- Email: [email protected]
Prolonged fecal excretion of hepatitis A virus in adult patients with hepatitis A as determined by polymerase chain reaction
Prolonged Fecal Excretion of Hepatitis A Virus in Adult Patients With Hepatitis A as Determined by Polymerase Chain Reaction HIROSHI YOTSUYANAGI,1 KAZUHIKO KOIKE,1 KIYOMI YASUDA,2 KYOJI MORIYA,1 YOSHIZUMI SHINTANI,1 HAJIME FUJIE,1 KIYOSHI KUROKAWA,1 AND SHIRO IINO2
the most sensitive method for the detection of nucleic acids.14 A recent report on an outbreak of hepatitis A in a neonatal intensive care unit reported the occurrence of prolonged excretion of HAV RNA in stool (as long as 6 months) much longer than previously reported.15 However, neonates may excrete HAV in stool for longer than adults because of their underdeveloped immunity.15 In the present study, we determined HAV RNA in stools from adult patients using the two-stage reverse-transcription (RT)-PCR method16 and found that fecal shedding of HAV continued for up to 3 months after onset of illness, and even after the normalization of the serum ALT levels.
In hepatitis A virus (HAV) infection, fecal excretion of the virus has been reported to cease shortly after symptoms occur. Although there have been several reports on detection of HAV in feces using polymerase chain reaction (PCR), the duration of fecal HAV shedding in human adult hepatitis A has not been well described. In the present study, we applied the reverse-transcription (RT)-PCR system to the detection of fecal HAV RNA in 10 patients with sporadic hepatitis A. The viral genomic RNA was detected in the stools from five patients after the onset of clinical symptoms. All stool samples collected within 10 days of onset of illness were HAV-RNA– positive, and the duration of positivity lasted from a few days to as long as 3 months. In four patients, HAV RNA was detected in the stool even after the serum alanine transaminase (ALT) levels had peaked, and in one patient well after ALT levels fell to normal. These results show that fecal shedding of HAV can last for months after resolution of symptoms and such patients could be a source of further spreading of the virus in the community. (HEPATOLOGY 1996;24:10-13.)
PATIENTS AND METHODS Patients and Stool Samples. We studied 10 patients with acute hepatitis A (men:women, 6:4; age, 37.2 { 12.0 years) admitted to the hospital who were found to be positive for immunoglobulin M antiHAV. All had been healthy with no history of liver disease before this illness, and none were immunosuppressed. None of the 10 had a history of travel to endemic areas for hepatitis A. Thirty-nine stool and 33 serum samples were collected 3 to 89 days after clinical onset. Stool samples from 2 patients with acute hepatitis B and 2 healthy subjects were used as negative controls. Hepatitis A virus particles of strain KRM 003 cultured in African green monkey kidney cells (obtained from Chemo-Sero-Therapeutic Research Institute, Kumamoto, Japan) were used as a positive control. Particle counts of HAV were shown in radioimmunofocus units. Viral Serology. Immunoglobulin M anti-HAV antibody and other viral markers, such as hepatitis B surface antigen or immunoglobulin M hepatitis B core antigen antibody, were detected using commercial kits (Dainabot, Tokyo, Japan). RNA Extraction and RT-PCR Method. RNA was extracted from sera as described previously.16 RNA pellets from 100 mL of sera were dissolved in 25 mL of distilled water and subjected to PCR. Stool RNA was extracted by the same method from 400 mL of 10% stool suspension in phosphate-buffered saline (pH 7.4). Reverse transcription and PCR were carried out as described previously.16 In brief, complementary DNA was synthesized with an external antisense primer (A3; AGCATGGAGCTGTAGGAGTC) in 30 mL of reaction mixture containing 200 mmol/L of each deoxynucleoside triphosphate, 11 PCR buffer (50 mmol/L KCl, 10 mmol/L TrisHCl [pH 8.3], 1.5 mmol/L MgCl2 , and 0.001% [wt/vol] gelatin) and 5 units of AMV reverse transcriptase (Boehringer Mannheim, Mannheim, Germany). After heat inactivation of the reverse transcriptase at 957C for 5 minutes, a sense primer (A1; TAGAGACAGCCCTGACAATC) was added to a final concentration of 1.0 mmol/L with 70 mL of 11 buffer and 2 units of Ampli-Taq (Perkin Elmer Cetus Corp., Norwalk, CT). Amplification was then performed in a thermal cycler for 30 cycles consisting of 947C for 1 minute, 627C for 2 minutes, and 727C for 1.5 minutes. A second amplification was performed in 100 mL of reaction mixture containing 2 mL of one of the amplified samples, 1 mmol/L of each of an internal antisense primer (A2; TCCACTCAATGCATCCACTG) and the sense primer (A1), 200 mmol/L of each deoxynucleoside triphosphate, 11 PCR buffer, and 2 units of AmpliTaq under the same conditions as used for the first amplification. Aliquots of the resulting samples were electrophoresed in 6% polyacrylamide gel and stained with ethidium bromide. Water and a sample from a healthy individual were used as negative controls.
Hepatitis A is still a serious disease, particularly in developing countries, where 20% to 25% of clinical hepatitis cases are caused by hepatitis A virus (HAV) infection. HAV spreads mainly by the fecal-oral route, and sporadic cases, as well as epidemics of HAV infection, have been reported.1 Defining the duration of fecal shedding of HAV is important for the control of this disease. Fecal shedding of HAV has been studied by several methods. Immunoelectron microscopy has disclosed that HAV antigen is detectable in the stool before the development of jaundice and peaking of serum alanine transaminase (ALT) levels.2-5 Fecal HAV antigen is detected for a slightly longer period during the course of hepatitis A by radio- or enzyme-immunoassay than by immunoelectron microscopy.6-10 Molecular hybridization to RNA, which is a more sensitive method for the detection of HAV RNA than radioimmunoassay, has also been applied to define the duration of fecal HAV excretion in human or experimental HAV infection.11-13 At present, the polymerase chain reaction (PCR) assay is
Abbreviations: HAV, hepatitis A virus; ALT, alanine transaminase; PCR, polymerase chain reaction; RT, reverse-transcription. From the 1First Department of Internal Medicine, University of Tokyo, Tokyo 113, Japan; and 2 Institute of Medical Science, St. Marianna University School of Medicine, Kawasaki 216, Japan. Received September 25, 1995; accepted March 1, 1996. Supported in part by grants-in-aid from the Ministry of Health and Welfare of Japan. Address reprint requests to: Kazuhiko Koike, M.D., First Department of Internal Medicine, Faculty of Medicine, University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113, Japan. Copyright q 1996 by the American Association for the Study of Liver Diseases. 0270-9139/96/2401-0002$3.00/0
10
AID
Hepa 0027
/
5P10$$$521
06-21-96 07:08:25
hpta
WBS: Hepatology
HEPATOLOGY Vol. 24, No. 1, 1996
YOTSUYANAGI ET AL.
FIG. 1. Detection of fecal HAV RNA by PCR. (A) Ethidium bromide staining of PCR products electrophoresed in 6% polyacrylamide gels. RNA extracted from stools of patients with hepatitis A (lanes 1-3), from stools of normal subjects (lanes 4 and 5), or from cultured HAV (lane 6) was reverse-transcribed and amplified by PCR. (B) Amplified products of 250 bp showed hybridization with a 19-base oligonucleotide probe specific for the HAV sequence.
To avoid contamination, all reagents were UV-irradiated and filter pipette tips (USA/Scientific Plastics, Ocala, FL) were used. Results were considered valid only if the same results were obtained in at least two separate experiments. Southern Blotting. Some of the products of the PCR reaction were separated in 2% agarose gel and transferred to a nylon membrane (Schleicher and Schuell, Dassel, Germany). The membrane was then hybridized with a 19-base oligonucleotide probe (A6; CACAAGGGGTAGGCTACGG), whose sequence is located between those of the A1 and A2 primers and which was labeled with digoxigenin (Boehringer Mannheim). RESULTS Specificity of PCR Products. We first conducted RT-PCR using tissue culture–derived HAV particles. Figure 1 shows results of electrophoresis of RT-PCR products of RNA samples from cultured HAV and from patients’ stools. The products amplified from the RNAs extracted from HAV particles and stools were both 250 bp in length, as expected (panel A, lanes 1, 2, 3, and 6). Southern blot analysis revealed specific hybridization of both RT-PCR products with a 20-base oligonucleotide probe (panel B). Sensitivity of RT-PCR. Substances normally found in stool can inhibit the PCR reaction.17 To clarify this issue and determine the sensitivity of our system for detection of RNA genomes in stool, we performed PCR with samples containing serially diluted preparations of HAV particles mixed with stool from a healthy subject. As shown in Fig. 2, HAV RNA was detectable from 10 HAV particles in 100 mL of phosphatebuffered saline without stool. Furthermore, the presence of stool inhibited the RT-PCR reaction, such that the lower limit of detection by the RT-PCR method increased from 10 particles/100 mL in the absence to 102 particles/100 mL in the presence of stool. This sensitivity was higher than that of the one-stage RT-PCR system that detected 103 HAV particles in 100 mL of reaction mixture.16 Detection of HAV RNA in Stools and Sera. We detected HAV RNA in the stools of 5 of 10 patients with hepatitis A
11
(50%, 2 men and 3 women) at least once during the clinical course of HAV infection. HAV RNA was also detectable in the sera of these 5 patients, in samples taken prior to or concurrent with the detection of HAV RNA in stool. In one case, HAV RNA was detected in serum but not stool. HAV RNA was not detected in the stools of any of the healthy subjects or patients with acute hepatitis B. We then investigated the timing and duration of the detection of HAV RNA in stool, defining the clinical onset of hepatitis A by the start of flu-like symptoms.12 As shown in Fig. 3, HAV RNA was detected in stool samples between days 3 and 89 after clinical onset. HAV RNA was found in all stool samples collected within 10 days of clinical onset. In two cases, fecal HAV RNA was detected more than 50 days after clinical onset (cases 2 and 4). The relationship between serum ALT levels and HAV-RNA positivity is shown in Fig. 4 for four patients whose stools were HAV-RNA–positive. In case 1, HAV RNA was detected in stool until day 18 after clinical onset but not on day 24 or thereafter. The patient in case 2 showed sustained elevated serum ALT levels for more than 3 months, during which his serum was HAV-RNA–positive on day 62 after clinical onset but negative on day 71 and thereafter. Nonetheless, his stool remained HAV-RNA–positive until day 89. In cases 3 and 4, intermittent shedding of HAV was observed. In case 3, HAV RNA was detected in stool on days 14, 18, and 30 after clinical onset, but not on day 25. In case 4, viremia was observed only when the serum ALT level was at its peak. ALT levels became normal on day 32, but HAV RNA was detected in stool from days 8 to 20, not on days 22 or 28, and again on days 34, 48, and 56. DISCUSSION
Fecal excretion of HAV during the course of hepatitis A has been examined using several methods. Using immunoelectron microscopy or radioimmunoassay, HAV antigen is detected for as long as 2 weeks after onset of hepatitis A during the peak of serum ALT levels.2-10 In neonates, fecal excretion of HAV RNA may continue for as long as 6 months.15 Duration of fecal excretion in adults may be shorter in view of the results of previous studies using radioimmunoassay or molecular hybridization techniques.11 Employing a RT-PCR method, we have detected HAV RNA in both serum and stool. In previous studies, we showed that hepatitis A viremia lasts for 2 to 7 days after clinical onset, which is longer than has been previously reported.16 In previous studies, HAV particles were captured onto a solid phase using a specific antibody prior to RNA extraction from stool,17,18 because substances in feces were reported to inhibit PCR.19 In the present study, we applied the two-stage RTPCR method for the detection of fecal HAV RNA using RNA prepared from a 10% stool–phosphate-buffered saline suspension. The presence of stool appeared to inhibit the PCR reaction, but the lower detection limit of the present method
FIG. 2. Sensitivity of RT-PCR HAV-RNA detection system. RNA was extracted from cultured HAV particles that were suspended in phosphate-buffered saline in the absence (panel A) or presence (panel B) of stool from a healthy subject. Using reverse transcription followed by two stages of 30 cycles of PCR, HAV RNA was detected in as few as 10 HAV particles in 100 mL of reaction mixture (panel A). Using a 10% stool suspension, the lower detection limit of the RT-PCR method increased, but HAV RNA from 102 HAV particles were still detected in 100 mL of reaction mixture (panel B).
AID
Hepa 0027
/
5P10$$$522
06-21-96 07:08:25
hpta
WBS: Hepatology
12
YOTSUYANAGI ET AL.
HEPATOLOGY July 1996
was still lower than that of the previously reported one-stage RT-PCR method.16 As shown in Fig. 3, all stool samples collected within 10 days from clinical onset were positive for HAV RNA, and some patients shed HAV into their stool for more than 1 month (up to 3 months). Our results show that (1) HAV was detected in the sera of approximately 50% of patients with hepatitis A after clinical onset, and (2) such cases were characterized by a longer duration of fecal excretion of HAV than that of HAV detection in serum. Hepatitis A is known to run a protracted clinical course in a small number of cases. In such cases, HAV antigen has been detected in the liver and stool.20,21 In the present study, patient 2 had abnormal ALT levels for more than 3 months. Although stool samples were not obtained in the early phase of the patient’s clinical course, stool was HAV-RNA–positive at 3 months after clinical onset, which was consistent with the findings reported previously.21 Interestingly, patient 4 shed HAV in stool for 2 months, well after his ALT levels had returned to normal. Moreover, this patient and patient 3 had intermittent fecal excretion of HAV, a pattern previously observed in chimpanzees.22 Therefore, HAV RNA might be detected for a longer period in patients with hepatitis A, if stool samples were collected later in the clinical course. Although hepatitis A is known to be a self-limiting disease, our results suggest that some patients with hepatitis A may have viral shedding into their stool even after normalization of their biochemical data. Such patients could be sources for
FIG. 4. Representative cases of patients with hepatitis A whose stools were HAV RNA–positive. In case 1, HAV RNA was detected in the patient’s stool until day 18 after clinical onset, but not on day 24 or thereafter. In case 2, the patient’s stool remained HAV-RNA–positive until day 89 with consistently elevated ALT levels. The patient in case 3 showed intermittent fecal shedding of the virus for about 30 days from clinical onset. The patient in case 4 also demonstrated intermittent fecal excretion of HAV RNA into his stool. In this patient, reappearance of shedding of HAV in stool occurred after serum ALT levels had become normal. Shaded areas indicate normal range of ALT levels. K.U., Karmen units.
secondary transmission of HAV in the community, although the infectivity of fecal HAV particles from such patients needs to be evaluated. A number of hepatitis A cases are sporadic, occurring as a result of casual person-to-person contact.1 Reported risk factors for HAV transmission during person-to-person contact are living in the same household with a patient with hepatitis A, homosexual activity, and close contact with young children.23 A report from a neonatal care unit suggests that deviation from infection-control procedures is associated with hepatitis A outbreaks among staff who are in close contact with neonates who shed HAV RNA for a long time.15 Our results suggest that HAV may be transmitted among members of the same household, hospitalized patients, and medical staff in the same manner. Careful attention to hygiene and sanitation is necessary even after patients with hepatitis A enter the recovery phase. Furthermore, these results indicate that hepatitis A prophylaxis including HAV vaccination is appropriate for all close contacts of patients, even when there are weeks of delay in identification or diagnosis. REFERENCES
FIG. 3. Relationship between HAV-RNA positivity and the number of days from clinical onset of hepatitis A. HAV RNA was detected in the stools and sera of 5 of 10 patients and in the serum only of 1 patient. j, HAV-RNA– positive sera; h, HAV-RNA–negative sera; ●, HAV-RNA–positive stools; s, HAV-RNA–negative stools.
AID
Hepa 0027
/
5P10$$$522
06-21-96 07:08:25
1. Sherlock S, Dooley J. Virus hepatitis. In: Sherlock S, Dooley J, eds. Diseases of the liver and biliary system. 9th ed. Oxford: Blackwell Scientific Publications, 1993:266-269. 2. Dienstag JL, Feinstone SM, Kapikian AZ, Purcell RH. Fecal shedding of hepatitis-A antigen. Lancet 1975;1:765-767. 3. Rakela J, Mosley JW. Fecal excretion of hepatitis A virus in humans. J Infect Dis 1977;135:933-938. 4. Flehmig B, Frank H, Frosner GG, Gerth HJ. Hepatitis A-virus particles in stools of patients from a natural hepatitis outbreak in Germany. Med Microbiol Immunol (Berl) 1977;163:209-214. 5. Locarnini SA, Gust ID, Ferris AA, Stott AC, Wong ML. A prospective study of acute viral hepatitis with particular reference to hepatitis A. Bull World Health Organ 1976;54:199-206. 6. Hall WT, Bradley DW, Madden DL, Zimmerman DH, Brandt DE. Comparison of sensitivity of radioimmunoassay and immune electron microscopy for detecting hepatitis A antigen in fecal extracts. Proc Soc Exp Biol Med 1977;155:193-198. 7. Fro¨sner GG, Overby LR, Flehmig B, Gerth HJ, Haas H, Decker RH, Ling CM, et al. Seroepidemiological investigation of patients and family contacts in an epidemic of hepatitis A. J Med Virol 1977;1:163-173.
hpta
WBS: Hepatology
HEPATOLOGY Vol. 24, No. 1, 1996
YOTSUYANAGI ET AL.
8. Coursaget P, Maupas P, Hibon P, Lesage G, Hubert M. Hepatitis A diagnosis in man: radioimmunoassay for hepatitis A antigen detection in faeces. J Med Virol 1980;6:53-60. 9. Coulepis AG, Locarnini SA, Lehmann NI, Gust ID. Detection of hepatitis A virus in the feces of patients with naturally acquired infections. J Infect Dis 1980;141:151-156. 10. Carl M, Kantor RJ, Webster HM, Fields HA, Maynard JE. Excretion of hepatitis A virus in the stools of hospitalized hepatitis patients. J Med Virol 1982;9:125-129. 11. Tassopoulos NC, Papaevangelos GJ, Ticehurst JR, Purcell RH. Fecal excretion of Greek strains of hepatitis A virus in patients with hepatitis A and in experimentally infected chimpanzees. J Infect Dis 1986;154:231237. 12. Stapleton JT, Lange DK, LeDuc JW, Binn LN, Jansen RW, Lemon SM. The role of secretory immunity in hepatitis A virus infection. J Infect Dis 1991;163:7-11. 13. Jansen RW, Newbold JE, Lemon SM. Combined immunoaffinity cDNARNA hybridization assay for detection of hepatitis A virus in clinical specimens. J Clin Microbiol 1985;22:984-989. 14. Tadeschi MV, Yoshida CF, Silva M, Feinstone SM. Detection of hepatitis A viral genome in stool samples of patients with relapsed hepatitis A by the polymerase chain reaction. Mem Inst Oswaldo Cruz 1989;84:429-433. 15. Rosenblum LS, Villarino ME, Nainan OV, Melish ME, Hadler SC, Pinsky PP, Jarvis WR, et al. Hepatitis A outbreak in a neonatal intensive care unit: risk factors for transmission and evidence of prolonged viral excretion among preterm infants. J Infect Dis 1991;164:476-482.
AID
Hepa 0027
/
5P10$$$522
06-21-96 07:08:25
13
16. Yotsuyanagi H, Iino S, Koike K, Yasuda K, Hino K, Kurokawa K. Duration of viremia in human hepatitis A viral infection as determined by polymerase chain reaction. J Med Virol 1993;40:35-38. 17. Jansen RW, Siegl G, Lemon SM. Molecular epidemiology of human hepatitis A virus defined by an antigen-capture polymerase chain method. Proc Natl Acad Sci U S A 1990;87:2867-2871. 18. Monceyron C, Grinde B. Detection of hepatitis A virus in clinical and environmental samples by immunomagnetic separation and PCR. J Virol Methods 1994;46:157-166. 19. Wilde J, Eiden J, Yolken R. Removal of inhibitory substances from human fecal specimens for detection of group A rotaviruses by reverse transcriptase and polymerase chain reactions. J Clin Microbiol 1990;28:13001307. 20. Fagan E, Yousef G, Brahm J, Garelick H, Mann G, Wolstenholme A, Portmann B, et al. Persistence of hepatitis A virus in fulminant hepatitis and after liver transplantation. J Med Virol 1990;30:131-136. 21. Sjo¨gren MH, Tanno H, Fay O, Sileoni S, Cohen BD, Burke DS, Feighny RJ. Hepatitis A virus in stool during clinical relapse. Ann Intern Med 1987;106:221-226. 22. Bradley DW, Gravelle CR, Cook EH, Fields RM, Maynard JE. Cyclic excretion of hepatitis A virus in experimentally infected chimpanzees: biophysical characterization of the associated HAV particles. J Med Virol 1977;1: 133-138. 23. Lemon SM. The natural history of hepatitis A: the potential for transmission of blood or blood products [Review]. Vox Sang 1994;67(suppl 4):1923.
hpta
WBS: Hepatology
the most sensitive method for the detection of nucleic acids.14 A recent report on an outbreak of hepatitis A in a neonatal intensive care unit reported the occurrence of prolonged excretion of HAV RNA in stool (as long as 6 months) much longer than previously reported.15 However, neonates may excrete HAV in stool for longer than adults because of their underdeveloped immunity.15 In the present study, we determined HAV RNA in stools from adult patients using the two-stage reverse-transcription (RT)-PCR method16 and found that fecal shedding of HAV continued for up to 3 months after onset of illness, and even after the normalization of the serum ALT levels.
In hepatitis A virus (HAV) infection, fecal excretion of the virus has been reported to cease shortly after symptoms occur. Although there have been several reports on detection of HAV in feces using polymerase chain reaction (PCR), the duration of fecal HAV shedding in human adult hepatitis A has not been well described. In the present study, we applied the reverse-transcription (RT)-PCR system to the detection of fecal HAV RNA in 10 patients with sporadic hepatitis A. The viral genomic RNA was detected in the stools from five patients after the onset of clinical symptoms. All stool samples collected within 10 days of onset of illness were HAV-RNA– positive, and the duration of positivity lasted from a few days to as long as 3 months. In four patients, HAV RNA was detected in the stool even after the serum alanine transaminase (ALT) levels had peaked, and in one patient well after ALT levels fell to normal. These results show that fecal shedding of HAV can last for months after resolution of symptoms and such patients could be a source of further spreading of the virus in the community. (HEPATOLOGY 1996;24:10-13.)
PATIENTS AND METHODS Patients and Stool Samples. We studied 10 patients with acute hepatitis A (men:women, 6:4; age, 37.2 { 12.0 years) admitted to the hospital who were found to be positive for immunoglobulin M antiHAV. All had been healthy with no history of liver disease before this illness, and none were immunosuppressed. None of the 10 had a history of travel to endemic areas for hepatitis A. Thirty-nine stool and 33 serum samples were collected 3 to 89 days after clinical onset. Stool samples from 2 patients with acute hepatitis B and 2 healthy subjects were used as negative controls. Hepatitis A virus particles of strain KRM 003 cultured in African green monkey kidney cells (obtained from Chemo-Sero-Therapeutic Research Institute, Kumamoto, Japan) were used as a positive control. Particle counts of HAV were shown in radioimmunofocus units. Viral Serology. Immunoglobulin M anti-HAV antibody and other viral markers, such as hepatitis B surface antigen or immunoglobulin M hepatitis B core antigen antibody, were detected using commercial kits (Dainabot, Tokyo, Japan). RNA Extraction and RT-PCR Method. RNA was extracted from sera as described previously.16 RNA pellets from 100 mL of sera were dissolved in 25 mL of distilled water and subjected to PCR. Stool RNA was extracted by the same method from 400 mL of 10% stool suspension in phosphate-buffered saline (pH 7.4). Reverse transcription and PCR were carried out as described previously.16 In brief, complementary DNA was synthesized with an external antisense primer (A3; AGCATGGAGCTGTAGGAGTC) in 30 mL of reaction mixture containing 200 mmol/L of each deoxynucleoside triphosphate, 11 PCR buffer (50 mmol/L KCl, 10 mmol/L TrisHCl [pH 8.3], 1.5 mmol/L MgCl2 , and 0.001% [wt/vol] gelatin) and 5 units of AMV reverse transcriptase (Boehringer Mannheim, Mannheim, Germany). After heat inactivation of the reverse transcriptase at 957C for 5 minutes, a sense primer (A1; TAGAGACAGCCCTGACAATC) was added to a final concentration of 1.0 mmol/L with 70 mL of 11 buffer and 2 units of Ampli-Taq (Perkin Elmer Cetus Corp., Norwalk, CT). Amplification was then performed in a thermal cycler for 30 cycles consisting of 947C for 1 minute, 627C for 2 minutes, and 727C for 1.5 minutes. A second amplification was performed in 100 mL of reaction mixture containing 2 mL of one of the amplified samples, 1 mmol/L of each of an internal antisense primer (A2; TCCACTCAATGCATCCACTG) and the sense primer (A1), 200 mmol/L of each deoxynucleoside triphosphate, 11 PCR buffer, and 2 units of AmpliTaq under the same conditions as used for the first amplification. Aliquots of the resulting samples were electrophoresed in 6% polyacrylamide gel and stained with ethidium bromide. Water and a sample from a healthy individual were used as negative controls.
Hepatitis A is still a serious disease, particularly in developing countries, where 20% to 25% of clinical hepatitis cases are caused by hepatitis A virus (HAV) infection. HAV spreads mainly by the fecal-oral route, and sporadic cases, as well as epidemics of HAV infection, have been reported.1 Defining the duration of fecal shedding of HAV is important for the control of this disease. Fecal shedding of HAV has been studied by several methods. Immunoelectron microscopy has disclosed that HAV antigen is detectable in the stool before the development of jaundice and peaking of serum alanine transaminase (ALT) levels.2-5 Fecal HAV antigen is detected for a slightly longer period during the course of hepatitis A by radio- or enzyme-immunoassay than by immunoelectron microscopy.6-10 Molecular hybridization to RNA, which is a more sensitive method for the detection of HAV RNA than radioimmunoassay, has also been applied to define the duration of fecal HAV excretion in human or experimental HAV infection.11-13 At present, the polymerase chain reaction (PCR) assay is
Abbreviations: HAV, hepatitis A virus; ALT, alanine transaminase; PCR, polymerase chain reaction; RT, reverse-transcription. From the 1First Department of Internal Medicine, University of Tokyo, Tokyo 113, Japan; and 2 Institute of Medical Science, St. Marianna University School of Medicine, Kawasaki 216, Japan. Received September 25, 1995; accepted March 1, 1996. Supported in part by grants-in-aid from the Ministry of Health and Welfare of Japan. Address reprint requests to: Kazuhiko Koike, M.D., First Department of Internal Medicine, Faculty of Medicine, University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113, Japan. Copyright q 1996 by the American Association for the Study of Liver Diseases. 0270-9139/96/2401-0002$3.00/0
10
AID
Hepa 0027
/
5P10$$$521
06-21-96 07:08:25
hpta
WBS: Hepatology
HEPATOLOGY Vol. 24, No. 1, 1996
YOTSUYANAGI ET AL.
FIG. 1. Detection of fecal HAV RNA by PCR. (A) Ethidium bromide staining of PCR products electrophoresed in 6% polyacrylamide gels. RNA extracted from stools of patients with hepatitis A (lanes 1-3), from stools of normal subjects (lanes 4 and 5), or from cultured HAV (lane 6) was reverse-transcribed and amplified by PCR. (B) Amplified products of 250 bp showed hybridization with a 19-base oligonucleotide probe specific for the HAV sequence.
To avoid contamination, all reagents were UV-irradiated and filter pipette tips (USA/Scientific Plastics, Ocala, FL) were used. Results were considered valid only if the same results were obtained in at least two separate experiments. Southern Blotting. Some of the products of the PCR reaction were separated in 2% agarose gel and transferred to a nylon membrane (Schleicher and Schuell, Dassel, Germany). The membrane was then hybridized with a 19-base oligonucleotide probe (A6; CACAAGGGGTAGGCTACGG), whose sequence is located between those of the A1 and A2 primers and which was labeled with digoxigenin (Boehringer Mannheim). RESULTS Specificity of PCR Products. We first conducted RT-PCR using tissue culture–derived HAV particles. Figure 1 shows results of electrophoresis of RT-PCR products of RNA samples from cultured HAV and from patients’ stools. The products amplified from the RNAs extracted from HAV particles and stools were both 250 bp in length, as expected (panel A, lanes 1, 2, 3, and 6). Southern blot analysis revealed specific hybridization of both RT-PCR products with a 20-base oligonucleotide probe (panel B). Sensitivity of RT-PCR. Substances normally found in stool can inhibit the PCR reaction.17 To clarify this issue and determine the sensitivity of our system for detection of RNA genomes in stool, we performed PCR with samples containing serially diluted preparations of HAV particles mixed with stool from a healthy subject. As shown in Fig. 2, HAV RNA was detectable from 10 HAV particles in 100 mL of phosphatebuffered saline without stool. Furthermore, the presence of stool inhibited the RT-PCR reaction, such that the lower limit of detection by the RT-PCR method increased from 10 particles/100 mL in the absence to 102 particles/100 mL in the presence of stool. This sensitivity was higher than that of the one-stage RT-PCR system that detected 103 HAV particles in 100 mL of reaction mixture.16 Detection of HAV RNA in Stools and Sera. We detected HAV RNA in the stools of 5 of 10 patients with hepatitis A
11
(50%, 2 men and 3 women) at least once during the clinical course of HAV infection. HAV RNA was also detectable in the sera of these 5 patients, in samples taken prior to or concurrent with the detection of HAV RNA in stool. In one case, HAV RNA was detected in serum but not stool. HAV RNA was not detected in the stools of any of the healthy subjects or patients with acute hepatitis B. We then investigated the timing and duration of the detection of HAV RNA in stool, defining the clinical onset of hepatitis A by the start of flu-like symptoms.12 As shown in Fig. 3, HAV RNA was detected in stool samples between days 3 and 89 after clinical onset. HAV RNA was found in all stool samples collected within 10 days of clinical onset. In two cases, fecal HAV RNA was detected more than 50 days after clinical onset (cases 2 and 4). The relationship between serum ALT levels and HAV-RNA positivity is shown in Fig. 4 for four patients whose stools were HAV-RNA–positive. In case 1, HAV RNA was detected in stool until day 18 after clinical onset but not on day 24 or thereafter. The patient in case 2 showed sustained elevated serum ALT levels for more than 3 months, during which his serum was HAV-RNA–positive on day 62 after clinical onset but negative on day 71 and thereafter. Nonetheless, his stool remained HAV-RNA–positive until day 89. In cases 3 and 4, intermittent shedding of HAV was observed. In case 3, HAV RNA was detected in stool on days 14, 18, and 30 after clinical onset, but not on day 25. In case 4, viremia was observed only when the serum ALT level was at its peak. ALT levels became normal on day 32, but HAV RNA was detected in stool from days 8 to 20, not on days 22 or 28, and again on days 34, 48, and 56. DISCUSSION
Fecal excretion of HAV during the course of hepatitis A has been examined using several methods. Using immunoelectron microscopy or radioimmunoassay, HAV antigen is detected for as long as 2 weeks after onset of hepatitis A during the peak of serum ALT levels.2-10 In neonates, fecal excretion of HAV RNA may continue for as long as 6 months.15 Duration of fecal excretion in adults may be shorter in view of the results of previous studies using radioimmunoassay or molecular hybridization techniques.11 Employing a RT-PCR method, we have detected HAV RNA in both serum and stool. In previous studies, we showed that hepatitis A viremia lasts for 2 to 7 days after clinical onset, which is longer than has been previously reported.16 In previous studies, HAV particles were captured onto a solid phase using a specific antibody prior to RNA extraction from stool,17,18 because substances in feces were reported to inhibit PCR.19 In the present study, we applied the two-stage RTPCR method for the detection of fecal HAV RNA using RNA prepared from a 10% stool–phosphate-buffered saline suspension. The presence of stool appeared to inhibit the PCR reaction, but the lower detection limit of the present method
FIG. 2. Sensitivity of RT-PCR HAV-RNA detection system. RNA was extracted from cultured HAV particles that were suspended in phosphate-buffered saline in the absence (panel A) or presence (panel B) of stool from a healthy subject. Using reverse transcription followed by two stages of 30 cycles of PCR, HAV RNA was detected in as few as 10 HAV particles in 100 mL of reaction mixture (panel A). Using a 10% stool suspension, the lower detection limit of the RT-PCR method increased, but HAV RNA from 102 HAV particles were still detected in 100 mL of reaction mixture (panel B).
AID
Hepa 0027
/
5P10$$$522
06-21-96 07:08:25
hpta
WBS: Hepatology
12
YOTSUYANAGI ET AL.
HEPATOLOGY July 1996
was still lower than that of the previously reported one-stage RT-PCR method.16 As shown in Fig. 3, all stool samples collected within 10 days from clinical onset were positive for HAV RNA, and some patients shed HAV into their stool for more than 1 month (up to 3 months). Our results show that (1) HAV was detected in the sera of approximately 50% of patients with hepatitis A after clinical onset, and (2) such cases were characterized by a longer duration of fecal excretion of HAV than that of HAV detection in serum. Hepatitis A is known to run a protracted clinical course in a small number of cases. In such cases, HAV antigen has been detected in the liver and stool.20,21 In the present study, patient 2 had abnormal ALT levels for more than 3 months. Although stool samples were not obtained in the early phase of the patient’s clinical course, stool was HAV-RNA–positive at 3 months after clinical onset, which was consistent with the findings reported previously.21 Interestingly, patient 4 shed HAV in stool for 2 months, well after his ALT levels had returned to normal. Moreover, this patient and patient 3 had intermittent fecal excretion of HAV, a pattern previously observed in chimpanzees.22 Therefore, HAV RNA might be detected for a longer period in patients with hepatitis A, if stool samples were collected later in the clinical course. Although hepatitis A is known to be a self-limiting disease, our results suggest that some patients with hepatitis A may have viral shedding into their stool even after normalization of their biochemical data. Such patients could be sources for
FIG. 4. Representative cases of patients with hepatitis A whose stools were HAV RNA–positive. In case 1, HAV RNA was detected in the patient’s stool until day 18 after clinical onset, but not on day 24 or thereafter. In case 2, the patient’s stool remained HAV-RNA–positive until day 89 with consistently elevated ALT levels. The patient in case 3 showed intermittent fecal shedding of the virus for about 30 days from clinical onset. The patient in case 4 also demonstrated intermittent fecal excretion of HAV RNA into his stool. In this patient, reappearance of shedding of HAV in stool occurred after serum ALT levels had become normal. Shaded areas indicate normal range of ALT levels. K.U., Karmen units.
secondary transmission of HAV in the community, although the infectivity of fecal HAV particles from such patients needs to be evaluated. A number of hepatitis A cases are sporadic, occurring as a result of casual person-to-person contact.1 Reported risk factors for HAV transmission during person-to-person contact are living in the same household with a patient with hepatitis A, homosexual activity, and close contact with young children.23 A report from a neonatal care unit suggests that deviation from infection-control procedures is associated with hepatitis A outbreaks among staff who are in close contact with neonates who shed HAV RNA for a long time.15 Our results suggest that HAV may be transmitted among members of the same household, hospitalized patients, and medical staff in the same manner. Careful attention to hygiene and sanitation is necessary even after patients with hepatitis A enter the recovery phase. Furthermore, these results indicate that hepatitis A prophylaxis including HAV vaccination is appropriate for all close contacts of patients, even when there are weeks of delay in identification or diagnosis. REFERENCES
FIG. 3. Relationship between HAV-RNA positivity and the number of days from clinical onset of hepatitis A. HAV RNA was detected in the stools and sera of 5 of 10 patients and in the serum only of 1 patient. j, HAV-RNA– positive sera; h, HAV-RNA–negative sera; ●, HAV-RNA–positive stools; s, HAV-RNA–negative stools.
AID
Hepa 0027
/
5P10$$$522
06-21-96 07:08:25
1. Sherlock S, Dooley J. Virus hepatitis. In: Sherlock S, Dooley J, eds. Diseases of the liver and biliary system. 9th ed. Oxford: Blackwell Scientific Publications, 1993:266-269. 2. Dienstag JL, Feinstone SM, Kapikian AZ, Purcell RH. Fecal shedding of hepatitis-A antigen. Lancet 1975;1:765-767. 3. Rakela J, Mosley JW. Fecal excretion of hepatitis A virus in humans. J Infect Dis 1977;135:933-938. 4. Flehmig B, Frank H, Frosner GG, Gerth HJ. Hepatitis A-virus particles in stools of patients from a natural hepatitis outbreak in Germany. Med Microbiol Immunol (Berl) 1977;163:209-214. 5. Locarnini SA, Gust ID, Ferris AA, Stott AC, Wong ML. A prospective study of acute viral hepatitis with particular reference to hepatitis A. Bull World Health Organ 1976;54:199-206. 6. Hall WT, Bradley DW, Madden DL, Zimmerman DH, Brandt DE. Comparison of sensitivity of radioimmunoassay and immune electron microscopy for detecting hepatitis A antigen in fecal extracts. Proc Soc Exp Biol Med 1977;155:193-198. 7. Fro¨sner GG, Overby LR, Flehmig B, Gerth HJ, Haas H, Decker RH, Ling CM, et al. Seroepidemiological investigation of patients and family contacts in an epidemic of hepatitis A. J Med Virol 1977;1:163-173.
hpta
WBS: Hepatology
HEPATOLOGY Vol. 24, No. 1, 1996
YOTSUYANAGI ET AL.
8. Coursaget P, Maupas P, Hibon P, Lesage G, Hubert M. Hepatitis A diagnosis in man: radioimmunoassay for hepatitis A antigen detection in faeces. J Med Virol 1980;6:53-60. 9. Coulepis AG, Locarnini SA, Lehmann NI, Gust ID. Detection of hepatitis A virus in the feces of patients with naturally acquired infections. J Infect Dis 1980;141:151-156. 10. Carl M, Kantor RJ, Webster HM, Fields HA, Maynard JE. Excretion of hepatitis A virus in the stools of hospitalized hepatitis patients. J Med Virol 1982;9:125-129. 11. Tassopoulos NC, Papaevangelos GJ, Ticehurst JR, Purcell RH. Fecal excretion of Greek strains of hepatitis A virus in patients with hepatitis A and in experimentally infected chimpanzees. J Infect Dis 1986;154:231237. 12. Stapleton JT, Lange DK, LeDuc JW, Binn LN, Jansen RW, Lemon SM. The role of secretory immunity in hepatitis A virus infection. J Infect Dis 1991;163:7-11. 13. Jansen RW, Newbold JE, Lemon SM. Combined immunoaffinity cDNARNA hybridization assay for detection of hepatitis A virus in clinical specimens. J Clin Microbiol 1985;22:984-989. 14. Tadeschi MV, Yoshida CF, Silva M, Feinstone SM. Detection of hepatitis A viral genome in stool samples of patients with relapsed hepatitis A by the polymerase chain reaction. Mem Inst Oswaldo Cruz 1989;84:429-433. 15. Rosenblum LS, Villarino ME, Nainan OV, Melish ME, Hadler SC, Pinsky PP, Jarvis WR, et al. Hepatitis A outbreak in a neonatal intensive care unit: risk factors for transmission and evidence of prolonged viral excretion among preterm infants. J Infect Dis 1991;164:476-482.
AID
Hepa 0027
/
5P10$$$522
06-21-96 07:08:25
13
16. Yotsuyanagi H, Iino S, Koike K, Yasuda K, Hino K, Kurokawa K. Duration of viremia in human hepatitis A viral infection as determined by polymerase chain reaction. J Med Virol 1993;40:35-38. 17. Jansen RW, Siegl G, Lemon SM. Molecular epidemiology of human hepatitis A virus defined by an antigen-capture polymerase chain method. Proc Natl Acad Sci U S A 1990;87:2867-2871. 18. Monceyron C, Grinde B. Detection of hepatitis A virus in clinical and environmental samples by immunomagnetic separation and PCR. J Virol Methods 1994;46:157-166. 19. Wilde J, Eiden J, Yolken R. Removal of inhibitory substances from human fecal specimens for detection of group A rotaviruses by reverse transcriptase and polymerase chain reactions. J Clin Microbiol 1990;28:13001307. 20. Fagan E, Yousef G, Brahm J, Garelick H, Mann G, Wolstenholme A, Portmann B, et al. Persistence of hepatitis A virus in fulminant hepatitis and after liver transplantation. J Med Virol 1990;30:131-136. 21. Sjo¨gren MH, Tanno H, Fay O, Sileoni S, Cohen BD, Burke DS, Feighny RJ. Hepatitis A virus in stool during clinical relapse. Ann Intern Med 1987;106:221-226. 22. Bradley DW, Gravelle CR, Cook EH, Fields RM, Maynard JE. Cyclic excretion of hepatitis A virus in experimentally infected chimpanzees: biophysical characterization of the associated HAV particles. J Med Virol 1977;1: 133-138. 23. Lemon SM. The natural history of hepatitis A: the potential for transmission of blood or blood products [Review]. Vox Sang 1994;67(suppl 4):1923.
hpta
WBS: Hepatology