RCC2 promotes proliferation and radio-resistance in glioblastoma via activating transcription of DNMT1

Biochemical and Biophysical Research Communications 516 (2019) 999e1006

Contents lists available at ScienceDirect

Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc

RCC2 promotes proliferation and radio-resistance in glioblastoma via activating transcription of DNMT1 Hai Yu a, Suojun Zhang b, Ahmed N. Ibrahim c, Jia Wang a, Zhong Deng a, Maode Wang a, * a

Department of Neurosurgery, The First Affiliated Hospital of Xi'an Jiaotong University, Xi'an, Shaanxi, 710061, China Department of Neurosurgery, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, 430073, China c Department of Neurology, SUNY Upstate Medical University, Syracuse, NY, USA b

a r t i c l e i n f o

a b s t r a c t

Article history: Received 16 June 2019 Accepted 18 June 2019 Available online 2 July 2019

Regulator of chromosome condensation 2 (RCC2) is a regulator of cell-cycle progression linked in multiple cancers to pro-tumorigenic phenomena including promotion of tumor growth, tumor metastases and poorer patient prognoses. However, the role of RCC2 in GBM remains under-investigated. Here, we sought to determine the relevance of RCC2 in GBM, as well as its roles in GBM development, progression and prognosis. Initial clinical evaluation determined significant RCC2 enrichment in GBM when compared to normal brain tissue, and elevated expression was closely associated with a poorer prognosis in glioma patients. Via shRNA inhibition, we determined that RCC2 is essential to tumor proliferation and tumorigenicity in vitro and in vivo. Additionally, RCC2 was determined to promote radioresistance of GBM tumor cells. Investigation of the underlying mechanisms implicated DNA mismatch repair, JAK-STAT pathway and activated transcription of DNA methyltransferase 1 (DNMT1). For validation, pharmacologic inhibition via administration of a DNMT1 inhibitor demonstrated attenuated GBM tumor growth both in vitro and in vivo. Collectively, this study determined a novel therapeutic target for GBM in the form of RCC2, which plays a pivotal role in GBM proliferation and radio-resistance via regulation of DNMT1 expression in a p-STAT3 dependent manner. © 2019 Elsevier Inc. All rights reserved.

Keywords: Glioblastoma RCC2 Tumorigenesis DNMT1 Radio-resistance

1. Introduction Glioblastoma (GBM) is the most common and fatal brain tumor with a median survival of 15 months [1]. Despite multi-modal approaches involving aggressive surgical resection and concurrent and adjuvant chemo-radiotherapy, patient prognostic milestones have minimally improved [2]. Novel therapeutic approaches targeting key oncogenic pathways must be developed in order to combat the adaptive therapeutic resistance of GBM cells. The cell-cycle gene regulator “chromosome condensation 2 regulator (RCC2)”, also known as TD-60, was initially reported to function at the spindle midzone in anaphase and telophase [3]. Sharing significant similarity with RCC1 [4], a known guanine nucleotide exchange factor (GEF) for Ran, RCC2 exhibits GEG activity for the small GTPases Rac1 [4] and RalA [5]. In addition to its role in mitosis, RCC2 also revealed functions in cellular migration

* Corresponding author. Department of Neurosurgery, The First Affiliated Hospital of Xi'an Jiaotong University, Xi'an, Shaanxi, China. E-mail address: [email protected] (M. Wang). https://doi.org/10.1016/j.bbrc.2019.06.097 0006-291X/© 2019 Elsevier Inc. All rights reserved.

[6]. RCC2, via regulating Rac1 and Arf6, is also associated with the integrin adhesion complexes during interphase [7]. Moreover, analysis of human embryonic stem cell lines revealed that RCC2 is associated with the stemness signature [8]. Recently, RCC2 has been recognized as a tumor oncogene in multiple cancers, with conferred risk in melanoma [9] and cutaneous basal cell carcinoma [10]. In gastric carcinomas, RCC2 was reported to be highly expressed and associated with tumor proliferation, which is negatively regulated by MiR-29c [11]. Mutation analysis in colorectal cancer demonstrated that RCC2 was a cancer biomarker with strong prognostic value [12]. Overexpression of RCC2 in lung adenocarcinoma was reported to be associated with higher cell motility and epithelial-mesenchymal transition [13], which is partially regulated by LncRNA LCPAT1 [14]. Study of chemotherapeutic response found that RCC2 regulated the apoptosis process by blocking Rac1 signaling in lung and ovarian cancer, conferring resistance in drug treatment [15]. However, the potential correlation between RCC2 and GBM progression is still unclear. In this study, we determined that RCC2 is highly expressed in GBM, with elevated expression being closely associated with a poor prognosis in glioma patients. Silencing of RCC2 attenuated the

1000

H. Yu et al. / Biochemical and Biophysical Research Communications 516 (2019) 999e1006

proliferation and increased radio-sensitivity of GBM tumor cells. We further determined that RCC2 activated the transcription of DNMT1 and inhibition of DNMT1 suppressed the growth of GBM tumor cells.

protein block solution and incubated with corresponding primary antibodies overnight at 4
C. Next day slides were stained with EnVision þ System e HRP labeled Polymer (Dako) and visualized with DAB peroxidase substrate kit (Vector Laboratories). Signals were detected using microscope (Olympus DP71).

2. Material and methods 2.1. Ethics The usage of cell lines and experimental animals (nude and SCID mice) was approved by the Scientific Ethics Committee of Xi'an Jiaotong University, Xi'an, China. The patient samples have obtained patient consent. 2.2. Reagents and antibodies DMEM-F12, Fetal bovine serum (FBS), Penicillin-Streptomycin, Trypsin-EDTA (Thermo scientific). Anti-RCC2 (5104s), anti-b-Actin (3700), anti-COX IV (4850s), anti-Ki67 (9027s), anti-STAT3 (9139s), anti-p-STAT3 (9145s), SignalStain® Boost IHC Detection Reagent (8114s) (Cell signaling), anti-rabbit IgG-Horseradish peroxidase (NA934V), anti-mouse IgG-Horseradish peroxidase (NXA931) (GE Healthcare). 2.3. In vitro cell cultures Glioma cell lines U373, U87 and U251 are provided by Xi'an Jiaotong University. Cell lines were cultivated in DMEM/F12 medium containing 10% FBS supplement (vol%), 1% PenicillinStreptomycin solution and the cultural medium was changed every 4e8 days. 2.4. RNA isolation and quantitative real-time PCR mRNA was isolated by Trizol (Thermo scientific) according to the manufacturer's protocol. cDNA was synthesized by using iScript reverse transcription supermix (Bio-Rad) according to the manufacturer's protocol. qPCR was performed on StepOnePlus thermal cycler with SYBR Select Master Mix (Thermo scientific). The primer sequences: RCC2 forward: AAGGAGCGCGTCAAACTTGAA; reverse: GCTTGCTGTTTAGGCACTTCTT; DNMT1 forward: AGGCGGCTCAAAGATTTGGAA; reverse: GCAGAAATTCGTGCAAGAGATTC; GAPDH forward: GGAGCGAGATCCCTCCAAAAT; reverse: GGCTGTTGT CATACTTCTCATGG. 2.5. Western blot Cells were lysed on ice in RIPA buffer containing 1% protease and 1% phosphatase inhibitor cocktail (Sigma). Protein concentration was determined by Bradford method. Equal amounts of protein lysates (10 mg/lane) were fractionated by NuPAGE Novex 4e12% BisTris Protein gel and transferred to a PVDF membrane (Thermo scientific). The membrane was blocked with 5% Blotting Grade Blocker Non Fat Dry Milk (Bio-Rad) for 1 h and then incubated with corresponding primary antibody overnight and next incubated with peroxidase conjugated secondary antibodies for 1 h. Staining was visualized with Amersham ECL Western Blot System. 2.6. Immunohistochemistry Tumors paraffin blocks were deparaffinized, and hydrated through an ethanol series. After microwave antigen retrieval in DakoCytomation target retrieval solution pH 6, slides were incubated in 0.3% hydrogen peroxide solution in methanol for 15 min at room temperature. Next samples were blocked with serum-free

2.7. Cell viability assay Viability of tumor cells was determined using AlamarBlue reagent (Thermo scientific). Cells were seeded at 1000 cells per well in a 96 well plate, after indicated period of time AlamarBlue reagent was added into each well and 6 h later fluorescence was measured (Excitation 515e565 nm, Emission 570e610 nm) using Synergy HTX multi-mode reader (BioTek). 2.8. In vivo intracranial xenograft tumor models 6e8 weeks old SCID or nude mice were used. The tumor cells suspension (1  105 cells in 5 ml of PBS) was injected into the brains of mouse. Drug treatment (Decitabine, Selleckchem (1 mg/kg, 100 ml PBS for each mouse)) was done through intraperitoneal injection (IP) method 1 week after injection of tumor cells. When neuropathological symptoms developed, mice were sacrificed and brains were dissected. 2.9. Lentivirus production and transduction HEK293FT cells were transfected with the vectors (Sigma) and two packaging plasmids psPAX2 and pMGD2) using the CalPhos Mammalian Transfection Kit (Clontech) according to the manufacturer's protocol. GBM cells were incubated with viral supernatants for 24 h in the presence of 8 mg/ml polybrene. shRNA sequence: RCC2 NM_018715.1e516s1c1 CCGGGCGTCAAACTTGAAGGGTCAACTCGAGTTGACCCTTCAAGTTTGACGCTTTTTTG (#1), NM_018715.1e1750s1c1 CCGGGACTGAGAAAGAGAAGATCAACTCGAGTTGATCTTCTCTTTCTCAGTCTTTTTTG (#2), NM_018715.1e1099s1c1 CCGGCAACTCAGATGGGAAGTT CATCTCGAGATGAACTTCCCATCTGAGTTGTTTTTTG (#3). (Sigma). 2.10. Flow cytometry For apoptosis assay cells were stained with Alexa Fluor® Annexin V/Dead Cell Apoptosis Kit according to the manufacturer's protocol. After staining samples were analyzed by Attune NxT Flow Cytometer. (Thermo scientific). 2.11. Chromatin immunoprecipitation Chromatin immunoprecipitation was performed according to the manufacturer's protocol. Bioruptor UCD-200 was used for sonication of DNA and 200,000 cells were applied for following each reaction. Promoter sequence: forward: CCCACCTAAGGTCGTATAGCC, reverse GTCCAGCTCCACGTTTCCT. 2.12. In vivo bioluminescent imaging GBM cells were transduced with lentiviral particles (pHAGE PGK-GFP-IRES-LUC-W) for co-expression of GFP and luciferase, and then GFP-expressing cells were sorted by FACS. Animals were administrated intraperitoneally with 2.5 mg/100 ml solution of XenoLight D-luciferin (PerkinElmer) and anesthetized with isoflurane for the imaging analysis. IVIS 100 imaging system (PerkinElmer).

H. Yu et al. / Biochemical and Biophysical Research Communications 516 (2019) 999e1006

2.13. Gene expression data analysis The data of shared Datasets (Obtain date: 2019.03.11) were download from http://gliovis.bioinfo.cnio.es/. Gene set Enrichment Analysis was performed using available online software (http:// software.broadinstitute.org/gsea/index.jsp).

1001

Statistical analysis was performed by Prism 6 (GraphPad Software). p < 0.05 was considered as Statistically significant. 3. Results 3.1. RCC2 expression is enriched in GBM and is associated with poorer prognosis

2.14. Statistical analysis All data are presented as mean ± SD. Statistical differences between two groups were evaluated by two tailed t-test. The comparison among multiple groups was performed by one-way ANOVA analysis of variance followed by Dunnett's posttest. The Statistical significance of KaplaneMeier survival plot was determined by logrank analysis. A Statistical correlation was performed to calculate the regression R2 value and Pearson's correlation coefficient.

In order to investigate the expression of RCC2 in gliomas and determine potential clinical relevance, RCC2 mRNA levels were analyzed in four publicly-available datasets (Rembrandt, Gravendeel [16], Kamoun [17] and TCGA). RCC2 expression was significantly elevated in gliomas compared to normal brain tissue, with direct correlation to grade of malignancy (highest expression in WHO Grade IV gliomas (GBM)) (Fig. 1A). Additionally, RCC2 expression was significantly elevated in all four molecular subtypes

Fig. 1. RCC2 expression is enriched in GBM and results in a poor prognosis. (A) Analysis of mRNA expression of RCC2 in glioma tumor and normal brain from indicated datasets. ***p < 0.001. (B) Analysis of RCC2 protein expression in high- and low-grade gliomas and normal brain in the Human Protein Atlas dataset. Scale bars indicate 200/20 mm respectively. (C) qRT-PCR comparing RCC2 mRNA expression in 3 GBM cell lines (U373, U87, U251); n ¼ 3. (D) Western blot (WB) analysis of RCC2 protein expression in 3 GBM cell lines and 1 GBM tissue sample. (E) Kaplan-Meier curve comparing overall survival of glioma patients according to expression of RCC2 in indicated datasets. p < 0.05, log-rank test.

1002

H. Yu et al. / Biochemical and Biophysical Research Communications 516 (2019) 999e1006

of GBM (classical, mesenchymal, neural and proneural (PN)), with greatest expression attributed to the proneural phenotype (Fig. 1A). Interrogation of the Human Protein Atlas (THPA) confirmed elevated RCC2 enrichment in high grade gliomas compared to both low grade counterparts and normal brain tissue (Fig. 1B). Comparison of the expression of RCC2 between these GBM cell lines via real-time quantitative PCR (qRT-PCR) and Western blot (WB) determined that RCC2 was expressed in all (Fig. 1C and D). For clinical correlation, overall survival of glioma patients was stratified from four datasets according to tumor expression of RCC2, which revealed that high-RCC2 expression leads to significantly poorer outcomes compared to their low-RCC2 counterparts (Fig. 1E). Collectively, these data indicate that RCC2 is preferentially expressed in gliomas in a tumor grade-dependent manner, and is associated with significantly poorer survival of glioma patients.

which indicated significantly reduced expression of RCC2 in shRCC2 group on both mRNA (Fig. 2A) and protein levels (Fig. 2B), with greatest efficacy in shRCC2#3. RCC2 silencing attenuated the rate of proliferation of GBM tumor cells compared to the shNT group (Fig. 2C). For in vivo correlation, shNT or shRCC2 U373 tumor cells were intracranially injected in SCID mice. Bioluminescence imaging (BLI) revealed that silencing of RCC2 attenuated the tumor formation ability of GBM tumor cells (Fig. 2D) and significantly prolonged survival was observed in the shRCC2 group (Fig. 2E). Comparison of tumor size via immunohistochemistry staining (IHC) for human mitochondria demonstrated significantly higher tumorgenicity of shNT group (Fig. 2F). These data indicate that RCC2 is essential to GBM cell proliferation in vitro and tumor formation in vivo.

3.2. Silencing RCC2 attenuates proliferation and tumorigenicity of GBM

Given the predominant reliance on irradiation (IR) for therapeutic management of GBM following surgical resection [1], we investigated whether RCC2 is associated with radioresistance in GBM. Gene set enrichment analyses (GSEA) was utilized to analyze pathway alterations in RCC2-high and RCC2-low patient samples. The cell cycle, mismatch repair [18] and JAK-STAT [19] pathways were enriched in the RCC2-high group, suggesting the function of

Next, we sought to examine the biological role of RCC2 in GBM. Transduction of GBM cell lines (U373 and U87) was performed with non-target (shNT) or RCC2-targeting (shRCC2, #1, #2 and #3) lentivirus. Silencing efficacy was evaluated via qRT-PCR and WB,

3.3. Silencing RCC2 decreases radioresistance of GBM cells

Fig. 2. Silencing of RCC2 attenuated proliferation and tumorigenicity of GBM cells. (A) qRT-PCR analysis of RCC2 mRNA expression in 2 GBM cells (U373, U87) treated with NTshRNA or RCC2-shRNA. n ¼ 3. (B) WB for RCC2 protein expression in U373 GBM cell line, treated with NT-shRNA or RCC2-shRNA. (C) In vitro cell viability assay of U373 and U87 GBM cells treated with either NT-shRNA or RCC2-shRNA. ***p < 0.001; n ¼ 3. (D) Bioluminescence images (BLI) of mice intracranially injected with luciferase-labeled U373 GBM cells pretreated with either NT-shRNA or RCC2-shRNA#2 on day 10. ***p < 0.001. (E) Kaplan-Meier curve comparing overall survival of mice intracranially injected with U373 GBM cells pretreated with either NT-shRNA or RCC2-shRNA#3. p ¼ 0.0067. (F) IHC staining of mouse brains injected with U373 GBM cells pre-treated with either NT-shRNA or RCC2-shRNA#3 for human mitochondria. Scale bar 2 mm.

H. Yu et al. / Biochemical and Biophysical Research Communications 516 (2019) 999e1006

RCC2 in promoting proliferation and radio-resistance in GBM (Fig. 3A) To verify, shNT and shRCC2 U373 and U87 tumor cells were treated with IR, followed by in vitro growth analysis. Significantly greater cytotoxicity was observed following combined IR and shRCC2 silencing, compared with shNT group (Fig. 3B). Elevated rate of apoptosis was further confirmed in shRCC2 U373 tumor cells via flow cytometry (FACS) (Fig. 3C). To verify in vivo, the previously demonstrated intracranial xenograft model (Fig. 2) was applied. Nude mice were treated with IR 1 week after injection of U373

1003

tumor cells. Subsequent analysis of overall survival indicated that combination of RCC2 silencing and IR contributed to significantly improved outcomes (Fig. 3D). All together, these data indicate that RCC2 promotes radioresistance of GBM tumor cells.

3.4. RCC2 regulates transcription of DNMT1 in GBM and inhibition of DNMT1 suppresses GBM cell growth Next, we analyzed potential downstream targets of RCC2 in

Fig. 3. Silencing of RCC2 decreased radioresistance of GBM cells. (A) Gene set enrichment analysis (GSEA) of patient samples from TCGA dataset that were sub-grouped by expression of RCC2. (B) In vitro cell viability assay of U373 and U87 GBM cells treated with/without IR after pre-treatment with either NT-shRNA or RCC2-shRNA. ***p < 0.001; n ¼ 3. (C) Representative flow cytometry analysis for Annexin V/Propidium Iodide (PI) using U373 GBM cells treated with/without IR after pre-treatment with either NT-shRNA or RCC2shRNA. (D) Kaplan-Meier curve comparing overall survival of mice intracranially injected with U373 GBM cells pre-treated with either NT-shRNA or RCC2-shRNA, the mice were treated with/without IR.

1004

H. Yu et al. / Biochemical and Biophysical Research Communications 516 (2019) 999e1006

GBM. Based on correlation analyses of TCGA and Rembrandt datasets, DNMT1 was found to be highly associated with RCC2 (Fig. 4A). Silencing of RCC2 induced significant reduction of DNMT1 expression in U373 tumor cells, determined via qRT-PCR (Fig. 4B). Consistent with the GSEA findings, p-STAT3 was also decreased in shRCC2 group compared with shNT control (Fig. 4C). To investigate whether p-STAT3 plays a role in regulating transcription activation of DNMT1, chromatin immunoprecipitation (ChIP) was performed. Clear occupancy of p-STAT3 at the DNMT1 promoter region was demonstrated, and silencing RCC2 significantly decreased the occupancy of p-STAT3 (Fig. 4D). Finally, we sought to challenge our findings with in vitro and in vivo GBM therapeutic models. The DNMT1 inhibitor, decitabine,

was used to investigate the efficacy of pharmacological DNMT1 inhibition on the growth of GBM tumor cells. In vitro cell viability assays demonstrated relatively high sensitivity of glioma cell lines to decitabine, with IC50 around 0.1 mM (Fig. 4E). To confirm in vivo, mice were treated with decitabine 2 weeks after injection of U373 tumor cells. BLI indicated that decitabine significantly attenuates the in vivo tumor formation ability of U373 tumor cells (Fig. 4F), further evidenced by decreased Ki67 expression in the decitabine treated group (Fig. 4G). Cell viability assay of U373 GBM cells infected with either shNT or shRCC2 was performed in the presence of decitabine, and indicated that RCC2 and DNMT1 functioned in an epistatic manner, rather than synergistically (Fig. 4H). Collectively, our findings indicate that RCC2 regulates the transcription of

Fig. 4. RCC2 regulated transcription of DNMT1 in GBM and inhibition of DNMT1 suppressed the growth of GBM cells. (A) Correlation analysis of RCC2 with DNMT1 in TCGA and Rembrandt datasets. (B) qRT-PCR analysis of RCC2 and DNMT1 mRNA expression in U373 treated with either NT-shRNA or RCC2-shRNA. **p < 0.01, *p < 0.05; n ¼ 3. (C) WB analysis of DNMT1 and p-STAT3 protein expression in U373 treated with either NT-shRNA or RCC2-shRNA. (D) ChIP analysis showing enrichment of p-STAT3 at DNMT1 promoter in U373 GBM cells pre-treated with either NT-shRNA or RCC2-shRNA; ud, undetected. ***p < 0.001. (E) In vitro cell viability assay of U373, U87 and U251 GBM cells treated with DMSO or decitabine at multiple concentrations. (F) BLI of mice intracranially injected with luciferase-labeled U373 GBM cell on day 30; mice were treated with Placebo or decitabine. (G) IHC staining of mouse brains injected with U373 GBM cells treated with Placebo or decitabine for human Ki67. Scale bar indicates 50 mm. (H) In vitro cell viability assay of U373 GBM cells treated with/without decitabine (0.1 mM) after pre-treatment with either NT-shRNA or RCC2-shRNA. ***p < 0.001, *p < 0.05, ns, not significant; n ¼ 3.

H. Yu et al. / Biochemical and Biophysical Research Communications 516 (2019) 999e1006

DNMT1 in a p-STAT3 dependent manner and inhibition of DNMT1 attenuates the tumorgenicity of GBM cells. 4. Discussion Accumulating evidence suggests that RCC2 plays a potential role in tumorigenesis in a range of cancers including cutaneous basal cell carcinoma [10], melanoma [9], gastric carcinomas [11], colorectal cancer [12], lung adenocarcinoma [13] and ovarian cancer [15]. In our present study, we demonstrated that RCC2 was significantly elevated in GBM compared to both low grade counterparts and normal human brain. In addition, survival analysis of four shared datasets revealed that elevated expression of RCC2 was associated with poorer prognosis of glioma patients. Transfection of RCC2 with shRNA was performed and validated, and growth of tumor cells in vitro and tumors in vivo indicated that silencing of RCC2 significantly inhibits proliferation of tumor cells and tumor development. Thus, RCC2 is functionally required for GBM tumor cell proliferation and tumorigenicity. Adaptive radio-resistance represents a major cause of poor clinical outcome following tumor recurrence in GBM. To our knowledge, the role of RCC2 in radio-resistance is unknown. Here, our findings indicate that RCC2 promotes radioresistance of GBM cells both in vitro and in vivo. Applying the TCGA dataset, GSEA identified oncogene pathways associated with radio-resistance (DNA mismatch repair [18] and JAK-STAT [19]) enriched in RCC2high expression patient samples, consistent with our functional results. DNMT1, reportedly cooperates with a key gene for radioresistance in GBM, EZH2 [20,21], to regulate promoter methylation of oncogene suppressor genes. Here, we observed a correlation between high expression of RCC2 and DNMT1, and silencing of RCC2 induced significant reduction of DNMT1 expression. Thus, these results indicate that RCC2 may promote radio-resistance of GBM via activating transcription of DNMT1 and enhancing the function of EZH2 in GBM. Further functional confirmation will be required for validation of this hypothesis. RCC2's mechanism of action, RCC2-dependent regulation of the transcription of DNMT1, was initially determined in this study via investigation of level alterations of p-STAT3 in the presence of RCC2-shRNA. Silencing of RCC2 induced significant reduction in the level of p-STAT3. The result is in accordance with the current knowledge of RCC2 that RalA is activated by RCC2 via its GEF activity [5] and RalA can promote the activation of its downstream targets including STAT3 [22]. Binding of STAT3 to the promoter of DNMT1 was previously shown in malignant T lymphocytes [23]. In our study, ChIP-PCR confirmed the binding of p-STAT3 to the promoter of DNMT1 in GBM cells, elucidating the role of p-STAT3 in activating transcription of DNMT1. However, the protein interaction of RCC2 remains poorly understood. Previously, RCC2 was reported to bind with coronin-1C, a highly expressed F-actin binding protein in diffuse glioma [24], to promote cell migration [6]. Whether RCC2 promotes the binding of p-STAT3 to the promoter of DNMT1 via physical occupancy (RCC2 binding with STAT3 or colocalized with STAT3 at the same area of promoter of DNMT1) is unknown, and will require further investigation with IP, ChIP or ChIP-ChIP methods. To apply our findings to clinical scenarios, we tested the efficiency of DNMT1 inhibitor on the proliferation and tumorigenicity of GBM cells. In vitro and in vivo findings consistently demonstrated that GBM cells showed high sensitivity to decitabine and confirmed decreased tumorigenesis of GBM cells when treated with decitabine, indicating that inhibition of RCC2-DNMT1 with decitabine may prove a potential strategy for the treatment of GBM patients. In conclusion, our findings indicate that RCC2 is highly expressed in GBM and confers aggressiveness to GBM cells, and

1005

suggest RCC2 as a valuable biomarker for GBM patient outcomes. Both functional and bioinformatics analysis confirmed the role of RCC2 in promoting radio-resistance in GBM. We further identified DNMT1 as one of the downstream targets of RCC2, and DNMT1 inhibition attenuated tumor progression. Collectively, this study suggests a role for RCC2 inhibition as a novel therapeutic modality in GBM. Acknowledgements We thank all the members that contributed to the study. This study was supported by the Fundamental Research Funds of Xi’an Jiaotong University and National Natural Science Foundation of China (grant no. 81802502). Transparency document Transparency document related to this article can be found online at https://doi.org/10.1016/j.bbrc.2019.06.097. References [1] R. Stupp, W.P. Mason, M.J. van den Bent, M. Weller, B. Fisher, M.J. Taphoorn, K. Belanger, A.A. Brandes, C. Marosi, U. Bogdahn, J. Curschmann, R.C. Janzer, S.K. Ludwin, T. Gorlia, A. Allgeier, D. Lacombe, J.G. Cairncross, E. Eisenhauer, R.O. Mirimanoff, Radiotherapy plus concomitant and adjuvant temozolomide for glioblastoma, N. Engl. J. Med. 352 (2005) 987e996. [2] O.L. Chinot, W. Wick, W. Mason, R. Henriksson, F. Saran, R. Nishikawa, A.F. Carpentier, K. Hoang-Xuan, P. Kavan, D. Cernea, A.A. Brandes, M. Hilton, L. Abrey, T. Cloughesy, Bevacizumab plus radiotherapy-temozolomide for newly diagnosed glioblastoma, N. Engl. J. Med. 370 (2014) 709e722. [3] P.R. Andreassen, D.K. Palmer, M.H. Wener, R.L. Margolis, Telophase disc: a new mammalian mitotic organelle that bisects telophase cells with a possible function in cytokinesis, J. Cell Sci. 99 (Pt 3) (1991) 523e534. [4] C. Mollinari, C. Reynaud, S. Martineau-Thuillier, S. Monier, S. Kieffer, J. Garin, P.R. Andreassen, A. Boulet, B. Goud, J.P. Kleman, R.L. Margolis, The mammalian passenger protein TD-60 is an RCC1 family member with an essential role in prometaphase to metaphase progression, Dev. Cell 5 (2003) 295e307. [5] D. Papini, L. Langemeyer, M.A. Abad, A. Kerr, I. Samejima, P.A. Eyers, A.A. Jeyaprakash, J.M. Higgins, F.A. Barr, W.C. Earnshaw, TD-60 links RalA GTPase function to the CPC in mitosis, Nat. Commun. 6 (2015) 7678. [6] R.C. Williamson, C.A. Cowell, C.L. Hammond, D.J. Bergen, J.A. Roper, Y. Feng, T.C. Rendall, P.R. Race, M.D. Bass, Coronin-1C and RCC2 guide mesenchymal migration by trafficking Rac1 and controlling GEF exposure, J. Cell Sci. 127 (2014) 4292e4307. [7] J.D. Humphries, A. Byron, M.D. Bass, S.E. Craig, J.W. Pinney, D. Knight, M.J. Humphries, Proteomic analysis of integrin-associated complexes identifies RCC2 as a dual regulator of Rac1 and Arf6, Sci. Signal. 2 (2009) ra51. [8] B. Bhattacharya, T. Miura, R. Brandenberger, J. Mejido, Y. Luo, A.X. Yang, B.H. Joshi, I. Ginis, R.S. Thies, M. Amit, I. Lyons, B.G. Condie, J. Itskovitz-Eldor, M.S. Rao, R.K. Puri, Gene expression in human embryonic stem cell lines: unique molecular signature, Blood 103 (2004) 2956e2964. [9] J. Rendleman, S. Shang, C. Dominianni, J.F. Shields, P. Scanlon, C. Adaniel, A. Desrichard, M. Ma, R. Shapiro, R. Berman, A. Pavlick, D. Polsky, Y. Shao, I. Osman, T. Kirchhoff, Melanoma risk loci as determinants of melanoma recurrence and survival, J. Transl. Med. 11 (2013) 279. [10] S.N. Stacey, D.F. Gudbjartsson, P. Sulem, J.T. Bergthorsson, R. Kumar, G. Thorleifsson, A. Sigurdsson, M. Jakobsdottir, B. Sigurgeirsson, K.R. Benediktsdottir, K. Thorisdottir, R. Ragnarsson, D. Scherer, P. Rudnai, E. Gurzau, K. Koppova, V. Hoiom, R. Botella-Estrada, V. Soriano, P. Juberias, M. Grasa, F.J. Carapeto, P. Tabuenca, Y. Gilaberte, J. Gudmundsson, S. Thorlacius, A. Helgason, T. Thorlacius, A. Jonasdottir, T. Blondal, S.A. Gudjonsson, G.F. Jonsson, J. Saemundsdottir, K. Kristjansson, G. Bjornsdottir, S.G. Sveinsdottir, M. Mouy, F. Geller, E. Nagore, J.I. Mayordomo, J. Hansson, T. Rafnar, A. Kong, J.H. Olafsson, U. Thorsteinsdottir, K. Stefansson, Common variants on 1p36 and 1q42 are associated with cutaneous basal cell carcinoma but not with melanoma or pigmentation traits, Nat. Genet. 40 (2008) 1313e1318. [11] M. Matsuo, C. Nakada, Y. Tsukamoto, T. Noguchi, T. Uchida, N. Hijiya, K. Matsuura, M. Moriyama, MiR-29c is downregulated in gastric carcinomas and regulates cell proliferation by targeting RCC2, Mol. Cancer 12 (2013) 15. [12] J. Bruun, M. Kolberg, T.C. Ahlquist, E.C. Royrvik, T. Nome, E. Leithe, G.E. Lind, M.A. Merok, T.O. Rognum, G. Bjorkoy, T. Johansen, A. Lindblom, X.F. Sun, A. Svindland, K. Liestol, A. Nesbakken, R.I. Skotheim, R.A. Lothe, Regulator of chromosome condensation 2 identifies high-risk patients within both major phenotypes of colorectal cancer, Clin. Cancer Res. : Off. J. Am. Assoc. Cancer Res. 21 (2015) 3759e3770. [13] B. Pang, N. Wu, R. Guan, L. Pang, X. Li, S. Li, L. Tang, Y. Guo, J. Chen, D. Sun,

1006

[14]

[15]

[16]

[17]

[18]

H. Yu et al. / Biochemical and Biophysical Research Communications 516 (2019) 999e1006 H. Sun, J. Dai, J. Bai, G. Ji, P. Liu, A. Liu, Q. Wang, S. Xiao, S. Fu, Y. Jin, Overexpression of RCC2 enhances cell motility and promotes tumor metastasis in lung adenocarcinoma by inducing epithelial-mesenchymal transition, Clin. Cancer Res. : Off. J. Am. Assoc. Cancer Res. 23 (2017) 5598e5610. S. Gao, H. Lin, W. Yu, F. Zhang, R. Wang, H. Yu, B. Qian, LncRNA LCPAT1 is involved in DNA damage induced by CSE, Biochem. Biophys. Res. Commun. 508 (2019) 512e515. S. Gong, Y. Chen, F. Meng, Y. Zhang, H. Wu, C. Li, G. Zhang, RCC2, a regulator of the RalA signaling pathway, is identified as a novel therapeutic target in cisplatin-resistant ovarian cancer, FASEB J.: Off. Pub. Fed. Am. Soc. Exp. Biol. 33 (4) (2019) fj201801529RR. L.A. Gravendeel, M.C. Kouwenhoven, O. Gevaert, J.J. de Rooi, A.P. Stubbs, J.E. Duijm, A. Daemen, F.E. Bleeker, L.B. Bralten, N.K. Kloosterhof, B. De Moor, P.H. Eilers, P.J. van der Spek, J.M. Kros, P.A. Sillevis Smitt, M.J. van den Bent, P.J. French, Intrinsic gene expression profiles of gliomas are a better predictor of survival than histology, Cancer Res. 69 (2009) 9065e9072. A. Kamoun, A. Idbaih, C. Dehais, N. Elarouci, C. Carpentier, E. Letouze, C. Colin, K. Mokhtari, A. Jouvet, E. Uro-Coste, N. Martin-Duverneuil, M. Sanson, J.Y. Delattre, D. Figarella-Branger, A. de Reynies, F. Ducray, Integrated multiomics analysis of oligodendroglial tumours identifies three subgroups of 1p/ 19q co-deleted gliomas, Nat. Commun. 7 (2016) 11263. S. Bao, Q. Wu, R.E. McLendon, Y. Hao, Q. Shi, A.B. Hjelmeland, M.W. Dewhirst,

[19]

[20]

[21]

[22]

[23]

[24]

D.D. Bigner, J.N. Rich, Glioma stem cells promote radioresistance by preferential activation of the DNA damage response, Nature 444 (2006) 756e760. J. Lau, S. Ilkhanizadeh, S. Wang, Y.A. Miroshnikova, N.A. Salvatierra, R.A. Wong, C. Schmidt, V.M. Weaver, W.A. Weiss, A.I. Persson, STAT3 blockade inhibits radiation-induced malignant progression in glioma, Cancer Res. 75 (2015) 4302e4311. X. Ning, Z. Shi, X. Liu, A. Zhang, L. Han, K. Jiang, C. Kang, Q. Zhang, DNMT1 and EZH2 mediated methylation silences the microRNA-200b/a/429 gene and promotes tumor progression, Cancer Lett. 359 (2015) 198e205. S.H. Kim, K. Joshi, R. Ezhilarasan, T.R. Myers, J. Siu, C. Gu, M. Nakano-Okuno, D. Taylor, M. Minata, E.P. Sulman, J. Lee, K.P. Bhat, A.E. Salcini, I. Nakano, EZH2 protects glioma stem cells from radiation-induced cell death in a MELK/ FOXM1-dependent manner, Stem cell reports 4 (2015) 226e238. T. Goi, M. Shipitsin, Z. Lu, D.A. Foster, S.G. Klinz, L.A. Feig, An EGF receptor/RalGTPase signaling cascade regulates c-Src activity and substrate specificity, EMBO J. 19 (2000) 623e630. Q. Zhang, H.Y. Wang, A. Woetmann, P.N. Raghunath, N. Odum, M.A. Wasik, STAT3 induces transcription of the DNA methyltransferase 1 gene (DNMT1) in malignant T lymphocytes, Blood 108 (2006) 1058e1064. D. Thal, C.P. Xavier, A. Rosentreter, S. Linder, B. Friedrichs, A. Waha, T. Pietsch, M. Stumpf, A. Noegel, C. Clemen, Expression of coronin-3 (coronin-1C) in diffuse gliomas is related to malignancy, J. Pathol. 214 (2008) 415e424.