- Email: [email protected]
RNA-based Capture-SELEX for the selection of small molecule-binding aptamers
Methods 161 (2019) 10–15
Contents lists available at ScienceDirect
Methods journal homepage: www.elsevier.com/locate/ymeth
RNA-based Capture-SELEX for the selection of small molecule-binding aptamers Adrien Boussebayle1, Florian Groher1, Beatrix Suess
T
⁎
Department of Biology, TU Darmstadt, Schnittspahnstrasse 10, 64287 Darmstadt, Germany
A R T I C LE I N FO
A B S T R A C T
Keywords: SELEX Aptamer Riboswitch Capture-SELEX Synthetic biology
Despite their wide applicability, the selection of small molecule-binding RNA aptamers with both high affinity binding and specificity is still challenging. Aptamers that excel at both binding and structure switching are particularly rare and difficult to find. Here, we present the protocol of a Capture-SELEX that specifically allows the in vitro selection of small-molecule binding aptamers, which are essential building blocks for the design process of synthetic riboswitches and biosensors. Moreover, we provide a comparative overview of our proposed methodology versus alternative in vitro selection protocols with a special focus on the design of the pool. Finally, we have included detailed notes to point out useful tips and pitfalls for future application.
1. Introduction Selection of nucleic acids that can bind a target with high affinity and specificity has been ongoing for nearly 30 years. Such nucleic acids are known as aptamers, i.e. single stranded RNA or DNA oligonucleotides generated in an in vitro process called SELEX (Systematic Evolution of Ligands by EXponential Enrichment, [1,2]. These aptamers are able to bind a wide range of targets including ions, small molecules, proteins and even whole cells [3–5]. The complex three-dimensional structures they can fold into allow aptamers to form binding pockets and clefts like their protein counterparts. Binding of the aptamer to its target results from structural compatibility, which may be generated by stacking of aromatic rings, electrostatic and van der Waals contacts, hydrogen bonding, or any combination of these interactions. The resulting aptamers often show affinities comparable to those observed for monoclonal antibodies. SELEX is an iterative process in which large libraries of RNA/DNA molecules are screened until high-affinity aptamers get enriched. In vitro selection experiments start from an initial chemically synthesised and heavily amplified combinatorial library of DNA oligonucleotides that has been transcribed into RNA. Usually, 1015 molecules are used to start such an experiment, thus covering a large set of potential threedimensional structures as well as target binding pockets. The core of the experimental procedure is the iterative incubation of this RNA pool with the target molecule and the following partitioning in binding and
non-binding species. For this partitioning step, there are plenty of different established methodologies including filter assay, affinity chromatography, (capillary) electrophoresis or microfluidics. In recent decades, the SELEX protocol has been further developed to optimise the partitioning effect [6,7], to adapt the protocol for different target including living cells [8] or to develop aptamers with enhanced in vivo stability [9]. Small molecules are attractive target molecules for aptamer selection, as these aptamers can be used as biosensors [10], as recognition modules in riboswitches [11] or even as antidotes in drug usage [12]. However, unlike for larger complexes such as proteins, the selection of small molecule aptamers has always been challenging in many ways. The major drawback of small molecules is their limited number of interaction moieties for chemical immobilisation on a matrix, so that the experimental design of the regular SELEX method already restricts aptamer development. Furthermore, chemical immobilisation is often performed at highly denaturing conditions (e.g. extreme pH, use of solvent etc.) that may compromise the target molecule before even starting the selection process. It is also possible to couple small molecules to a matrix via a linker molecule like e.g. biotin, but the biotinylation of small molecules is not always trivial and once again, a chemical moiety with which the nucleic acid could otherwise interact is thus lost. Finally, there is a risk that the aptamer will not only recognise the small molecule, but also the biotin moiety. In order to avoid these difficulties in the selection of small molecule binding aptamers, a
Abbreviations: EtOH, ethanol; Ac, acetate; MQ, ultrapure water; RT, reverse transcription ⁎ Corresponding author. E-mail address: [email protected] (B. Suess). 1 Contributed equally. https://doi.org/10.1016/j.ymeth.2019.04.004 Received 30 January 2019; Received in revised form 29 March 2019; Accepted 2 April 2019 Available online 04 April 2019 1046-2023/ © 2019 The Authors. Published by Elsevier Inc. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Methods 161 (2019) 10–15
A. Boussebayle, et al.
added to bind to the biotin linker of the Capture-oligonucleotide, thus forming a complex between RNA pool and magnetic beads. After several wash steps to remove weak Capture-oligonucleotide binders and RNA sticking non-specifically to the beads, the target molecule is incubated with the RNA pool-beads complex. Then, only RNA aptamers that undergo a structure switching upon target binding will be undocked from the Capture-oligonucleotide. These sequences are afterwards recovered, purified, reverse-transcribed and amplified before injection into a new selection round.
target-immobilisation free protocol called a Capture-SELEX was developed in several labs [13–15] Capture-SELEX was formerly mostly applied for DNA aptamers [14–16]. In this protocol, we adapt the protocol for RNA based library (Note A). Capture-SELEX is a technique where the roles of pool and target are inverted. Instead of immobilising the target on a solid support, the RNA and DNA pools are respectively captured due to the interaction of conserved motif located within the randomised region of the library (called the docking sequence) with a Capture-oligonucleotide used as an anchor. To elute aptamers from their support, the free ligand molecule dissolved in buffer in its native state is incubated with the immobilised pool, thus undocking aptamers from the Capture-oligonucleotide. As a result, only aptamers able to bind the original unmodified free ligand are generated. Moreover, solely structureswitching aptamers are eluted; a main feature required for the development of riboswitches or biosensors [17]. Since there is a shortage of structure-switching aptamers, we have adapted and considerably optimised the protocol and provide a detailed description of our findings in this Methods paper.
2.2. Pool design – Theoretical considerations Two parameters fundamentally define pool design: the size of the randomised region and the sequence composition of both primer binding site and docking sequence. The size and the repartition of the random region have to be adequately designed. In contrast to the classical SELEX approach, the sequence between the primer binding site is not fully randomised, i.e. it contains the docking sequence. The undocking of the sequence upon target binding has to be an event that happens relatively often with the aptamers contained in the pool. Therefore, the length of the random region and also the position of the docking sequence are crucial. The docking sequence should be placed inside the randomised region, splitting it into two parts. This will ensure that either a rearrangement and/or an undocking event happens upon ligand binding, which is important for enrichment of these aptamers during the selection process. Moreover, placement of the docking sequence within the random regions allows more flexible refolding upon target binding. The target can be trapped between the random regions on both sides of the docking sequence, thus causing the aptamer to refold and getting undocked from the Capture-oligonucleotide as a result. In addition, the
2. General considerations 2.1. Capture-SELEX overview Fig. 1A provides a general overview of the Capture-SELEX protocol. The first step of the protocol is the efficient coupling of the RNA pool onto the solid support, e.g. magnetic beads via the Capture-oligonucleotide. To achieve this, the RNA pool must be folded in the presence of the Capture-oligonucleotide by heating and cooling down to allow efficient hybridisation of the pool with the Capture-oligonucleotide. Once this complex is formed, magnetic streptavidin-coated beads are
Fig. 1. Overview of the Capture-SELEX procedure (A) One round of Capture-SELEX. All the necessary steps to perform one cycle of selection are represented on this graph. After production, the RNA is folded with the Capture-oligonucleotide and then incubated with the beads. After several washing steps, the target is incubated with the RNA-beads complex. Target-bound RNAs are recovered and amplified for the next cycle. (B) Example of a SELEX result chart. The amount of RNA in the last wash fraction (also called background) is represented in grey compared to the amount of RNA eluted by the target (also called specific elution) in black. Enrichment occurs when the specific elution is at least two times higher than the background for two consecutive rounds. Round 7–8 and 9–10 represent the classical behaviour of a pool when higher stringency is applied, e.g. counter-elution (CE) or target concentration-reduction (CR). The amount of specifically eluted RNA drops and then increases again in an exponential manner. (C) Representation of the interaction of an aptamer under Capture-SELEX conditions. During selection, optimal conditions have to be established to find the right balance between a strong interaction with both Capture-oligonucleotide and aptamer to decrease the amount of non-specific elution (red cross) and binding to closely related targets (green molecule). Conversely, the interaction has to be loose enough to allow specific binding to the desired target (blue molecule). (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.) 11
Methods 161 (2019) 10–15
A. Boussebayle, et al.
- 5x CSB (Capture-SELEX buffer)
size of the random region has to be optimised. In the case of small molecule SELEX, where Capture-SELEX is a convenient option, the surface of interaction of the target is very limited. Hence, a library with a random region containing N70 that was successfully used in classical SELEX [18] is rather counter-productive here. It is essential for the binding event to take place relatively close to the docking sequence to allow undocking due to refolding of the aptamer. In consequence, an overly long random region can generate more aptamers that bind the target, yet will not be eluted, than a library where the random region is shorter. As proven in a Capture-SELEX for paromomycin, the 5′ part of the N40 random region proved unnecessary for binding of the target and for the refolding of the docking sequence [19]. The design of the primer binding sites and docking sequence also requires some care and consideration. These regions are included in the design to reamplify the eluted sequence after selection. Therefore, they must be designed to allow high PCR efficiency for successful amplification. Additionally, the formation of self- or heterodimers of the oligonucleotides should be avoided. Heterodimers could lead to the formation of structures that could decrease the immobilisation efficiency on the Capture-oligonucleotide. Also, both primer binding sites need to have a similar melting temperature. The docking sequence is a crucial element for the design of an efficient aptamer-generating library. Indeed, this sequence not only governs the immobilisation of the pool on the matrix, but also its release from the Capture-oligonucleotide. Consequently, a sweet spot of perfect balance between a high rate of immobilisation and the release of the aptamer upon target binding needs to be established. The balance of the nucleotide distribution is equally important, i.e. care should be taken to have an even distribution to prevent self-dimerisation. The major parameter here is the melting temperature. To avoid a high rate of unspecific docking, Tm should always exceed the temperature at which the selection occurs in a 1.5-2x range for any design. An overly strong interaction is also disadvantageous, as most aptamers cannot undock and the sequence required for a strong docking sequence would be too long. The optimal Tm for a docking sequence needs to be between 36 and 40 °C (calculation made on the OligoCalc software (http://biotools.nubic. northwestern.edu/OligoCalc.html)). Finally, a last adjustment to prevent rebinding of the docking sequence to the Capture-oligonucleotide can be integrated. By including a partially complementary sequence in the primer binding site to allow sequestration of the docking sequence only when set free upon target binding, the probability to retain the eluted aptamer in the supernatant is much higher (These sequence are underlined in 2.2).
4. Methods
3. Materials
4.1. Preparation of the starting pool
3.1. Buffers and reagents
The general protocol reported in this section reflects the perfect conditions solely for the chosen combinations of oligonucleotides and pool template, and the PCR conditions have to be optimised before performing large-scale PCRs (for details see [20]). The general design of the oligonucleotides is as follows: one long reverse oligonucleotide containing both constant regions and the variable region is ordered and amplified by the primers used in RT-PCR in later SELEX. The forwardoligonucleotide also introduces the sequence of the T7 promoter.
(40 mM HEPES pH 7.4 (Roth, p.a.), 250 mM KCl, 20 mM NaCl, 5 mM MgCl2 (Roth, p.a.), 0.002% Tween-20 (Roth, Ph. Eur.)) - RT-PCR mix (1x Taq Polymerase buffer (New England Biolabs), 0.2x First Strand Buffer (Invitrogen), 2 mM DTT (Roth, p.a.) , 1 µM Primer Pool_rev, 1.5 mM MgCl2, 0.75 mM dNTP (Sigma, > 95% HPLC) in a total volume of 47 µL) - Transcription mix (40 mM Tris-HCl pH 8.0, 5 mM DTT, NTPs − 2.5 mM each (Sigma, > 95% HPLC), 15 mM MgCl2, 100 U T7 RNA Polymerase (homemade), 40 U ribonuclease inhibitor (Roth, moloX) and 33 nM 32 [P]-α-UTP (Hartmann analytics) in a total volume of 90 µL) 3.2. Oligonucleotides All oligonucleotides were purchased from Sigma (for standard PCR: desalted, Pool: gel purified). -
Pool_fwd (CCAAG TAATACGACTCACTATAGGGCAACTCCAAGCTAGATCTACCGGT) Pool_rev (AGTGAAAAGTTCTTCTCCTTTGCTAGCCATTTT) Pool_Oligo_rev (AGTGAAAAGTTCTTCTCCTTTGCTAGCCATTTTNN NNNNNNNNTAGAAGCCAGTAGNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNACCGGTAGATCTAGCTTGGAGTTG CCC) - Capture-oligonucleotide (TAGAAGCCAGTAG -biotin TEG linker) 3.3. Equipment -
- 10x PCR buffer (0.5 M KCl (Roth, p.a.), 0.1 M Tris-HCl pH 9 (Roth, p.a.), 1% Triton X100 (Sigma, purest)) - 2x RNA loading dye (formamide (Roth, 99.5% bioscience grade) with 25 mM EDTA pH 8.0 (Roth, p.a.) and bromphenol/xylencyanol (Roth))
Scintillation Counter PCR Cycler Magnetic rack Gel electrophoresis and power supply Nanodrop 0.2 μM filter
- Set up large scale PCR reaction in a 50 mL tube (total reaction volume = 50 mL) as follows: 0.2 mM dNTPs (each), 1.5 mM MgCl2, 24 nM Pool_Oligo_rev, 2.4 µM Pool_fwd, 2.4 µM Pool_rev, 50 U/mL Taq polymerase in 1x PCR buffer. - Aliquot the 50 mL to 200 µL PCR tubes (150 µL each, see Note B). - Run PCR with following conditions: 3 min 95 °C; 5*{1 min 95 °C, 1 min 54 °C, 2 min 72 °C}; 3 min 72 °C. - After performing PCR, pool the individual PCR reactions and precipitate with NaAc (Roth p.a.)/EtOH (VWR, p.a.). - Resolve the pellet in a suitable amount of MQ-H2O. Monitor size and quality of the PCR product on a 3% agarose gel. If the size is
- 10x TBE buffer (1 M Tris base, 1 M Boric acid (Roth, p.a.), 20 mM EDTA) - Streptavidin Dynabeads M−270 (Thermo Fisher) - B&W buffer (5 mM Tris-HCl pH 7.5, 0.5 mM EDTA, 1 M NaCl) 12
Methods 161 (2019) 10–15
A. Boussebayle, et al.
-
-
-
4.4. Hybridisation of the pool with Capture-oligonucleotide (CO)
appropriate, start with large-scale overnight transcription. For the transcription, one tenth of the total volume should be used as template, as it contains theoretically at least one copy of each sequence. Large-scale overnight transcription (10 mL total volume): 200 mM Tris-Cl pH 8.0, 20 mM MgAc2, 20 mM DTT, 10 mM spermidine (Roth, p.a.), 4 mM NTPs (each), one tenth of the total volume of the PCR template, 250 U/mL T7 polymerase, fill up to 10 mL with MQH2O. Incubate overnight (16 h) at 37 °C (Note C). If pyrophosphate is precipitated during transcription, centrifuge the tube and take the clear supernatant. Precipitate the filtrate with EtOH/acetone (Note D). Wash the pellet twice with 10 mL 70 °C EtOH (Note E). Air dry pellet for 15 min (Note F). Resuspend the pellet in 2 mL MQ-H2O, then add 1 vol 2x RNA loading dye. Separate the transcribed RNA by denaturing PAGE (6% PAA gel with 8 M urea in 1x TBE). Run gel with 20 V/cm until the bromophenol blue exits the gel. Visualise RNA via UV-shadowing and cut it out. Cut gel into small slices and transfer them into 50 mL tube. Add 300 mM NaAc pH 6.5 to the slices until they are completely covered. Put the tube in a rotating shaker over night to elute RNA Filter the eluted RNA using a 0.2 µM filter to remove gel debris and take the clear filtrate for subsequent steps. Precipitate the filtrate with NaAc/EtOH (Note G) Wash pellet twice with 70% EtOH Air dry pellet for 5 min and resolve RNA in a suitable amount of MQH2O Determine RNA concentration (e.g. by Nanodrop) and calculate molarity.
- For the first round, 2 nmol of RNA (∼1015 different sequences) from the previously purified RNA are used for the immobilization mixed with 150,000 CPM 5′ [32P] labelled RNA. For all other rounds, 150,000 CPM [32P] RNA from the body-labelled transcription is used. Mix 150 pmol [1.5 nmol] CO with 10 µL [40 µL] 5x CSB with the RNA and fill up to 50 µL [200 µL] with MQ-H2O. - Heat the solution for 5 min at 65 °C - Slowly cool the solution down to 21 °C (20 min using a thermoblock) 4.5. Coating beads with RNA - Mix prepared beads with folded and hybridised RNA - Incubate for at least 30 min at RT on a revolver mixer (20–25 rpm). - Remove supernatant (i.e. unbound RNA and CO) after placing the tube on a magnetic rack for 30 sec. 4.6. Selection process - Resuspend by pipetting 5–10 times the RNA-coated beads in 200 µL [400 µL] 1× CSB and incubate 5 min at 30 °C on a thermoblock to remove weak CO binders - Collect the supernatant, set apart 5% of the volume for measurement of radioactivity (corresponds to the RNA content) - Resuspend by pipetting 5–10 times the RNA-coated magnetic beads in 200 µL [400 µL] 1x CSB and incubate 5 min on the revolver shaker at room temperature - From each step, collect 5% of the volume for measurement of radioactivity. The value is calculated using this formula: % input eluted = [CPM measured for the eluted fraction/Sum of all measured fraction (all washes + elution + beads)] *100 - Repeat these step 2 [4] times - Resuspend your RNA-coated beads in 200 µL [400 µL] of a solution containing your target molecule at a 1 mM concentration in 1x CSB and incubate 5 min on the revolver shaker (Note J) - Collect 5% of the supernatant (eluted aptamers) for measurement and transfer the remainder into a fresh 1.5 mL tube - Resuspend the remaining beads in 1× CSB 200 µL [400 µL] and collect 5% to measure the amount of RNA immobilized on the beads but not eluted after target addition. - Perform a NaAc precipitation by addition of 0.1 V of NaAc 3 M pH 5.5 and 2.5 V of 100% ethanol and place it for at least 30 min at −20 °C. Tip: 1 µL of GlycolBlue (Thermos Fisher) can be added to obtain a clearer pellet after centrifugation
4.2. End labelling of the pool for the first round For the first round, a part of the starting pool needs to be radioactive-labelled as a tracer. - Dephosphorylate 10 pmol (about 6*1012 different sequences) by adding 2 µL CIP (Roche) in 1x CIP buffer (provided by supplier). - Incubate for 30 min at 55 °C and then heat-inactivate the enzyme for 10 min at 95 °C. - Precipitate the inactivated reaction with NaAc/EtOH. - Label the complete dephosphorylated RNA by adding 3 µL [γ-32P] ATP and 1 µL PNK (Roche) in 1x PNK buffer (provided by supplier). - Incubate the reaction for 1 h at 37 °C. - Precipitate the reaction with NH4Ac (Roth, p.a.) (Note H). - Resuspend the pellet in 20 µL MQ-H20.
4.7. Amplification of the eluted aptamers - Transfer the 1.5 mL tube containing the RNA from the freezer to a 4 °C pre-cooled centrifuge and spin RNA for 30 min at 13 rpm - Carefully discard the supernatant and wash the pellet twice with 800 µL of 70% ethanol - Dry pellet for 5 min at 37 °C and dissolve RNA in 50 µL [150 µL] MQwater - Mix RNA with 1 [3] RT-PCR mix (47 µL per mix) and incubate the tube for 5 min at 65 °C - Add 1 µL [3 µL] of Superscript II and Taq polymerase and transfer the reaction to a PCR cycler - Incubate the reaction at 54 °C for 10 min and heat it up to 95 °C to denature the reverse-transcriptase - Add 100 pmol of the forward primer per 100 µL RT-PCR reaction - Perform at least 6 [4] rounds of PCR and check the amplification product on a 3% agarose gel - When the band on the gel shows a strong intensity without any sign of overamplification, stop the PCR. If no product is visible, 4 additional cycles can be added
As the first round of SELEX needs to screen a larger number of unique sequences than the following rounds, higher amounts of all compounds/reactants involved have to be used. Therefore, the values reported in square brackets indicate the corresponding amounts required for round 1. 4.3. Preparation of paramagnetic beads - Wash three times 1 × 108 [1 × 109] Streptavidin Dynabeads M-270 (150 µL [1.5 mL]) with 500 µL [1 mL] of B&W buffer. - Wash once with 500 µL [1 mL] 1× CSB - Resuspend the beads in 150 µL [200 µL] 1× CSB - Store at room temperature (RT) until use
13
Methods 161 (2019) 10–15
A. Boussebayle, et al.
5.2. Conclusions
- Transfer 10 µL of the RT-PCR mix into a 87 µL transcription mix and incubate at least 1 h at 37 °C. (Note K) - RNA is afterwards purified by ammonium precipitation and radioactivity of the sample is measured to determine to amount of RNA equivalent to 150 kcpm to use for the next round
Capture-SELEX is a method for fast and efficient enrichment of small molecule-binding aptamers. The main advantage of this method is that the ligand does not require immobilisation. Consequently, the resulting aptamers can recognise each chemical moiety of the respective target. However, Capture SELEX is not only a very efficient method for selecting aptamers. The rearrangement and undocking steps of the method also render it very suitable for several downstream applications, e.g. development into riboswitches or biosensors. To qualify for these applications, aptamers are required to not only bind their target molecule with high affinity and specificity, but also to exhibit structure switching. Conveniently, Capture SELEX selects for aptamers with precisely these characteristics. In addition, fine tuning of the stringency of the selection process is possible via the docking sequence. So far, our experience suggests that structure switching does not take place at the expense of affinity or specificity, but that the aptamers found via Capture-SELEX have the same excellent binding properties as aptamers obtained via classical SELEX. Since the method is even faster than a classical SELEX, Capture SELEX is universally recommended for the selection of small molecule-binding aptamers.
5. Results and conclusions 5.1. Capture-SELEX for ATP-binding aptamers As a target for this selection, rATP was selected among other metabolites to develop aptamers that are able to sense rATP inside of a cell. Developed aptamer could then be further engineered into a biosensor, e.g. to monitor the metabolic flux of this metabolite. For the first round, an RNA pool containing of 1015 different sequences were hybridised on 2 nmol of Capture-oligonucleotide. Among the RNA, 100 kcpm of radioactively 32-P-end labelled RNA were added as a tracer. After folding, the immobilised RNA was incubated with magnetic beads having a binding capacity of 2 nmol (1 mL). For all subsequent rounds, 150 µL of beads and 0.2 nmol of Capture-oligonucleotide were used. For all specific elution steps, 1 mM of rATP in SELEX buffer was used. For the five first rounds, the specific elution step was performed directly after the washing steps (Fig. 2). At round number 5, a specific enrichment towards rATP could be observed. To enhance specificity of the library, a counter-elution step was introduced in the following rounds. In rounds 6 and 7, 1 mM of rADP was used to elute non-specific binders. In rounds 8 and 9, 1 mM of dATP was used as a counter-elution target. After 9 rounds, the proportion of binders was still superior to the background fraction, indicating that aptamers were enriched. However, the amount of non-specific binders in the fraction is also very important as they reveal a low specificity of the library. To investigate the affinity of specifically enriched sequences in detail, cloning of the library is necessary. In a first run, standard Sangersequencing is sufficient to identify most enriched sequences that will statistically be detectable even with a low amount of cloned sequenced. Binding studies have to be performed to identify those sequences showing a specific binding behaviour. For more detail about the enrichment of the library, we recommend to perform next generation sequencing (NGS) for an in-depth analysis of the behaviour of the library. NGS data is superior because of the specific detail provided for each round of enrichment [11]. Thus, sequences can be observed that may be appearing later in the process due to experimental conditions (e.g. overly strong interaction with the Capture-oligonucleotide, weak transcription efficiency etc.). These sequences may be strong candidates with prominent enrichment under mid-experimental conditions, e.g. when higher stringency or counter elution is applied. However, such sequences would be lost with classical sequencing approaches because they would never catch up with candidates that show strong enrichment from round 1. Obviously, later candidates may be well worth analysing because the data suggest a stronger affinity/specificity [11].
6. Notes Note A The adjustment of DNA towards RNA Capture-SELEX needed some adaptations based on the chemical properties of RNA. The main difference between the DNA Capture-SELEX protocol and the RNA Capture-SELEX based protocol is at the folding step. RNA cannot be boiled at 95 °C in the presence of magnesium without being cleaved. Therefore, the folding was done at lower temperature and in the presence of the CO to allow the RNA to unfold without being degraded and to fold directly on the CO once the tube is transfer to 21 °C. RNA Capture-SELEX protocol can be also apply for 2′-Fluoro-modified RNA if the suitable enzymes for transcription and reverse-transcription are used. Note B The optimisation was done in a total volume of 150 µL PCR reaction in a 200 µL tube. Also, the reactions were performed on the same cycler to exclude variation arising from the individual cycler model. Note C White pyrophosphate precipitate should visibly form and also accumulated at the bottom of the tube. Note D Ethanol/Acetone precipitation of RNA EtOH/acetone (Roth, p.a.) is particularly suitable for the precipitation of small oligonucleotides (personal experience). - Add EDTA pH 8.0 and NaAc pH 6.5 to a final concentration of 80 mM and 400 µM, respectively, and fill up with 2.5 vol of ice-cold EtOH/acetone (1:1) - After thoroughly vortexing the mixture, incubate 1 h at −20 °C and centrifuge afterwards for at least 1 h with maximum speed, 4 °C. Fig. 2. Capture-SELEX against rATP. The blue bars represent the amount of RNA eluted specifically by rATP. The dark grey bars represent the amount of RNA non-specifically eluted in the last washing step (background). The green bars represent the amount of RNA left on the beads after all the wash steps and the elution step. The 5 first rounds were performed with specific elution only. The light grey bars represent the amount of RNA eluted by the countertarget in round 6–7 for rADP and in round 8–9 for dATP. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
14
Methods 161 (2019) 10–15
A. Boussebayle, et al.
Note E Be very carefully when decanting the supernatant, since the RNA may be not forming a pellet after the first centrifugation – it may resemble a gel. After the second wash, this gel should form a pellet. If the RNA is still gel-like, wash a third time with increased volume. Note F Make sure you carefully remove the 70% EtOH and then dry the RNA for only 5 min leaving the centrifuge tube open. Do not overdry the RNA, as it will be very difficult to dissolve. Note G Ethanol precipitation of RNA. Mix the nucleic acid solution with 0.1 vol 3 M sodium acetate (pH 6.5), 2.5 vol 100% EtOH and 1 µL GlycoBlue (Invitrogen). After vortexing, freeze for 30 min @ −20 °C. Afterwards centrifuge 30 min at maximum speed and 4 °C. Remove supernatant and wash pellet twice with 70% EtOH. Air dry pellet for 5 min and resuspend pellet in suitable amount of H2O (for RT-PCR, use 50 µL H2O). Note H Ammonium acetate precipitation of RNA. Mix nucleic acid solution with 0.5 vol 7.5 M ammonium acetate and 2.5 vol 100% EtOH. After vortexing, place sample on ice for exactly 10 min. Centrifuge precipitate for exactly 15 min at maximum speed and RT. Wash pellet twice with 70% EtOH. After air-drying the pellet, resuspend in a suitable amount of H2O. Note J 5 min was decided to be the optimal time for specific elution. It is a good compromise between the time that allow specific binding of the target and a smallest possible amount of unspecific elution. The extension of the elution time increases the non-specific elution of RNA from the beads linearly. However, specific binding to a target happens fast (according to ITC data that shows an equilibrium between the target and the aptamer within a few seconds). Therefore, a short time is always better. However, a too short incubation time may select for aptamers with a high koff. Note K To transcribe RNA for the second and subsequent rounds, a simpler mix can be used than the highly efficient mix used to prepare the starting pool. The highly efficient reaction is optimized for long term transcription, while the simpler mix is optimized for short term transcriptions.
ligands to bacteriophage T4 DNA polymerase, Science (80-) 249 (1990) 505 LP-510. [3] B.-F. Ye, Y.-J. Zhao, Y. Cheng, T.-T. Li, Z.-Y. Xie, X.-W. Zhao, Z.-Z. Gu, Colorimetric photonic hydrogel aptasensor for the screening of heavy metal ions, Nanoscale 4 (2012) 5998–6003. [4] M. Meli, J. Vergne, J.-L. Décout, M.-C. Maurel, Adenine-aptamer complexes: a bipartite RNA site that binds the adenine nucleic base, J. Biol. Chem. 277 (2002) 2104–2111. [5] A. Hunsicker, M. Steber, J. Meitert, M. Klotzsche, M. Blind, W. Hillen, C. Berens, B. Suess, Article An RNA Aptamer that Induces Transcription, 2009 doi: 10.1016/j. chembiol.2008.12.008. [6] A. Geiger, P. Burgstaller, H. von der Eltz, A. Roeder, M. Famulok, RNA aptamers that bind L-arginine with sub-micromolar dissociation constants and high enantioselectivity, Nucleic Acids Res. 24 (1996) 1029–1036. [7] R.D. Jenison, S.C. Gill, A. Pardi, B. Polisky, High-resolution molecular discrimination by RNA, Science (80-.) 263 (1994) 1425–1429. [8] D. Shangguan, Y. Li, Z. Tang, Z.C. Cao, H.W. Chen, P. Mallikaratchy, K. Sefah, C.J. Yang, W. Tan, Aptamers evolved from live cells as effective molecular probes for cancer study, Proc. Natl. Acad. Sci. 103 (2006) 11838 LP-11843. [9] D. Thirunavukarasu, T. Chen, Z. Liu, N. Hongdilokkul, F.E. Romesberg, Selection of 2′-fluoro-modified aptamers with optimized properties, J. Am. Chem. Soc. 139 (2017) 2892–2895. [10] R.L. Strack, W. Song, S.R. Jaffrey, Using Spinach-based sensors for fluorescence imaging of intracellular metabolites and proteins in living bacteria, Nat. Protoc. 9 (2013) 146–155. [11] F. Groher, C. Bofill-Bosch, C. Schneider, J. Braun, S. Jager, K. Geißler, K. Hamacher, B. Suess, Riboswitching with ciprofloxacin-development and characterization of a novel RNA regulator, Nucl. Acids Res. 46 (2018) 2121–2132. [12] J.H. Lee, F. Jucker, A. Pardi, Imino proton exchange rates imply an induced-fit binding mechanism for the VEGF165-targeting aptamer, Macugen, FEBS Lett. 582 (2008) 1835–1839. [13] R. Nutiu, Y. Li, In vitro selection of structure-switching signaling aptamers, Angew. Chemie - Int. Ed. 44 (2005) 1061–1065. [14] R. Stoltenburg, N. Nikolaus, B. Strehlitz. Capture-SELEX: Selection of DNA Aptamers for Aminoglycoside Antibiotics. 2012. [15] M. Rajendran, A.D. Ellington, In vitro selection of molecular beacons, Nucl. Acids Res. 31 (2003) 5700–5713. [16] F.M. Spiga, P. Maietta, C. Guiducci, More DNA–aptamers for small drugs: a capture–SELEX coupled with surface plasmon resonance and high-throughput sequencing, ACS Comb. Sci. 17 (2015) 326–333. [17] B. Suess, B. Fink, C. Berens, R. Stentz, W. Hillen, A theophylline responsive riboswitch based on helix slipping controls gene expression in vivo, Nucl. Acids Res. 32 (2004) 1610–1614. [18] M.G. Wallis, U. von Ahsen, R. Schroeder, M. Famulok, A novel RNA motif for neomycin recognition, Chem. Biol. 2 (1995) 543–552. [19] A. Boussebayle, D. Torka, S. Ollivaud, J. Braun, C. Bofill-Bosch, M. Dombrowski, F. Groher, K. Hamacher, B. Suess, Next-level riboswitch development-implementation of Capture-SELEX facilitates identification of a new synthetic riboswitch, Nucleic Acids Res. (2019), https://doi.org/10.1093/nar/gkz216 pii: gkz216. [20] F. Groher, B. Suess, In vitro selection of antibiotic-binding aptamers, Methods 106 (2016) 42–50.
References [1] A.D. Ellington, J.W. Szostak, In vitro selection of RNA molecules that bind specific ligands, Nature 346 (1990) 818. [2] C. Tuerk, L. Gold, Systematic evolution of ligands by exponential enrichment: RNA
15
Contents lists available at ScienceDirect
Methods journal homepage: www.elsevier.com/locate/ymeth
RNA-based Capture-SELEX for the selection of small molecule-binding aptamers Adrien Boussebayle1, Florian Groher1, Beatrix Suess
T
⁎
Department of Biology, TU Darmstadt, Schnittspahnstrasse 10, 64287 Darmstadt, Germany
A R T I C LE I N FO
A B S T R A C T
Keywords: SELEX Aptamer Riboswitch Capture-SELEX Synthetic biology
Despite their wide applicability, the selection of small molecule-binding RNA aptamers with both high affinity binding and specificity is still challenging. Aptamers that excel at both binding and structure switching are particularly rare and difficult to find. Here, we present the protocol of a Capture-SELEX that specifically allows the in vitro selection of small-molecule binding aptamers, which are essential building blocks for the design process of synthetic riboswitches and biosensors. Moreover, we provide a comparative overview of our proposed methodology versus alternative in vitro selection protocols with a special focus on the design of the pool. Finally, we have included detailed notes to point out useful tips and pitfalls for future application.
1. Introduction Selection of nucleic acids that can bind a target with high affinity and specificity has been ongoing for nearly 30 years. Such nucleic acids are known as aptamers, i.e. single stranded RNA or DNA oligonucleotides generated in an in vitro process called SELEX (Systematic Evolution of Ligands by EXponential Enrichment, [1,2]. These aptamers are able to bind a wide range of targets including ions, small molecules, proteins and even whole cells [3–5]. The complex three-dimensional structures they can fold into allow aptamers to form binding pockets and clefts like their protein counterparts. Binding of the aptamer to its target results from structural compatibility, which may be generated by stacking of aromatic rings, electrostatic and van der Waals contacts, hydrogen bonding, or any combination of these interactions. The resulting aptamers often show affinities comparable to those observed for monoclonal antibodies. SELEX is an iterative process in which large libraries of RNA/DNA molecules are screened until high-affinity aptamers get enriched. In vitro selection experiments start from an initial chemically synthesised and heavily amplified combinatorial library of DNA oligonucleotides that has been transcribed into RNA. Usually, 1015 molecules are used to start such an experiment, thus covering a large set of potential threedimensional structures as well as target binding pockets. The core of the experimental procedure is the iterative incubation of this RNA pool with the target molecule and the following partitioning in binding and
non-binding species. For this partitioning step, there are plenty of different established methodologies including filter assay, affinity chromatography, (capillary) electrophoresis or microfluidics. In recent decades, the SELEX protocol has been further developed to optimise the partitioning effect [6,7], to adapt the protocol for different target including living cells [8] or to develop aptamers with enhanced in vivo stability [9]. Small molecules are attractive target molecules for aptamer selection, as these aptamers can be used as biosensors [10], as recognition modules in riboswitches [11] or even as antidotes in drug usage [12]. However, unlike for larger complexes such as proteins, the selection of small molecule aptamers has always been challenging in many ways. The major drawback of small molecules is their limited number of interaction moieties for chemical immobilisation on a matrix, so that the experimental design of the regular SELEX method already restricts aptamer development. Furthermore, chemical immobilisation is often performed at highly denaturing conditions (e.g. extreme pH, use of solvent etc.) that may compromise the target molecule before even starting the selection process. It is also possible to couple small molecules to a matrix via a linker molecule like e.g. biotin, but the biotinylation of small molecules is not always trivial and once again, a chemical moiety with which the nucleic acid could otherwise interact is thus lost. Finally, there is a risk that the aptamer will not only recognise the small molecule, but also the biotin moiety. In order to avoid these difficulties in the selection of small molecule binding aptamers, a
Abbreviations: EtOH, ethanol; Ac, acetate; MQ, ultrapure water; RT, reverse transcription ⁎ Corresponding author. E-mail address: [email protected] (B. Suess). 1 Contributed equally. https://doi.org/10.1016/j.ymeth.2019.04.004 Received 30 January 2019; Received in revised form 29 March 2019; Accepted 2 April 2019 Available online 04 April 2019 1046-2023/ © 2019 The Authors. Published by Elsevier Inc. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Methods 161 (2019) 10–15
A. Boussebayle, et al.
added to bind to the biotin linker of the Capture-oligonucleotide, thus forming a complex between RNA pool and magnetic beads. After several wash steps to remove weak Capture-oligonucleotide binders and RNA sticking non-specifically to the beads, the target molecule is incubated with the RNA pool-beads complex. Then, only RNA aptamers that undergo a structure switching upon target binding will be undocked from the Capture-oligonucleotide. These sequences are afterwards recovered, purified, reverse-transcribed and amplified before injection into a new selection round.
target-immobilisation free protocol called a Capture-SELEX was developed in several labs [13–15] Capture-SELEX was formerly mostly applied for DNA aptamers [14–16]. In this protocol, we adapt the protocol for RNA based library (Note A). Capture-SELEX is a technique where the roles of pool and target are inverted. Instead of immobilising the target on a solid support, the RNA and DNA pools are respectively captured due to the interaction of conserved motif located within the randomised region of the library (called the docking sequence) with a Capture-oligonucleotide used as an anchor. To elute aptamers from their support, the free ligand molecule dissolved in buffer in its native state is incubated with the immobilised pool, thus undocking aptamers from the Capture-oligonucleotide. As a result, only aptamers able to bind the original unmodified free ligand are generated. Moreover, solely structureswitching aptamers are eluted; a main feature required for the development of riboswitches or biosensors [17]. Since there is a shortage of structure-switching aptamers, we have adapted and considerably optimised the protocol and provide a detailed description of our findings in this Methods paper.
2.2. Pool design – Theoretical considerations Two parameters fundamentally define pool design: the size of the randomised region and the sequence composition of both primer binding site and docking sequence. The size and the repartition of the random region have to be adequately designed. In contrast to the classical SELEX approach, the sequence between the primer binding site is not fully randomised, i.e. it contains the docking sequence. The undocking of the sequence upon target binding has to be an event that happens relatively often with the aptamers contained in the pool. Therefore, the length of the random region and also the position of the docking sequence are crucial. The docking sequence should be placed inside the randomised region, splitting it into two parts. This will ensure that either a rearrangement and/or an undocking event happens upon ligand binding, which is important for enrichment of these aptamers during the selection process. Moreover, placement of the docking sequence within the random regions allows more flexible refolding upon target binding. The target can be trapped between the random regions on both sides of the docking sequence, thus causing the aptamer to refold and getting undocked from the Capture-oligonucleotide as a result. In addition, the
2. General considerations 2.1. Capture-SELEX overview Fig. 1A provides a general overview of the Capture-SELEX protocol. The first step of the protocol is the efficient coupling of the RNA pool onto the solid support, e.g. magnetic beads via the Capture-oligonucleotide. To achieve this, the RNA pool must be folded in the presence of the Capture-oligonucleotide by heating and cooling down to allow efficient hybridisation of the pool with the Capture-oligonucleotide. Once this complex is formed, magnetic streptavidin-coated beads are
Fig. 1. Overview of the Capture-SELEX procedure (A) One round of Capture-SELEX. All the necessary steps to perform one cycle of selection are represented on this graph. After production, the RNA is folded with the Capture-oligonucleotide and then incubated with the beads. After several washing steps, the target is incubated with the RNA-beads complex. Target-bound RNAs are recovered and amplified for the next cycle. (B) Example of a SELEX result chart. The amount of RNA in the last wash fraction (also called background) is represented in grey compared to the amount of RNA eluted by the target (also called specific elution) in black. Enrichment occurs when the specific elution is at least two times higher than the background for two consecutive rounds. Round 7–8 and 9–10 represent the classical behaviour of a pool when higher stringency is applied, e.g. counter-elution (CE) or target concentration-reduction (CR). The amount of specifically eluted RNA drops and then increases again in an exponential manner. (C) Representation of the interaction of an aptamer under Capture-SELEX conditions. During selection, optimal conditions have to be established to find the right balance between a strong interaction with both Capture-oligonucleotide and aptamer to decrease the amount of non-specific elution (red cross) and binding to closely related targets (green molecule). Conversely, the interaction has to be loose enough to allow specific binding to the desired target (blue molecule). (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.) 11
Methods 161 (2019) 10–15
A. Boussebayle, et al.
- 5x CSB (Capture-SELEX buffer)
size of the random region has to be optimised. In the case of small molecule SELEX, where Capture-SELEX is a convenient option, the surface of interaction of the target is very limited. Hence, a library with a random region containing N70 that was successfully used in classical SELEX [18] is rather counter-productive here. It is essential for the binding event to take place relatively close to the docking sequence to allow undocking due to refolding of the aptamer. In consequence, an overly long random region can generate more aptamers that bind the target, yet will not be eluted, than a library where the random region is shorter. As proven in a Capture-SELEX for paromomycin, the 5′ part of the N40 random region proved unnecessary for binding of the target and for the refolding of the docking sequence [19]. The design of the primer binding sites and docking sequence also requires some care and consideration. These regions are included in the design to reamplify the eluted sequence after selection. Therefore, they must be designed to allow high PCR efficiency for successful amplification. Additionally, the formation of self- or heterodimers of the oligonucleotides should be avoided. Heterodimers could lead to the formation of structures that could decrease the immobilisation efficiency on the Capture-oligonucleotide. Also, both primer binding sites need to have a similar melting temperature. The docking sequence is a crucial element for the design of an efficient aptamer-generating library. Indeed, this sequence not only governs the immobilisation of the pool on the matrix, but also its release from the Capture-oligonucleotide. Consequently, a sweet spot of perfect balance between a high rate of immobilisation and the release of the aptamer upon target binding needs to be established. The balance of the nucleotide distribution is equally important, i.e. care should be taken to have an even distribution to prevent self-dimerisation. The major parameter here is the melting temperature. To avoid a high rate of unspecific docking, Tm should always exceed the temperature at which the selection occurs in a 1.5-2x range for any design. An overly strong interaction is also disadvantageous, as most aptamers cannot undock and the sequence required for a strong docking sequence would be too long. The optimal Tm for a docking sequence needs to be between 36 and 40 °C (calculation made on the OligoCalc software (http://biotools.nubic. northwestern.edu/OligoCalc.html)). Finally, a last adjustment to prevent rebinding of the docking sequence to the Capture-oligonucleotide can be integrated. By including a partially complementary sequence in the primer binding site to allow sequestration of the docking sequence only when set free upon target binding, the probability to retain the eluted aptamer in the supernatant is much higher (These sequence are underlined in 2.2).
4. Methods
3. Materials
4.1. Preparation of the starting pool
3.1. Buffers and reagents
The general protocol reported in this section reflects the perfect conditions solely for the chosen combinations of oligonucleotides and pool template, and the PCR conditions have to be optimised before performing large-scale PCRs (for details see [20]). The general design of the oligonucleotides is as follows: one long reverse oligonucleotide containing both constant regions and the variable region is ordered and amplified by the primers used in RT-PCR in later SELEX. The forwardoligonucleotide also introduces the sequence of the T7 promoter.
(40 mM HEPES pH 7.4 (Roth, p.a.), 250 mM KCl, 20 mM NaCl, 5 mM MgCl2 (Roth, p.a.), 0.002% Tween-20 (Roth, Ph. Eur.)) - RT-PCR mix (1x Taq Polymerase buffer (New England Biolabs), 0.2x First Strand Buffer (Invitrogen), 2 mM DTT (Roth, p.a.) , 1 µM Primer Pool_rev, 1.5 mM MgCl2, 0.75 mM dNTP (Sigma, > 95% HPLC) in a total volume of 47 µL) - Transcription mix (40 mM Tris-HCl pH 8.0, 5 mM DTT, NTPs − 2.5 mM each (Sigma, > 95% HPLC), 15 mM MgCl2, 100 U T7 RNA Polymerase (homemade), 40 U ribonuclease inhibitor (Roth, moloX) and 33 nM 32 [P]-α-UTP (Hartmann analytics) in a total volume of 90 µL) 3.2. Oligonucleotides All oligonucleotides were purchased from Sigma (for standard PCR: desalted, Pool: gel purified). -
Pool_fwd (CCAAG TAATACGACTCACTATAGGGCAACTCCAAGCTAGATCTACCGGT) Pool_rev (AGTGAAAAGTTCTTCTCCTTTGCTAGCCATTTT) Pool_Oligo_rev (AGTGAAAAGTTCTTCTCCTTTGCTAGCCATTTTNN NNNNNNNNTAGAAGCCAGTAGNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNACCGGTAGATCTAGCTTGGAGTTG CCC) - Capture-oligonucleotide (TAGAAGCCAGTAG -biotin TEG linker) 3.3. Equipment -
- 10x PCR buffer (0.5 M KCl (Roth, p.a.), 0.1 M Tris-HCl pH 9 (Roth, p.a.), 1% Triton X100 (Sigma, purest)) - 2x RNA loading dye (formamide (Roth, 99.5% bioscience grade) with 25 mM EDTA pH 8.0 (Roth, p.a.) and bromphenol/xylencyanol (Roth))
Scintillation Counter PCR Cycler Magnetic rack Gel electrophoresis and power supply Nanodrop 0.2 μM filter
- Set up large scale PCR reaction in a 50 mL tube (total reaction volume = 50 mL) as follows: 0.2 mM dNTPs (each), 1.5 mM MgCl2, 24 nM Pool_Oligo_rev, 2.4 µM Pool_fwd, 2.4 µM Pool_rev, 50 U/mL Taq polymerase in 1x PCR buffer. - Aliquot the 50 mL to 200 µL PCR tubes (150 µL each, see Note B). - Run PCR with following conditions: 3 min 95 °C; 5*{1 min 95 °C, 1 min 54 °C, 2 min 72 °C}; 3 min 72 °C. - After performing PCR, pool the individual PCR reactions and precipitate with NaAc (Roth p.a.)/EtOH (VWR, p.a.). - Resolve the pellet in a suitable amount of MQ-H2O. Monitor size and quality of the PCR product on a 3% agarose gel. If the size is
- 10x TBE buffer (1 M Tris base, 1 M Boric acid (Roth, p.a.), 20 mM EDTA) - Streptavidin Dynabeads M−270 (Thermo Fisher) - B&W buffer (5 mM Tris-HCl pH 7.5, 0.5 mM EDTA, 1 M NaCl) 12
Methods 161 (2019) 10–15
A. Boussebayle, et al.
-
-
-
4.4. Hybridisation of the pool with Capture-oligonucleotide (CO)
appropriate, start with large-scale overnight transcription. For the transcription, one tenth of the total volume should be used as template, as it contains theoretically at least one copy of each sequence. Large-scale overnight transcription (10 mL total volume): 200 mM Tris-Cl pH 8.0, 20 mM MgAc2, 20 mM DTT, 10 mM spermidine (Roth, p.a.), 4 mM NTPs (each), one tenth of the total volume of the PCR template, 250 U/mL T7 polymerase, fill up to 10 mL with MQH2O. Incubate overnight (16 h) at 37 °C (Note C). If pyrophosphate is precipitated during transcription, centrifuge the tube and take the clear supernatant. Precipitate the filtrate with EtOH/acetone (Note D). Wash the pellet twice with 10 mL 70 °C EtOH (Note E). Air dry pellet for 15 min (Note F). Resuspend the pellet in 2 mL MQ-H2O, then add 1 vol 2x RNA loading dye. Separate the transcribed RNA by denaturing PAGE (6% PAA gel with 8 M urea in 1x TBE). Run gel with 20 V/cm until the bromophenol blue exits the gel. Visualise RNA via UV-shadowing and cut it out. Cut gel into small slices and transfer them into 50 mL tube. Add 300 mM NaAc pH 6.5 to the slices until they are completely covered. Put the tube in a rotating shaker over night to elute RNA Filter the eluted RNA using a 0.2 µM filter to remove gel debris and take the clear filtrate for subsequent steps. Precipitate the filtrate with NaAc/EtOH (Note G) Wash pellet twice with 70% EtOH Air dry pellet for 5 min and resolve RNA in a suitable amount of MQH2O Determine RNA concentration (e.g. by Nanodrop) and calculate molarity.
- For the first round, 2 nmol of RNA (∼1015 different sequences) from the previously purified RNA are used for the immobilization mixed with 150,000 CPM 5′ [32P] labelled RNA. For all other rounds, 150,000 CPM [32P] RNA from the body-labelled transcription is used. Mix 150 pmol [1.5 nmol] CO with 10 µL [40 µL] 5x CSB with the RNA and fill up to 50 µL [200 µL] with MQ-H2O. - Heat the solution for 5 min at 65 °C - Slowly cool the solution down to 21 °C (20 min using a thermoblock) 4.5. Coating beads with RNA - Mix prepared beads with folded and hybridised RNA - Incubate for at least 30 min at RT on a revolver mixer (20–25 rpm). - Remove supernatant (i.e. unbound RNA and CO) after placing the tube on a magnetic rack for 30 sec. 4.6. Selection process - Resuspend by pipetting 5–10 times the RNA-coated beads in 200 µL [400 µL] 1× CSB and incubate 5 min at 30 °C on a thermoblock to remove weak CO binders - Collect the supernatant, set apart 5% of the volume for measurement of radioactivity (corresponds to the RNA content) - Resuspend by pipetting 5–10 times the RNA-coated magnetic beads in 200 µL [400 µL] 1x CSB and incubate 5 min on the revolver shaker at room temperature - From each step, collect 5% of the volume for measurement of radioactivity. The value is calculated using this formula: % input eluted = [CPM measured for the eluted fraction/Sum of all measured fraction (all washes + elution + beads)] *100 - Repeat these step 2 [4] times - Resuspend your RNA-coated beads in 200 µL [400 µL] of a solution containing your target molecule at a 1 mM concentration in 1x CSB and incubate 5 min on the revolver shaker (Note J) - Collect 5% of the supernatant (eluted aptamers) for measurement and transfer the remainder into a fresh 1.5 mL tube - Resuspend the remaining beads in 1× CSB 200 µL [400 µL] and collect 5% to measure the amount of RNA immobilized on the beads but not eluted after target addition. - Perform a NaAc precipitation by addition of 0.1 V of NaAc 3 M pH 5.5 and 2.5 V of 100% ethanol and place it for at least 30 min at −20 °C. Tip: 1 µL of GlycolBlue (Thermos Fisher) can be added to obtain a clearer pellet after centrifugation
4.2. End labelling of the pool for the first round For the first round, a part of the starting pool needs to be radioactive-labelled as a tracer. - Dephosphorylate 10 pmol (about 6*1012 different sequences) by adding 2 µL CIP (Roche) in 1x CIP buffer (provided by supplier). - Incubate for 30 min at 55 °C and then heat-inactivate the enzyme for 10 min at 95 °C. - Precipitate the inactivated reaction with NaAc/EtOH. - Label the complete dephosphorylated RNA by adding 3 µL [γ-32P] ATP and 1 µL PNK (Roche) in 1x PNK buffer (provided by supplier). - Incubate the reaction for 1 h at 37 °C. - Precipitate the reaction with NH4Ac (Roth, p.a.) (Note H). - Resuspend the pellet in 20 µL MQ-H20.
4.7. Amplification of the eluted aptamers - Transfer the 1.5 mL tube containing the RNA from the freezer to a 4 °C pre-cooled centrifuge and spin RNA for 30 min at 13 rpm - Carefully discard the supernatant and wash the pellet twice with 800 µL of 70% ethanol - Dry pellet for 5 min at 37 °C and dissolve RNA in 50 µL [150 µL] MQwater - Mix RNA with 1 [3] RT-PCR mix (47 µL per mix) and incubate the tube for 5 min at 65 °C - Add 1 µL [3 µL] of Superscript II and Taq polymerase and transfer the reaction to a PCR cycler - Incubate the reaction at 54 °C for 10 min and heat it up to 95 °C to denature the reverse-transcriptase - Add 100 pmol of the forward primer per 100 µL RT-PCR reaction - Perform at least 6 [4] rounds of PCR and check the amplification product on a 3% agarose gel - When the band on the gel shows a strong intensity without any sign of overamplification, stop the PCR. If no product is visible, 4 additional cycles can be added
As the first round of SELEX needs to screen a larger number of unique sequences than the following rounds, higher amounts of all compounds/reactants involved have to be used. Therefore, the values reported in square brackets indicate the corresponding amounts required for round 1. 4.3. Preparation of paramagnetic beads - Wash three times 1 × 108 [1 × 109] Streptavidin Dynabeads M-270 (150 µL [1.5 mL]) with 500 µL [1 mL] of B&W buffer. - Wash once with 500 µL [1 mL] 1× CSB - Resuspend the beads in 150 µL [200 µL] 1× CSB - Store at room temperature (RT) until use
13
Methods 161 (2019) 10–15
A. Boussebayle, et al.
5.2. Conclusions
- Transfer 10 µL of the RT-PCR mix into a 87 µL transcription mix and incubate at least 1 h at 37 °C. (Note K) - RNA is afterwards purified by ammonium precipitation and radioactivity of the sample is measured to determine to amount of RNA equivalent to 150 kcpm to use for the next round
Capture-SELEX is a method for fast and efficient enrichment of small molecule-binding aptamers. The main advantage of this method is that the ligand does not require immobilisation. Consequently, the resulting aptamers can recognise each chemical moiety of the respective target. However, Capture SELEX is not only a very efficient method for selecting aptamers. The rearrangement and undocking steps of the method also render it very suitable for several downstream applications, e.g. development into riboswitches or biosensors. To qualify for these applications, aptamers are required to not only bind their target molecule with high affinity and specificity, but also to exhibit structure switching. Conveniently, Capture SELEX selects for aptamers with precisely these characteristics. In addition, fine tuning of the stringency of the selection process is possible via the docking sequence. So far, our experience suggests that structure switching does not take place at the expense of affinity or specificity, but that the aptamers found via Capture-SELEX have the same excellent binding properties as aptamers obtained via classical SELEX. Since the method is even faster than a classical SELEX, Capture SELEX is universally recommended for the selection of small molecule-binding aptamers.
5. Results and conclusions 5.1. Capture-SELEX for ATP-binding aptamers As a target for this selection, rATP was selected among other metabolites to develop aptamers that are able to sense rATP inside of a cell. Developed aptamer could then be further engineered into a biosensor, e.g. to monitor the metabolic flux of this metabolite. For the first round, an RNA pool containing of 1015 different sequences were hybridised on 2 nmol of Capture-oligonucleotide. Among the RNA, 100 kcpm of radioactively 32-P-end labelled RNA were added as a tracer. After folding, the immobilised RNA was incubated with magnetic beads having a binding capacity of 2 nmol (1 mL). For all subsequent rounds, 150 µL of beads and 0.2 nmol of Capture-oligonucleotide were used. For all specific elution steps, 1 mM of rATP in SELEX buffer was used. For the five first rounds, the specific elution step was performed directly after the washing steps (Fig. 2). At round number 5, a specific enrichment towards rATP could be observed. To enhance specificity of the library, a counter-elution step was introduced in the following rounds. In rounds 6 and 7, 1 mM of rADP was used to elute non-specific binders. In rounds 8 and 9, 1 mM of dATP was used as a counter-elution target. After 9 rounds, the proportion of binders was still superior to the background fraction, indicating that aptamers were enriched. However, the amount of non-specific binders in the fraction is also very important as they reveal a low specificity of the library. To investigate the affinity of specifically enriched sequences in detail, cloning of the library is necessary. In a first run, standard Sangersequencing is sufficient to identify most enriched sequences that will statistically be detectable even with a low amount of cloned sequenced. Binding studies have to be performed to identify those sequences showing a specific binding behaviour. For more detail about the enrichment of the library, we recommend to perform next generation sequencing (NGS) for an in-depth analysis of the behaviour of the library. NGS data is superior because of the specific detail provided for each round of enrichment [11]. Thus, sequences can be observed that may be appearing later in the process due to experimental conditions (e.g. overly strong interaction with the Capture-oligonucleotide, weak transcription efficiency etc.). These sequences may be strong candidates with prominent enrichment under mid-experimental conditions, e.g. when higher stringency or counter elution is applied. However, such sequences would be lost with classical sequencing approaches because they would never catch up with candidates that show strong enrichment from round 1. Obviously, later candidates may be well worth analysing because the data suggest a stronger affinity/specificity [11].
6. Notes Note A The adjustment of DNA towards RNA Capture-SELEX needed some adaptations based on the chemical properties of RNA. The main difference between the DNA Capture-SELEX protocol and the RNA Capture-SELEX based protocol is at the folding step. RNA cannot be boiled at 95 °C in the presence of magnesium without being cleaved. Therefore, the folding was done at lower temperature and in the presence of the CO to allow the RNA to unfold without being degraded and to fold directly on the CO once the tube is transfer to 21 °C. RNA Capture-SELEX protocol can be also apply for 2′-Fluoro-modified RNA if the suitable enzymes for transcription and reverse-transcription are used. Note B The optimisation was done in a total volume of 150 µL PCR reaction in a 200 µL tube. Also, the reactions were performed on the same cycler to exclude variation arising from the individual cycler model. Note C White pyrophosphate precipitate should visibly form and also accumulated at the bottom of the tube. Note D Ethanol/Acetone precipitation of RNA EtOH/acetone (Roth, p.a.) is particularly suitable for the precipitation of small oligonucleotides (personal experience). - Add EDTA pH 8.0 and NaAc pH 6.5 to a final concentration of 80 mM and 400 µM, respectively, and fill up with 2.5 vol of ice-cold EtOH/acetone (1:1) - After thoroughly vortexing the mixture, incubate 1 h at −20 °C and centrifuge afterwards for at least 1 h with maximum speed, 4 °C. Fig. 2. Capture-SELEX against rATP. The blue bars represent the amount of RNA eluted specifically by rATP. The dark grey bars represent the amount of RNA non-specifically eluted in the last washing step (background). The green bars represent the amount of RNA left on the beads after all the wash steps and the elution step. The 5 first rounds were performed with specific elution only. The light grey bars represent the amount of RNA eluted by the countertarget in round 6–7 for rADP and in round 8–9 for dATP. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
14
Methods 161 (2019) 10–15
A. Boussebayle, et al.
Note E Be very carefully when decanting the supernatant, since the RNA may be not forming a pellet after the first centrifugation – it may resemble a gel. After the second wash, this gel should form a pellet. If the RNA is still gel-like, wash a third time with increased volume. Note F Make sure you carefully remove the 70% EtOH and then dry the RNA for only 5 min leaving the centrifuge tube open. Do not overdry the RNA, as it will be very difficult to dissolve. Note G Ethanol precipitation of RNA. Mix the nucleic acid solution with 0.1 vol 3 M sodium acetate (pH 6.5), 2.5 vol 100% EtOH and 1 µL GlycoBlue (Invitrogen). After vortexing, freeze for 30 min @ −20 °C. Afterwards centrifuge 30 min at maximum speed and 4 °C. Remove supernatant and wash pellet twice with 70% EtOH. Air dry pellet for 5 min and resuspend pellet in suitable amount of H2O (for RT-PCR, use 50 µL H2O). Note H Ammonium acetate precipitation of RNA. Mix nucleic acid solution with 0.5 vol 7.5 M ammonium acetate and 2.5 vol 100% EtOH. After vortexing, place sample on ice for exactly 10 min. Centrifuge precipitate for exactly 15 min at maximum speed and RT. Wash pellet twice with 70% EtOH. After air-drying the pellet, resuspend in a suitable amount of H2O. Note J 5 min was decided to be the optimal time for specific elution. It is a good compromise between the time that allow specific binding of the target and a smallest possible amount of unspecific elution. The extension of the elution time increases the non-specific elution of RNA from the beads linearly. However, specific binding to a target happens fast (according to ITC data that shows an equilibrium between the target and the aptamer within a few seconds). Therefore, a short time is always better. However, a too short incubation time may select for aptamers with a high koff. Note K To transcribe RNA for the second and subsequent rounds, a simpler mix can be used than the highly efficient mix used to prepare the starting pool. The highly efficient reaction is optimized for long term transcription, while the simpler mix is optimized for short term transcriptions.
ligands to bacteriophage T4 DNA polymerase, Science (80-) 249 (1990) 505 LP-510. [3] B.-F. Ye, Y.-J. Zhao, Y. Cheng, T.-T. Li, Z.-Y. Xie, X.-W. Zhao, Z.-Z. Gu, Colorimetric photonic hydrogel aptasensor for the screening of heavy metal ions, Nanoscale 4 (2012) 5998–6003. [4] M. Meli, J. Vergne, J.-L. Décout, M.-C. Maurel, Adenine-aptamer complexes: a bipartite RNA site that binds the adenine nucleic base, J. Biol. Chem. 277 (2002) 2104–2111. [5] A. Hunsicker, M. Steber, J. Meitert, M. Klotzsche, M. Blind, W. Hillen, C. Berens, B. Suess, Article An RNA Aptamer that Induces Transcription, 2009 doi: 10.1016/j. chembiol.2008.12.008. [6] A. Geiger, P. Burgstaller, H. von der Eltz, A. Roeder, M. Famulok, RNA aptamers that bind L-arginine with sub-micromolar dissociation constants and high enantioselectivity, Nucleic Acids Res. 24 (1996) 1029–1036. [7] R.D. Jenison, S.C. Gill, A. Pardi, B. Polisky, High-resolution molecular discrimination by RNA, Science (80-.) 263 (1994) 1425–1429. [8] D. Shangguan, Y. Li, Z. Tang, Z.C. Cao, H.W. Chen, P. Mallikaratchy, K. Sefah, C.J. Yang, W. Tan, Aptamers evolved from live cells as effective molecular probes for cancer study, Proc. Natl. Acad. Sci. 103 (2006) 11838 LP-11843. [9] D. Thirunavukarasu, T. Chen, Z. Liu, N. Hongdilokkul, F.E. Romesberg, Selection of 2′-fluoro-modified aptamers with optimized properties, J. Am. Chem. Soc. 139 (2017) 2892–2895. [10] R.L. Strack, W. Song, S.R. Jaffrey, Using Spinach-based sensors for fluorescence imaging of intracellular metabolites and proteins in living bacteria, Nat. Protoc. 9 (2013) 146–155. [11] F. Groher, C. Bofill-Bosch, C. Schneider, J. Braun, S. Jager, K. Geißler, K. Hamacher, B. Suess, Riboswitching with ciprofloxacin-development and characterization of a novel RNA regulator, Nucl. Acids Res. 46 (2018) 2121–2132. [12] J.H. Lee, F. Jucker, A. Pardi, Imino proton exchange rates imply an induced-fit binding mechanism for the VEGF165-targeting aptamer, Macugen, FEBS Lett. 582 (2008) 1835–1839. [13] R. Nutiu, Y. Li, In vitro selection of structure-switching signaling aptamers, Angew. Chemie - Int. Ed. 44 (2005) 1061–1065. [14] R. Stoltenburg, N. Nikolaus, B. Strehlitz. Capture-SELEX: Selection of DNA Aptamers for Aminoglycoside Antibiotics. 2012. [15] M. Rajendran, A.D. Ellington, In vitro selection of molecular beacons, Nucl. Acids Res. 31 (2003) 5700–5713. [16] F.M. Spiga, P. Maietta, C. Guiducci, More DNA–aptamers for small drugs: a capture–SELEX coupled with surface plasmon resonance and high-throughput sequencing, ACS Comb. Sci. 17 (2015) 326–333. [17] B. Suess, B. Fink, C. Berens, R. Stentz, W. Hillen, A theophylline responsive riboswitch based on helix slipping controls gene expression in vivo, Nucl. Acids Res. 32 (2004) 1610–1614. [18] M.G. Wallis, U. von Ahsen, R. Schroeder, M. Famulok, A novel RNA motif for neomycin recognition, Chem. Biol. 2 (1995) 543–552. [19] A. Boussebayle, D. Torka, S. Ollivaud, J. Braun, C. Bofill-Bosch, M. Dombrowski, F. Groher, K. Hamacher, B. Suess, Next-level riboswitch development-implementation of Capture-SELEX facilitates identification of a new synthetic riboswitch, Nucleic Acids Res. (2019), https://doi.org/10.1093/nar/gkz216 pii: gkz216. [20] F. Groher, B. Suess, In vitro selection of antibiotic-binding aptamers, Methods 106 (2016) 42–50.
References [1] A.D. Ellington, J.W. Szostak, In vitro selection of RNA molecules that bind specific ligands, Nature 346 (1990) 818. [2] C. Tuerk, L. Gold, Systematic evolution of ligands by exponential enrichment: RNA
15