Rapid identification of non-essential genes for in vitro replication of Marek's disease virus by random transposon mutagenesis

Journal of Virological Methods 135 (2006) 288–291

Short communication

Rapid identification of non-essential genes for in vitro replication of Marek’s disease virus by random transposon mutagenesis Jason P. Chattoo, Mark P. Stevens, Venugopal Nair ∗ Division of Microbiology, Institute for Animal Health, Compton, Berkshire RG20 7NN, United Kingdom Received 1 December 2005; received in revised form 10 March 2006; accepted 20 March 2006 Available online 2 May 2006

Abstract Marek’s disease virus (MDV) is a highly oncogenic alphaherpesvirus that induces rapid-onset T-cell lymphomas in poultry. The MDV genome encodes more than 100 genes. However, the role of many of these genes in virus replication is not known. The construction of an infectious bacterial artificial chromosome (BAC) clone of the highly oncogenic RB-1B strain of MDV has been described previously. Virus reconstituted from the BAC clone induced rapid-onset lymphomas in chickens very similar to the wildtype viruses. In this paper, the construction of a high-density random transposon-insertion mutant library of the RB-1B BAC clone using a high throughput in vitro transposon mutagenesis technique is described. Furthermore a PCR screening method, using primers specific for the transposon sequence and the MDV gene(s) of interest, was developed for the rapid identification of specific insertion mutants. The application of the screening method to identify some of the non-essential genes for MDV replication in vitro is described. © 2006 Elsevier B.V. All rights reserved. Keywords: MDV; BAC; Transposon mutagenesis

Marek’s Disease is a widespread and highly contagious neoplastic disease characterised by the development of Tlymphomas in susceptible chickens. The causative agent, Marek’s disease virus (MDV), was considered originally to be a gammaherpesvirus because of its lymphotropic properties, but it is now classified as an alphaherpesvirus on the basis of its genome structure and sequence homology (Ross, 1999). The MDV genome encodes more than 100 genes, the vast majority of which consist of open reading frames (ORF) that are homologous to those seen in other herpesviruses. However a number of genes that are unique to MDV have also been identified (Lee et al., 2000; Tulman et al., 2000). As in the case of other herpesviruses, MDV also shows a temporal pattern of gene expression, with the transcripts grouped into immediate early, early and late kinetic classes (Schat et al., 1989). However, the kinetics of expression of the majority of the MDV genes and their role in virus replication are not understood fully. The functions of many MDV genes have been deduced on the basis of homology to genes from other well-studied alpha-

∗

Corresponding author. Tel.: +44 1635 577356; fax: +44 1635 577263. E-mail address: [email protected] (V. Nair).

0166-0934/$ – see front matter © 2006 Elsevier B.V. All rights reserved. doi:10.1016/j.jviromet.2006.03.011

herpesviruses such as HSV-1 (Lupiani et al., 2001). However, predictions of gene functions based on sequence or structural homology may not be accurate as the functions of homologous genes can vary between viruses. Furthermore, such predictions are not possible for the MDV genes that do not have any homologues in other herpesviruses. Hence a direct examination of the functions of MDV genes is important to determine their role in the biology of MDV including virus replication in vitro. Bacterial artificial chromosome (BAC) vectors have been used extensively for the efficient propagation of genomes of several herpesviruses (Adler et al., 2003), including MDV (Petherbridge et al., 2003; Schumacher et al., 2000). BACderived viruses have biological characteristics very similar to the wild type viruses, including in vitro and in vivo replication, immunogenicity and oncogenicity. The availability of stable BAC clones of MDV provides the opportunity for rapid analysis of gene functions by using various tools developed for bacterial genetics. Transposon (Tn)-mediated insertion mutagenesis (Hayes, 2003) have been used widely for random mutagenesis of several cloned herpesvirus genomes (Brune et al., 1999; Hobom et al., 2000; McGregor et al., 2004; Smith and Enquist, 1999). Tn mutagenesis can be carried out either by delivery

J.P. Chattoo et al. / Journal of Virological Methods 135 (2006) 288–291

of Tn-containing suicide plasmids into E. coli harbouring BAC clones by bacterial conjugation, or by incubating the Tn and BAC DNA in vitro with purified transposase. In vitro transposition reactions offer the advantage that transposition into the chromosomal DNA can be avoided (McGregor et al., 2004). An in vitro transposition reaction with the EZ::TN Kan-2 insertion kit (Epicentre, Wisconsin, USA) was carried out to construct a random Tn5 insertion library of the pRB-1B BAC clone. Initially, the transposition reaction was done following the manufacturer’s protocol. However, examination of the restriction digests of the DNA from 12 mutant BAC clones showed that all the clones have undergone large-scale rearrangements with deletions of portions of the virus genome (data not shown). Having observed high frequency of rearrangements using the recommended protocol, investigation was carried out to examine whether shortening the reaction time would reduce the frequency of rearrangements. It was found that a 5 min reaction at 37 ◦ C (in a buffer containing 2 ␮g of RB-1B BAC, 2 ␮g purified Tn DNA, and 1 ␮l EZ::TN transposase) was optimal for successful transposition. This modification significantly reduced the frequency of rearrangements in the library, although two out of the eight clones examined (25%) still showed evidence of rearrangements. The RB-1B BAC Tn insertion mutant library consisting of more than 500 individual clones were stored as glycerol stocks in 96-well microtitre plates. Assuming a completely random distribution of the Tn insertions in the 180-kB MDV genome, the library would consist of mutants with around one insertion every 360 nucleotides. In order to test the randomness of the mutant library, BamHI-digested BAC DNA from randomly-picked colonies were tested by Southern blot hybridization using a digoxigenin (Roche Molecular Biochemicals)-labelled probe specific to the kanamycin resistance gene within the Tn sequence. The 784 bp probe, generated by PCR with Kanamycin gene-specific KanFor and Kan-Rev primers (Table 1), is expected to detect only single fragments containing the inserted Tn. The distinct hybridization pattern of the 16 clones picked at random demonstrated that the Tn insertions were random with no evidence of any hot spots of insertion (Fig. 1). Randomness of Tn insertions has also been demonstrated with Tn-insertion libraries of other herpesviruses such as cytomegalovirus, where not even a single repetitive Tn insertion was seen in any of the 250 Tn mutants examined (Hobom et al., 2000). Although the Tn

289

Fig. 1. Southern blot of BamHI-digested DNA from 16 random RB-1B BAC mutant clones hybridised with a probe specific for the kanamycin resistance gene encoded for by the transposon. The different sizes of fragments which hybridised to the probe indicate the random nature of the transposon insertion in the pRB-1B genome.

insertions in the RB-1B BAC mutant library were random, they were not always single insertions. Southern hybridisation of the 16 mutant clones showed that at least four had more than one Tn insertion (Fig. 1). Since the length of the RB-1B BAC clone is less than 180 kbp, theoretically only one insertion was expected in each of the mutant clones due to the phenomenon of target immunity that restricts the transposition events to occur only once in approximately 200 kbp (Stellwagen and Craig, 1997). In spite of the multiple insertions and rearrangements in a proportion of the mutant clones, the RB1B Tn library with more than 500 individual clones would be large enough to identify mutants with insertions in most of the MDV genes. In order to ascertain that the Tn insertion in the pRB-1B mutant library did occur at random, as well as to identify the genes disrupted by the Tn insertion, direct sequencing of the mutant clones was carried out using primers designed from either the terminal regions of Tn5 or from genes of interest (Table 1). The sequencing data from 21 independent mutant clones confirmed that the Tn insertions occurred at random within different ORFs or intergenic regions (Table 2). In order to locate the specific Tn insertion sites in the mutant library, a modification of the method described previously (Hobom et al., 2000) was used. This high throughput screening method uses three consecutive rounds of PCR on DNA from hierarchically pooled aliquots of the mutant library. This

Table 1 Primers used to identify transposon insertions within ORFs of unknown function Target ORF

Sequence 5 –3

Nucleotide position (accession numbers)

Orientation

MDV012 MDV012 MDV071 MDV071 MDV072 MDV072 Kan For Kan Rev KAN-2 FP1 KAN-2 RP1

AAGCCCCACACATTTATGCTC CCCATAACAATACGTGAAG GAGATTCTTTCGTCCGTTG ACTCACGAATTTCAGTACAACC CATTATGTATCGGGGATAGG AAAGAGAGGGGATATACCTTG AGCCATATTCAACGGGAAAC CTCATCGAGCATCAAATGAAAC ACCTACAACAAAGCTCTCATCAACC GCAATGTAACATCAGAGATTTTGAG

17730-50 (AF243438) 19082-64 (AF243438) 122244-62 (AF243438) 122984-63 (AF243438) 123431-50 (AF243438) 126336-16 (AF243438) 10110-29 (AY297843) 9326-47 (AY297843) 10203-27 (AY297843) 10350-74 (AY297843)

Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse

290

J.P. Chattoo et al. / Journal of Virological Methods 135 (2006) 288–291

Table 2 Location of Tn insertion and growth characteristics of pRB-1B mutants MDV mutant

Gene/protein location of Tn insertion (nucleotide position if known)a

Growth on chicken embryo fibroblastsb

Requirement in HSV-1c

JC3 6A1 6A5 6A9 7A3 6A2 JC4 JC6 Tn1 1A9 6A3 1A3 6A7 7G8 6E2 7A8 6A6 1A7 6A8 1A4 JC2

MDV006a/14 kDa lytic phase protein MDV006b/14 kDa lytic phase b protein MDV010-MDV008 intergenic region MDV012/unknown ORF (18086) MDV012/unknown ORF (18427) MDV015-MDV016 intergenic region MDV028/tegument MDV031/major capsid protein MDV040/glycoprotein B MDV048/Capsid protein MDV049/large tegument protein MDV054/vhs protein, tegument MDV054/vhs protein, tegument MDV071/unknown ORF (122647) MDV072/unknown ORF (125839) MDV072/unknown ORF (125472) MDV077-MDV078 intergenic region MDV084/ICP4 MDV084/ICP4 MDV087-MDV088 intergenic region MDV095/glycoprotein I

+ + + − − + + − − − − + + + + + + − + − −

Unknown Unknown Unknown Absent in HSV Absent in HSV Unknown Non-essential Essential Essential Essential Essential Non-essential Non-essential Absent in HSV Absent in HSV Absent in HSV Unknown Essential Essential Unknown Non-essential

a

Nomenclature and positions of genes are based on the sequence of the Md5 strain of MDV GenBank Accession number AF243438. Virus growth of the mutants is indicated either by the presence (+) or absence (−) of specific MDV plaques after two continuous passages in chicken embryo fibroblasts. c As summarised previously (Roizman and Knipe, 2001). b

method was used for the rapid identification of mutants with insertions in some of the ORFs of unknown function (Tulman et al., 2000). For this, pools of DNA from each of the 96-well plates, as well as from each of the rows and columns were prepared separately. Using primer pairs designed from either end of the Tn sequence (KAN-2 FP1 and KAN-2 RP1) and from some of the selected ORFs (Table 1), we identified five mutant clones with Tn insertions in three of these unknown ORFs (Table 2). These results demonstrated that the Tn insertions are sufficiently frequent and random in the library that clones with mutated genes of interest can be readily isolated. The application of this rapid PCR screening technique should accelerate significantly the evaluation of the functions of MDV genes including those for which the functions are unknown. Having identified mutant MDV clones with insertions in different genes, a preliminary examination of the effects of such insertions on MDV replication in vitro was carried out. For this 1 ␮g DNA from selected mutant BAC clones was transfected into primary chicken embryo fibroblasts (CEF) using Lipofectamine (Invitrogen, Paisley, UK) along with wild type RB-1B BAC as the positive control. The plates were incubated at 37 ◦ C for 4–5 days and examined for the development of specific MDV plaques. The cultures were passaged twice on to fresh chicken embryo fibroblasts and observed for plaques before being considered negative. This assay provided a rapid preliminary screening method for grouping genes into essential and non-essential for MDV replication in vitro (Table 2). The Tn1 mutant with an insertion within the MDV040 gene failed to show any cytopathic effects in vitro indicating that the glycoprotein B (gB), encoded by this gene is essential for MDV

growth in vitro. These results are in agreement with a previous report demonstrating the replication defect of gB-deletion mutant of 584Ap80C strain of MDV (Schumacher et al., 2000). The mutant clone 1A9 with Tn insertion in gene MDV048 also failed to grow in chicken embryo fibroblasts, indicating that the gene product capsid protein VP26 is essential for MDV replication. However, another study using the 584Ap80C strain of MDV demonstrated that deletion of VP26 did not completely abolish infectivity although virus replication was compromised seriously (Vautherot and Osterrieder, 2004). Similarly, the insertion in the adjacent MDV049 gene that encodes the HSV large tegument protein homologue was also found to prevent the growth of MDV 6A3 mutant, reiterating the important role of tegument proteins in MDV replication (Vautherot and Osterrieder, 2004). Interestingly, the mutant 1A4 with Tn insertion in the intergenic region before MDV088 gene also failed to replicate even after two passages in CEF. This replication defect is likely to be due to the disruption of some of the important regulatory sequences upstream of the US region, since previous studies introducing mutations or deletions of ORF within the US region did not appear to affect the replication of MDV or of GA strain (Parcells et al., 1994, 1995). Clone JC6 which contains a Tn insertion in the MDV031 region failed to produce any plaques demonstrating that the major capsid protein VP5 encoded by this gene is essential for replication. Although the methods described above will be useful as a rapid tool to identify essential and non-essential genes for MDV replication, further complementation studies and evaluation of functions using revertant viruses are required for the absolute confirmation that the Tn insertions were indeed the reason for the failure of these clones to replicate in vitro.

J.P. Chattoo et al. / Journal of Virological Methods 135 (2006) 288–291

Several mutations did not impair MDV replication in vitro. Tn insertions in the MDV015-MDV016 intergenic junction (mutant 6A2), between pp24 and lipase (6A5) and between MDV004 and R-LORF8 (6A6) did not affect MDV replication in vitro. The mutants (1A3 and 6A7) which had distinct Tn insertions in MDV054 showed evidence of virus replication in chicken embryo fibroblasts indicating that the MDV054 gene product, virion host shutoff protein, is not an essential gene for MDV replication in vitro. The replication of MDV strain 584p80C in chicken cells were also shown to be unaffected by deletion of UL41/MDV054 (Vautherot and Osterrieder, 2004). Similarly, the tegument protein encoded by MDV028 gene also appeared to be non-essential for in vitro replication of MDV, since the JC4 mutant with Tn insertion within this gene showed evidence of virus growth upon transfection. Functional characterisation of mutants with Tn insertions in the repeat regions is difficult since insertion into one of the copies may not result in a change of phenotype due to the presence of a possible functional second copy. In two of the mutant clones 1A7 and 6A8, the insertions were in the MDV084 gene that encodes the MDV ICP4 homologue. Given that there are two copies of ICP4, a loss of infectivity might not be expected and the 6A8 mutant did replicate in chicken embryo fibroblasts as demonstrated by the development of MDV plaques upon transfection of the BAC DNA. However, the clone 1A7 failed to show any virus growth in chicken embryo fibroblasts even after repeated passages. Although the reasons for this difference are not clear, it is likely to be either due to the differences in the insertion sites between these two clones or due to other subtle mutations elsewhere. The MDV071 and MDV072 mutant viruses (Table 2) were all able to tolerate the insertion of the transposon cassette. This indicates that the functions provided by these ORFs of unknown function are not necessary for in vitro growth. Further studies are required to assess the contribution of these ORFs for virulence in vivo. However, the insertion of the Tn cassette within MDV012 in two of the mutants resulted in the failure of in vitro replication suggesting that this ORF, despite its unknown function, is potentially essential for MDV replication. Despite the drawbacks such as the multiple Tn insertions or genome rearrangements in the BAC, the methods described in this paper permit a rapid identification of the non-essential genes for MDV replication in vitro. Although definite confirmation of the role of each gene, particularly the essential genes, would require further studies using complementation or revertant viruses, the Tn mutagenesis system and the PCR-based method of isolation of specific mutant clones is an important addition to the tools available for understanding the biology of MDV. Acknowledgement The work was supported by a studentship from the Biotechnology and Biological Sciences Research Council (BBSRC), United Kingdom.

291

References Adler, H., Messerle, M., Koszinowski, U.H., 2003. Cloning of herpesviral genomes as bacterial artificial chromosomes. Rev. Med. Virol. 13, 111–121. Brune, W., Menard, C., Hobom, U., Odenbreit, S., Messerle, M., Koszinowski, U.H., 1999. Rapid identification of essential and nonessential herpesvirus genes by direct transposon mutagenesis. Nat. Biotechnol. 17, 360–364. Hayes, F., 2003. Transposon-based strategies for microbial functional genomics and proteomics. Ann. Rev. Genet. 37, 3–29. Hobom, U., Brune, W., Messerle, M., Hahn, G., Koszinowski, U.H., 2000. Fast screening procedures for random transposon libraries of cloned herpesvirus genomes: mutational analysis of human cytomegalovirus envelope glycoprotein genes. J. Virol. 74, 7720–7729. Lee, L.F., Wu, P., Sui, D., Ren, D., Kamil, J., Kung, H.J., Witter, R.L., 2000. The complete unique long sequence and the overall genomic organization of the GA strain of Marek’s disease virus. Proc. Natl. Acad. Sci. USA 97, 6091–6096. Lupiani, B., Lee, L.F., Reddy, S.M., 2001. Protein-coding content of the sequence of Marek’s disease virus serotype 1. In: Hirai, H. (Ed.), Marek’s Disease, vol. 255. Springer-Verlag, Berlin, pp. 159–190. McGregor, A., Liu, F., Schleiss, M.R., 2004. Identification of essential and non-essential genes of the guinea pig cytomegalovirus (GPCMV) genome via transposome mutagenesis of an infectious BAC clone. Virus Res. 101, 101–108. Parcells, M.S., Anderson, A.S., Cantello, J.L., Morgan, R.W., 1994. Characterization of Marek’s disease virus insertion and deletion mutants that lack US1 (ICP22 homolog), US10, and/or US2 and neighboring short-component open reading frames. J. Virol. 68, 8239– 8253. Parcells, M.S., Anderson, A.S., Morgan, T.W., 1995. Retention of oncogenicity by a Marek’s disease virus mutant lacking six unique short region genes. J. Virol. 69, 7888–7898. Petherbridge, L., Howes, K., Baigent, S.J., Sacco, M.A., Evans, S., Osterrieder, N., Nair, V., 2003. Replication-competent bacterial artificial chromosomes of Marek’s disease virus: novel tools for generation of molecularly defined herpesvirus vaccines. J. Virol. 77, 8712– 8718. Roizman, B., Knipe, D.M., 2001. Herpes simplex virus and their replication. In: Knipe, D.M., Howley, P.M. (Eds.), Fields Virology, vol. 2. Lippincott Williams & Wilkins, Philadelphia, pp. 2399–2459. Ross, L., 1999. T-cell transformation by Marek’s disease virus. Trends Microbiol. 7, 22–29. Schat, K.A., Buckmaster, A., Ross, L.J., 1989. Partial transcription map of Marek’s disease herpesvirus in lytically infected cells and lymphoblastoid cell lines. Int. J. Cancer 44, 101–109. Schumacher, D., Tischer, B.K., Fuchs, W., Osterrieder, N., 2000. Reconstitution of Marek’s disease virus serotype 1 (MDV-1) from DNA cloned as a bacterial artificial chromosome and characterization of a glycoprotein B-negative MDV-1 mutant. J. Virol. 74, 11088–11098. Smith, G.A., Enquist, L.W., 1999. Construction and transposon mutagenesis in Escherichia coli of a full-length infectious clone of pseudorabies virus, an alphaherpesvirus. J. Virol. 73, 6405–6414. Stellwagen, A.E., Craig, N.L., 1997. Avoiding self: two Tn7-encoded proteins mediate target immunity in Tn7 transposition. EMBO J. 16, 6823– 6834. Tulman, E.R., Afonso, C.L., Lu, Z., Zsak, L., Rock, D.L., Kutish, G.F., 2000. The genome of a very virulent Marek’s disease virus. J. Virol. 74, 7980–7988. Vautherot, J.F., Osterrieder, K., 2004. The genome content of Marek’s diseaselike viruses. In: Davison, F., Nair, V. (Eds.), Marek’s Disease: An Evolving Problem, vol. 1. Elsevier, London, pp. 17–31.