- Email: [email protected]
Rapid monitoring of mRNA levels with a molecular beacon during microbial fermentation
Journal of Biotechnology 145 (2010) 310–316
Contents lists available at ScienceDirect
Journal of Biotechnology journal homepage: www.elsevier.com/locate/jbiotec
Rapid monitoring of mRNA levels with a molecular beacon during microbial fermentation Dexian Dong 1 , Yanping Pang 1 , Qian Gao, Xianqing Huang, Yuquan Xu ∗ , Rongxiu Li MOE Key Laboratory of Microbial Metabolism, College of Life Science and Biotechnology, Shanghai Jiao Tong University, 800 Dongchuan Road, Shanghai 200240, China
a r t i c l e
i n f o
Article history: Received 8 February 2009 Received in revised form 15 November 2009 Accepted 18 November 2009 Keywords: Molecular beacon mRNA monitoring Hybridization condition Phenazine-1-carboxylic acid
a b s t r a c t In the microbial fermentation bioreactor, the processes of mRNA transcription, protein translation, and enzyme-catalyzed biosynthesis remain as “black boxes” of industrial monitoring and process control. Monitoring the kinetics of these “black boxes” is very helpful for optimizing and controlling the microbial fermentation process. This study first applied a molecular beacon (MB) to monitor the changes in the mRNA level of the phzC gene during antibiotic phenazine-1-carboxylic acid fermentation. Seven typical MB hybridization buffers were compared, and the effect of formamide on MBs was also studied. The results showed that rapid monitoring of the mRNA level using MBs was feasible. The optimal hybridization buffer for phzC MB was 100 mM Tris, 1 mM MgCl2 , pH 8.0. The optimal hybridization temperature was 35 ◦ C, and formamide proved unsuitable for MB hybridization. The limit of detection of phzC MB was 1.67 nM and MB hybridization was complete by 7 min. Given that the time for RNA extraction is 12 min, it is possible that monitoring of phzC mRNA can be completed in less than 20 min. Since production of most amine acids, organic acids, wines, antibiotics, and proteins relies on microbial fermentation, our method may have some potential for application in these other microbial industries. © 2009 Elsevier B.V. All rights reserved.
1. Introduction Microbial fermentation generally involves monitoring environmental parameters (e.g., pH and dissolved oxygen), product parameters, and biological parameters (e.g., cell density). On the other hand, the intracellular processes in the bioreactor, such as mRNA transcription and protein translation, have not been monitored (Becker et al., 2007). Yet the environmental variables of bioreactors indirectly affect product yield by influencing these intracellular biochemical processes. Until now there have been no reports on the monitoring of these intracellular activities during microbial fermentation. The long-term goal of this study is to significantly increase the product yields of microbial fermentation via process control of these intracellular activities. Examining and monitoring the kinetics and regulation of these intracellular activities are the first steps in this research plan. Of these processes of transcription, translation, and enzyme-catalyzed biosynthesis, we chose to begin by monitoring mRNA transcription because transcriptional regulation is the major mechanism for regulating the synthesis of gene products in bacteria.
∗ Corresponding author. Tel.: +86 21 34204207; fax: +86 21 34204207. E-mail addresses: [email protected] (D. Dong), [email protected] (Y. Xu). 1 These authors contributed equally to this work. 0168-1656/$ – see front matter © 2009 Elsevier B.V. All rights reserved. doi:10.1016/j.jbiotec.2009.11.013
To rapidly monitor transcription during fermentation, a simple and rapid method for quantitative detection of mRNA is necessary. A sufficiently fast detection time is critical. The classic mRNA quantification method is real-time quantitative RT-PCR (VanGuilder et al., 2008; Ashton and Headrick, 2007; Nolan et al., 2006). But realtime RT-PCR requires at least 1 h for the reverse transcription of mRNA and 2 h for the PCR amplification of cDNA. Consequently, the total detection time is too long for rapid monitoring. In addition, real-time RT-PCR suffers from problems such as the non-linear amplification bias of Taq enzyme, degradation of the RNA template, and difficult automation for rapid detection. Besides real-time RTPCR, RNase protection assays (Qu and Boutjdir, 2007), microarray studies (Liu and Slininger, 2007), and fluorescence in situ hybridization (Day et al., 2007) have also been used for mRNA quantification. Most of these methods suffer from at least one of the following disadvantages of being time-consuming, difficult to be automated for process fermentation, less sensitive than other techniques, expensive, or vulnerable to cross-contamination. A more recently developed method based on molecular beacons (MBs) (Li et al., 2008a,b) has been used to identify microorganisms, image intracellular gene expression (Crey-Desbiolles et al., 2005; Deiman et al., 2007), detect the transcriptional level of RNA in vitro (Belon and Frick, 2008; Hopkins and Woodson, 2005; Nadal et al., 2007), and measure the folding rates of RNA (Silverman and Kool, 2005). A molecular beacon is a stem-loop DNA oligonucleotide carrying a fluorophore and a quencher. In the absence of
D. Dong et al. / Journal of Biotechnology 145 (2010) 310–316
311
Table 1 Seven typical reported buffers for molecular beacon hybridization. NO.
Hybridization buffers
References
B1 B2 B3 B4 B5 B6 B7
100 mM Tris–HCl buffer, 5 mM MgCl2 , pH 8.0 4 × sodium chloride/sodium citrate (SSC), 0.1% SDS 10 mM phosphate-buffered saline, 150 mM NaCl, pH 7.0 20 mM Tris–HCl buffer, 50 mM NaCl, 5 mM MgCl2 , pH 7.6 10 mM Tris, 50 mM KCl, 3.5 mM MgCl2 , pH 8.0 100 mM Tris, 1 mM MgCl2 , pH 8.0 10 mM Tris, 100 mM KCl, 1 mM MgCl2 , pH 8.0
Martí et al. (2006) Tsai et al. (2003) Horejsh et al. (2005) Li et al. (2006a,b) Crey-Desbiolles et al. (2005) Tyagi and Kramer (1996) Bonnet et al. (1999)
RNA or DNA targets, the fluorophore and the quencher are held in close proximity to each other by the hairpin stem, and the molecular beacon does not fluoresce. When the MB encounters a target such as DNA or mRNA, it forms a probe–target hybrid that is longer and more stable than the stem hybrid. Consequently, the MB undergoes a spontaneous conformational reorganization, separating the fluorophore and quencher and thereby restoring fluorescence. The most attractive features of the MB-based method are that it occurs in a single-step, the hybridization time is short, and no enzyme is required. Theoretically, DNA/RNA hybridization involving short DNA oligonucleotides is very fast and specific. No enzyme involvement means there is no bias due to the particular enzymatic reaction, the signal of the MB–RNA hybrid need not be amplified or transformed, and the signal intensity is proportional to the amount of MB–target hybrid. In addition, it is easy to engineer a one-step liquid hybridization into a detection technology compatible with online process monitoring. Given that RNA purification can be complete within 12 min, we sought to design a method combining single-step RNA purification with one-step MB hybridization for the rapid detection of mRNA. Based on reports involving MB hybridization (Crey-Desbiolles et al., 2005; Deiman et al., 2007; Belon and Frick, 2008; Hopkins and Woodson, 2005; Nadal et al., 2007; Silverman and Kool, 2005; Bonnet et al., 1999; Horejsh et al., 2005; Li et al., 2006a,b; Martí et al., 2006; Tsai et al., 2003; Tyagi and Kramer, 1996), we found that MB hybridization conditions such as hybridization buffer, temperature, and time were all arbitrarily chosen. Seven typical hybridization buffers (see Table 1) had been reported but there are no explanations why these buffers were chosen. Thus, the systematic optimization of MB hybridization conditions was needed. Pseudomonas sp. M18 produces the antibiotics phenazine1-carboxylic acid (PCA) and pyoluteorin (Yan et al., 2007). Pseudomonas sp. M18G is a strain of this bacterium carrying a mutation in the regulatory gene GacA (Ge et al., 2004). The phzC gene is one component of the PCA biosynthetic operon phzABCDEFG and only have two copies in one single cell (Mavrodi et al., 2001), which encodes a phospho-2-keto-3-deoxyheptonate aldolase. The transcriptional level of phzC should correlate closely with PCA biosynthesis and yield because the phzC gene is one component of the PCA biosynthetic operon. The transcriptional copy numbers of phzC gene should be much larger than the DNA copy numbers of phzC gene. Because our laboratory had already initiated pilot-scale fermentation of Pseudomonas sp. M18G, we chose PCA fermentation of Pseudomonas sp. M18G as our research system and the phzC gene as our detection target to develop a MB-based method for rapid quantification of mRNA.
GCA CGA GCA GGT-3 ; and phzCr, 5 -CGG GTC GCT CAG CCA GAT CAC-3 . The genomic DNA of Pseudomonas sp. M18G grown in a fermentor was extracted and the phzC gene was amplified according to the protocol of Dong et al. (2006). The PCR product was submitted to the Invitrogen Corp. China for sequencing. The sequence of phzC gene was deposited in GenBank (accession number EF491207). 2.2. Design and synthesis of phzC MB and complementary DNA oligonucleotide Using the sequence of phzC gene EF491207, the DNA sequence from position 350 to position 374 was chosen as the loop of the phzC MB based on the evaluation of Oligo 6 and Primer Primer 5 software. GenBank BLAST was used to confirm the specificity of this chosen sequence. The designed MB was: 5 -(FAM)- GCCCGA GAGGTGCTCAACCCGGTGGCCTGCA TCGGGC (DABSYL)-3 , and its proposed secondary structure is shown in Fig. 1a. The designed complementary DNA oligonucleotide was 5 TGCAGGCCACCGGGTTGAGCACCTC-3 . MB and the complementary DNA oligonucleotide were synthesized at Invitrogen Corp. China. The phzC MB comprises a 37-nt stem-loop structure with a 6-nt complementary stem sequence and a 25-nt loop sequence. The fluorophore FAM and the quencher DABSYL were conjugated to the 5 and 3 ends, respectively. 2.3. Bacterial culture The seed cultures of Pseudomonas sp. M18G and Pseudomonas sp. Q2-87 [gift from Linda S. Thomashow, USDA-ARS, Washington, USA (Mavrodi et al., 2007)] were respectively grown by inoculating 50 mL King’s B broth with a single colony in a 250-mL flask and incubating at 28 ◦ C with shaking at 165 rpm. After 10 h of growth, 4.5 mL of the seed culture was transferred to a 500-mL flask containing 150 mL PCA-producing medium, and shaken at 165 rpm at 28 ◦ C.
2. Materials and methods 2.1. Sequencing of phzC Primers for PCR amplification of the phzC gene were designed using Oligo 6 software and the sequence of the Pseudomonas aeruginosa pyocyanine biosynthesis operon (GenBank accession number AF005404). The designed primer pairs were: phzCf, 5 -TTC CAA GCC
Fig. 1. (a) The proposed secondary structure of phzC MB. (b) The electrophoretic profile of total extracted RNA using a 1% agarose–TBE system.
312
D. Dong et al. / Journal of Biotechnology 145 (2010) 310–316
The King’s B broth contained 20 g L−1 peptone, 0.392 g L−1 K2 HPO4 , 0.732 g L−1 MgSO4 , and 15 mL glycerol. The pH value of the medium was adjusted to 7.5 before autoclaving. The PCA-producing medium contained 33 g L−1 soybean powder, 11 g L−1 soya peptone, 12 g L−1 glucose, 4 mL L−1 glycerol, and 13 mL L−1 ethanol. The pH value of medium was adjusted to 7.8–8.0 before autoclaving. The seed culture of Escherichia coli BL21 was grown by inoculating 50 mL LB broth with a single colony in a 250-mL flask and incubating at 28 ◦ C with shaking at 165 rpm. After 10 h of growth, 4.5 mL of the seed culture was transferred to a 500-mL flask containing 150 mL LB broth, and shaken at 165 rpm at 28 ◦ C. The LB broth contained 10 g L−1 peptone; 5 g L−1 yeast extract; 5 g L−1 NaCl, pH 7.5. 2.4. RNA extraction At different times during the fermentation, samples of 1 mL were withdrawn, filtered through a 500-mesh sieve to remove particulate residues in the fermentation medium, and centrifuged at 10,000 rpm and 4 ◦ C. The pellets were immediately frozen in liquid nitrogen and stored at −70 ◦ C. RNA extraction of the fermentation samples from different time points was conducted in parallel to reduce experimental variation. Trizol reagent (1 mL, TianGen Biotech Co., Ltd.) and 200 L chloroform was added to the frozen cell pellets. After vortexing for 1 min, the mixture was centrifuged for 2 min at 10,000 rpm and 4 ◦ C. The supernatant was transferred to a fresh tube and precipitated with 250 L of isopropanol and 250 L of concentrated salt (0.8 M tri-sodium citrate and 1.2 M sodium chloride) for 5 min at −20 ◦ C. After centrifugation for 2 min at 10,000 rpm and 4 ◦ C, The pellet was washed with 500 L of 80% (v/v) ethanol, then dried for 1 min with a hair dryer. Millipore Q water (treated by DEPC and autoclaved) or the MB hybridization buffer was used to dissolve the RNA pellet for further experimentation. RNA integrity and purity were checked on 1% agarose–TBE gels. 2.5. The linear curve construction of MB hybridization The phzC MB (330 nM) was mixed with the following concentrations (nM) of complementary DNA oligonucleotides: 0.8325, 1.665, 3.33, 6.67, 13.33, 26.67, 33.33, and 66.67. The mixtures were incubated at 35 ◦ C until the intensity reached a stable level; higher concentrations of standard required more time. The calibration curve was drawn by displaying the averages of triplicate fluorescence intensity measurements along the vertical axis and the concentrations of standard on the horizontal axis.
3. Results and discussion 3.1. RNA extraction Because RNA is easily degraded by ubiquitous RNase, extracting intact and pure total RNA from the fermenting sample is the first and most critical step for rapid quantification of mRNA. The traditional method for RNA extraction is the single-step acid phenol–guanidinium thiocyanate–chloroform extraction (Chomczynski and Sacchi, 2006). Commercial TRIZOL reagent is an improvement on this isolation method (http://www.invitrogen.com). In our laboratory, both commercial and self-made TRIZOL reagents have been used successfully and RNA extraction is performed daily. To ensure the standardization of our new MB procedure, we used commercial TRIZOL reagent for the MB hybridization with phzC mRNA. Fig. 1b shows that there was no DNA contamination between the sample loading well and the rRNA bands in our total RNA. The OD260 /OD280 of our total RNA was measured as 1.9. These results proved that our total RNA was pure. Using this procedure for RNA extraction, RNA could be extracted within 12 min. The degradation of total RNA is negligible because RNA is protected by the organic solvents during the entire extraction procedure, except for the 1-min air-drying to remove residual ethanol. 3.2. The choice of hybridization buffer To determine the optimal buffer for our MB hybridizations, seven typical hybridization buffers (see Table 1) were systematically examined in reactions involving complementary DNA oligonucleotide and extracted RNA. Fig. 2a shows changes in fluorescence intensity during MB hybridization with or without complementary DNA oligonucleotide in different buffers at 30 ◦ C during the first 10 min. Fig. 2c shows the results from similar experiments with or without the extracted RNA in different buffers at 35 ◦ C. The fluorescence intensities of MB without target (0.4–0.8 unit) in all seven buffers were much lower than those of the MB-target hybrid (4.3–11.5 units). The fluorescence intensities of both MB-target hybrids varied significantly across the seven buffers tested. Calculating the signal (S) to background (B) ratio showed that buffer B7 had the highest S:B (24.0) and the lowest background intensity (0.47 unit), and buffer B6 performed nearly as well as B7 during the hybridization of MB to complementary DNA oligonucleotide (Fig. 2b). Buffer B6 showed the highest S:B (11.7) and the lowest background intensity (0.25 unit) during hybridization of MB with extracted RNA (Fig. 2d). In light of the downstream steps for RNA hybridization and its similarity to buffer B7, buffer 6 was chosen for phzC mRNA hybridization.
2.6. MB hybridization 3.3. The effect of formamide on MB hybridization MB hybridization was carried out in a total volume of 30 L in microcentrifuge tubes from Axygen Scientific, Inc. MB (1 L of 10 M phzC MB) and the complementary DNA oligonucleotide (present in five-fold molar excess) were mixed in different hybridization buffers. The extracted RNA pellets were dissolved in 29 L of different buffer solutions and 1 L of 10 M phzC MB was added. The mixtures of phzC MB with total RNA or complementary DNA oligonucleotide were analyzed in a RG-3000A real-time PCR amplifier (Corbett Research, Italy). The temperature was increased in steps of 1 ◦ C from 30 ◦ C to 94 ◦ C, with each step lasting 1 min. To confirm that nonequilibrium hysteresis did not occur, the temperature was then decreased in 1 ◦ C steps from 94 ◦ C to 30 ◦ C, again with each step lasting 1 min. Fluorescence was measured during the last 30 s of each step. The excitation and emission wavelength of fluorescence were 470 nm and 510 nm, respectively.
Since RNA is easily degraded by RNase, which is exceptionally stable and ubiquitous in laboratories, we evaluated the effect of formamide addition to the MB buffer, a common reagent used to prevent RNA degradation and decrease the hybridization temperature (Choi et al., 2006). Fig. 3 shows the effect of formamide on phzC MB in buffer B7. At low temperatures such as 35 ◦ C, the fluorescence intensity of phzC MB increased significantly with increasing formamide concentration from 0% to 50%. The formamide may have opened up the MB and significantly increased the background intensity. At formamide concentrations less than 20%, the hybridization curves reflect the Tm of the nucleic acids. Indeed, the Tm for phzC MB decreased when the formamide concentration increased from 0% to 20%. It is not clear why the fluorescence intensity of phzC MB dropped when the temperature increased
D. Dong et al. / Journal of Biotechnology 145 (2010) 310–316
313
Fig. 2. The choice of hybridization buffer. (a) The fluorescence intensity changes and (b) signal to background ratio (S:B) of MB hybridization with or without complementary DNA oligonucleotide in seven different buffers at 30 ◦ C during 0–10 min. MB control lines indicate MB added without complementary DNA oligonucleotide. Buffer only lines indicate only buffers added without complementary DNA oligonucleotide and MB. (c) The fluorescence intensity changes and (d) signal to background ratio of MB hybridization with or without the extracted RNA in seven different buffers at 35 ◦ C during 0–10 min. Buffer control lines indicate MB added without the extracted RNA. S:B was calculated as: (Fopen − Fbuffer )/(Fclosed − Fbuffer ). Fbuffer , fluorescence intensity of buffer solution. Fclosed , fluorescence intensity of MB without target. Fopen , fluorescence intensity of MB hybridization with target. B1–B7 represent seven different buffers. All the experiments were performed three times.
from 70 ◦ C to 94 ◦ C. Because of the increased background intensity, we considered that formamide was not a suitable additive for MB hybridization. 3.4. The determination of hybridization temperature To determine the optimal hybridization temperature of phzC MB–mRNA hybrids, the thermal denaturation profiles of phzC MB with complementary DNA oligonucleotide and extracted RNA were studied (Fig. 4). In Fig. 4a, the fluorescence intensity in the absence of complementary DNA oligonucleotide showed a sigmoidal profile as the temperature increased from 30 ◦ C to 94 ◦ C. At lower temperatures, the phzC MB stem kept the fluorophore and quencher together so that very low fluorescence intensity was observed. Nevertheless, increasing temperature caused an increase in thermal motion. Thus, when the temperature reached the Tm value of phzC MB (65 ◦ C in Fig. 4a), the MB stem opened and emitted intense fluorescence. In the presence of the complementary
DNA oligonucleotide target, the fluorescence intensity of the phzC MB–complementary DNA hybrids was very high and it decreased slowly from 30 ◦ C to 94 ◦ C, consistent with the report of Bonnet et al. (1999). The fluorescence intensities with or without the extracted RNA in the four hybridization buffers mentioned above showed similar sigmoidal profiles as the temperature increased from 30 ◦ C to 94 ◦ C (Fig. 4b). Combining the data in Fig. 4a and b, we found that all the hybrids showed fluorescence intensities that were stable and directly correlated to the number of target copies from 30 ◦ C to 40 ◦ C. Complementary DNA oligonucleotide was excess, caused high fluorescence intensity from 30 ◦ C to 40 ◦ C, while the extracted RNA copies possibly were less than the MB, caused the low fluorescence intensities from 30 ◦ C to 40 ◦ C. MB hybridization occurred at low temperature probably because the hairpin stem of MB was less stable than the MB–target hybrids at lower temperatures and the MB–target hybrids formed spontaneously due to the thermal collision of molecules. Based on the results shown in Fig. 4, the phzC MB–target showed a higher signal to background ratio at temper-
314
D. Dong et al. / Journal of Biotechnology 145 (2010) 310–316
Fig. 3. The effect of formamide on phzC MB in buffer B7 (10 mM Tris, 100 mM KCl, 1 mM MgCl2 , pH 8.0). Control lines show fluorescent intensities with 0–50% formamide in the absence of MB.
atures under 40 ◦ C. We therefore chose 35 ◦ C as the hybridization temperature for further mRNA monitoring. 3.5. The linear curve of MB hybridization The best way to determine the linear curve of MB–RNA hybridization is to use natural or synthetic RNA as the standard. However, RNA is often rapidly degraded by ubiquitous RNase, which causes inaccuracies in standard curves. The normalization and standardization of RNA data is a serious problem in academic research (Nolan et al., 2006). Because one MB molecule can hybridize with only one molecule of DNA target or one molecule of RNA, the fluorescence intensity produced by DNA–MB hybrids should be directly proportional to that produced by RNA–MB hybrids. In addition, because the rate of change in the mRNA level is more important for process monitoring than the absolute number of mRNA copies, we chose to construct a calibration line using synthetic complementary DNA oligonucleotides as the standard for the determination of the limit of detection (LOD). Fig. 5a showed that the fluorescence intensity was linearly proportional to the concentration of DNA standard between 3.33 nM and 66.67 nM. The regression equation without the data for 0.8325 nM and 1.665 nM was y = 0.0767x + 0.8078 (r = 0.998). According to the fluorescence intensity (0.32) and the standard deviation (0.03) of control (without complementary DNA), the LOD of MB hybridization could be calculated as 1.665 nM. 3.6. Monitoring the changes in phzC mRNA level during fermentation Pseudomonas sp. M18G fermentation samples were collected after fermentation for 12, 24, 36, 48, 60, and 72 h. RNA extraction, PCA quantification [HPLC method (Li et al., 2008a,b)], and determination of viable cell numbers [dilution plate method (Li et al., 2008a,b)] were carried out simultaneously. The TRIZOL-extracted RNA pellets were dissolved in 29 L buffer B6, 1 L of 10 M phzC MB was added, and the mixture was incubated at 35 ◦ C. Complementary DNA oligonucleotide (6.67 nM and 33.33 nM) was used as a positive control, while RNA pellets kept for 2 days at room temperature to allow degradation by RNase were used as a negative control. Within 7 min, all the fluorescence intensities reached
Fig. 4. (a) Thermal denaturation profiles of MB with or without complementary DNA oligonucleotide in buffer B7. (b) Thermal denaturation profiles of MB with or without the extracted RNA in buffers B1, B5, B6, and B7. C1, C5, C6, and C7 indicate the profiles of MB without the extracted RNA in buffers B1, B5, B6, and B7. The experiments were performed three times.
a stable level. The averages of triplicate fluorescence intensity at 12, 24, 36, 48, 60, and 72 h were measured as 0.27, 0.88, 1.70, 0.85, 0.47, and 0.11 units, respectively. Because the RNA level is related only to the number of viable cells and not the volume of the fermentation sample, these fluorescence intensities were normalized according to the averages of triplicate viable cell counts (see Fig. 5c) and shown in Fig. 5b. The data shown in Fig. 5b indicate that the phzC mRNA level increased before 24 h, and then remained at its highest level from 24 to 36 h. After 36 h, the level decreased slightly at first, and then decreased even more as time went on. The decrease in phzC transcription during the late stationary phase of bacterial growth (after 48 h) has not been previously reported. By a SYBR Green I-based hybridization assay, we confirmed a similar tendency of phzC mRNA level during the fermentation process of Pseudomonas sp. M18G (Dong et al., 2009). The averages of triplicate PCA measurements were shown in Fig. 5d. The PCA level reached a high point during the late stationary phase of bacterial growth and later increased slightly (thus the fluorescence intensity at 72 h could be considered as the negative control for the cells that do not produce PCA).
D. Dong et al. / Journal of Biotechnology 145 (2010) 310–316
315
Fig. 5. (a) The calibration curve of phzC MB hybridization with complementary DNA oligonucleotide. (b) The kinetics of phzC transcription during the fermentation process of Pseudomonas sp. M18G. The Y-axis fluorescent units were standardized to 31.0 × 1010 cells using count of viable cells as denominator. Complementary DNA oligonucleotide at concentrations of 6.67 nM and 33.33 nM was used as the positive control and RNA pellets kept for 2 days in room temperature (to allow degradation by RNase) were used as a negative control. The experiments were performed six times. (c) The viable cell numbers during the fermentation process of Pseudomonas sp. M18G. The experiments were performed three times by standard dilution plate method. (d) The PCA accumulations during the fermentation process of Pseudomonas sp. M18G.
This suggests that the decrease in phzC transcription during the late stationary phase of bacterial growth was probably caused by feedback inhibition by PCA. 3.7. Specificity confirmation of phzC MB To confirm the specificity of the phzC MB we had designed, Pseudomonas sp. Q2-87 and Escherichia coli BL21 strain that do not produce PCA were used as a negative control. For the Pseudomonas sp. Q2-87 strain, the averages of triplicate fluorescence intensity at 12, 24, and 48 h were measured as 0.15, 0.18, and 0.16 units per 31.0 × 1010 cell, respectively. For the Escherichia coli BL21 strain, the averages of triplicate fluorescence intensity at 12, 24, and 48 h were measured as 0.19, 0.18, and 0.15 units per 31.0 × 1010 cells, respectively. All these data were very low and similar to the fluorescence intensity (0.19) at 72 h of Pseudomonas sp. M18G fermentation. It indicates that both the Pseudomonas sp. Q2-87 and Escherichia coli BL21 strains do not express the phzC gene and confirmed the specificity of our phzC MB. This study demonstrates that rapid monitoring of mRNA levels during fermentation using MB hybridization is feasible. The detection process involves only one step for RNA extraction and one step for MB hybridization. MB hybridization and mRNA quantification could be completed within 7 min and easily automated. The automation bottleneck is the RNA extraction procedure. Up to now, many RNA extraction methods have been invented (Korotky et al., 2007; Deng et al., 2005; Phongsisay et al., 2007). By comparison of these methods, the acid guanidinium
thiocyanate–phenol–chloroform (AGPC) method developed by Chomczynski and Sacchi (1987) appears to be the best one and has become widely used for isolating total RNA from biological samples from different sources (Chomczynski and Sacchi, 2006; Hagan et al., 2008; Li et al., 2006a,b). Commercial TRIZOL reagent is also based on this method. This study used the commercial TRIZOL reagent for RNA extraction. According to the protocol mentioned above, the isopropanol precipitation step took a longer time and automation of the high speed centrifugation was difficult. Fortunately, QIAGEN (Germany) has developed a wide range of silica-gel–membrane products that selectively bind RNA (http://www1.qiagen.com/resources/info). This silica column technology (Mutiu and Brandl, 2005) can be used in place of the isopropanol precipitation. Negative pressure filtration could be used in place of the high-speed centrifugation. Thus, our method can easily be automated and the entire detection time can be further shortened. The decrease phenomenon in phzC transcription during the late stationary phase of bacterial growth let us think one regulating site in the sequences upstream of the PCA operon phzABCDEFG probably existed. To follow up on this idea, our laboratory is currently carrying out the deletion mutagenesis. Using this approach, we hope to remove the inhibition and thereby make higher PCA yields possible. Our fermentation sample contained some tiny soybean particles. When the sample was taken out from the bioreactor for RNA extraction, these tiny particles had to be removed. According to our experiments, a 500-mesh sieve filtration was feasible. However, for automation design, the sieve filtration may cause some
316
D. Dong et al. / Journal of Biotechnology 145 (2010) 310–316
slow flowthrough and clogged sieve problems. Pre-filtration with a sieve of larger aperture and immediate cleaning of the clog material is recommended. Since production of most amine acids, organic acids, wines, antibiotics, and proteins relies on microbial fermentation, our method based on antibiotic phenazine-1-carboxylic acid fermentation may prove applicable to these other microbial industries. Acknowledgements This work was supported by the High-Tech Research and Development Program of China (863 Program) Nos. 2006AA02Z228, 2007AA02Z215, 2007AA100506, 2009ZX09306-008, the Key Program of Natural Science Foundation of China Nos. 30630012, 30821005, National Basic Research Program of China (973 Program) No. 2007CB936004, No. 2009CB118906, the Municipal Research Program of Shanghai No. 072312048 and Shanghai Leading Academic Discipline Project No. B203. References Ashton, K.J., Headrick, J.P., 2007. Quantitative (real-time) RT-PCR in cardiovascular research. Methods Mol. Biol. 366, 121–143. Becker, T., Hitzmann, B., Muffler, K., Pörtner, R., Reardon, K.F., Stahl, F., Ulber, R., 2007. Future aspects of bioprocess monitoring. Adv. Biochem. Eng. Biotechnol. 105, 249–293. Belon, C., Frick, D., 2008. Monitoring helicase activity with molecular beacons. Biotechniques 45, 433–440. Bonnet, G., Tyagi, S., Libchaber, A., Kramer, F.R., 1999. Thermodynamic basis of the enhanced specificity of structured DNA probes. Proc. Natl. Acad. Sci. 96, 6171–6176. Choi, C., Hudson, L.G., Savagner, P., Kusewitt, D.F., 2006. An in situ hybridization technique to detect low-abundance slug mRNA in adherent cultured cells. Methods Mol. Biol. 326, 173–188. Chomczynski, P., Sacchi, N., 1987. Single step method of RNA isolation by acid guanidinium thiocynate–phenol–chloroform extraction. Anal. Biochem. 162, 156–159. Chomczynski, P., Sacchi, N., 2006. The single-step method of RNA isolation by acid guanidinium thiocyanate–phenol–chloroform extraction: twenty-something years on. Nat. Protoc. 1, 581–585. Crey-Desbiolles, C., Ahn, D.R., Leuman, C.J., 2005. Molecular beacons with a homoDNA stem: improving target selectivity. Nucleic Acids Res. 33 (8), e77. Day, D.J., Mrkusich, E.M., Miller, J.H., 2007. Comparative quantitation of mRNA expression in the central nervous system using fluorescence in situ hybridization. Methods Mol. Biol. 353, 125–142. Deiman, B., Schrover, C., Moore, C., Westmoreland, D., van de Wiel, P., 2007. Rapid and highly sensitive qualitative real-time assay for detection of respiratory syncytial virus A and B using NASBA and molecular beacon technology. J. Virol. Methods 146, 29–35. Deng, M.Y., Wang, H., Ward, G.B., Beckham, T.R., McKenna, T.S., 2005. Comparison of six RNA extraction methods for the detection of classical swine fever virus by real-time and conventional reverse transcription–PCR. J. Vet. Diagn. Invest. 17, 574–578. Dong, D., Yan, A., Liu, H., Zhang, X., Xu, Y., 2006. Removal of humic substances from soil DNA using aluminium sulfate. J. Microbiol. Methods 66, 217–222. Dong, D., Li, J., Gao, Q., Huang, X., Xu, Y., Li, R., 2009. Utilizing RNA/DNA hybridization to directly quantify mRNA levels in microbial fermentation samples. J. Microbiol. Methods 79, 205–210.
Ge, Y., Huang, X., Wang, S., Zhang, X., Xu, Y., 2004. Phenazine-1-carboxylic acid is negatively regulated and pyoluteorin positively regulated by gacA in Pseudomonas sp M18. FEMS Microbiol. Lett. 237, 41–47. Hagan, K.A., Bienvenue, J.M., Moskaluk, C.A., Landers, J.P., 2008. Microchip-based solid-phase purification of RNA from biological samples. Anal. Chem. 80, 8453–8460. Hopkins, J.F., Woodson, A.S., 2005. Molecular beacons as probes of RNA unfolding under native conditions. Nucleic Acids Res. 33, 5763–5770. Horejsh, D., Martini, F., Poccia, F., Ippolito, G., Di Caro, A., Capobianchi, M.R., 2005. A molecular beacon, bead-based assay for the detection of nucleic acids by flow cytometry. Nucleic Acids Res. 33 (2), e13. Korotky, H.S.L., Kelly, L.A., Piltcher, O., Hebda, P.A., Doyle, W.J., 2007. Evaluation of microbial RNA extractions from Streptococcus Pneumoniae. J. Microbiol. Methods 68, 342–348. Li, B., Wang, B., Tang, K., Liang, Y., Wang, J., Wei, J., 2006a. A simple and convenient approach for isolating RNA from highly viscous plant tissue rich in polysaccharides. Colloids Surf. B: Biointerf. 49, 101–105. Li, X., Li, Z., Martí, A.A., Jockusch, S., Stevens, N., Akins, D.L., Turro, N.J., Ju, J., 2006b. Combinatorial fluorescence energy transfer molecular beacons for probing nucleic acid sequences. Photochem. Photobiol. Sci. 5, 896–902. Li, Y., Jiang, H., Xu, Y., Zhang, X., 2008a. Optimization of nutrient components for enhanced phenazine-1-carboxylic acid production by gacA-inactivated Pseudomonas sp M18G using response surface method. Appl. Microbiol. Biotechnol. 77, 1207–1217. Li, Y., Zhou, X., Ye, D., 2008b. Molecular beacons: an optimal multifunctional biological probe. Biochem. Biophys. Res. Commun. 373, 457–461. Liu, Z., Slininger, P.J., 2007. Universal external RNA controls for microbial gene expression analysis using microarray and qRT-PCR. J. Microbiol. Methods 68, 486–496. Martí, A.A., Jockusch, S., Li, Z., Ju, J., Turro, N.J., 2006. Molecular beacons with intrinsically fluorescent nucleotides. Nucleic Acids Res. 34 (6), e50. Mavrodi, O.V., Mavrodi, D.V., Thomashow, L.S., Weller, D.M., 2007. Quantification of 2,4-diacetylphloroglucinol-producing Pseudomonas fluorescens strains in the plant rhizosphere by real-time PCR. Appl. Environ. Microbiol. 73, 5531– 5538. Mavrodi, D.V., Bonsall, R.F., Delaney, S.M., Soule, M.J., Phillips, G., Thomashow, L.S., 2001. Functional analysis of genes for biosynthesis of pyocyanin and phenazine-1-carboxamide from Pseudomonas aeruginosa PAO1. J. Bacteriol. 183, 6454–6465. Mutiu, A.I., Brandl, C.J., 2005. RNA isolation from yeast using silica matrices. J. Biomol. Tech. 16, 316–317. Nadal, A., Coll, A., Cook, N., Pla, M., 2007. A molecular beacon-based real time NASBA assay for detection of Listeria monocytogenes in food products: role of target mRNA secondary structure on NASBA design. J. Microbiol. Methods 68, 623– 632. Nolan, T., Hands, R.E., Bustin, S.A., 2006. Quantification of mRNA using real-time RT-PCR. Nat. Protoc. 1, 1559–1582. Phongsisay, V., Perera, V.N., Fry, B.N., 2007. Evaluation of eight RNA isolation methods for transcriptional analysis in Campylobacter jejuni. J. Microbiol. Methods 68, 427–429. Qu, Y., Boutjdir, M., 2007. RNase protection assay for quantifying gene expression levels. Methods Mol. Biol. 366, 145–158. Silverman, A.P., Kool, E.T., 2005. Quenched probes for highly specific detection of cellular RNAs. Trends Biotechnol. 23, 225–230. Tsai, S.P., Wong, A., Mai, E., Chan, P., Mausisa, G., Vasser, M., Mogens, P.J., Stephan, J.P., 2003. Nucleic acid capture assay, a new method for direct quantitation of nucleic acids. Nucleic Acids Res. 31, e25. Tyagi, S., Kramer, F.R., 1996. Molecular beacons: probes that fluoresce upon hybridization. Nat. Biotechnol. 14, 303–308. VanGuilder, H.D., Vrana, K.E., Freeman, W.M., 2008. Twenty-five years of quantitative PCR for gene expression analysis. BioTechniques 44, 619–626. Yan, A., Huang, X., Liu, H., Dong, D., Zhang, D., Zhang, X., Xu, Y., 2007. An rhl-like quorum-sensing system negatively regulates pyoluteorin production in Pseudomonas sp M18. Microbiology-SGM 153, 16–28.
Contents lists available at ScienceDirect
Journal of Biotechnology journal homepage: www.elsevier.com/locate/jbiotec
Rapid monitoring of mRNA levels with a molecular beacon during microbial fermentation Dexian Dong 1 , Yanping Pang 1 , Qian Gao, Xianqing Huang, Yuquan Xu ∗ , Rongxiu Li MOE Key Laboratory of Microbial Metabolism, College of Life Science and Biotechnology, Shanghai Jiao Tong University, 800 Dongchuan Road, Shanghai 200240, China
a r t i c l e
i n f o
Article history: Received 8 February 2009 Received in revised form 15 November 2009 Accepted 18 November 2009 Keywords: Molecular beacon mRNA monitoring Hybridization condition Phenazine-1-carboxylic acid
a b s t r a c t In the microbial fermentation bioreactor, the processes of mRNA transcription, protein translation, and enzyme-catalyzed biosynthesis remain as “black boxes” of industrial monitoring and process control. Monitoring the kinetics of these “black boxes” is very helpful for optimizing and controlling the microbial fermentation process. This study first applied a molecular beacon (MB) to monitor the changes in the mRNA level of the phzC gene during antibiotic phenazine-1-carboxylic acid fermentation. Seven typical MB hybridization buffers were compared, and the effect of formamide on MBs was also studied. The results showed that rapid monitoring of the mRNA level using MBs was feasible. The optimal hybridization buffer for phzC MB was 100 mM Tris, 1 mM MgCl2 , pH 8.0. The optimal hybridization temperature was 35 ◦ C, and formamide proved unsuitable for MB hybridization. The limit of detection of phzC MB was 1.67 nM and MB hybridization was complete by 7 min. Given that the time for RNA extraction is 12 min, it is possible that monitoring of phzC mRNA can be completed in less than 20 min. Since production of most amine acids, organic acids, wines, antibiotics, and proteins relies on microbial fermentation, our method may have some potential for application in these other microbial industries. © 2009 Elsevier B.V. All rights reserved.
1. Introduction Microbial fermentation generally involves monitoring environmental parameters (e.g., pH and dissolved oxygen), product parameters, and biological parameters (e.g., cell density). On the other hand, the intracellular processes in the bioreactor, such as mRNA transcription and protein translation, have not been monitored (Becker et al., 2007). Yet the environmental variables of bioreactors indirectly affect product yield by influencing these intracellular biochemical processes. Until now there have been no reports on the monitoring of these intracellular activities during microbial fermentation. The long-term goal of this study is to significantly increase the product yields of microbial fermentation via process control of these intracellular activities. Examining and monitoring the kinetics and regulation of these intracellular activities are the first steps in this research plan. Of these processes of transcription, translation, and enzyme-catalyzed biosynthesis, we chose to begin by monitoring mRNA transcription because transcriptional regulation is the major mechanism for regulating the synthesis of gene products in bacteria.
∗ Corresponding author. Tel.: +86 21 34204207; fax: +86 21 34204207. E-mail addresses: [email protected] (D. Dong), [email protected] (Y. Xu). 1 These authors contributed equally to this work. 0168-1656/$ – see front matter © 2009 Elsevier B.V. All rights reserved. doi:10.1016/j.jbiotec.2009.11.013
To rapidly monitor transcription during fermentation, a simple and rapid method for quantitative detection of mRNA is necessary. A sufficiently fast detection time is critical. The classic mRNA quantification method is real-time quantitative RT-PCR (VanGuilder et al., 2008; Ashton and Headrick, 2007; Nolan et al., 2006). But realtime RT-PCR requires at least 1 h for the reverse transcription of mRNA and 2 h for the PCR amplification of cDNA. Consequently, the total detection time is too long for rapid monitoring. In addition, real-time RT-PCR suffers from problems such as the non-linear amplification bias of Taq enzyme, degradation of the RNA template, and difficult automation for rapid detection. Besides real-time RTPCR, RNase protection assays (Qu and Boutjdir, 2007), microarray studies (Liu and Slininger, 2007), and fluorescence in situ hybridization (Day et al., 2007) have also been used for mRNA quantification. Most of these methods suffer from at least one of the following disadvantages of being time-consuming, difficult to be automated for process fermentation, less sensitive than other techniques, expensive, or vulnerable to cross-contamination. A more recently developed method based on molecular beacons (MBs) (Li et al., 2008a,b) has been used to identify microorganisms, image intracellular gene expression (Crey-Desbiolles et al., 2005; Deiman et al., 2007), detect the transcriptional level of RNA in vitro (Belon and Frick, 2008; Hopkins and Woodson, 2005; Nadal et al., 2007), and measure the folding rates of RNA (Silverman and Kool, 2005). A molecular beacon is a stem-loop DNA oligonucleotide carrying a fluorophore and a quencher. In the absence of
D. Dong et al. / Journal of Biotechnology 145 (2010) 310–316
311
Table 1 Seven typical reported buffers for molecular beacon hybridization. NO.
Hybridization buffers
References
B1 B2 B3 B4 B5 B6 B7
100 mM Tris–HCl buffer, 5 mM MgCl2 , pH 8.0 4 × sodium chloride/sodium citrate (SSC), 0.1% SDS 10 mM phosphate-buffered saline, 150 mM NaCl, pH 7.0 20 mM Tris–HCl buffer, 50 mM NaCl, 5 mM MgCl2 , pH 7.6 10 mM Tris, 50 mM KCl, 3.5 mM MgCl2 , pH 8.0 100 mM Tris, 1 mM MgCl2 , pH 8.0 10 mM Tris, 100 mM KCl, 1 mM MgCl2 , pH 8.0
Martí et al. (2006) Tsai et al. (2003) Horejsh et al. (2005) Li et al. (2006a,b) Crey-Desbiolles et al. (2005) Tyagi and Kramer (1996) Bonnet et al. (1999)
RNA or DNA targets, the fluorophore and the quencher are held in close proximity to each other by the hairpin stem, and the molecular beacon does not fluoresce. When the MB encounters a target such as DNA or mRNA, it forms a probe–target hybrid that is longer and more stable than the stem hybrid. Consequently, the MB undergoes a spontaneous conformational reorganization, separating the fluorophore and quencher and thereby restoring fluorescence. The most attractive features of the MB-based method are that it occurs in a single-step, the hybridization time is short, and no enzyme is required. Theoretically, DNA/RNA hybridization involving short DNA oligonucleotides is very fast and specific. No enzyme involvement means there is no bias due to the particular enzymatic reaction, the signal of the MB–RNA hybrid need not be amplified or transformed, and the signal intensity is proportional to the amount of MB–target hybrid. In addition, it is easy to engineer a one-step liquid hybridization into a detection technology compatible with online process monitoring. Given that RNA purification can be complete within 12 min, we sought to design a method combining single-step RNA purification with one-step MB hybridization for the rapid detection of mRNA. Based on reports involving MB hybridization (Crey-Desbiolles et al., 2005; Deiman et al., 2007; Belon and Frick, 2008; Hopkins and Woodson, 2005; Nadal et al., 2007; Silverman and Kool, 2005; Bonnet et al., 1999; Horejsh et al., 2005; Li et al., 2006a,b; Martí et al., 2006; Tsai et al., 2003; Tyagi and Kramer, 1996), we found that MB hybridization conditions such as hybridization buffer, temperature, and time were all arbitrarily chosen. Seven typical hybridization buffers (see Table 1) had been reported but there are no explanations why these buffers were chosen. Thus, the systematic optimization of MB hybridization conditions was needed. Pseudomonas sp. M18 produces the antibiotics phenazine1-carboxylic acid (PCA) and pyoluteorin (Yan et al., 2007). Pseudomonas sp. M18G is a strain of this bacterium carrying a mutation in the regulatory gene GacA (Ge et al., 2004). The phzC gene is one component of the PCA biosynthetic operon phzABCDEFG and only have two copies in one single cell (Mavrodi et al., 2001), which encodes a phospho-2-keto-3-deoxyheptonate aldolase. The transcriptional level of phzC should correlate closely with PCA biosynthesis and yield because the phzC gene is one component of the PCA biosynthetic operon. The transcriptional copy numbers of phzC gene should be much larger than the DNA copy numbers of phzC gene. Because our laboratory had already initiated pilot-scale fermentation of Pseudomonas sp. M18G, we chose PCA fermentation of Pseudomonas sp. M18G as our research system and the phzC gene as our detection target to develop a MB-based method for rapid quantification of mRNA.
GCA CGA GCA GGT-3 ; and phzCr, 5 -CGG GTC GCT CAG CCA GAT CAC-3 . The genomic DNA of Pseudomonas sp. M18G grown in a fermentor was extracted and the phzC gene was amplified according to the protocol of Dong et al. (2006). The PCR product was submitted to the Invitrogen Corp. China for sequencing. The sequence of phzC gene was deposited in GenBank (accession number EF491207). 2.2. Design and synthesis of phzC MB and complementary DNA oligonucleotide Using the sequence of phzC gene EF491207, the DNA sequence from position 350 to position 374 was chosen as the loop of the phzC MB based on the evaluation of Oligo 6 and Primer Primer 5 software. GenBank BLAST was used to confirm the specificity of this chosen sequence. The designed MB was: 5 -(FAM)- GCCCGA GAGGTGCTCAACCCGGTGGCCTGCA TCGGGC (DABSYL)-3 , and its proposed secondary structure is shown in Fig. 1a. The designed complementary DNA oligonucleotide was 5 TGCAGGCCACCGGGTTGAGCACCTC-3 . MB and the complementary DNA oligonucleotide were synthesized at Invitrogen Corp. China. The phzC MB comprises a 37-nt stem-loop structure with a 6-nt complementary stem sequence and a 25-nt loop sequence. The fluorophore FAM and the quencher DABSYL were conjugated to the 5 and 3 ends, respectively. 2.3. Bacterial culture The seed cultures of Pseudomonas sp. M18G and Pseudomonas sp. Q2-87 [gift from Linda S. Thomashow, USDA-ARS, Washington, USA (Mavrodi et al., 2007)] were respectively grown by inoculating 50 mL King’s B broth with a single colony in a 250-mL flask and incubating at 28 ◦ C with shaking at 165 rpm. After 10 h of growth, 4.5 mL of the seed culture was transferred to a 500-mL flask containing 150 mL PCA-producing medium, and shaken at 165 rpm at 28 ◦ C.
2. Materials and methods 2.1. Sequencing of phzC Primers for PCR amplification of the phzC gene were designed using Oligo 6 software and the sequence of the Pseudomonas aeruginosa pyocyanine biosynthesis operon (GenBank accession number AF005404). The designed primer pairs were: phzCf, 5 -TTC CAA GCC
Fig. 1. (a) The proposed secondary structure of phzC MB. (b) The electrophoretic profile of total extracted RNA using a 1% agarose–TBE system.
312
D. Dong et al. / Journal of Biotechnology 145 (2010) 310–316
The King’s B broth contained 20 g L−1 peptone, 0.392 g L−1 K2 HPO4 , 0.732 g L−1 MgSO4 , and 15 mL glycerol. The pH value of the medium was adjusted to 7.5 before autoclaving. The PCA-producing medium contained 33 g L−1 soybean powder, 11 g L−1 soya peptone, 12 g L−1 glucose, 4 mL L−1 glycerol, and 13 mL L−1 ethanol. The pH value of medium was adjusted to 7.8–8.0 before autoclaving. The seed culture of Escherichia coli BL21 was grown by inoculating 50 mL LB broth with a single colony in a 250-mL flask and incubating at 28 ◦ C with shaking at 165 rpm. After 10 h of growth, 4.5 mL of the seed culture was transferred to a 500-mL flask containing 150 mL LB broth, and shaken at 165 rpm at 28 ◦ C. The LB broth contained 10 g L−1 peptone; 5 g L−1 yeast extract; 5 g L−1 NaCl, pH 7.5. 2.4. RNA extraction At different times during the fermentation, samples of 1 mL were withdrawn, filtered through a 500-mesh sieve to remove particulate residues in the fermentation medium, and centrifuged at 10,000 rpm and 4 ◦ C. The pellets were immediately frozen in liquid nitrogen and stored at −70 ◦ C. RNA extraction of the fermentation samples from different time points was conducted in parallel to reduce experimental variation. Trizol reagent (1 mL, TianGen Biotech Co., Ltd.) and 200 L chloroform was added to the frozen cell pellets. After vortexing for 1 min, the mixture was centrifuged for 2 min at 10,000 rpm and 4 ◦ C. The supernatant was transferred to a fresh tube and precipitated with 250 L of isopropanol and 250 L of concentrated salt (0.8 M tri-sodium citrate and 1.2 M sodium chloride) for 5 min at −20 ◦ C. After centrifugation for 2 min at 10,000 rpm and 4 ◦ C, The pellet was washed with 500 L of 80% (v/v) ethanol, then dried for 1 min with a hair dryer. Millipore Q water (treated by DEPC and autoclaved) or the MB hybridization buffer was used to dissolve the RNA pellet for further experimentation. RNA integrity and purity were checked on 1% agarose–TBE gels. 2.5. The linear curve construction of MB hybridization The phzC MB (330 nM) was mixed with the following concentrations (nM) of complementary DNA oligonucleotides: 0.8325, 1.665, 3.33, 6.67, 13.33, 26.67, 33.33, and 66.67. The mixtures were incubated at 35 ◦ C until the intensity reached a stable level; higher concentrations of standard required more time. The calibration curve was drawn by displaying the averages of triplicate fluorescence intensity measurements along the vertical axis and the concentrations of standard on the horizontal axis.
3. Results and discussion 3.1. RNA extraction Because RNA is easily degraded by ubiquitous RNase, extracting intact and pure total RNA from the fermenting sample is the first and most critical step for rapid quantification of mRNA. The traditional method for RNA extraction is the single-step acid phenol–guanidinium thiocyanate–chloroform extraction (Chomczynski and Sacchi, 2006). Commercial TRIZOL reagent is an improvement on this isolation method (http://www.invitrogen.com). In our laboratory, both commercial and self-made TRIZOL reagents have been used successfully and RNA extraction is performed daily. To ensure the standardization of our new MB procedure, we used commercial TRIZOL reagent for the MB hybridization with phzC mRNA. Fig. 1b shows that there was no DNA contamination between the sample loading well and the rRNA bands in our total RNA. The OD260 /OD280 of our total RNA was measured as 1.9. These results proved that our total RNA was pure. Using this procedure for RNA extraction, RNA could be extracted within 12 min. The degradation of total RNA is negligible because RNA is protected by the organic solvents during the entire extraction procedure, except for the 1-min air-drying to remove residual ethanol. 3.2. The choice of hybridization buffer To determine the optimal buffer for our MB hybridizations, seven typical hybridization buffers (see Table 1) were systematically examined in reactions involving complementary DNA oligonucleotide and extracted RNA. Fig. 2a shows changes in fluorescence intensity during MB hybridization with or without complementary DNA oligonucleotide in different buffers at 30 ◦ C during the first 10 min. Fig. 2c shows the results from similar experiments with or without the extracted RNA in different buffers at 35 ◦ C. The fluorescence intensities of MB without target (0.4–0.8 unit) in all seven buffers were much lower than those of the MB-target hybrid (4.3–11.5 units). The fluorescence intensities of both MB-target hybrids varied significantly across the seven buffers tested. Calculating the signal (S) to background (B) ratio showed that buffer B7 had the highest S:B (24.0) and the lowest background intensity (0.47 unit), and buffer B6 performed nearly as well as B7 during the hybridization of MB to complementary DNA oligonucleotide (Fig. 2b). Buffer B6 showed the highest S:B (11.7) and the lowest background intensity (0.25 unit) during hybridization of MB with extracted RNA (Fig. 2d). In light of the downstream steps for RNA hybridization and its similarity to buffer B7, buffer 6 was chosen for phzC mRNA hybridization.
2.6. MB hybridization 3.3. The effect of formamide on MB hybridization MB hybridization was carried out in a total volume of 30 L in microcentrifuge tubes from Axygen Scientific, Inc. MB (1 L of 10 M phzC MB) and the complementary DNA oligonucleotide (present in five-fold molar excess) were mixed in different hybridization buffers. The extracted RNA pellets were dissolved in 29 L of different buffer solutions and 1 L of 10 M phzC MB was added. The mixtures of phzC MB with total RNA or complementary DNA oligonucleotide were analyzed in a RG-3000A real-time PCR amplifier (Corbett Research, Italy). The temperature was increased in steps of 1 ◦ C from 30 ◦ C to 94 ◦ C, with each step lasting 1 min. To confirm that nonequilibrium hysteresis did not occur, the temperature was then decreased in 1 ◦ C steps from 94 ◦ C to 30 ◦ C, again with each step lasting 1 min. Fluorescence was measured during the last 30 s of each step. The excitation and emission wavelength of fluorescence were 470 nm and 510 nm, respectively.
Since RNA is easily degraded by RNase, which is exceptionally stable and ubiquitous in laboratories, we evaluated the effect of formamide addition to the MB buffer, a common reagent used to prevent RNA degradation and decrease the hybridization temperature (Choi et al., 2006). Fig. 3 shows the effect of formamide on phzC MB in buffer B7. At low temperatures such as 35 ◦ C, the fluorescence intensity of phzC MB increased significantly with increasing formamide concentration from 0% to 50%. The formamide may have opened up the MB and significantly increased the background intensity. At formamide concentrations less than 20%, the hybridization curves reflect the Tm of the nucleic acids. Indeed, the Tm for phzC MB decreased when the formamide concentration increased from 0% to 20%. It is not clear why the fluorescence intensity of phzC MB dropped when the temperature increased
D. Dong et al. / Journal of Biotechnology 145 (2010) 310–316
313
Fig. 2. The choice of hybridization buffer. (a) The fluorescence intensity changes and (b) signal to background ratio (S:B) of MB hybridization with or without complementary DNA oligonucleotide in seven different buffers at 30 ◦ C during 0–10 min. MB control lines indicate MB added without complementary DNA oligonucleotide. Buffer only lines indicate only buffers added without complementary DNA oligonucleotide and MB. (c) The fluorescence intensity changes and (d) signal to background ratio of MB hybridization with or without the extracted RNA in seven different buffers at 35 ◦ C during 0–10 min. Buffer control lines indicate MB added without the extracted RNA. S:B was calculated as: (Fopen − Fbuffer )/(Fclosed − Fbuffer ). Fbuffer , fluorescence intensity of buffer solution. Fclosed , fluorescence intensity of MB without target. Fopen , fluorescence intensity of MB hybridization with target. B1–B7 represent seven different buffers. All the experiments were performed three times.
from 70 ◦ C to 94 ◦ C. Because of the increased background intensity, we considered that formamide was not a suitable additive for MB hybridization. 3.4. The determination of hybridization temperature To determine the optimal hybridization temperature of phzC MB–mRNA hybrids, the thermal denaturation profiles of phzC MB with complementary DNA oligonucleotide and extracted RNA were studied (Fig. 4). In Fig. 4a, the fluorescence intensity in the absence of complementary DNA oligonucleotide showed a sigmoidal profile as the temperature increased from 30 ◦ C to 94 ◦ C. At lower temperatures, the phzC MB stem kept the fluorophore and quencher together so that very low fluorescence intensity was observed. Nevertheless, increasing temperature caused an increase in thermal motion. Thus, when the temperature reached the Tm value of phzC MB (65 ◦ C in Fig. 4a), the MB stem opened and emitted intense fluorescence. In the presence of the complementary
DNA oligonucleotide target, the fluorescence intensity of the phzC MB–complementary DNA hybrids was very high and it decreased slowly from 30 ◦ C to 94 ◦ C, consistent with the report of Bonnet et al. (1999). The fluorescence intensities with or without the extracted RNA in the four hybridization buffers mentioned above showed similar sigmoidal profiles as the temperature increased from 30 ◦ C to 94 ◦ C (Fig. 4b). Combining the data in Fig. 4a and b, we found that all the hybrids showed fluorescence intensities that were stable and directly correlated to the number of target copies from 30 ◦ C to 40 ◦ C. Complementary DNA oligonucleotide was excess, caused high fluorescence intensity from 30 ◦ C to 40 ◦ C, while the extracted RNA copies possibly were less than the MB, caused the low fluorescence intensities from 30 ◦ C to 40 ◦ C. MB hybridization occurred at low temperature probably because the hairpin stem of MB was less stable than the MB–target hybrids at lower temperatures and the MB–target hybrids formed spontaneously due to the thermal collision of molecules. Based on the results shown in Fig. 4, the phzC MB–target showed a higher signal to background ratio at temper-
314
D. Dong et al. / Journal of Biotechnology 145 (2010) 310–316
Fig. 3. The effect of formamide on phzC MB in buffer B7 (10 mM Tris, 100 mM KCl, 1 mM MgCl2 , pH 8.0). Control lines show fluorescent intensities with 0–50% formamide in the absence of MB.
atures under 40 ◦ C. We therefore chose 35 ◦ C as the hybridization temperature for further mRNA monitoring. 3.5. The linear curve of MB hybridization The best way to determine the linear curve of MB–RNA hybridization is to use natural or synthetic RNA as the standard. However, RNA is often rapidly degraded by ubiquitous RNase, which causes inaccuracies in standard curves. The normalization and standardization of RNA data is a serious problem in academic research (Nolan et al., 2006). Because one MB molecule can hybridize with only one molecule of DNA target or one molecule of RNA, the fluorescence intensity produced by DNA–MB hybrids should be directly proportional to that produced by RNA–MB hybrids. In addition, because the rate of change in the mRNA level is more important for process monitoring than the absolute number of mRNA copies, we chose to construct a calibration line using synthetic complementary DNA oligonucleotides as the standard for the determination of the limit of detection (LOD). Fig. 5a showed that the fluorescence intensity was linearly proportional to the concentration of DNA standard between 3.33 nM and 66.67 nM. The regression equation without the data for 0.8325 nM and 1.665 nM was y = 0.0767x + 0.8078 (r = 0.998). According to the fluorescence intensity (0.32) and the standard deviation (0.03) of control (without complementary DNA), the LOD of MB hybridization could be calculated as 1.665 nM. 3.6. Monitoring the changes in phzC mRNA level during fermentation Pseudomonas sp. M18G fermentation samples were collected after fermentation for 12, 24, 36, 48, 60, and 72 h. RNA extraction, PCA quantification [HPLC method (Li et al., 2008a,b)], and determination of viable cell numbers [dilution plate method (Li et al., 2008a,b)] were carried out simultaneously. The TRIZOL-extracted RNA pellets were dissolved in 29 L buffer B6, 1 L of 10 M phzC MB was added, and the mixture was incubated at 35 ◦ C. Complementary DNA oligonucleotide (6.67 nM and 33.33 nM) was used as a positive control, while RNA pellets kept for 2 days at room temperature to allow degradation by RNase were used as a negative control. Within 7 min, all the fluorescence intensities reached
Fig. 4. (a) Thermal denaturation profiles of MB with or without complementary DNA oligonucleotide in buffer B7. (b) Thermal denaturation profiles of MB with or without the extracted RNA in buffers B1, B5, B6, and B7. C1, C5, C6, and C7 indicate the profiles of MB without the extracted RNA in buffers B1, B5, B6, and B7. The experiments were performed three times.
a stable level. The averages of triplicate fluorescence intensity at 12, 24, 36, 48, 60, and 72 h were measured as 0.27, 0.88, 1.70, 0.85, 0.47, and 0.11 units, respectively. Because the RNA level is related only to the number of viable cells and not the volume of the fermentation sample, these fluorescence intensities were normalized according to the averages of triplicate viable cell counts (see Fig. 5c) and shown in Fig. 5b. The data shown in Fig. 5b indicate that the phzC mRNA level increased before 24 h, and then remained at its highest level from 24 to 36 h. After 36 h, the level decreased slightly at first, and then decreased even more as time went on. The decrease in phzC transcription during the late stationary phase of bacterial growth (after 48 h) has not been previously reported. By a SYBR Green I-based hybridization assay, we confirmed a similar tendency of phzC mRNA level during the fermentation process of Pseudomonas sp. M18G (Dong et al., 2009). The averages of triplicate PCA measurements were shown in Fig. 5d. The PCA level reached a high point during the late stationary phase of bacterial growth and later increased slightly (thus the fluorescence intensity at 72 h could be considered as the negative control for the cells that do not produce PCA).
D. Dong et al. / Journal of Biotechnology 145 (2010) 310–316
315
Fig. 5. (a) The calibration curve of phzC MB hybridization with complementary DNA oligonucleotide. (b) The kinetics of phzC transcription during the fermentation process of Pseudomonas sp. M18G. The Y-axis fluorescent units were standardized to 31.0 × 1010 cells using count of viable cells as denominator. Complementary DNA oligonucleotide at concentrations of 6.67 nM and 33.33 nM was used as the positive control and RNA pellets kept for 2 days in room temperature (to allow degradation by RNase) were used as a negative control. The experiments were performed six times. (c) The viable cell numbers during the fermentation process of Pseudomonas sp. M18G. The experiments were performed three times by standard dilution plate method. (d) The PCA accumulations during the fermentation process of Pseudomonas sp. M18G.
This suggests that the decrease in phzC transcription during the late stationary phase of bacterial growth was probably caused by feedback inhibition by PCA. 3.7. Specificity confirmation of phzC MB To confirm the specificity of the phzC MB we had designed, Pseudomonas sp. Q2-87 and Escherichia coli BL21 strain that do not produce PCA were used as a negative control. For the Pseudomonas sp. Q2-87 strain, the averages of triplicate fluorescence intensity at 12, 24, and 48 h were measured as 0.15, 0.18, and 0.16 units per 31.0 × 1010 cell, respectively. For the Escherichia coli BL21 strain, the averages of triplicate fluorescence intensity at 12, 24, and 48 h were measured as 0.19, 0.18, and 0.15 units per 31.0 × 1010 cells, respectively. All these data were very low and similar to the fluorescence intensity (0.19) at 72 h of Pseudomonas sp. M18G fermentation. It indicates that both the Pseudomonas sp. Q2-87 and Escherichia coli BL21 strains do not express the phzC gene and confirmed the specificity of our phzC MB. This study demonstrates that rapid monitoring of mRNA levels during fermentation using MB hybridization is feasible. The detection process involves only one step for RNA extraction and one step for MB hybridization. MB hybridization and mRNA quantification could be completed within 7 min and easily automated. The automation bottleneck is the RNA extraction procedure. Up to now, many RNA extraction methods have been invented (Korotky et al., 2007; Deng et al., 2005; Phongsisay et al., 2007). By comparison of these methods, the acid guanidinium
thiocyanate–phenol–chloroform (AGPC) method developed by Chomczynski and Sacchi (1987) appears to be the best one and has become widely used for isolating total RNA from biological samples from different sources (Chomczynski and Sacchi, 2006; Hagan et al., 2008; Li et al., 2006a,b). Commercial TRIZOL reagent is also based on this method. This study used the commercial TRIZOL reagent for RNA extraction. According to the protocol mentioned above, the isopropanol precipitation step took a longer time and automation of the high speed centrifugation was difficult. Fortunately, QIAGEN (Germany) has developed a wide range of silica-gel–membrane products that selectively bind RNA (http://www1.qiagen.com/resources/info). This silica column technology (Mutiu and Brandl, 2005) can be used in place of the isopropanol precipitation. Negative pressure filtration could be used in place of the high-speed centrifugation. Thus, our method can easily be automated and the entire detection time can be further shortened. The decrease phenomenon in phzC transcription during the late stationary phase of bacterial growth let us think one regulating site in the sequences upstream of the PCA operon phzABCDEFG probably existed. To follow up on this idea, our laboratory is currently carrying out the deletion mutagenesis. Using this approach, we hope to remove the inhibition and thereby make higher PCA yields possible. Our fermentation sample contained some tiny soybean particles. When the sample was taken out from the bioreactor for RNA extraction, these tiny particles had to be removed. According to our experiments, a 500-mesh sieve filtration was feasible. However, for automation design, the sieve filtration may cause some
316
D. Dong et al. / Journal of Biotechnology 145 (2010) 310–316
slow flowthrough and clogged sieve problems. Pre-filtration with a sieve of larger aperture and immediate cleaning of the clog material is recommended. Since production of most amine acids, organic acids, wines, antibiotics, and proteins relies on microbial fermentation, our method based on antibiotic phenazine-1-carboxylic acid fermentation may prove applicable to these other microbial industries. Acknowledgements This work was supported by the High-Tech Research and Development Program of China (863 Program) Nos. 2006AA02Z228, 2007AA02Z215, 2007AA100506, 2009ZX09306-008, the Key Program of Natural Science Foundation of China Nos. 30630012, 30821005, National Basic Research Program of China (973 Program) No. 2007CB936004, No. 2009CB118906, the Municipal Research Program of Shanghai No. 072312048 and Shanghai Leading Academic Discipline Project No. B203. References Ashton, K.J., Headrick, J.P., 2007. Quantitative (real-time) RT-PCR in cardiovascular research. Methods Mol. Biol. 366, 121–143. Becker, T., Hitzmann, B., Muffler, K., Pörtner, R., Reardon, K.F., Stahl, F., Ulber, R., 2007. Future aspects of bioprocess monitoring. Adv. Biochem. Eng. Biotechnol. 105, 249–293. Belon, C., Frick, D., 2008. Monitoring helicase activity with molecular beacons. Biotechniques 45, 433–440. Bonnet, G., Tyagi, S., Libchaber, A., Kramer, F.R., 1999. Thermodynamic basis of the enhanced specificity of structured DNA probes. Proc. Natl. Acad. Sci. 96, 6171–6176. Choi, C., Hudson, L.G., Savagner, P., Kusewitt, D.F., 2006. An in situ hybridization technique to detect low-abundance slug mRNA in adherent cultured cells. Methods Mol. Biol. 326, 173–188. Chomczynski, P., Sacchi, N., 1987. Single step method of RNA isolation by acid guanidinium thiocynate–phenol–chloroform extraction. Anal. Biochem. 162, 156–159. Chomczynski, P., Sacchi, N., 2006. The single-step method of RNA isolation by acid guanidinium thiocyanate–phenol–chloroform extraction: twenty-something years on. Nat. Protoc. 1, 581–585. Crey-Desbiolles, C., Ahn, D.R., Leuman, C.J., 2005. Molecular beacons with a homoDNA stem: improving target selectivity. Nucleic Acids Res. 33 (8), e77. Day, D.J., Mrkusich, E.M., Miller, J.H., 2007. Comparative quantitation of mRNA expression in the central nervous system using fluorescence in situ hybridization. Methods Mol. Biol. 353, 125–142. Deiman, B., Schrover, C., Moore, C., Westmoreland, D., van de Wiel, P., 2007. Rapid and highly sensitive qualitative real-time assay for detection of respiratory syncytial virus A and B using NASBA and molecular beacon technology. J. Virol. Methods 146, 29–35. Deng, M.Y., Wang, H., Ward, G.B., Beckham, T.R., McKenna, T.S., 2005. Comparison of six RNA extraction methods for the detection of classical swine fever virus by real-time and conventional reverse transcription–PCR. J. Vet. Diagn. Invest. 17, 574–578. Dong, D., Yan, A., Liu, H., Zhang, X., Xu, Y., 2006. Removal of humic substances from soil DNA using aluminium sulfate. J. Microbiol. Methods 66, 217–222. Dong, D., Li, J., Gao, Q., Huang, X., Xu, Y., Li, R., 2009. Utilizing RNA/DNA hybridization to directly quantify mRNA levels in microbial fermentation samples. J. Microbiol. Methods 79, 205–210.
Ge, Y., Huang, X., Wang, S., Zhang, X., Xu, Y., 2004. Phenazine-1-carboxylic acid is negatively regulated and pyoluteorin positively regulated by gacA in Pseudomonas sp M18. FEMS Microbiol. Lett. 237, 41–47. Hagan, K.A., Bienvenue, J.M., Moskaluk, C.A., Landers, J.P., 2008. Microchip-based solid-phase purification of RNA from biological samples. Anal. Chem. 80, 8453–8460. Hopkins, J.F., Woodson, A.S., 2005. Molecular beacons as probes of RNA unfolding under native conditions. Nucleic Acids Res. 33, 5763–5770. Horejsh, D., Martini, F., Poccia, F., Ippolito, G., Di Caro, A., Capobianchi, M.R., 2005. A molecular beacon, bead-based assay for the detection of nucleic acids by flow cytometry. Nucleic Acids Res. 33 (2), e13. Korotky, H.S.L., Kelly, L.A., Piltcher, O., Hebda, P.A., Doyle, W.J., 2007. Evaluation of microbial RNA extractions from Streptococcus Pneumoniae. J. Microbiol. Methods 68, 342–348. Li, B., Wang, B., Tang, K., Liang, Y., Wang, J., Wei, J., 2006a. A simple and convenient approach for isolating RNA from highly viscous plant tissue rich in polysaccharides. Colloids Surf. B: Biointerf. 49, 101–105. Li, X., Li, Z., Martí, A.A., Jockusch, S., Stevens, N., Akins, D.L., Turro, N.J., Ju, J., 2006b. Combinatorial fluorescence energy transfer molecular beacons for probing nucleic acid sequences. Photochem. Photobiol. Sci. 5, 896–902. Li, Y., Jiang, H., Xu, Y., Zhang, X., 2008a. Optimization of nutrient components for enhanced phenazine-1-carboxylic acid production by gacA-inactivated Pseudomonas sp M18G using response surface method. Appl. Microbiol. Biotechnol. 77, 1207–1217. Li, Y., Zhou, X., Ye, D., 2008b. Molecular beacons: an optimal multifunctional biological probe. Biochem. Biophys. Res. Commun. 373, 457–461. Liu, Z., Slininger, P.J., 2007. Universal external RNA controls for microbial gene expression analysis using microarray and qRT-PCR. J. Microbiol. Methods 68, 486–496. Martí, A.A., Jockusch, S., Li, Z., Ju, J., Turro, N.J., 2006. Molecular beacons with intrinsically fluorescent nucleotides. Nucleic Acids Res. 34 (6), e50. Mavrodi, O.V., Mavrodi, D.V., Thomashow, L.S., Weller, D.M., 2007. Quantification of 2,4-diacetylphloroglucinol-producing Pseudomonas fluorescens strains in the plant rhizosphere by real-time PCR. Appl. Environ. Microbiol. 73, 5531– 5538. Mavrodi, D.V., Bonsall, R.F., Delaney, S.M., Soule, M.J., Phillips, G., Thomashow, L.S., 2001. Functional analysis of genes for biosynthesis of pyocyanin and phenazine-1-carboxamide from Pseudomonas aeruginosa PAO1. J. Bacteriol. 183, 6454–6465. Mutiu, A.I., Brandl, C.J., 2005. RNA isolation from yeast using silica matrices. J. Biomol. Tech. 16, 316–317. Nadal, A., Coll, A., Cook, N., Pla, M., 2007. A molecular beacon-based real time NASBA assay for detection of Listeria monocytogenes in food products: role of target mRNA secondary structure on NASBA design. J. Microbiol. Methods 68, 623– 632. Nolan, T., Hands, R.E., Bustin, S.A., 2006. Quantification of mRNA using real-time RT-PCR. Nat. Protoc. 1, 1559–1582. Phongsisay, V., Perera, V.N., Fry, B.N., 2007. Evaluation of eight RNA isolation methods for transcriptional analysis in Campylobacter jejuni. J. Microbiol. Methods 68, 427–429. Qu, Y., Boutjdir, M., 2007. RNase protection assay for quantifying gene expression levels. Methods Mol. Biol. 366, 145–158. Silverman, A.P., Kool, E.T., 2005. Quenched probes for highly specific detection of cellular RNAs. Trends Biotechnol. 23, 225–230. Tsai, S.P., Wong, A., Mai, E., Chan, P., Mausisa, G., Vasser, M., Mogens, P.J., Stephan, J.P., 2003. Nucleic acid capture assay, a new method for direct quantitation of nucleic acids. Nucleic Acids Res. 31, e25. Tyagi, S., Kramer, F.R., 1996. Molecular beacons: probes that fluoresce upon hybridization. Nat. Biotechnol. 14, 303–308. VanGuilder, H.D., Vrana, K.E., Freeman, W.M., 2008. Twenty-five years of quantitative PCR for gene expression analysis. BioTechniques 44, 619–626. Yan, A., Huang, X., Liu, H., Dong, D., Zhang, D., Zhang, X., Xu, Y., 2007. An rhl-like quorum-sensing system negatively regulates pyoluteorin production in Pseudomonas sp M18. Microbiology-SGM 153, 16–28.