2015). In this study, for the simultaneous and differential detection of the capsid genes of PCV2 and PCV3 in a single reaction, probes for the capsid genes were labeled differently at the 5′ and 3′ ends with 6-carboxyfluorescein (FAM) and 6-carboxytetramethylrhodamine (TAMRA) for PCV2, and 6-carboxy-X-rhodamine (ROX) and Black Hole Quencher 2 (BHQ2) for PCV3, according to the manufacturer’s guidelines (Bioneer, Daejeon, Korea) (Table 2).
2.7. Clinical evaluation of mqPCR Evaluation of field samples was performed by mqPCR using the clinical samples described in Section 2.1 (Table 4). For clinical samples, monoplex qPCR and mqPCR were performed as described in Sections 2.3 and 2.4 using DNAs extracted from the samples and compared with the results of previously reported qPCR assays for PCV2 (Olvera et al., 2004) and PCV3 (Palinski et al., 2017) using a commercial qPCR kit (Premix Ex Taq™ Probe qPCR, Takara, Shiga, Japan) and CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). 3. Results
2.4. mqPCR conditions 3.1. Interpretation of mqPCR Before optimization of the mqPCR, a monoplex qPCR assay with each PCV2 or PCV3 primer and probe set was carried out using a commercial qPCR kit (Premix Ex Taq™ Probe qPCR, Takara, Shiga, Japan) and CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). The 25-μL reaction mixture contained 12.5 μL of 2 × Premix Ex Taq buffer with enzyme, 0.4 μM of each primer and probe, and 5 μL of cloned PCV2 or PCV3 DNA (106 copies/μL), and was prepared according to the manufacturer’s instructions. To optimize the mqPCR conditions, the concentrations of the two sets of primers and probe were optimized, while other reaction components were the same as those used for monoplex qPCR. The monoplex qPCR and mqPCR programs were the same and comprised 3 min at 95 °C for initial denaturation, followed by 40 cycles of 95 °C for 10 s and 60 °C for 30 s for amplification. FAM and ROX fluorescence signals were obtained at the end of each annealing step. To interpret the monoplex and mqPCR results, samples producing a cycle threshold (Ct) of less than 37 were considered positive, while those with a higher Ct value (> 37) were considered negative, according to previously described guidelines (Broeders et al., 2014).
The fluorescent signals of FAM or ROX were detected for PCV2 or PCV3 using monoplex qPCR, respectively (Supplemental Fig. 1A and B). For the simultaneous and differential detection of ORF2 genes of PCV2 and PCV3 in a single reaction tube, two sets of primers and probes for mqPCR were used with the same PCR conditions in a multiplex format (Supplemental Fig. 1C). The results of mqPCR using the optimized primer concentration (0.4 μM of each primer and 0.4 μM of each probe for PCV2 and PCV3, respectively) showed that two fluorescent signals of FAM and ROX could be detected simultaneously by the mqPCR assay (Supplemental Fig. 1C). These results demonstrated that mqPCR could successfully amplify the two target genes of PCV and PCV3 in a single reaction without spurious amplification or significant crosstalk between the two fluorescent reporter dyes. 3.2. Specificity of mqPCR The PCV2 and PCV3 primer and probe sets detected the DNA of their respective virus only. No positive results were obtained for any of the other swine pathogens and two swine-origin cell cultures (Table 1). As expected, capsid genes of PCV2 and PCV3 were co-amplified from a mixed sample of PCV2 and PCV3 (Supplemental Fig. 1C). The results indicated that the mqPCR assay is specific for the simultaneous and differential detection of PCV2 and PCV3.
2.5. Specificity and sensitivity of mqPCR To test the specificity of the mqPCR assay, the assay was performed with total nucleic acids extracted from seven viral samples (PCV1, PCV2, PCV3, type 1 and 2 PRRSV, classical swine fever virus, and porcine parvovirus) and two PCV3 non-infected porcine-origin cell cultures (ST cell and PK-15 cell) as negative controls. Assay sensitivities (mqPCR and its corresponding monoplex assay for PCV2 and PCV3) were determined in triplicate using serial dilutions (from 106 to 100 copies/μL) of each plasmid DNA containing the entire PCV2 or PCV3 capsid gene. For data analysis, CFX96 Touch™ Real-Time PCR Detection software (Bio-Rad) was used to create a standard curve with the threshold cycle (Ct) values of the 10-fold dilutions PCV2 or PCV3 capsid DNA (from 106 to 100 copies/μL). The detection software also calculated the correlation coefficient (R2) of the standard curve, the standard deviations of the results, and the PCV2 or PCV3 DNA copy number of the samples based on the standard curve.
3.3. Sensitivity of mqPCR In terms of capsid gene copy number, the limits of detection (LODs) of mqPCR were below 50 gene copies for PCV2 and PCV3, which were similar to that of each monoplex qPCR (Fig. 1 and Supplemental Fig. 1). To determine the linearity of the reaction and PCR efficiency, standard curves for the target genes were generated by plotting their Ct numbers versus their dilution factors. High correlation values (R2 > 0.99) between the Ct values and the dilution factors were calculated for the monoplex qPCR and mqPCR assays (Fig. 1). 3.4. Precision of mqPCR To assess the intra-assay repeatability and inter-assay reproducibility, three different concentrations (high, medium, and low) of each standard DNA were tested in triplicate in six different runs performed by two distinct operators on different days. The coefficients of variation within runs (intra-assay variability) ranged from 0.14% to 0.78% for
2.6. Precision of mqPCR Repeatability (intra-assay precision) and reproducibility (interassay precision) of the mqPCR assay for PCV2 or PCV3 was determined using three different concentrations (high, medium, and low) of each 13
Journal of Virological Methods 250 (2017) 11–16
H.-R. Kim et al.
Table 4 Comparison of diagnostic results for clinical samples by multiplex quantitative real-time PCR (mqPCR) and previously reported qPCR assays for PCV2 and PCV3. Method
mqPCR (PCV2/3) Monoplex qPCR (PCV2) Monoplex qPCR (PCV3) Olvera’s qPCR (PCV2) Palinski’s qPCR (PCV3)
No. tested
Results of different methodsa
Detection rate (%)
PCV2
PCV3
PCV2/3
Negative
46
10
3
13
20
56.5
46
10
–
13
23
50.0
46
–
3
13
30
34.8
46
10
–
13
23
50.0
46
–
3
13
30
34.8
a PCV3 DNAs were detected by mqPCR from 15 of 29 piglet tissue samples, and two of 17 fetal tissue samples, respectively.
or PCV3-positive (10 PCV2-positive, three PCV3 positive, and 13 PCV2 and PCV3 positive), and the results agreed with those of the monoplex qPCR assay (Table 4). PCV3 ORF2 DNAs were detected by mqPCR in 15 of 29 piglet tissue samples and in two of 17 fetal tissue samples. The coinfection rate of PCV3 with PCV2 was 28.3% (13/46) according to the mqPCR assay developed in this study. The detection rates of PCV2 and PCV3 by mqPCR were 50.0% (23/46) and 34.8% (16/46), and agreed with those of Olvera’s PCV2 qPCR method or Palinski’s PCV3 qPCR method, respectively (Table 4). These results demonstrated that mqPCR is applicable for the differential diagnosis of PCV2 and PCV3 in field samples, with high sensitivity and specificity. 4. Discussion PCV2 is one of the most devastating swine viral pathogens, causing PCVAD worldwide (Allan et al., 2012). Five PCV2 genotypes (PCV2a, 2b, 2c, 2d, and 2e) have been identified, of which PCV2a and PCV2b are the major genotypes associated with PCVAD worldwide (Gagnon et al., 2007; Olvera et al., 2007). The novel genotype PCV2d was first reported in Switzerland in 1999, and its incidence has subsequently increased in several countries (Grierson et al., 2004; Kwon et al., 2017a; Wang et al., 2009; Xiao et al., 2012). Moreover, PCV2d causes more severe clinical signs in pigs than the PCV2a and b strains (Grierson et al., 2004; Guo et al., 2010; Shiou et al., 2012). PCV3 has recently been identified in various clinical cases in the US, China, and Korea (Kwon et al., 2017b; Palinski et al., 2017; Phan et al., 2016). Infection with PCV3 may be associated with PDNS and reproductive failure (Palinski et al., 2017; Ku et al., 2017), cardiac and multi-systemic inflammation (Phan et al., 2016), and respiratory disease complex (Shen et al., 2017). Moreover, PCV3 prevalence is relatively high in the US (Palinski et al., 2017), China (Ku et al., 2017), and Korea (Kwon et al., 2017b), suggesting that PCV3 is already widely distributed on pig farms in these countries. Based on these findings, it is likely that single infection of PCV3 or coinfection of PCV2 and PCV3 could cause various diseases in pig populations, although the virus has not been isolated, and pathogenesis studies using isolated virus have not been conducted. A reliable diagnostic method is essential to simultaneously detect PCV2 and PCV3 in clinical samples for epidemiological and clinical studies, and to establish control strategies for PCV2 and PCV3 infection. Several qPCR assays have been reported to detect the PCV2 capsid gene (Brunborg et al., 2004; Chang et al., 2010; Olvera et al., 2004; Rovira et al., 2002; Zhao et al., 2010). Recently, two qPCR assays were developed to detect and quantify PCV3 DNA (Palinski et al., 2017; Wang et al., 2017). However, there is no specific single assay capable of
Fig. 1. Standard curves for each quantitative real-time PCR (qPCR) assay using standard plasmid DNA of PCV2 and/or PCV3 ORF2 genes. A and B, monoplex qPCR for PCV2 and PCV3; C, multiplex qPCR for PCV2 and PCV3. Each qPCR assay was performed using 10fold serial dilutions of viral DNA in triplicate. Serial 10-fold dilutions of viral DNA standard (from 5 × 106.0 to 100 copies) were plotted against the threshold cycle (Ct). The coefficient of determination (R2) and the equation of the regression curve (y) were calculated using CFX Manager Software (Bio-Rad).
Table 3 Intra- and inter-assay coefficient of variation of multiplex quantitative real-time PCR (mqPCR). Dilution (copies/μL)
High (106) Medium (104) Low (102)
Coefficient of variation (%) for PCVs Porcine circovirus 2
Porcine circovirus 3
Intra-assay
Inter-assay
Intra-assay
Inter-assay
0.78 0.14 0.61
3.16 2.60 1.92
0.52 0.13 0.94
2.86 2.71 2.23
PCV2 and 0.13% to 0.94% for PCV3, respectively. The inter-assay variability ranged from 1.92% to 3.16% for PCV2 and 2.23% to 2.86%, respectively (Table 3). 3.5. Clinical evaluation of mqPCR The mqPCR assay detected 26 of 46 clinical samples as PCV2- and/ 14
Journal of Virological Methods 250 (2017) 11–16
H.-R. Kim et al.
Appendix A. Supplementary data
differentiating infection by PCV2 and PCV3. Therefore, a rapid mqPCR assay for the differential detection of PCV2 and PCV3 in clinical samples was developed in this study. The monoplex qPCR assay with PCV2- or PCV3-specific primers/ probe successfully amplified the 99-bp PCV2 or 118-bp PCV3 capsid gene. Furthermore, the mqPCR assay with two sets of PCV2- and PCV3specific primers/probe simultaneously and differentially detected PCV2 and PCV3 DNA in a single reaction, with similar sensitivity to the corresponding monoplex qPCR assay (Supplemental Fig. 1 and Fig. 1). The LOD of the mqPCR assay for the PCV2 capsid gene was below 50 copies/reaction (Supplemental Fig. 1), which is comparable to that of previously reported qPCR assays, which ranged from 10 to 100 copies/ reaction (Brunborg et al., 2004; Chang et al., 2010). The LOD of the mqPCR assay for PCV3 capsid gene was also below 50 copies/reaction (Supplemental Fig. 1 and Fig. 1) and was similar to that found previously (Wang et al., 2017). Thus, the sensitivity of the mqPCR assay is sufficient to detect PCV2 and PCV3 in clinical samples, provided the viruses are present at more than 50 copies/sample. In 2017, PCV3 was first identified on Korean pig farms by our research team and further surveillance studies showed that PCV3 commonly circulates in a number of Korean pig farms (Kwon et al., 2017b). We collected 46 swine tissue samples from a PCV2 and PCV3-infected domestic pig farm to clinically evaluate the mqPCR assay. The singular infection rates of PCV2 and PCV3 were 21.7% (10/46) and 6.5% (3/ 46), respectively, while the co-infection rate of PCV3 with PCV2 was 28.3% (13/46) (Table 4). PCV3 DNAs were detected by mqPCR in respiratory diseased piglet tissue samples and aborted fetal tissue samples, suggesting that PCV3 infection is associated with respiratory disease and reproductive failure at the tested pig farm, as previously suggested (Ku et al., 2017; Palinski et al., 2017; Wang et al., 2017). These results demonstrated that mixed infections, as well as PCV2 and PCV3 singular infections, are common in the Korean pig population, and are consistent with previous reports from the US (Palinski et al., 2017), China (Ku et al., 2017; Wang et al., 2017), and Korea (Kwon et al., 2017a,b). Although animal experiments with PCV3 isolates have not been conducted, PCV3 has been identified as a potential pathogen associated with a variety of clinical symptoms that are similar to those of PCV2 infection, suggesting that singular infection of PCV3 and mixed infection of PCV3 and PCV2 play an etiological role in PCVAD. The mqPCR assay allows the detection of PCV2 or PCV3 in field samples with a sensitivity level comparable to those obtained with each monoplex qPCR, and also allow simultaneous and differential detection of both target viruses in a single reaction, which makes it less time- and cost-consuming. In view of the prevalence of co-infection of PCV2 and PCV3 in the field, the mqPCR will be valuable tool to diagnose and control PCV2 and PCV3 infection. In conclusion, the developed mqPCR assay for the differential detection and quantification of PCV2 and PCV3 DNA with high specificity, sensitivity, and reliability will be useful in epidemiological and etiological studies, as well as clinical diagnosis.
Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.jviromet.2017.09.021. References Allan, G., Krakowka, S., Ellis, J., Charreyre, C., 2012. Discovery and evolving history of two genetically related but phenotypically different viruses, porcine circoviruses 1 and 2. Virus Res. 64, 4–9. Broeders, S., Huber, I., Grohmann, L., Berben, G., Taverniers, I., Mazzara, M., Roosens, N., Morisset, D., 2014. Guidelines for validation of qualitative real-time PCR methods. Trends Food Sci. Technol. 37, 115–126. Brunborg, I.M., Moldal, T., Jonassen, C.M., 2004. Quantitation of porcine circovirus type 2 isolated from serum/plasma and tissue samples of healthy pigs and pigs with postweaning multisystemic wasting syndrome using a TaqMan-based real-time PCR. J. Virol. Methods 122, 171–178. Bustin, S.A., Benes, V., Garson, J.A., Hellemans, J., Huggett, J., Kubista, M., Mueller, R., Nolan, T., Pfaffl, M.W., Shipley, G.L., Vandesompele, J., Wittwer, C.T., 2009. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 55, 611–622. Chang, G.N., Hwang, J.F., Chen, J.T., Tsen, H.Y., Wang, J.J., 2010. Fast diagnosis and quantification for porcine circovirus type 2 (PCV-2) using real-time polymerase chain reaction. J. Microbiol. Immunol. Infect. 43, 85–92. Gagnon, C.A., Tremblay, D., Tijssen, P., Venne, M.H., Houde, A., Elahi, S.M., 2007. The emergence of porcine circovirus 2b genotype (PCV-2b) in swine in Canada. Can. Vet. J. 48, 811–819. Grierson, S.S., King, D.P., Wellenberg, G.J., Banks, M., 2004. Genome sequence analysis of 10 Dutch porcine circovirus type 2 (PCV-2) isolates from a PMWS case-control study. Res. Vet. Sci. 77, 265–268. Guo, L.J., Lu, Y.H., Wei, Y.W., Huang, L.P., Liu, C.M., 2010. Porcine circovirus type 2 (PCV2): genetic variation and newly emerging genotypes in China. Virol. J. 7, 1–12. Kalendar, R., Lee, D., Schulman, A.H., 2011. Java web tools for PCR, in silico PCR, and oligonucleotide assembly and analysis. Genomics 98, 137–144. Ku, X., Chen, F., Li, P., Wang, Y., Yu, X., Fan, S., Qian, P., Wu, M., He, Q., 2017. Identification and genetic characterization of porcine circovirus type 3 in China. Transbound. Emerg. Dis. 64, 703–708. Kwon, T., Lee, D.U., Yoo, S.J., Je, S.H., Shin, J.Y., Lyoo, Y.S., 2017a. Genotypic diversity of porcine circovirus type 2 (PCV2) and genotype shift to PCV2d in Korean pig population. Virus Res. 228, 24–29. Kwon, T., Yoo, S.J., Park, C.K., Lyoo, Y.S., 2017b. Prevalence of novel porcine circovirus 3 in Korean pig populations. Vet. Microbiol. 207, 178–180. Navarro, E., Serrano-Heras, G., Castañoa, M.J., Solera, J., 2015. Real-time PCR detection chemistry. Clin. Chim. Acta 439, 231–250. Olvera, A., Sibila, M., Calsamiglia, M., Segalés, J., Domingo, M., 2004. Comparison of porcine circovirus type 2 load in serum quantified by a real time PCR in postweaning multisystemic wasting syndrome and porcine dermatitis and nephropathy syndrome naturally affected pigs. J. Virol. Methods 117, 75–80. Olvera, A., Cortey, M., Segales, J., 2007. Molecular evolution of porcine circovirus type 2 genomes: phylogeny and clonality. Virology 357, 175–185. Opriessnig, T., Meng, X.J., Halbur, P.G., 2007. Porcine circovirus type 2 associated disease: update on current terminology, clinical manifestations, pathogenesis, diagnosis, and intervention strategies. J. Vet. Diagn. Invest. 19, 591–615. Palinski, R., Pineyro, P., Shang, P., Yuan, F., Guo, R., Fang, Y., Byers, E., Hause, B.M., 2017. A novel porcine circovirus distantly related to known circoviruses is associated with porcine dermatitis and nephropathy syndrome and reproductive failure. J. Virol. 91. Parida, M., Shukla, J., Sharma, S., Santhosh, S.R., Ravi, V., Mani, R., Thomas, M., Khare, S., Rai, A., Ratho, R.K., Pujari, S., Mishra, B., Rao, P.V.L., Vijayaraghavan, R., 2011. Development and evaluation of reverse transcription loop-mediated isothermal amplification assay for rapid and real-time detection of the swine-origin influenza A H1N1 virus. J. Mol. Diagn. 13, 100–107. Park, C.K., Lee, K.K., Kim, H.S., 2004. Genetic characterization of porcine circovirus 2 Korean isolates. Korean J. Vet. Res. 44, 571–579. Phan, T.G., Giannitti, F., Rossow, S., Marthaler, D., Knutson, T., Li, L., Deng, X., Resende, T., Vannucci, F., Delwart, E., 2016. Detection of a novel circovirus PCV3 in pigs with cardiac and multi-systemic inflammation. Virol. J. 13, 184. Rovira, A., Balasch, M., Segales, J., Garcia, L., Plana-Duran, J., Rosell, C., Ellerbrok, H., Mankertz, A., Domingo, M., 2002. Experimental inoculation of conventional pigs with porcine reproductive and respiratory syndrome virus and porcine circovirus 2. J. Virol. 76, 3232–3239. Segalés, J., 2012. Porcine circovirus type 2 (PCV2) infections: clinical signs, pathology and laboratory diagnosis. Virus Res. 164, 10–19. Shen, H., Liu, X., Zhang, P., Wang, L., Liu, Y., Zhang, L., Liang, P., Song, C., 2017. Genome characterization of a porcine circovirus type 3 in South China. Transbound. Emerg. Dis. 1–3. Shiou, M.T., Lin, C.N., Yang, C.Y., Su, G.S., Lin, C.F., Chang, T.C., 2012. Genotypic change and phylogenetic analysis of porcine circovirus type 2 in Taiwanese pig herds. J. Vet. Med. Sci. 74, 1303–1310. Tischer, I., Gelderblom, H., Vettermann, W., Koch, M.A., 1982. A very small porcine virus with circular single-stranded DNA. Nature 295, 64–66. Wang, F., Guo, X., Ge, X., Wang, Z., Chen, Y., Cha, Z., Yang, H., 2009. Genetic variation analysis of Chinese strains of porcine circovirus type 2. Virus Res. 145, 151–156. Wang, J., Zhang, Y., Wang, J., Liu, L., Pang, X., Yuan, W., 2017. Development of a
Conflicts of interest statement The authors declare that they have no competing interests.
Acknowledgments This research was supported by the Golden Seed Project [Project No. PJ01281801 and 213010051SB610], Next-Generation BioGreen 21 Program [Project No. PJ01181601], and Research of Animal and Plant Quarantine Agency [Project No. Z-1543082-2017-18-01], Rural Development Administration (RDA), Ministry of Agriculture, Food and Rural Affairs (MAFRA), Republic of Korea.
15
Journal of Virological Methods 250 (2017) 11–16
H.-R. Kim et al.
States. J. Virol. 86, 12469. Zhao, K., Han, F., Zou, Y., Zhu, L., Li, C., Xu, Y., Zhang, C., Tan, F., Wang, J., Tao, S., He, X., Zhou, Z., Tang, X., 2010. Rapid detection of porcine circovirus type 2 using a TaqMan-based real-time PCR. Virol. J. 7, 374.
TaqMan-based real-time PCR assay for the specific detection of porcine circovirus 3. J. Virol. Methods 248, 177–180. Xiao, C.T., Halbur, P.G., Opriessnig, T., 2012. Complete genome sequence of a novel porcine circovirus type 2b variant present in cases of vaccine failures in the United
16