- Email: [email protected]
Simultaneous detection of Apple Chlorotic Leaf Spot Virus and Apple mosaic virus in crab apples and apple rootstocks by duplex RT-PCR
Scientia Horticulturae 164 (2013) 88–93
Contents lists available at ScienceDirect
Scientia Horticulturae journal homepage: www.elsevier.com/locate/scihorti
Simultaneous detection of Apple Chlorotic Leaf Spot Virus and Apple mosaic virus in crab apples and apple rootstocks by duplex RT-PCR Santosh Watpade a,∗ , Baswaraj Raigond b , K.K. Pramanick a , Neeraj Sharma c , Anil Handa c , Usha Sharma c a
IARI Regional Station, Shimla 171004, India CPRI, Shimla, India c Dr. YSPUHF Nauni, Solan, India b
a r t i c l e
i n f o
Article history: Received 2 July 2013 Received in revised form 9 September 2013 Accepted 13 September 2013 Keywords: ACLSV ApMV Apple Duplex RT-PCR Malus ELISA NADH Crab apple Rootstock
a b s t r a c t Apple Chlorotic Leaf Spot Virus (ACLSV; family Betaflexiviridae, genus Trichovirus) and Apple mosaic virus (ApMV; family Bromoviridae, genus Ilarvirus) are economically important viruses of apple (Malus × domestica Borkh.). A duplex reverse transcription polymerase chain reaction (RT-PCR) assay was developed for simultaneous detection of both ACLSV and ApMV along with an internal control (NADH dehydrogenase subunit 5 gene). The internal control was used to minimize the risk of getting false negative results. Specific primers were designed against coat protein gene of ApMV while for ACLSV & internal control previously reported primer sets were used. Firstly the uniplex RT-PCR assay was standardized for the detection of each virus independently. Then duplex RT-PCR protocol for simultaneous detection of ACLSV and ApMV was standardized by using primer pairs ACLSV-CP1F & ACLSV-CP1R and ApMV-CP1F & ApMV-CP5R, respectively, along with primer set for internal control. Robustness of the technique was further validated wherein; duplex RT-PCR was carried out to detect both viruses in crab apples, rootstocks and different popular cultivars of apple. Results reveal that the duplex RT-PCR assay has detection sensitivity as that of uniplex RT-PCR assay for respective viruses. This optimized duplex RT-PCR provides a simple, rapid, sensitive and convenient way for simultaneous detection of ACLSV & ApMV by reducing the time and cost of the supplies. © 2013 Elsevier B.V. All rights reserved.
1. Introduction The apple (Malus × domestica) belongs to the family Rosaceae which is one of the most widely cultivated temperate fruit tree. About 69 million tons of apples were grown worldwide in 2010 and China produced almost half of this total whereas, India stands in 5th position with an area of 0.29 mHa, production of 2.89 mt and productivity of 10 t/Ha (Anonymous, 2012). Wild species of genus Malus that are relatives of the cultivated apple and that produce small sour fruit are called as crab apples. These crab apples may be used in breeding program, as pollinizers in apple orchards, ornamental trees and most commonly as rootstocks for domestic apples. Crab apple Malus baccata collected from Shillong is an ideal example of wild species being used as a rootstock. The relatively low productivity of apple in India is due to several biotic and abiotic factors. Biotic factors comprise of various fungal, bacterial and viral diseases. Many viruses have been reported in apple (Nemeth, 1986) viz. Apple mosaic virus (ApMV), Apple chlorotic
∗ Corresponding author. Tel.: +91 9805325107. E-mail address: [email protected] (S. Watpade). 0304-4238/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.scienta.2013.09.015
leaf spot virus (ACLSV), Apple stem grooving virus (ASGV) and Apple stem pitting virus (ASPV) that cause significant yield losses (Mink, 1989). ACLSV is a type member of the genus Trichovirus (Martelli et al., 1994) of Betaflexiviridae family (Adams et al., 2004), whereas ApMV belongs to the genus Ilarvirus and family Bromoviridae. ACLSV was first reported in Malus spp. from the US by Mink and Shay in 1959 (Burnt et al., 1996). It is one important latent virus whose infection rates ranges up to 80–100% in many commercial apple cultivars with yield losses to the tune of 30–40% (Nemchinov et al., 1995; Wu et al., 1998; Cembali et al., 2003). In Himachal Pradesh (India) ACLSV appeared as a major virus on apple with disease incidence ranging from 85% to 90% (Rana et al., 2010). ApMV is one of the oldest known viral diseases of plants (Posnette and Cropley, 1952). This virus was first reported in Malus domestica from the USA by Bradford and Joley (1933). In India, mosaic symptoms were first noticed in Uttarakhand during 1957 (Bhargava and Bist, 1957). It infects all kinds of apple in commerce and appears sporadically but frequently. The virus spreads by means of vegetative propulage. The typical symptom of infection is color change of the leaf. An apple tree infected with the ApMV will display symptoms of pale to bright cream spots on the leaves. It causes reduction in shoot growth, fruit set, fruit weight, yield per
S. Watpade et al. / Scientia Horticulturae 164 (2013) 88–93
tree and ascorbic acid content of the fruit (Singh et al., 1979) which results in yield reduction of up to 60% (Menzel et al., 2002). Similarly yield loss of more than 46% in the cultivar Golden Delicious was reported due to ApMV infection (Cembali et al., 2003). Apparently healthy looking and high yielding plants used as a source of bud stick may carry latent virus infection. Similarly virus infected rootstock/crab apple multiplied clonally is also potential source of virus transmission. Hence detection of the virus in elite mother plants, rootstocks and in crab apples used as a rootstock is a matter of great importance. Although, a natural spread under field condition has been observed but the natural mode of spread is unknown. Thus a program of disseminating virus-free material will help in controlling virus infection. So, reliable detection of viruses is an important aspect in generation of virus-free planting material (Nakahara et al., 2011). Biological indexing and ELISA are routinely used for detection of important viruses of apple. Both methods have their limitations, the major limitations of biological indexing are its application length (3 years), its cost in terms of glasshouse space and labor intensity and sometimes symptoms are difficult to interpret. At the same time ELISA often fails because of low virus titers or the inhibitory effects of plant polysaccharides or phenolic compounds. In addition, no internal controls are available to prevent false negative results in ELISA. Therefore for routine diagnosis, reliable, fast, inexpensive and robust procedures are essential, therefore, PCR technique would provide a possible alternative. Use of duplex RT-PCR assay will further reduce the costs, time and quantity of sample required. Hence an experiment was design to standardize duplex RT-PCR for simultaneous detection of ACLSV and ApMV in a given sample. 2. Materials and methods 2.1. Samples for ELISA and RT-PCR Leaf samples from rootstocks, crab apples and popular cultivars were collected from Indian Agricultural Research Institute Regional Station (IARI-RS), Shimla (HP), India and were stored at 4 ◦ C until further processing. Leaf samples from virus infected plants maintained at IARI-RS, Shimla were used as a positive control in the present study. Lab-based techniques were carried out in the Division of Plant Protection, Central Potato Research Institute (CPRI), Shimla, HP (India) and the Division of Mycology and Plant Pathology, Dr. Y.S. Parmar University of Horticulture and Forestry, Nauni, Solan, HP (India). 2.2. ELISA Leaves collected from different apple plants (Table 2) were then serologically subjected to detection of viruses through double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA). For ELISA tests, reagents, buffers, controls supplied by the BIOREBA AG (Switzerland) were used as per the instructions of manufacturer. ELISA results were interpreted by following Lemmetty (1988) and Dijkstra and Jager (1998), wherein samples were considered infected when their OD values at 405 nm (A405 ) exceeded two times the mean values of respective healthy and negative control samples. 2.3. Isolation of total RNA and c-DNA synthesis Total RNA was isolated from leaves of apple plants by using SpectrumTM Plant Total RNA kit (Sigma–Aldrich, USA) as per manufactures instructions. The isolated total RNA was quantified by Thermo Scientific Nanodrop 2000. The first strand of c-DNA was synthesized by Revert AidTM c-DNA synthesis kit (Fermentas Life
89
Sciences) using random hexamer. The reverse transcription (RT) mixture comprising of 4.0 l of 5× buffer, 2.0 l of 10 mM each dNTP mix, 1.0 l of 20 U/l RNase inhibitor, 1.0 l of 0.2 g/l random primer, 6.0 l of template RNA, 1.0 l of 200 U/l RT enzyme and 5.0 l of RNase-free water to provide a final volume of 20 l. All the reactions were set up in ice cold condition to avoid premature cDNA synthesis and minimize the risk of RNA degradation. The reaction mixture was mixed, briefly centrifuged and incubated at 25 ◦ C for 5 min, 42 ◦ C for 59 min, 75 ◦ C for 10 min. Later cDNA was used for further PCR amplification and the remaining quantity was stored at −20 ◦ C for further use. 2.4. Designing of virus specific primers for RT-PCR Coat protein gene was targeted to design primers for ApMV. Sequence data of ApMV (CP region: 6.677 of Acc no: FN435317.1) was obtained from the Genebank of the National Center for Biotechnology Information (NCBI) and primers were designed by using software Primer 3. With respect to ACLSV primer set ACLSV-CP1F, ACLSV-CP1R reported by Watpade et al. (2012) was used. The primer names, oligonucleotide sequences, and expected size of amplified products are shown in Table 1. 2.5. Primers for internal control Performance of RT-PCR with an internal control can minimize the risk of obtaining false negative results (Menzel et al., 2002; Thompson et al., 2003). Although several plant internal control primers have been published (Bariana et al., 1994; Nassuth et al., 2000) none of them can distinguish DNA from RNA so that the complete removal of DNA is required before performing RT-PCR (Nassuth et al., 2000; Menzel et al., 2002). To solve this problem, Menzel et al. (2002) designed the primers for amplifying apple mitochondrial NADH dehydrogenase subunit 5 (nad 5) gene. The same primer set, i.e., sense: 5 -gatgcttcttggggcttcttgtt-3 and antisense: 5 -ctccagtcaccaacattggcataa-3 giving 181 base pair amplification was used in the present study. 2.6. Optimization of uniplex RT-PCR For ACLSV, PCR protocol standardized by Watpade et al. (2012) was used. To optimize PCR conditions for ApMV, PCR was carried out in thin walled 1.25 ml tubes in GeneAmp PCR 9700 system (Applied Biosystems, USA). The reaction mixture of 20 l containing 0.8 units of Red Taq DNA polymerase (Genei, Banglore, India) 1.6 l of 2 mM dNTP mix (Fermentas), 2.5 l of 10× taq DNA Polymerase buffer (Genei, Banglore, India), 0.5 l of each downstream and upstream primers, 2 l of cDNA and volume was made up to 20 l with DEPC treated water. Amplification was carried out by following PCR conditions with five primer pairs along with an internal control. Denaturation was performed at 94 ◦ C/30 s annealing temperature of 59 ◦ C/1 min followed by extension at 72 ◦ C/1 min for 40 cycles along with a final elongation step at 72 ◦ C for 10 min. After PCR about 10 l of the reaction mixture from each tube was loaded onto 1% agarose gel alongside 1 kb DNA ladder as molecular weight marker. Electrophoresis was carried out at 80 V, the buffer used was 1× TAE at 8.0 pH. The DNA bands in the gel were visualized on a UV-transilluminator and primer pair showing expected size was selected. 2.7. Optimization of annealing temperature After selecting a primer set, same PCR mix and PCR conditions were used on varying annealing temperatures ranging from 57 ◦ C to 63 ◦ C (57 ◦ C, 59 ◦ C, 61 ◦ C and 63 ◦ C). Once the primer
90
S. Watpade et al. / Scientia Horticulturae 164 (2013) 88–93
Table 1 Details of primers. S.N.
Code
Sequence
Polarity
Position of primer within ACLSV CP gene
Product size (bp)
1
ApMV-CP1F ApMV-CP1R
5 acactcaccctggatcttgc 3 5 cggtatttgcactggtggta 3
Sense Antisense
125–145 556–536
432
2
ApMV-CP1F ApMV-CP2R
5 acactcaccctggatcttgc 3 5 aacattcgtcggtatttgcac 3
Sense Antisense
125–145 557–537
433
3
ApMV-CP3F ApMV-CP1R
5 cacactcaccctggatcttg 3 5 cggtatttgcactggtggta 3
Sense Antisense
151–171 556–536
406
4
ApMV-CP1F ApMV-CP4R
5 acactcaccctggatcttgc 3 5 cattcgtcggtatttgcact 3
Sense Antisense
150–170 556–536
407
5
ApM-CP1F ApMV-CP5R
5 acactcaccctggatcttgc 3 5 attcgtcggtatttgcactg 3
Sense Antisense
151–171 557–537
407
6
ACLSV-CP1F ACLSV-CP1R
5 tcgcgaacatagcgatacag 3 5 acgacattttcgcctcattc 3
Sense Antisense
125–145 556–536
432
set and annealing temperature was standardized, the optimized parameters were used for further studies. 2.8. Elution and sequencing For further validation and confirmation, the expected size amplicon (614 bp) of ApMV was subjected to sequencing. For this the amplified DNA of desired size on the electrophoresis gel was eluted by mini elute gel extraction kit (Qiagen, Germany). Eluted DNA was subjected to cycle sequencing in the Thermal cycler for ApMV. Twenty micro liter (20 l) mix containing 3 l reaction mixture (Big dye® Applied Biosystem, USA), 2 l 5× sequencing buffer (Big dye® Applied Biosystem, UK), selected primers 4 l and eluted DNA 8 l, were use and cycle sequencing was performed at 96 ◦ C/10 s, 50 ◦ C/5 s, 60 ◦ C/4 min for 25 cycles. The cycle sequenced product was then subjected to purification to obtain pure template. Then sequencing of purified product was performed by using 3500 Genetic analyser (Applied biosystem-Hitachi). The sequence obtained was further analyzed by BLAST algorithm available at http://www.ncbi.nim.nih.gov.
2.11. Validation of duplex RT-PCR After standardization of duplex RT-PCR parameters the protocol was used for the detection of ACLSV and ApMV in the rootstocks, crab apples and popular cultivars planted in IARI-RS farm, Shimla. Leaves collected from different trees were subjected to duplex RT-PCR detection for the presence or absence of ACLSV and ApMV. 3. Results 3.1. ELISA Six rootstocks, sixteen crab apples and thirteen cultivars were serologically tested for the presence or absence of two apple viruses viz., ACLSV and ApMV. OD value-based serological detection of viruses revealed that 2 rootstocks (M-7 and M-26) were found positive for ACLSV, whereas the rest of the rootstocks and crab apples were found free from infection by both viruses. Among thirteen popular cultivars nine were found positive for ACLSV as well as for ApMV.
2.9. Validation of uniplex RT-PCR Uniplex RT-PCR for ApMV was validated by screening apple samples showing mosaic symptoms collected from IARI-RS farm, Shimla. Sample from five cultivars viz., Well Spur, Red Delicious, Vance Delicious, Red Chief and Oregon Spur was collected and subjected to virus indexing. 2.10. Optimization of duplex RT-PCR To standardize duplex RT-PCR for simultaneous detection of ACLSV and ApMV, the reaction mixture of 20 l containing 0.8 units of Red Taq DNA polymerase (Genei, Banglore, India) 1.6 l of 2 mM dNTP mix (Fermentas), 2.5 l of 10× taq DNA polymerase buffer (Genei, Banglore, India), 0.5 l of each downstream, upstream primers of ACLSV, ApMV & internal control and 2 l cDNA from positives of both viruses and volume was made up to 20 l with DEPC treated water. Amplification was carried out by following the PCR conditions standardized for ApMV where in different annealing temperatures of 57 ◦ C, 59 ◦ C, 61 ◦ C, 63 ◦ C/1 min were used. About 10 l of the PCR product from each tube was loaded onto 1% agarose gel and subjected to electrophoresis. Annealing temperature showing amplification for both viruses including internal control was selected. The PCR mix was again optimized by modifying PCR reagent mix, i.e., dNTPs (1.6, 1.8, 2, 2.2 and 2.5 l) and primer (0.5, 0.8, 1 l). The optimum concentration of PCR mix giving sharp bands of ACLSV and ApMV was selected.
3.2. Optimization of uniplex RT-PCR For RT PCR standardization and detection of the target virus (ApMV), five different Primer sets were designed and used, i.e., ApMV-CP1F ApMV-CP 1R, ApMV-CP1F ApMV-CP2R, ApMV-CP3F ApMV-CP1R, ApMV-CP1F ApMV-CP4R and ApMV-CP1F ApMVCP5R (Table 1). The feasibility of the primers was checked according to the target virus. Among five primer pairs ApMV-CP1F, ApMVCP5R permitted amplification of c-DNA fragments containing ApMV. The size of amplified product (614 bp) agreed well with required size. But along with expected size, another non-specific band was observed. Hence four different annealing temperatures (57 ◦ C, 59 ◦ C, 61 ◦ C and 63 ◦ C) were tested. It is found that at 63 ◦ C primer pair ApMV-CP1F ApMV-CP5R gave a sharp band without any multiple bands (Fig. 1). Hence ApMV-CP1F ApMV-CP5R was selected for further studies. 3.3. Sequencing and phylogenetic analysis After validating the RT-PCR conditions the desired fragment was eluted from the gel and further processed for sequencing. After obtaining the sequence data it was subjected to BLAST which confirmed that the amplified product obtained was of ApMV cp gene. The results exhibited identities of 96% at the nucleotide levels, with apple ApMV isolate from earlier reported sequences.
S. Watpade et al. / Scientia Horticulturae 164 (2013) 88–93
91
3.6. Validation of duplex RT-PCR As depicted in Fig. 4, among tested rootstocks only 2 showed presence of expected size band (432 bp) for ACLSV whereas none showed amplification for ApMV. Similarly all crab apples tested were free from infection by both viruses as no band was visible, whereas 11 out of 13 cultivars were found positive for ACLAV and 9 for ApMV (Table 2). In all the 35 samples, fragment of the expected size (181 bp) for internal control was amplified.
Fig. 1. Optimization of annealing temperature for amplification of ApMV coat protein gene by primer set ApMV-CP1F 4R. Lane M: 1 kb DNA ladder, 1: internal control at 57 ◦ C, 2: ApMV-CP1F 4R at 57 ◦ C, 3: ApMV-CP1F 4R at 59 ◦ C, 4: ApMV-CP1F 4R at 61 ◦ C, and 5: ApMV-CP1F 4R at 63 ◦ C.
3.7. Internal control The primer pair used for the internal control amplified consistently a fragment of the expected size, i.e., 181 bp (Figs. 1–4), irrespective of whether the extract came from infected or healthy plants samples. 4. Discussion
Fig. 2. Validation of uniplex PCR for ApMV by screening of apple samples. Lane M: 1 kb DNA ladder, 1: internal control (IC), 2: water control, 3: Well Spur, 4: Red Delicious, 5: Vance Delicious, 6: Red Chief and 7: Oregon Spur.
3.4. Validation of uniplex RT-PCR After standardization of the RT-PCR conditions for ApMV the standardized protocol was used for molecular detection of ApMV in 5 apple cultivars collected from IARI-RS, Shimla. All the cultivars showed the presence of expected size, i.e., 614 bp band (Fig. 2), indicating that the cultivars were carrying the infection of ApMV. 3.5. Optimization of duplex RT-PCR An attempt was made for simultaneous detection of ACLSV and ApMV along with internal control in a single reaction tube with some modifications to the optimized uniplex RT-PCR. Prior to Duplex PCR, amplification of ACLSV with internal control and ApMV with internal control were evaluated separately. All the reactions showed amplification of both the fragments (Fig. 3). The increased quantity of primers (0.5, 0.8, 1 l) and dNTPs (1.6, 1.8, 2, 2.2, 2.5 l) was evaluated to get the better results. The dNTPs concentration of 2 l yields sharp bands of both viruses but increased concentration of primers did not show any significant difference. Hence the lowest quantity of primer, i.e., 0.5 l was used for further studies along with 2 l dNTPs. Among different annealing temperatures (57 ◦ C, 59 ◦ C, 61 ◦ C, 63 ◦ C), it is found that at 63 ◦ C was optimum as it gave sharp bands without any nonspecific band.
Fig. 3. Standardization of Duplex PCR for ACLSV and ApMV. Lane M: 1 kb plus DNA ladder, 1: Internal control (IC), 2: ACLSV, 3: ApMV, 4: IC and ACLSV, 5: IC and ApMV, 6: IC, ACLSV and ApMV.
We report here the development of duplex RT-PCR protocol for simultaneous detection of ACLSV and ApMV in Apple. The development of duplex RT-PCR assay will provide more efficient alternative to existing detection techniques. The coat protein gene appeared to be the most conserved region, encoding genes with identity levels ranging between 87% and 93.3% (Nakahara et al., 2011). Thus coat protein gene sequence was used for designing the primers for ACLSV and ApMV. For ApMV uniplex PCR, among the five sets of primer, one primer set, i.e., ApMV-CP1F ApMV-CP5R was selected and was further optimized by exposing it to different annealing temperature (57 ◦ C, 59 ◦ C, 61 ◦ C, 63 ◦ C and 65 ◦ C). Wherein, the optimum annealing temperature of 63 ◦ C effectively amplified the specific fragment of ApMV from leaves of apple tree. Similarly RT-PCR detection protocol for ApMV was standardized by Thokchom et al. (2009). The specific/desired amplicon of ApMV was eluted and further processed for sequencing. The sequence data obtained was BLAST analyzed and results revealed that the amplicon belongs to ApMV cp gene. The optimized protocol for detection of ApMV through RT-PCR was validated by screening virus suspected cultivars of apple. All the cultivars showed presence of virus, which indicates selected primer pair can be used for virus indexing in future. Since the first report by Chamberlain et al. (1988), multiplex PCR has been successfully applied in the detection of multiple plant virus infections (Menzel et al., 2002; Thompson et al., 2003; Malmstrom and Shu, 2004). Detecting more than one virus in an assay can accelerate testing procedures and decrease the cost of diagnosis and the quantity of plant material required (Al Rwahnih et al., 2004; Foissac et al., 2005; Hassan et al., 2006). The duplex RT-PCR protocol for simultaneous detection of ACLSV and ApMV was standardized by using primer pairs ACLSVCP1F & ACLSV-CP1R; ApMV-CP1F & ApMV-CP5R along with primer for internal control. Menzel et al. (2003) standardized a protocol to detect apple viruses ACLSV with ASGV and ASPV with ApMV along with internal control. Similarly Ma et al. (2008) was able to detect ACLSV with ASGV and ASPV with ASGV in pear. Baswaraj et al. (2013) standardize a duplex RT-PCR assay for simultaneous detection of two viruses infecting potato, i.e., Potyvirus (Potato virus Y) and Carlavirus (Potato virus S). The standardized duplex RT-PCR protocol was validated by screening rootstocks, crab apples and popular cultivars. As the popular cultivars may be used as a source of budsticks in future, it is important to know the virus status in those cultivars. Crab apples are being used as a rootstock for domestic cultivars as some of them impart resistance to diseases and pests without impairing the productivity and quality. For example M. baccata collected from
92
S. Watpade et al. / Scientia Horticulturae 164 (2013) 88–93
Fig. 4. Validation of duplex PCR for ACLSV and ApMV by screening rootstocks and cultivars of apple. Lane M: 1 kb plus DNA ladder, W: water control (WC), H: healthy control, P: positive control, 1–35: rootstocks, crab apples and popular cultivars of apple (details are given in Table 2).
Shillong is used as a rootstock because it is tolerant to white root rot (Dematophora necatrix) and wooly aphid (Erisoma lanigerum). Rootstocks propagated clonally may transmit the virus if it is infected. Hence rootstocks, crab apples and cultivars were subjected to virus indexing by duplex RT-PCR. Among rootstocks only 2 were found positive for ACLSV where as all the crab apples were free from
infection by both viruses. All the popular cultivars were found infected by either one or both viruses. The virus-infected rootstocks and popular cultivars should not be used for clonal multiplication and as a source of bud-sticks for grafting respectively. In future, virus-infected cultivars can be used for the yield loss study by apple viruses. The rootstocks and cultivars also screened by ELISA
Table 2 Detection of ACLSV & ApMV in apple samples by duplex RT-PCR and ELISA. Sr. No.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35
Apple sample
Purpose
ELISA
Duplex RT-PCR
ACLSV
ApMV
ACLSV
ApMV
M-7 M-26 M. pumila Mill Snowdrift Malus × ‘Snowdrift’ M. sargentii Malus sieboldii M. simcoe M. esseltine M. baccata Shillong M. spectibillis M. baccata Kinnaur M. purpurea Red Flesh M. baccata Kashmir M-9 M. baccata Rohroo MM-111 EMLA-793 Manchurica M. zhumi Manchurian M. sargam Gloster Well Spur Starking Delicious Well Spur Oregon Spur Oregon Spur Silver Spur Red Delicious Vance Delicious Oregon Spur Red Delicious Red Chief Oregon Spur
Rootstock Rootstock Rootstock Crab apple
+ + – –
– – – –
+ + – –
– – – –
Crab apple Crab apple Crab apple Crab apple Crab apple Crab apple Crab apple Crab apple Crab apple Crab apple Rootstock Crab apple Rootstock Rootstock Crab apple Crab apple Crab apple Crab apple Cultivated apple Cultivated apple Cultivated apple Cultivated apple Cultivated apple Cultivated apple Cultivated apple Cultivated apple Cultivated apple Cultivated apple Cultivated apple Cultivated apple Cultivated apple
– – – – – – – – – – – – – – – – – – – – + + + + + + + – – + +
– – – – – – – – – – – – – – – – – – + + + + + + + – – + + – –
– – – – – – – – – – – – – – – – – – + + + + + + + + + – – + +
– – – – – – – – – – – – – – – – – – + + + + + + + – – + + – –
S. Watpade et al. / Scientia Horticulturae 164 (2013) 88–93
wherein the results were similar to duplex RT-PCR except for 2 cultivars, where ELISA showed negative which were shown positive by RT-PCR (Table 2). False negative results can be a problem in conventional RT-PCR amplifications because inhibitor in the plant extract can interfere with the amplification process. The use of internal PCR controls targeting the plant genome is one of the methods available to avoid the false negative amplification products in RT-PCR assays and ensure the reliability of diagnosis (Ma et al., 2008). Menzel et al. (2002) designed a pair of primers for amplification the nad5 gene, the same was used in the study. Amplification of internal control in all the experiments indicates the reliability of the results. 5. Conclusion Based on the study we can conclude that duplex RT-PCR is the reliable, fast and comparatively cheaper than the individual RT-PCR for each virus. Results also imply that standardized protocol can be used for virus indexing for the ACLSV and ApMV in different species of apple. Acknowledgments Authors express gratitude to the Director, CPRI, Shimla for extending laboratory facilities, Director and Joint Director (Research), IARI, New Delhi for kind cooperation and financial support and Head of the Mycology and Plant Pathology Division, Dr YSPUHF, Solan for providing virus infected plants. References Adams, M.J., Antoniw, J.F., Bar-Joseph, M., Brunt, A.A., Candresse, T., Foste, G.D., Martelli, G.P., Milne, R.G., Fauquet, C.M., 2004. The new plant virus family Flexiviridae and assessment of molecular criteria for species demarcation. Arch. Virol. 149, 1045–1060. Al Rwahnih, M., Turturo, A., Minafra, P., Saldarelli, A., Myrta, V., Pallas, V., Savino, V., 2004. Molecular variability of Apple chlorotic leaf spot virus in different hosts and geographical regions. J. Plant Pathol. 86, 117–122. Anonymous, 2012. FAO, https://www.faostat.fao.org Bariana, H.S., Shannon, A.L., Chu, P.W.G., Waterhouse, P.M., 1994. Detection of five seed borne legume viruses in one sensitive multiplex polymerase chain reaction test. Phytopathology 84, 1201–1205. Baswaraj, R., Sharma, M., Chauhan, Y., Jeevalatha, A., Singh, B.P., Sharma, S., 2013. Optimization of duplex RT-PCR for simultaneous detection of Potato virus Y and S. Potato J. 40, 22–28. Bhargava, K.S., Bist, N.S., 1957. Three virus diseases of hill fruits in Kumaon. Curr. Sci. 26, 324–325. Ma, B.G., Niu, J.X., Bunker, M.M., Pan, L.Z., Zhang, H.P., Zhang, L.X., 2008. Detection of three pear viruses by multiplex RT-PCR assays with co-amplification of an internal control. Austral. Plant Pathol. 37, 117–122. Bradford, F.C., Joley, L., 1933. Infectious variegation in the apple. J. Agric. Res. 46, 901–908. Burnt, A.A., Crabtree, K., Dallwitz, M.J., Gibbs, A.J., Watson, L., 1996. Viruses of plantsdescriptions and lists from the VIDE database. CAB International, Wallingford, UK, pp. 100.
93
Cembali, T., Folwell, R.J., Wandschneider, P., Eastwell, K.C., Howell, W.E., 2003. Economic implications of a virus prevention program in deciduous tree fruits in the US. Crop Prot. 22, 1149–1156. Chamberlain, J.S., Gibbs, R.A., Ranier, J.E., Nguyen, P.N., Caskey, C.T., 1988. Deletion screening of the Duchenne muscular dystrophy locus via multiplex DNA amplification. Nucl. Acids Res. 16, 11141–11156. Dijkstra, J., Jager, C.P., 1998. Practical Plant Virology: Protocols and Exercises. Springer Verlag, New York, p. 459. Foissac, X., Svanella-Dumas, L., Gentit, P., Dulucq, M.J., Marais, A., Candresse, T., 2005. Polyvalent degenerate oligonucleotides reverse transcription-polymerase chain reaction: a polyvalent detection and characterization tool for trichoviruses, capilloviruses, and foveaviruses. Phytopathology 95, 617–625. Hassan, M., Myrta, A., Polak, J., 2006. Simultaneous detection and identification of four pome fruit viruses by one-tube pentaplex RT-PCR. J. Virol. Methods 133, 124–129. Lemmetty, A., 1988. Isolation and purification of apple chlorotic leaf spot virus and its occurrence in Finnish orchards. Acta Hortic. 235, 177–180. Malmstrom, C.M., Shu, R., 2004. Multiplexed RT-PCR for streamlined detection and separation of barley and cereal yellow dwarf viruses. J. Virol. Methods 120, 69–78. Martelli, G.P., Candresse, T., Namba, S., 1994. Trichovirus, a new genus of plant viruses. Arch. Virol. 134, 451–455. Menzel, W., Jelkmann, W., Maiss, E., 2002. Detection of four apple viruses by multiplex RT-PCR assays with coamplification of plant mRNA as internal control. J. Virol. Methods 99, 81–92. Menzel, W., Zahn, V., Maiss, E., 2003. Multiplex RT-PCR-ELISA compared with bioassay for the detection of four apple viruses. J. Virol. Methods 110, 153–157. Mink, G.I., 1989. Apple chlorotic leaf spot. In: Fridlund, P.R. (Ed.), Virus and virus like disease of pome fruits and simulating noninfectious disorders. Cooperative College of Agriculture and Home Economics Washington State University, Pullman, pp. 8–19. Nakahara, K.S., Yoshida, K., Suzaki, K., Yoshikawa, N., Ito, T., 2011. Sensitive PCRbased detection of Apple Chlorotic Leaf Spot Virus heterogenous in apple trees. Jpn. Agric. Res Q. 45 (4), 411–421. Nassuth, A., Pollari, E., Helmeczy, K., Stewart, S., Kofalvi, S.A., 2000. Improved RNA extraction and one-tube RTPCR assay for simultaneous detection of control plant RNA plus several viruses in plant extracts. J. Virol. Methods 90, 37–49. Nemchinov, L., Hadidi, A., Verderevskaya, T., 1995. Detection and partial characterization of a Plum Pox Virus isolate from infected sour cherry. Acta Hortic. 386, 226–236. Nemeth, M., 1986. Apple chlorotic leaf spot. In: Kiado, A., Budapest, Nijhoff, M. (Eds.), Virus, Mycoplasma and Rickettsia Diseases of Fruit Trees, Dordrecht, Boston, Lancaster. , pp. 197–204. Posnette, A.F., Cropley, R., 1952. A preliminary report on strains of the apple mosaic virus. Rep. E. Malling Res. Stn. 1951, 128–130. Rana, T., Chandel, V., Kumar, Y., Ram, R., Hallan, V., Zaidi, A.A., 2010. Molecular variability analyses of Apple chlorotic leaf spot virus capsid protein. J. Biosci. 35 (4), 605–615. Singh, B.B., Pandey, B.N., Singh, R.N., Singh, S., 1979. Effect of apple mosaic virus on the growth, yield and quality of apple. Punjab Hortic. J. 19, 80–82. Thokchom, T., Rana, T., Hallan, V., Ram, R., Zaidi, A.A., 2009. Molecular characterization of the Indian strain of Apple mosaic virus isolated from apple (Malus domestica). Phytoparasitica 37, 375–379. Thompson, J.R., Wetzel, S., Klerks, M.M., Vaskova, D., Schoen, C.D., Spak, J., Jelkmann, W., 2003. Multiplex RT-PCR detection of four aphid-borne strawberry viruses in Fragaria spp. in combination with a plant mRNA specific internal control. J. Virol. Methods 111, 85–93. Watpade, S., Baswaraj, R., Thakur, P.D., Handa, A., Pramanick, K.K., Sharma, Y.P., Tomar, M., 2012. Molecular detection of Latent Apple chlorotic leaf spot virus in Elite Mother Plants of Apple. Indian J. Virol. 23 (3), 359–363. Wu, Y.Q., Zhang, D.M., Chen, S.Y., Wang, X.F., Wang, W.H., 1998. Comparison of three ELISA methods for the detection of Apple chlorotic leaf spot virus and Apple stem grooving virus. Acta Hortic. 472, 55–60.
Contents lists available at ScienceDirect
Scientia Horticulturae journal homepage: www.elsevier.com/locate/scihorti
Simultaneous detection of Apple Chlorotic Leaf Spot Virus and Apple mosaic virus in crab apples and apple rootstocks by duplex RT-PCR Santosh Watpade a,∗ , Baswaraj Raigond b , K.K. Pramanick a , Neeraj Sharma c , Anil Handa c , Usha Sharma c a
IARI Regional Station, Shimla 171004, India CPRI, Shimla, India c Dr. YSPUHF Nauni, Solan, India b
a r t i c l e
i n f o
Article history: Received 2 July 2013 Received in revised form 9 September 2013 Accepted 13 September 2013 Keywords: ACLSV ApMV Apple Duplex RT-PCR Malus ELISA NADH Crab apple Rootstock
a b s t r a c t Apple Chlorotic Leaf Spot Virus (ACLSV; family Betaflexiviridae, genus Trichovirus) and Apple mosaic virus (ApMV; family Bromoviridae, genus Ilarvirus) are economically important viruses of apple (Malus × domestica Borkh.). A duplex reverse transcription polymerase chain reaction (RT-PCR) assay was developed for simultaneous detection of both ACLSV and ApMV along with an internal control (NADH dehydrogenase subunit 5 gene). The internal control was used to minimize the risk of getting false negative results. Specific primers were designed against coat protein gene of ApMV while for ACLSV & internal control previously reported primer sets were used. Firstly the uniplex RT-PCR assay was standardized for the detection of each virus independently. Then duplex RT-PCR protocol for simultaneous detection of ACLSV and ApMV was standardized by using primer pairs ACLSV-CP1F & ACLSV-CP1R and ApMV-CP1F & ApMV-CP5R, respectively, along with primer set for internal control. Robustness of the technique was further validated wherein; duplex RT-PCR was carried out to detect both viruses in crab apples, rootstocks and different popular cultivars of apple. Results reveal that the duplex RT-PCR assay has detection sensitivity as that of uniplex RT-PCR assay for respective viruses. This optimized duplex RT-PCR provides a simple, rapid, sensitive and convenient way for simultaneous detection of ACLSV & ApMV by reducing the time and cost of the supplies. © 2013 Elsevier B.V. All rights reserved.
1. Introduction The apple (Malus × domestica) belongs to the family Rosaceae which is one of the most widely cultivated temperate fruit tree. About 69 million tons of apples were grown worldwide in 2010 and China produced almost half of this total whereas, India stands in 5th position with an area of 0.29 mHa, production of 2.89 mt and productivity of 10 t/Ha (Anonymous, 2012). Wild species of genus Malus that are relatives of the cultivated apple and that produce small sour fruit are called as crab apples. These crab apples may be used in breeding program, as pollinizers in apple orchards, ornamental trees and most commonly as rootstocks for domestic apples. Crab apple Malus baccata collected from Shillong is an ideal example of wild species being used as a rootstock. The relatively low productivity of apple in India is due to several biotic and abiotic factors. Biotic factors comprise of various fungal, bacterial and viral diseases. Many viruses have been reported in apple (Nemeth, 1986) viz. Apple mosaic virus (ApMV), Apple chlorotic
∗ Corresponding author. Tel.: +91 9805325107. E-mail address: [email protected] (S. Watpade). 0304-4238/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.scienta.2013.09.015
leaf spot virus (ACLSV), Apple stem grooving virus (ASGV) and Apple stem pitting virus (ASPV) that cause significant yield losses (Mink, 1989). ACLSV is a type member of the genus Trichovirus (Martelli et al., 1994) of Betaflexiviridae family (Adams et al., 2004), whereas ApMV belongs to the genus Ilarvirus and family Bromoviridae. ACLSV was first reported in Malus spp. from the US by Mink and Shay in 1959 (Burnt et al., 1996). It is one important latent virus whose infection rates ranges up to 80–100% in many commercial apple cultivars with yield losses to the tune of 30–40% (Nemchinov et al., 1995; Wu et al., 1998; Cembali et al., 2003). In Himachal Pradesh (India) ACLSV appeared as a major virus on apple with disease incidence ranging from 85% to 90% (Rana et al., 2010). ApMV is one of the oldest known viral diseases of plants (Posnette and Cropley, 1952). This virus was first reported in Malus domestica from the USA by Bradford and Joley (1933). In India, mosaic symptoms were first noticed in Uttarakhand during 1957 (Bhargava and Bist, 1957). It infects all kinds of apple in commerce and appears sporadically but frequently. The virus spreads by means of vegetative propulage. The typical symptom of infection is color change of the leaf. An apple tree infected with the ApMV will display symptoms of pale to bright cream spots on the leaves. It causes reduction in shoot growth, fruit set, fruit weight, yield per
S. Watpade et al. / Scientia Horticulturae 164 (2013) 88–93
tree and ascorbic acid content of the fruit (Singh et al., 1979) which results in yield reduction of up to 60% (Menzel et al., 2002). Similarly yield loss of more than 46% in the cultivar Golden Delicious was reported due to ApMV infection (Cembali et al., 2003). Apparently healthy looking and high yielding plants used as a source of bud stick may carry latent virus infection. Similarly virus infected rootstock/crab apple multiplied clonally is also potential source of virus transmission. Hence detection of the virus in elite mother plants, rootstocks and in crab apples used as a rootstock is a matter of great importance. Although, a natural spread under field condition has been observed but the natural mode of spread is unknown. Thus a program of disseminating virus-free material will help in controlling virus infection. So, reliable detection of viruses is an important aspect in generation of virus-free planting material (Nakahara et al., 2011). Biological indexing and ELISA are routinely used for detection of important viruses of apple. Both methods have their limitations, the major limitations of biological indexing are its application length (3 years), its cost in terms of glasshouse space and labor intensity and sometimes symptoms are difficult to interpret. At the same time ELISA often fails because of low virus titers or the inhibitory effects of plant polysaccharides or phenolic compounds. In addition, no internal controls are available to prevent false negative results in ELISA. Therefore for routine diagnosis, reliable, fast, inexpensive and robust procedures are essential, therefore, PCR technique would provide a possible alternative. Use of duplex RT-PCR assay will further reduce the costs, time and quantity of sample required. Hence an experiment was design to standardize duplex RT-PCR for simultaneous detection of ACLSV and ApMV in a given sample. 2. Materials and methods 2.1. Samples for ELISA and RT-PCR Leaf samples from rootstocks, crab apples and popular cultivars were collected from Indian Agricultural Research Institute Regional Station (IARI-RS), Shimla (HP), India and were stored at 4 ◦ C until further processing. Leaf samples from virus infected plants maintained at IARI-RS, Shimla were used as a positive control in the present study. Lab-based techniques were carried out in the Division of Plant Protection, Central Potato Research Institute (CPRI), Shimla, HP (India) and the Division of Mycology and Plant Pathology, Dr. Y.S. Parmar University of Horticulture and Forestry, Nauni, Solan, HP (India). 2.2. ELISA Leaves collected from different apple plants (Table 2) were then serologically subjected to detection of viruses through double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA). For ELISA tests, reagents, buffers, controls supplied by the BIOREBA AG (Switzerland) were used as per the instructions of manufacturer. ELISA results were interpreted by following Lemmetty (1988) and Dijkstra and Jager (1998), wherein samples were considered infected when their OD values at 405 nm (A405 ) exceeded two times the mean values of respective healthy and negative control samples. 2.3. Isolation of total RNA and c-DNA synthesis Total RNA was isolated from leaves of apple plants by using SpectrumTM Plant Total RNA kit (Sigma–Aldrich, USA) as per manufactures instructions. The isolated total RNA was quantified by Thermo Scientific Nanodrop 2000. The first strand of c-DNA was synthesized by Revert AidTM c-DNA synthesis kit (Fermentas Life
89
Sciences) using random hexamer. The reverse transcription (RT) mixture comprising of 4.0 l of 5× buffer, 2.0 l of 10 mM each dNTP mix, 1.0 l of 20 U/l RNase inhibitor, 1.0 l of 0.2 g/l random primer, 6.0 l of template RNA, 1.0 l of 200 U/l RT enzyme and 5.0 l of RNase-free water to provide a final volume of 20 l. All the reactions were set up in ice cold condition to avoid premature cDNA synthesis and minimize the risk of RNA degradation. The reaction mixture was mixed, briefly centrifuged and incubated at 25 ◦ C for 5 min, 42 ◦ C for 59 min, 75 ◦ C for 10 min. Later cDNA was used for further PCR amplification and the remaining quantity was stored at −20 ◦ C for further use. 2.4. Designing of virus specific primers for RT-PCR Coat protein gene was targeted to design primers for ApMV. Sequence data of ApMV (CP region: 6.677 of Acc no: FN435317.1) was obtained from the Genebank of the National Center for Biotechnology Information (NCBI) and primers were designed by using software Primer 3. With respect to ACLSV primer set ACLSV-CP1F, ACLSV-CP1R reported by Watpade et al. (2012) was used. The primer names, oligonucleotide sequences, and expected size of amplified products are shown in Table 1. 2.5. Primers for internal control Performance of RT-PCR with an internal control can minimize the risk of obtaining false negative results (Menzel et al., 2002; Thompson et al., 2003). Although several plant internal control primers have been published (Bariana et al., 1994; Nassuth et al., 2000) none of them can distinguish DNA from RNA so that the complete removal of DNA is required before performing RT-PCR (Nassuth et al., 2000; Menzel et al., 2002). To solve this problem, Menzel et al. (2002) designed the primers for amplifying apple mitochondrial NADH dehydrogenase subunit 5 (nad 5) gene. The same primer set, i.e., sense: 5 -gatgcttcttggggcttcttgtt-3 and antisense: 5 -ctccagtcaccaacattggcataa-3 giving 181 base pair amplification was used in the present study. 2.6. Optimization of uniplex RT-PCR For ACLSV, PCR protocol standardized by Watpade et al. (2012) was used. To optimize PCR conditions for ApMV, PCR was carried out in thin walled 1.25 ml tubes in GeneAmp PCR 9700 system (Applied Biosystems, USA). The reaction mixture of 20 l containing 0.8 units of Red Taq DNA polymerase (Genei, Banglore, India) 1.6 l of 2 mM dNTP mix (Fermentas), 2.5 l of 10× taq DNA Polymerase buffer (Genei, Banglore, India), 0.5 l of each downstream and upstream primers, 2 l of cDNA and volume was made up to 20 l with DEPC treated water. Amplification was carried out by following PCR conditions with five primer pairs along with an internal control. Denaturation was performed at 94 ◦ C/30 s annealing temperature of 59 ◦ C/1 min followed by extension at 72 ◦ C/1 min for 40 cycles along with a final elongation step at 72 ◦ C for 10 min. After PCR about 10 l of the reaction mixture from each tube was loaded onto 1% agarose gel alongside 1 kb DNA ladder as molecular weight marker. Electrophoresis was carried out at 80 V, the buffer used was 1× TAE at 8.0 pH. The DNA bands in the gel were visualized on a UV-transilluminator and primer pair showing expected size was selected. 2.7. Optimization of annealing temperature After selecting a primer set, same PCR mix and PCR conditions were used on varying annealing temperatures ranging from 57 ◦ C to 63 ◦ C (57 ◦ C, 59 ◦ C, 61 ◦ C and 63 ◦ C). Once the primer
90
S. Watpade et al. / Scientia Horticulturae 164 (2013) 88–93
Table 1 Details of primers. S.N.
Code
Sequence
Polarity
Position of primer within ACLSV CP gene
Product size (bp)
1
ApMV-CP1F ApMV-CP1R
5 acactcaccctggatcttgc 3 5 cggtatttgcactggtggta 3
Sense Antisense
125–145 556–536
432
2
ApMV-CP1F ApMV-CP2R
5 acactcaccctggatcttgc 3 5 aacattcgtcggtatttgcac 3
Sense Antisense
125–145 557–537
433
3
ApMV-CP3F ApMV-CP1R
5 cacactcaccctggatcttg 3 5 cggtatttgcactggtggta 3
Sense Antisense
151–171 556–536
406
4
ApMV-CP1F ApMV-CP4R
5 acactcaccctggatcttgc 3 5 cattcgtcggtatttgcact 3
Sense Antisense
150–170 556–536
407
5
ApM-CP1F ApMV-CP5R
5 acactcaccctggatcttgc 3 5 attcgtcggtatttgcactg 3
Sense Antisense
151–171 557–537
407
6
ACLSV-CP1F ACLSV-CP1R
5 tcgcgaacatagcgatacag 3 5 acgacattttcgcctcattc 3
Sense Antisense
125–145 556–536
432
set and annealing temperature was standardized, the optimized parameters were used for further studies. 2.8. Elution and sequencing For further validation and confirmation, the expected size amplicon (614 bp) of ApMV was subjected to sequencing. For this the amplified DNA of desired size on the electrophoresis gel was eluted by mini elute gel extraction kit (Qiagen, Germany). Eluted DNA was subjected to cycle sequencing in the Thermal cycler for ApMV. Twenty micro liter (20 l) mix containing 3 l reaction mixture (Big dye® Applied Biosystem, USA), 2 l 5× sequencing buffer (Big dye® Applied Biosystem, UK), selected primers 4 l and eluted DNA 8 l, were use and cycle sequencing was performed at 96 ◦ C/10 s, 50 ◦ C/5 s, 60 ◦ C/4 min for 25 cycles. The cycle sequenced product was then subjected to purification to obtain pure template. Then sequencing of purified product was performed by using 3500 Genetic analyser (Applied biosystem-Hitachi). The sequence obtained was further analyzed by BLAST algorithm available at http://www.ncbi.nim.nih.gov.
2.11. Validation of duplex RT-PCR After standardization of duplex RT-PCR parameters the protocol was used for the detection of ACLSV and ApMV in the rootstocks, crab apples and popular cultivars planted in IARI-RS farm, Shimla. Leaves collected from different trees were subjected to duplex RT-PCR detection for the presence or absence of ACLSV and ApMV. 3. Results 3.1. ELISA Six rootstocks, sixteen crab apples and thirteen cultivars were serologically tested for the presence or absence of two apple viruses viz., ACLSV and ApMV. OD value-based serological detection of viruses revealed that 2 rootstocks (M-7 and M-26) were found positive for ACLSV, whereas the rest of the rootstocks and crab apples were found free from infection by both viruses. Among thirteen popular cultivars nine were found positive for ACLSV as well as for ApMV.
2.9. Validation of uniplex RT-PCR Uniplex RT-PCR for ApMV was validated by screening apple samples showing mosaic symptoms collected from IARI-RS farm, Shimla. Sample from five cultivars viz., Well Spur, Red Delicious, Vance Delicious, Red Chief and Oregon Spur was collected and subjected to virus indexing. 2.10. Optimization of duplex RT-PCR To standardize duplex RT-PCR for simultaneous detection of ACLSV and ApMV, the reaction mixture of 20 l containing 0.8 units of Red Taq DNA polymerase (Genei, Banglore, India) 1.6 l of 2 mM dNTP mix (Fermentas), 2.5 l of 10× taq DNA polymerase buffer (Genei, Banglore, India), 0.5 l of each downstream, upstream primers of ACLSV, ApMV & internal control and 2 l cDNA from positives of both viruses and volume was made up to 20 l with DEPC treated water. Amplification was carried out by following the PCR conditions standardized for ApMV where in different annealing temperatures of 57 ◦ C, 59 ◦ C, 61 ◦ C, 63 ◦ C/1 min were used. About 10 l of the PCR product from each tube was loaded onto 1% agarose gel and subjected to electrophoresis. Annealing temperature showing amplification for both viruses including internal control was selected. The PCR mix was again optimized by modifying PCR reagent mix, i.e., dNTPs (1.6, 1.8, 2, 2.2 and 2.5 l) and primer (0.5, 0.8, 1 l). The optimum concentration of PCR mix giving sharp bands of ACLSV and ApMV was selected.
3.2. Optimization of uniplex RT-PCR For RT PCR standardization and detection of the target virus (ApMV), five different Primer sets were designed and used, i.e., ApMV-CP1F ApMV-CP 1R, ApMV-CP1F ApMV-CP2R, ApMV-CP3F ApMV-CP1R, ApMV-CP1F ApMV-CP4R and ApMV-CP1F ApMVCP5R (Table 1). The feasibility of the primers was checked according to the target virus. Among five primer pairs ApMV-CP1F, ApMVCP5R permitted amplification of c-DNA fragments containing ApMV. The size of amplified product (614 bp) agreed well with required size. But along with expected size, another non-specific band was observed. Hence four different annealing temperatures (57 ◦ C, 59 ◦ C, 61 ◦ C and 63 ◦ C) were tested. It is found that at 63 ◦ C primer pair ApMV-CP1F ApMV-CP5R gave a sharp band without any multiple bands (Fig. 1). Hence ApMV-CP1F ApMV-CP5R was selected for further studies. 3.3. Sequencing and phylogenetic analysis After validating the RT-PCR conditions the desired fragment was eluted from the gel and further processed for sequencing. After obtaining the sequence data it was subjected to BLAST which confirmed that the amplified product obtained was of ApMV cp gene. The results exhibited identities of 96% at the nucleotide levels, with apple ApMV isolate from earlier reported sequences.
S. Watpade et al. / Scientia Horticulturae 164 (2013) 88–93
91
3.6. Validation of duplex RT-PCR As depicted in Fig. 4, among tested rootstocks only 2 showed presence of expected size band (432 bp) for ACLSV whereas none showed amplification for ApMV. Similarly all crab apples tested were free from infection by both viruses as no band was visible, whereas 11 out of 13 cultivars were found positive for ACLAV and 9 for ApMV (Table 2). In all the 35 samples, fragment of the expected size (181 bp) for internal control was amplified.
Fig. 1. Optimization of annealing temperature for amplification of ApMV coat protein gene by primer set ApMV-CP1F 4R. Lane M: 1 kb DNA ladder, 1: internal control at 57 ◦ C, 2: ApMV-CP1F 4R at 57 ◦ C, 3: ApMV-CP1F 4R at 59 ◦ C, 4: ApMV-CP1F 4R at 61 ◦ C, and 5: ApMV-CP1F 4R at 63 ◦ C.
3.7. Internal control The primer pair used for the internal control amplified consistently a fragment of the expected size, i.e., 181 bp (Figs. 1–4), irrespective of whether the extract came from infected or healthy plants samples. 4. Discussion
Fig. 2. Validation of uniplex PCR for ApMV by screening of apple samples. Lane M: 1 kb DNA ladder, 1: internal control (IC), 2: water control, 3: Well Spur, 4: Red Delicious, 5: Vance Delicious, 6: Red Chief and 7: Oregon Spur.
3.4. Validation of uniplex RT-PCR After standardization of the RT-PCR conditions for ApMV the standardized protocol was used for molecular detection of ApMV in 5 apple cultivars collected from IARI-RS, Shimla. All the cultivars showed the presence of expected size, i.e., 614 bp band (Fig. 2), indicating that the cultivars were carrying the infection of ApMV. 3.5. Optimization of duplex RT-PCR An attempt was made for simultaneous detection of ACLSV and ApMV along with internal control in a single reaction tube with some modifications to the optimized uniplex RT-PCR. Prior to Duplex PCR, amplification of ACLSV with internal control and ApMV with internal control were evaluated separately. All the reactions showed amplification of both the fragments (Fig. 3). The increased quantity of primers (0.5, 0.8, 1 l) and dNTPs (1.6, 1.8, 2, 2.2, 2.5 l) was evaluated to get the better results. The dNTPs concentration of 2 l yields sharp bands of both viruses but increased concentration of primers did not show any significant difference. Hence the lowest quantity of primer, i.e., 0.5 l was used for further studies along with 2 l dNTPs. Among different annealing temperatures (57 ◦ C, 59 ◦ C, 61 ◦ C, 63 ◦ C), it is found that at 63 ◦ C was optimum as it gave sharp bands without any nonspecific band.
Fig. 3. Standardization of Duplex PCR for ACLSV and ApMV. Lane M: 1 kb plus DNA ladder, 1: Internal control (IC), 2: ACLSV, 3: ApMV, 4: IC and ACLSV, 5: IC and ApMV, 6: IC, ACLSV and ApMV.
We report here the development of duplex RT-PCR protocol for simultaneous detection of ACLSV and ApMV in Apple. The development of duplex RT-PCR assay will provide more efficient alternative to existing detection techniques. The coat protein gene appeared to be the most conserved region, encoding genes with identity levels ranging between 87% and 93.3% (Nakahara et al., 2011). Thus coat protein gene sequence was used for designing the primers for ACLSV and ApMV. For ApMV uniplex PCR, among the five sets of primer, one primer set, i.e., ApMV-CP1F ApMV-CP5R was selected and was further optimized by exposing it to different annealing temperature (57 ◦ C, 59 ◦ C, 61 ◦ C, 63 ◦ C and 65 ◦ C). Wherein, the optimum annealing temperature of 63 ◦ C effectively amplified the specific fragment of ApMV from leaves of apple tree. Similarly RT-PCR detection protocol for ApMV was standardized by Thokchom et al. (2009). The specific/desired amplicon of ApMV was eluted and further processed for sequencing. The sequence data obtained was BLAST analyzed and results revealed that the amplicon belongs to ApMV cp gene. The optimized protocol for detection of ApMV through RT-PCR was validated by screening virus suspected cultivars of apple. All the cultivars showed presence of virus, which indicates selected primer pair can be used for virus indexing in future. Since the first report by Chamberlain et al. (1988), multiplex PCR has been successfully applied in the detection of multiple plant virus infections (Menzel et al., 2002; Thompson et al., 2003; Malmstrom and Shu, 2004). Detecting more than one virus in an assay can accelerate testing procedures and decrease the cost of diagnosis and the quantity of plant material required (Al Rwahnih et al., 2004; Foissac et al., 2005; Hassan et al., 2006). The duplex RT-PCR protocol for simultaneous detection of ACLSV and ApMV was standardized by using primer pairs ACLSVCP1F & ACLSV-CP1R; ApMV-CP1F & ApMV-CP5R along with primer for internal control. Menzel et al. (2003) standardized a protocol to detect apple viruses ACLSV with ASGV and ASPV with ApMV along with internal control. Similarly Ma et al. (2008) was able to detect ACLSV with ASGV and ASPV with ASGV in pear. Baswaraj et al. (2013) standardize a duplex RT-PCR assay for simultaneous detection of two viruses infecting potato, i.e., Potyvirus (Potato virus Y) and Carlavirus (Potato virus S). The standardized duplex RT-PCR protocol was validated by screening rootstocks, crab apples and popular cultivars. As the popular cultivars may be used as a source of budsticks in future, it is important to know the virus status in those cultivars. Crab apples are being used as a rootstock for domestic cultivars as some of them impart resistance to diseases and pests without impairing the productivity and quality. For example M. baccata collected from
92
S. Watpade et al. / Scientia Horticulturae 164 (2013) 88–93
Fig. 4. Validation of duplex PCR for ACLSV and ApMV by screening rootstocks and cultivars of apple. Lane M: 1 kb plus DNA ladder, W: water control (WC), H: healthy control, P: positive control, 1–35: rootstocks, crab apples and popular cultivars of apple (details are given in Table 2).
Shillong is used as a rootstock because it is tolerant to white root rot (Dematophora necatrix) and wooly aphid (Erisoma lanigerum). Rootstocks propagated clonally may transmit the virus if it is infected. Hence rootstocks, crab apples and cultivars were subjected to virus indexing by duplex RT-PCR. Among rootstocks only 2 were found positive for ACLSV where as all the crab apples were free from
infection by both viruses. All the popular cultivars were found infected by either one or both viruses. The virus-infected rootstocks and popular cultivars should not be used for clonal multiplication and as a source of bud-sticks for grafting respectively. In future, virus-infected cultivars can be used for the yield loss study by apple viruses. The rootstocks and cultivars also screened by ELISA
Table 2 Detection of ACLSV & ApMV in apple samples by duplex RT-PCR and ELISA. Sr. No.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35
Apple sample
Purpose
ELISA
Duplex RT-PCR
ACLSV
ApMV
ACLSV
ApMV
M-7 M-26 M. pumila Mill Snowdrift Malus × ‘Snowdrift’ M. sargentii Malus sieboldii M. simcoe M. esseltine M. baccata Shillong M. spectibillis M. baccata Kinnaur M. purpurea Red Flesh M. baccata Kashmir M-9 M. baccata Rohroo MM-111 EMLA-793 Manchurica M. zhumi Manchurian M. sargam Gloster Well Spur Starking Delicious Well Spur Oregon Spur Oregon Spur Silver Spur Red Delicious Vance Delicious Oregon Spur Red Delicious Red Chief Oregon Spur
Rootstock Rootstock Rootstock Crab apple
+ + – –
– – – –
+ + – –
– – – –
Crab apple Crab apple Crab apple Crab apple Crab apple Crab apple Crab apple Crab apple Crab apple Crab apple Rootstock Crab apple Rootstock Rootstock Crab apple Crab apple Crab apple Crab apple Cultivated apple Cultivated apple Cultivated apple Cultivated apple Cultivated apple Cultivated apple Cultivated apple Cultivated apple Cultivated apple Cultivated apple Cultivated apple Cultivated apple Cultivated apple
– – – – – – – – – – – – – – – – – – – – + + + + + + + – – + +
– – – – – – – – – – – – – – – – – – + + + + + + + – – + + – –
– – – – – – – – – – – – – – – – – – + + + + + + + + + – – + +
– – – – – – – – – – – – – – – – – – + + + + + + + – – + + – –
S. Watpade et al. / Scientia Horticulturae 164 (2013) 88–93
wherein the results were similar to duplex RT-PCR except for 2 cultivars, where ELISA showed negative which were shown positive by RT-PCR (Table 2). False negative results can be a problem in conventional RT-PCR amplifications because inhibitor in the plant extract can interfere with the amplification process. The use of internal PCR controls targeting the plant genome is one of the methods available to avoid the false negative amplification products in RT-PCR assays and ensure the reliability of diagnosis (Ma et al., 2008). Menzel et al. (2002) designed a pair of primers for amplification the nad5 gene, the same was used in the study. Amplification of internal control in all the experiments indicates the reliability of the results. 5. Conclusion Based on the study we can conclude that duplex RT-PCR is the reliable, fast and comparatively cheaper than the individual RT-PCR for each virus. Results also imply that standardized protocol can be used for virus indexing for the ACLSV and ApMV in different species of apple. Acknowledgments Authors express gratitude to the Director, CPRI, Shimla for extending laboratory facilities, Director and Joint Director (Research), IARI, New Delhi for kind cooperation and financial support and Head of the Mycology and Plant Pathology Division, Dr YSPUHF, Solan for providing virus infected plants. References Adams, M.J., Antoniw, J.F., Bar-Joseph, M., Brunt, A.A., Candresse, T., Foste, G.D., Martelli, G.P., Milne, R.G., Fauquet, C.M., 2004. The new plant virus family Flexiviridae and assessment of molecular criteria for species demarcation. Arch. Virol. 149, 1045–1060. Al Rwahnih, M., Turturo, A., Minafra, P., Saldarelli, A., Myrta, V., Pallas, V., Savino, V., 2004. Molecular variability of Apple chlorotic leaf spot virus in different hosts and geographical regions. J. Plant Pathol. 86, 117–122. Anonymous, 2012. FAO, https://www.faostat.fao.org Bariana, H.S., Shannon, A.L., Chu, P.W.G., Waterhouse, P.M., 1994. Detection of five seed borne legume viruses in one sensitive multiplex polymerase chain reaction test. Phytopathology 84, 1201–1205. Baswaraj, R., Sharma, M., Chauhan, Y., Jeevalatha, A., Singh, B.P., Sharma, S., 2013. Optimization of duplex RT-PCR for simultaneous detection of Potato virus Y and S. Potato J. 40, 22–28. Bhargava, K.S., Bist, N.S., 1957. Three virus diseases of hill fruits in Kumaon. Curr. Sci. 26, 324–325. Ma, B.G., Niu, J.X., Bunker, M.M., Pan, L.Z., Zhang, H.P., Zhang, L.X., 2008. Detection of three pear viruses by multiplex RT-PCR assays with co-amplification of an internal control. Austral. Plant Pathol. 37, 117–122. Bradford, F.C., Joley, L., 1933. Infectious variegation in the apple. J. Agric. Res. 46, 901–908. Burnt, A.A., Crabtree, K., Dallwitz, M.J., Gibbs, A.J., Watson, L., 1996. Viruses of plantsdescriptions and lists from the VIDE database. CAB International, Wallingford, UK, pp. 100.
93
Cembali, T., Folwell, R.J., Wandschneider, P., Eastwell, K.C., Howell, W.E., 2003. Economic implications of a virus prevention program in deciduous tree fruits in the US. Crop Prot. 22, 1149–1156. Chamberlain, J.S., Gibbs, R.A., Ranier, J.E., Nguyen, P.N., Caskey, C.T., 1988. Deletion screening of the Duchenne muscular dystrophy locus via multiplex DNA amplification. Nucl. Acids Res. 16, 11141–11156. Dijkstra, J., Jager, C.P., 1998. Practical Plant Virology: Protocols and Exercises. Springer Verlag, New York, p. 459. Foissac, X., Svanella-Dumas, L., Gentit, P., Dulucq, M.J., Marais, A., Candresse, T., 2005. Polyvalent degenerate oligonucleotides reverse transcription-polymerase chain reaction: a polyvalent detection and characterization tool for trichoviruses, capilloviruses, and foveaviruses. Phytopathology 95, 617–625. Hassan, M., Myrta, A., Polak, J., 2006. Simultaneous detection and identification of four pome fruit viruses by one-tube pentaplex RT-PCR. J. Virol. Methods 133, 124–129. Lemmetty, A., 1988. Isolation and purification of apple chlorotic leaf spot virus and its occurrence in Finnish orchards. Acta Hortic. 235, 177–180. Malmstrom, C.M., Shu, R., 2004. Multiplexed RT-PCR for streamlined detection and separation of barley and cereal yellow dwarf viruses. J. Virol. Methods 120, 69–78. Martelli, G.P., Candresse, T., Namba, S., 1994. Trichovirus, a new genus of plant viruses. Arch. Virol. 134, 451–455. Menzel, W., Jelkmann, W., Maiss, E., 2002. Detection of four apple viruses by multiplex RT-PCR assays with coamplification of plant mRNA as internal control. J. Virol. Methods 99, 81–92. Menzel, W., Zahn, V., Maiss, E., 2003. Multiplex RT-PCR-ELISA compared with bioassay for the detection of four apple viruses. J. Virol. Methods 110, 153–157. Mink, G.I., 1989. Apple chlorotic leaf spot. In: Fridlund, P.R. (Ed.), Virus and virus like disease of pome fruits and simulating noninfectious disorders. Cooperative College of Agriculture and Home Economics Washington State University, Pullman, pp. 8–19. Nakahara, K.S., Yoshida, K., Suzaki, K., Yoshikawa, N., Ito, T., 2011. Sensitive PCRbased detection of Apple Chlorotic Leaf Spot Virus heterogenous in apple trees. Jpn. Agric. Res Q. 45 (4), 411–421. Nassuth, A., Pollari, E., Helmeczy, K., Stewart, S., Kofalvi, S.A., 2000. Improved RNA extraction and one-tube RTPCR assay for simultaneous detection of control plant RNA plus several viruses in plant extracts. J. Virol. Methods 90, 37–49. Nemchinov, L., Hadidi, A., Verderevskaya, T., 1995. Detection and partial characterization of a Plum Pox Virus isolate from infected sour cherry. Acta Hortic. 386, 226–236. Nemeth, M., 1986. Apple chlorotic leaf spot. In: Kiado, A., Budapest, Nijhoff, M. (Eds.), Virus, Mycoplasma and Rickettsia Diseases of Fruit Trees, Dordrecht, Boston, Lancaster. , pp. 197–204. Posnette, A.F., Cropley, R., 1952. A preliminary report on strains of the apple mosaic virus. Rep. E. Malling Res. Stn. 1951, 128–130. Rana, T., Chandel, V., Kumar, Y., Ram, R., Hallan, V., Zaidi, A.A., 2010. Molecular variability analyses of Apple chlorotic leaf spot virus capsid protein. J. Biosci. 35 (4), 605–615. Singh, B.B., Pandey, B.N., Singh, R.N., Singh, S., 1979. Effect of apple mosaic virus on the growth, yield and quality of apple. Punjab Hortic. J. 19, 80–82. Thokchom, T., Rana, T., Hallan, V., Ram, R., Zaidi, A.A., 2009. Molecular characterization of the Indian strain of Apple mosaic virus isolated from apple (Malus domestica). Phytoparasitica 37, 375–379. Thompson, J.R., Wetzel, S., Klerks, M.M., Vaskova, D., Schoen, C.D., Spak, J., Jelkmann, W., 2003. Multiplex RT-PCR detection of four aphid-borne strawberry viruses in Fragaria spp. in combination with a plant mRNA specific internal control. J. Virol. Methods 111, 85–93. Watpade, S., Baswaraj, R., Thakur, P.D., Handa, A., Pramanick, K.K., Sharma, Y.P., Tomar, M., 2012. Molecular detection of Latent Apple chlorotic leaf spot virus in Elite Mother Plants of Apple. Indian J. Virol. 23 (3), 359–363. Wu, Y.Q., Zhang, D.M., Chen, S.Y., Wang, X.F., Wang, W.H., 1998. Comparison of three ELISA methods for the detection of Apple chlorotic leaf spot virus and Apple stem grooving virus. Acta Hortic. 472, 55–60.