- Email: [email protected]
Spliced leader RNA gene promoter sequence heterogeneity in CL-Brener Trypanosoma cruzi reference strain
Infection, Genetics and Evolution 4 (2004) 153–157
Short communication
Spliced leader RNA gene promoter sequence heterogeneity in CL-Brener Trypanosoma cruzi reference strain夽 Pamela Cribb a , Elizabeth Tapia b , Patricio Diosque c,1 , Esteban Serra a,∗ a
IBR, Facultad de Ciencias Bioqu´ımicas y Farmacéuticas, UNR, Suipacha 531, CP2000, Rosario, Argentina b Facultad de Ciencias Exactas, Ingenier´ıa y Agrimensura, UNR, Rosario, Argentina c Laboratorio de Patolog´ıa Experimental, Facultad de Ciencias de la Salud, Universidad Nacional de Salta 177, CP4400 Salta, Argentina Received 16 October 2003; received in revised form 23 February 2004; accepted 25 February 2004
Abstract Trypanosoma cruzi is divided into two phylogenetic lineages, T. cruzi I and T. cruzi II, which contain different spliced leader (SL) RNA gene promoter sequences: Class I SL gene promoter sequences are found in T. cruzi II, and Class II sequences in T. cruzi I. We analysed different SL RNA promoter sequences from CL-Brener reference strain, belonging to T. cruzi II lineage, and detected sequences that differed within the −80/+1 highly conserved region. Indeed, many of these divergent SL promoters present features of T. cruzi I promoters. Some of these sequences were grouped into the T. cruzi I sequences clade by Bayesian analysis. The results presented herein show that sequence heterogeneity in SL RNA gene promoter not only exists between T. cruzi strains but also within CL-Brener strain. These CL-Brener “T. cruzi I-like” sequences could be considered a molecular trace of a hybrid origin of the SL RNA gene and a new evidence for the presence of sequences of T. cruzi I origin into a T. cruzi II strain. The possible origins of these sequences are discussed. © 2004 Elsevier B.V. All rights reserved. Keywords: Trypanosoma cruzi; SL RNA; Gene promoter; Hybrid strains; Taxonomy
Trypanosomatid’s spliced leader (SL) gene is encoded in highly repeated genes, transcribed independently from their own promoters (Agabian, 1990). SL RNA gene sequences are highly divergent from one genus of the trypanosomatidae family to other and their functionality is genus specific too (reviewed by Campbell and Ayala, 2000). Nunes et al. (1997) described two groups of SL RNA gene promoter sequences in Trypanosoma cruzi. All Class I SL gene promoter sequences described until now, included that from CL-Brener strain, are identical in the region −80/+1. By contrast, Class II promoter sequences exhibit variation in this region. Transient transfection assays performed by the same authors using the SL RNA gene promoter from the CL strain, showed that this sequence is optimally expressed
夽 Nucleotide sequence data reported in this paper are available in the GenBankTM , EMBL and DDBJ databases under the accession number AF506368. ∗ Corresponding author. Tel.: +54-341-4350661; fax: +54-341-4390465. E-mail addresses: [email protected] (P. Diosque), [email protected], [email protected] (E. Serra). 1 Co-corresponding author.
1567-1348/$ – see front matter © 2004 Elsevier B.V. All rights reserved. doi:10.1016/j.meegid.2004.02.002
only in strains of the same group, suggesting that promoter functionality is group specific. Natural populations of T. cruzi consist of multiple clones distributed into two phylogenetic lineages, T. cruzi I and T. cruzi II (Souto et al., 1996; Anonymous, 1999; Briones et al., 1999). Five lower phylogenetic subdivisions have been identified within T. cruzi II lineage, designated T. cruzi IIa–e, whereas no clear subdivision has been found within T. cruzi I lineage (Anonymous, 1999; Barnabé et al., 2000; Brisse et al., 2001). In this phylogenetic context, Class I SL gene promoter sequences are found in T. cruzi II, and Class II sequences in T. cruzi I (Nunes et al., 1997). The phylogenetic relationships among different sub-lineages in T. cruzi are still unclear. In fact, evidence in favour of a hybrid origin for sub-lineages IId and IIe, from one or more hybridisation events between strains from clades IIb and IIc, has been found (Tibayrenc and Miles, 1983; Brisse et al., 2000, 2003; Barnabé et al., 2000; Machado and Ayala, 2001), and particularly for CL-Brener strain (Brisse et al., 1998). Recently, DNA exchange between two different—but closely related—T. cruzi I clones has been demonstrated for the first time, in an experimental model co-infecting mammalian cells (Gaunt et al., 2003). Indeed, recent data suggest the
154
P. Cribb et al. / Infection, Genetics and Evolution 4 (2004) 153–157
possibility of hybridisation events between T. cruzi I and T. cruzi II at evolutionary scale: (i) analysis of 1F8 gene polymorphism in different strains has revealed evidence of possible hybridisation between T. cruzi I and T. cruzi II in CL-Brener (Sturm et al., 2003); (ii) for one isolate, gene mosaics between T. cruzi IIb and T. cruzi I were reported by Gaunt et al. (2003); and (iii) presence and chromosomal location of rRNA gene variants (corresponding to those found in T. cruzi I and T. cruzi II) in putative hybrid strains, suggest genetic exchange between these two major lineages (Souto et al., 1996; Stolf et al., 2003). We cloned and sequenced several different SL RNA promoters from CL-Brener T. cruzi reference strain (belonging to IIe lineage). We designed SL-1 (5 -TTTTGTACACAAGGCC-3 ) and SL-2 (5 -AAAGGGGTCCGTGGACCC-3 ) oligonucleotides based on the already reported SL RNA gene sequences. When these primers were used for PCR on CL-Brener strain genomic DNA, a band of the expected size 241 bp was obtained and cloned into pGEM-T plasmid. Surprisingly, one of the sequences obtained differed in seven nucleotides in the −80 bp region from that already reported for CL-Brener strain. Sequence comparison determined that the nucleotides observed in six of the seven sites correspond to those found in T. cruzi I promoters (Fig. 1). To further analyse the SL RNA gene heterogeneity in CL-Brener strain, we recovered 973,418 single pass sequences from the TIGR T. cruzi genome project. This database was formatted and screened by Blast using −80 CL-Brener SL promoter region sequence present in the database (U39748) as query. From 1700 hits obtained, 958 showed 100% identity all along the query sequence. The remaining hits were analysed by visual inspection. A significant number of these hits correspond to sequences -80
truncated that fully match with a region of the query. Nearly 250 hits correspond to non-truncated sequences with one to six punctual mutations compared to the query sequence. Many of these sequences showed increased A-content at the Proximal Sequence Element and increased G-content in the −10/−30 region, typical features of T. cruzi I promoters. The remaining hits corresponded to sequences with low identity to CL-Brener SL promoter, many of them not related to the SL gene cluster. Analysis of the sequences with features of T. cruzi I promoter led to the detection of divergent SL promoters, most of them showing T. cruzi I/T. cruzi II hybrid characteristics. One of these sequences (CLATN68TF) was identical to that previously cloned and sequenced in our laboratory. Fig. 1 shows an alignment of ten selected sequences showing similarities to T. cruzi I SL promoters. The −80/+1 region from these selected CL-Brener promoters, together to those from T. cruzi II and T. cruzi I found in databases were aligned, and the relationship between them was inferred by Bayesian analysis using MrBayes program (Huelsenbeck and Ronquist, 2001). To do so, Markov Chain Monte Carlo simulation was performed during 1 × 106 generations, taking one state each 100 generations. The first 300 states were burned and the remaining 9.7 × 105 were recovered and taken as stable likelihood ones. These states were used for determining phylogenetic relationships and partition probabilities. After calculations, the program classified the data into two clades with a 100% of posterior probability (Fig. 2). One of these clades contains all T. cruzi II sequences and eight of the new sequences detected in this study. The second clade contains all T. cruzi I sequences, two of the new CL-Brener sequences and M5631–M6241 strains. Clones TCGST43TF and TCGSK65TF were very similar between them and
PSE
+1
U39748
GGGTTTTTGTACACGGTCCCAAGTGCCGCGAAGGA-CCCCTCATCAAAATTGAAAACCGTTGTGGAACACAACTCCTTTC AAC
TCGON58TF
.......C........................AA.-..................GG.................C......
TCGDN82TR
................................AA.-...................G.................CAT...T
TCHPL07TR
..AC..........A.................AA.-...................G.....A..................
TCPA031TF
...G.....G...............G.........-A...............G............C......G.......
AF506368
.............................A..AA.-..................GG.........G..G...........
CLATN68TF
.............................A..AA.-..................GG.........G..G...........
TCGEK39TR
...G............................AA.-...................G.........G..G...-..T...T
TCGNR73TR
...G............................AA.-...................G.........G..G...TCTT...G
TCGSK65TF
..AA............G...G-..AT...A..AA.A............T......G.-.G.CC..GC.CGG.ACTT....
TCGST43TF
..AA............G...G-.CAT...A..AA.A............T......G.-.G.CC..GC.CGG.ACTT....
T.cruzi I SL Promoters G2
..AG............C...-G..AT...AA..AA.............T......G.G..CCG..CC.GG....-T....
Colombiana
..AG............G...-T..AT...AA..AA.A........T..C.C......G..GTG..G..G....-.T....
Fig. 1. Alignment of CL-Brener SL gene promoters. U39748 is CL-Brener sequence previously described by Nunes et al. (1997). AF506368 corresponds to the sequence amplified in our laboratory. TCGON58TF, TCGDN82TR, TCHPL07TR, TCPA031TF, CLATN68TF, TCGEK39TR, TCGNR73TR, TCGSK65TF, TCGST43TF are a subset of T. cruzi I-like sequences recovered from TIGR T. cruzi genome project. Dots (· · · ) indicate identity with U39748 CL-Brener sequence. The boxed area corresponds to the Proximal Sequence Element (PSE). SL gene promoter sequences from T. cruzi I strains Colombiana (U39758) and G2 (U39756), are also shown.
P. Cribb et al. / Infection, Genetics and Evolution 4 (2004) 153–157
155
MT4183 MT4167
92
MT4181 Basileu CanIII Tulahuen 1 150zd 222ZC 229za Esmeraldo Y NR_c13 CL-Brener (U39748)
100 97
T. cruzi II
32
TCTPA037TF AF506368
36
CLATN68TF 95
TCHPL07TR TCGON58TF 48
TCGDN82TR
69
TCGEK39TR
97
TCGNR73TR M6241
100
M5631 TCGST43TF
47
TCGSK65TF
73 100
X10 37
68 100 90
T. cruzi I
Colombiana Peru
87 100
OPS_0021
Cuica Dm28c
G2
Fig. 2. Phylogenetic tree obtained by comparison of SL gene promoter. Tree was constructed by Bayesian inference as described in the text. The numbers on the branches indicate the bipartition probabilities calculated by the 50% majority rule. CL-Brener sequences used in the analysis, are the same subset of T. cruzi I-like sequences recovered from TIGR T. cruzi genome project shown in Fig. 1 and are underlined. Other sequences used are (strain names are indicated in brackets): AF050522 (M6241), AF050521 (M5631), AF051309 (MT4183), AF05523 (MT4167), AF051308 (MT4181), U57984 (CL), U57985 (NR), U39749 (150zd), U39750 (Basileu), U39760 (Y), U39751 (222zc), U39758 (229za), U39753 (CanIII), U39754 (Esmeraldo), U39755 (X10), U39756 (G2), U57987 (Dm28c), U39758 (Colombiana), U39759 (Peru), K02632 (Tulahuen 2), U90129 (Tulahuen 1), U90130 (OPS) and U90131 (Cuica).
clearly related to SL promoter from T. cruzi I X10 isolate. MT4183, MT4181 and MT4167 strains (“MT-strains”) clustered in a separated sub-group within T. cruzi II lineage (Fig. 2). Fernandes et al. (1998) characterised these strains by sequencing of the non-transcribed spacer of the mini-exon array and hybridisation patterns with specific probes. These authors suggest that the “MT-strains” and strains belonging to IIa (CAN III, reference strain for zymodeme III; Miles et al., 1978) and IIc (M5631 and M6241 strains) lineages, are more related to T. cruzi I than to T. cruzi II. All these isolates constitute a controversial pool of strains, included within T. cruzi II by some authors (Barnabé et al., 2000; Brisse et al., 2000, 2001), and considered more related to T. cruzi I by others (Miles et al., 1978; Fernandes et al., 1998; Machado and Ayala, 2001). In our analysis, the “MT-strains” and CAN III clustered with the
T. cruzi II strains, while M6241–M5631 were included in a discrete clade as a sister group of T. cruzi I. These results point out again the controversial status of these strains and the need for gene genealogies of an adequate number of individual genes in order to determine their phylogenetic relationships. Finally, phylogenetic relationships between sequences grouped into each clade were defined with less statistic consistence, probably due to the short size of the sequences. Nevertheless, defining these relationships is out of the goals of this report. The results presented herein show for the first time that sequence heterogeneity in SL RNA gene promoter not only exists among T. cruzi strains but also within CL-Brener strain. The data used in this study correspond to unassembled single pass genomic sequences. Because of that, it is difficult to determine the proportion of atypical SL gene
156
P. Cribb et al. / Infection, Genetics and Evolution 4 (2004) 153–157
promoters, however, the analysis of the results obtained by Blast suggests that it could represent nearly 5% of the SL genes. Moreover, not all these atypical genes are necessarily located at functional SL gene clusters. The fact that some of these sequences showed also mutations at the Spliced Leader region suggests that they could be non functional gene copies. The heterogeneity observed for the SL gene promoter can be interpreted given the possibility of hybridisation events. These hybridisation events could have taken place among T. cruzi I and T. cruzi II strains at the origin of the CL-Brener strain. Nevertheless, an alternative hypothesis, compatible with the hybrid origin of CL-Brener from hybridisation between IIb and IIc strains (Tibayrenc and Miles, 1983; Brisse et al., 1998, 2000, 2003; Barnabé et al., 2000; Machado and Ayala, 2001), could be that the parental IIc and/or IIb lines of CL-Brener were themselves T. cruzi I–T. cruzi II hybrids. Even though a large number of CL-Brener sequences analysed in our laboratory diverged from canonical T. cruzi II SL promoter without exactly matching T. cruzi I sequences, there are suggestive similarities with T. cruzi I SL promoters in these sequences. These “T. cruzi I-like” sequences could be considered a molecular trace of a hybrid origin of the SL RNA gene and a new evidence for the presence of sequences of T. cruzi I origin into a T. cruzi II (IIe) strain. T. cruzi is considered a diploid organism. However, some strains including CL-Brener, have shown to diverge from uniform diploidy, presenting triploid sections in their genomes (Gaunt et al., 2003). This means that T. cruzi harbours at least two copies of the SL gene cluster. Accepting the hybridisation hypothesis, each cluster could derive from each one of the organisms that generated the hybrid. However, highly repetitive sequences, such as SL sequences, constitute regions prone to both inter- and intrachromosomal recombination events. Moreover, the homogeneity observed in most of these sequences in different strains suggests also some mechanism of concerted evolution (Liao, 1999). These mechanisms—and a strong selection pressure due to functional constrains in favour of T. cruzi II sequences—could be responsible for the replacement of T. cruzi I-like by T. cruzi II promoter genes, what would explain the fact that most of the SL genes in CL-Brener harbour T. cruzi II promoters. As we mentioned above, some results suggest a lineage-specific functionality of the SL RNA gene promoter (Nunes et al., 1997). During CL-Brener strain evolution, the prevalence of transcription mechanisms selective for T. cruzi II promoters could have acted as a selection force for these promoters against T. cruzi I sequences, explaining the fact that most of the SL genes harbour T. cruzi II promoters. Recent data suggest that genetic exchange could have played an important role in the evolution of at least some T. cruzi lineages (Tibayrenc and Miles, 1983; Brisse et al., 2000, 2003; Machado and Ayala, 2001; Stolf et al., 2003). In view of this information and our findings, we hypothesise
that hybridisation events could be related to the origin of “T. cruzi I-like” SL promoter sequences found in CL-Brener strain, either by “direct” T. cruzi I–T. cruzi II hybridisation events, or by a previous hybrid origin of the IIb and/or IIc parental lines of CL-Brener.
Acknowledgements This work was supported by Fundación Antorchas, Third Word Academy of Sciences and the National Research Council (CONICET). References Agabian, N., 1990. Trans splicing of nuclear pre-mRNAs. Cell 61, 1157– 1160. Anonymous, 1999. Recommendations from a satellite meeting. Mem. Inst. Oswaldo Cruz 194 (Suppl. 1), 429–432. Barnabé, C., Brisse, S., Tibayrenc, M., 2000. Population structure and genetic typing of Trypanosoma cruzi, the agent of Chagas disease: a multilocus enzyme electrophoresis approach. Parasitology 120, 513– 526. Briones, M.R., Souto, R.P., Stolf, B.S., Zingales, B., 1999. The evolution of two Trypanosoma cruzi subgroups inferred from rRNA genes can be correlated with the interchange of American mammalian faunas in the Cenozoic and has implications to pathogenicity and host specificity. Mol. Biochem. Parasitol. 104, 219–232. Brisse, S., Barnabé, C., Banuls, A.L., Sidibe, I., Noel, S., Tibayrenc, M., 1998. A phylogenetic analysis of the Trypanosoma cruzi genome project CL-Brener reference strain by multilocus enzyme electrophoresis and multiprimer random amplified polymorphic DNA. Mol. Biochem. Parasitol. 92, 253–263. Brisse, S., Barnabé, C., Tibayrenc, M., 2000. Identification of six Trypanosoma cruzi phylogenetic lineages by random amplified polymorphic DNA and multilocus enzyme electrophoresis. Int. J. Parasitol. 30, 35–44. Brisse, S., Verhoef, J., Tibayrenc, M., 2001. Characterization of large and small subunit rRNA and miniexon genes further supports the distinction of six Trypanosoma cruzi lineages. Int. J. Parasitol. 31, 1218–1226. Brisse, S., Henriksson, J., Barnabé, C., Douaery, E.J., Berkvens, D., Serrano, M., de Carvalho, M.R., Buck, G.A., Dujardin, J.C., Tibayrenc, M., 2003. Evidence for genetic exchange and hybridization in Trypanosoma cruzi based on nucleotide sequences and molecular karyotype. Infect. Genet. E 2, 173–183. Campbell, D.A., Ayala, F.J., 2000. Transcription of the kinetoplastid spliced leader RNA gene. Parasitol. Today 16, 78–82. Liao, D., 1999. Concerted evolution: molecular mechanism and biological implications. Am. J. Genet. 64, 24–30. Fernandes, O., Sturm, N.R., Derré, R., Campbell, D.A., 1998. The mini-exon gene: a genetic marker for zymodeme III of Trypanosoma cruzi. Mol. Biochem. Parasitol. 95, 129–133. Gaunt, M.W., Yeo, M., Frame, I.A., Stothard, J.R., Carrasco, H.J., Taylor, M.C., Mena, S.S., Veazey, P., Miles, G.A., Acosta, N., de Arias, A.R., Milles, M.A., 2003. Mechanism of genetic exchange in American Trypanosomes. Nature 421, 936–939. Huelsenbeck, J.P., Ronquist, F., 2001. MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics 17, 754–755. Machado, C.A., Ayala, F.J., 2001. Nucleotide sequences provide evidence of genetic exchange among distantly related lineages of Trypanosoma cruzi. Proc. Natl. Acad. Sci. U.S.A. 98, 7396–7401. Miles, M.A., Souza, A., Povoa, M., Shaw, J.J., Lainson, R., Toyé, P.J., 1978. Isoenzymic heterogeneity of Trypanosoma cruzi in the first
P. Cribb et al. / Infection, Genetics and Evolution 4 (2004) 153–157 autochthonous patients with Chagas’ disease in Amazonian Brazil. Nature 272, 819–821. Nunes, L.R., de Carvalho, M.R., Buck, G., 1997. Trypanosoma cruzi strains partition into two groups based on the structure and function of the spliced leader RNA and rRNA gene promoters. Mol. Biochem. Parasitol. 86, 211–224. Souto, R.P., Fernandes, O., Macedo, A.M., Campbell, D.A., Zingalles, B., 1996. DNA markers define two major phylogenetic lineages of Trypanosoma cruzi. Mol. Biochem. Parasitol. 83, 141–152.
157
Stolf, B.S., Souto, R.P., Pedroso, A., Zingales, B., 2003. Two types of ribosomal RNA genes in hybrid Trypanosoma cruzi strains. Mol. Biochem. Parasitol. 126, 73–80. Sturm, N.R., Vargas, N.S., Westenberger, S.J., Zingales, B., Campbell, D.A., 2003. Evidence for multiple hybrid groups in Trypanosoma cruzi. Int. J. Parasitol. 33, 269–279. Tibayrenc, M., Miles, M.A., 1983. A genetic comparison between Brazilian and Bolivian zymodemes of Trypanosoma cruzi. Trans. R. Soc. Trop. Med. Hyg. 77, 76–83.
Short communication
Spliced leader RNA gene promoter sequence heterogeneity in CL-Brener Trypanosoma cruzi reference strain夽 Pamela Cribb a , Elizabeth Tapia b , Patricio Diosque c,1 , Esteban Serra a,∗ a
IBR, Facultad de Ciencias Bioqu´ımicas y Farmacéuticas, UNR, Suipacha 531, CP2000, Rosario, Argentina b Facultad de Ciencias Exactas, Ingenier´ıa y Agrimensura, UNR, Rosario, Argentina c Laboratorio de Patolog´ıa Experimental, Facultad de Ciencias de la Salud, Universidad Nacional de Salta 177, CP4400 Salta, Argentina Received 16 October 2003; received in revised form 23 February 2004; accepted 25 February 2004
Abstract Trypanosoma cruzi is divided into two phylogenetic lineages, T. cruzi I and T. cruzi II, which contain different spliced leader (SL) RNA gene promoter sequences: Class I SL gene promoter sequences are found in T. cruzi II, and Class II sequences in T. cruzi I. We analysed different SL RNA promoter sequences from CL-Brener reference strain, belonging to T. cruzi II lineage, and detected sequences that differed within the −80/+1 highly conserved region. Indeed, many of these divergent SL promoters present features of T. cruzi I promoters. Some of these sequences were grouped into the T. cruzi I sequences clade by Bayesian analysis. The results presented herein show that sequence heterogeneity in SL RNA gene promoter not only exists between T. cruzi strains but also within CL-Brener strain. These CL-Brener “T. cruzi I-like” sequences could be considered a molecular trace of a hybrid origin of the SL RNA gene and a new evidence for the presence of sequences of T. cruzi I origin into a T. cruzi II strain. The possible origins of these sequences are discussed. © 2004 Elsevier B.V. All rights reserved. Keywords: Trypanosoma cruzi; SL RNA; Gene promoter; Hybrid strains; Taxonomy
Trypanosomatid’s spliced leader (SL) gene is encoded in highly repeated genes, transcribed independently from their own promoters (Agabian, 1990). SL RNA gene sequences are highly divergent from one genus of the trypanosomatidae family to other and their functionality is genus specific too (reviewed by Campbell and Ayala, 2000). Nunes et al. (1997) described two groups of SL RNA gene promoter sequences in Trypanosoma cruzi. All Class I SL gene promoter sequences described until now, included that from CL-Brener strain, are identical in the region −80/+1. By contrast, Class II promoter sequences exhibit variation in this region. Transient transfection assays performed by the same authors using the SL RNA gene promoter from the CL strain, showed that this sequence is optimally expressed
夽 Nucleotide sequence data reported in this paper are available in the GenBankTM , EMBL and DDBJ databases under the accession number AF506368. ∗ Corresponding author. Tel.: +54-341-4350661; fax: +54-341-4390465. E-mail addresses: [email protected] (P. Diosque), [email protected], [email protected] (E. Serra). 1 Co-corresponding author.
1567-1348/$ – see front matter © 2004 Elsevier B.V. All rights reserved. doi:10.1016/j.meegid.2004.02.002
only in strains of the same group, suggesting that promoter functionality is group specific. Natural populations of T. cruzi consist of multiple clones distributed into two phylogenetic lineages, T. cruzi I and T. cruzi II (Souto et al., 1996; Anonymous, 1999; Briones et al., 1999). Five lower phylogenetic subdivisions have been identified within T. cruzi II lineage, designated T. cruzi IIa–e, whereas no clear subdivision has been found within T. cruzi I lineage (Anonymous, 1999; Barnabé et al., 2000; Brisse et al., 2001). In this phylogenetic context, Class I SL gene promoter sequences are found in T. cruzi II, and Class II sequences in T. cruzi I (Nunes et al., 1997). The phylogenetic relationships among different sub-lineages in T. cruzi are still unclear. In fact, evidence in favour of a hybrid origin for sub-lineages IId and IIe, from one or more hybridisation events between strains from clades IIb and IIc, has been found (Tibayrenc and Miles, 1983; Brisse et al., 2000, 2003; Barnabé et al., 2000; Machado and Ayala, 2001), and particularly for CL-Brener strain (Brisse et al., 1998). Recently, DNA exchange between two different—but closely related—T. cruzi I clones has been demonstrated for the first time, in an experimental model co-infecting mammalian cells (Gaunt et al., 2003). Indeed, recent data suggest the
154
P. Cribb et al. / Infection, Genetics and Evolution 4 (2004) 153–157
possibility of hybridisation events between T. cruzi I and T. cruzi II at evolutionary scale: (i) analysis of 1F8 gene polymorphism in different strains has revealed evidence of possible hybridisation between T. cruzi I and T. cruzi II in CL-Brener (Sturm et al., 2003); (ii) for one isolate, gene mosaics between T. cruzi IIb and T. cruzi I were reported by Gaunt et al. (2003); and (iii) presence and chromosomal location of rRNA gene variants (corresponding to those found in T. cruzi I and T. cruzi II) in putative hybrid strains, suggest genetic exchange between these two major lineages (Souto et al., 1996; Stolf et al., 2003). We cloned and sequenced several different SL RNA promoters from CL-Brener T. cruzi reference strain (belonging to IIe lineage). We designed SL-1 (5 -TTTTGTACACAAGGCC-3 ) and SL-2 (5 -AAAGGGGTCCGTGGACCC-3 ) oligonucleotides based on the already reported SL RNA gene sequences. When these primers were used for PCR on CL-Brener strain genomic DNA, a band of the expected size 241 bp was obtained and cloned into pGEM-T plasmid. Surprisingly, one of the sequences obtained differed in seven nucleotides in the −80 bp region from that already reported for CL-Brener strain. Sequence comparison determined that the nucleotides observed in six of the seven sites correspond to those found in T. cruzi I promoters (Fig. 1). To further analyse the SL RNA gene heterogeneity in CL-Brener strain, we recovered 973,418 single pass sequences from the TIGR T. cruzi genome project. This database was formatted and screened by Blast using −80 CL-Brener SL promoter region sequence present in the database (U39748) as query. From 1700 hits obtained, 958 showed 100% identity all along the query sequence. The remaining hits were analysed by visual inspection. A significant number of these hits correspond to sequences -80
truncated that fully match with a region of the query. Nearly 250 hits correspond to non-truncated sequences with one to six punctual mutations compared to the query sequence. Many of these sequences showed increased A-content at the Proximal Sequence Element and increased G-content in the −10/−30 region, typical features of T. cruzi I promoters. The remaining hits corresponded to sequences with low identity to CL-Brener SL promoter, many of them not related to the SL gene cluster. Analysis of the sequences with features of T. cruzi I promoter led to the detection of divergent SL promoters, most of them showing T. cruzi I/T. cruzi II hybrid characteristics. One of these sequences (CLATN68TF) was identical to that previously cloned and sequenced in our laboratory. Fig. 1 shows an alignment of ten selected sequences showing similarities to T. cruzi I SL promoters. The −80/+1 region from these selected CL-Brener promoters, together to those from T. cruzi II and T. cruzi I found in databases were aligned, and the relationship between them was inferred by Bayesian analysis using MrBayes program (Huelsenbeck and Ronquist, 2001). To do so, Markov Chain Monte Carlo simulation was performed during 1 × 106 generations, taking one state each 100 generations. The first 300 states were burned and the remaining 9.7 × 105 were recovered and taken as stable likelihood ones. These states were used for determining phylogenetic relationships and partition probabilities. After calculations, the program classified the data into two clades with a 100% of posterior probability (Fig. 2). One of these clades contains all T. cruzi II sequences and eight of the new sequences detected in this study. The second clade contains all T. cruzi I sequences, two of the new CL-Brener sequences and M5631–M6241 strains. Clones TCGST43TF and TCGSK65TF were very similar between them and
PSE
+1
U39748
GGGTTTTTGTACACGGTCCCAAGTGCCGCGAAGGA-CCCCTCATCAAAATTGAAAACCGTTGTGGAACACAACTCCTTTC AAC
TCGON58TF
.......C........................AA.-..................GG.................C......
TCGDN82TR
................................AA.-...................G.................CAT...T
TCHPL07TR
..AC..........A.................AA.-...................G.....A..................
TCPA031TF
...G.....G...............G.........-A...............G............C......G.......
AF506368
.............................A..AA.-..................GG.........G..G...........
CLATN68TF
.............................A..AA.-..................GG.........G..G...........
TCGEK39TR
...G............................AA.-...................G.........G..G...-..T...T
TCGNR73TR
...G............................AA.-...................G.........G..G...TCTT...G
TCGSK65TF
..AA............G...G-..AT...A..AA.A............T......G.-.G.CC..GC.CGG.ACTT....
TCGST43TF
..AA............G...G-.CAT...A..AA.A............T......G.-.G.CC..GC.CGG.ACTT....
T.cruzi I SL Promoters G2
..AG............C...-G..AT...AA..AA.............T......G.G..CCG..CC.GG....-T....
Colombiana
..AG............G...-T..AT...AA..AA.A........T..C.C......G..GTG..G..G....-.T....
Fig. 1. Alignment of CL-Brener SL gene promoters. U39748 is CL-Brener sequence previously described by Nunes et al. (1997). AF506368 corresponds to the sequence amplified in our laboratory. TCGON58TF, TCGDN82TR, TCHPL07TR, TCPA031TF, CLATN68TF, TCGEK39TR, TCGNR73TR, TCGSK65TF, TCGST43TF are a subset of T. cruzi I-like sequences recovered from TIGR T. cruzi genome project. Dots (· · · ) indicate identity with U39748 CL-Brener sequence. The boxed area corresponds to the Proximal Sequence Element (PSE). SL gene promoter sequences from T. cruzi I strains Colombiana (U39758) and G2 (U39756), are also shown.
P. Cribb et al. / Infection, Genetics and Evolution 4 (2004) 153–157
155
MT4183 MT4167
92
MT4181 Basileu CanIII Tulahuen 1 150zd 222ZC 229za Esmeraldo Y NR_c13 CL-Brener (U39748)
100 97
T. cruzi II
32
TCTPA037TF AF506368
36
CLATN68TF 95
TCHPL07TR TCGON58TF 48
TCGDN82TR
69
TCGEK39TR
97
TCGNR73TR M6241
100
M5631 TCGST43TF
47
TCGSK65TF
73 100
X10 37
68 100 90
T. cruzi I
Colombiana Peru
87 100
OPS_0021
Cuica Dm28c
G2
Fig. 2. Phylogenetic tree obtained by comparison of SL gene promoter. Tree was constructed by Bayesian inference as described in the text. The numbers on the branches indicate the bipartition probabilities calculated by the 50% majority rule. CL-Brener sequences used in the analysis, are the same subset of T. cruzi I-like sequences recovered from TIGR T. cruzi genome project shown in Fig. 1 and are underlined. Other sequences used are (strain names are indicated in brackets): AF050522 (M6241), AF050521 (M5631), AF051309 (MT4183), AF05523 (MT4167), AF051308 (MT4181), U57984 (CL), U57985 (NR), U39749 (150zd), U39750 (Basileu), U39760 (Y), U39751 (222zc), U39758 (229za), U39753 (CanIII), U39754 (Esmeraldo), U39755 (X10), U39756 (G2), U57987 (Dm28c), U39758 (Colombiana), U39759 (Peru), K02632 (Tulahuen 2), U90129 (Tulahuen 1), U90130 (OPS) and U90131 (Cuica).
clearly related to SL promoter from T. cruzi I X10 isolate. MT4183, MT4181 and MT4167 strains (“MT-strains”) clustered in a separated sub-group within T. cruzi II lineage (Fig. 2). Fernandes et al. (1998) characterised these strains by sequencing of the non-transcribed spacer of the mini-exon array and hybridisation patterns with specific probes. These authors suggest that the “MT-strains” and strains belonging to IIa (CAN III, reference strain for zymodeme III; Miles et al., 1978) and IIc (M5631 and M6241 strains) lineages, are more related to T. cruzi I than to T. cruzi II. All these isolates constitute a controversial pool of strains, included within T. cruzi II by some authors (Barnabé et al., 2000; Brisse et al., 2000, 2001), and considered more related to T. cruzi I by others (Miles et al., 1978; Fernandes et al., 1998; Machado and Ayala, 2001). In our analysis, the “MT-strains” and CAN III clustered with the
T. cruzi II strains, while M6241–M5631 were included in a discrete clade as a sister group of T. cruzi I. These results point out again the controversial status of these strains and the need for gene genealogies of an adequate number of individual genes in order to determine their phylogenetic relationships. Finally, phylogenetic relationships between sequences grouped into each clade were defined with less statistic consistence, probably due to the short size of the sequences. Nevertheless, defining these relationships is out of the goals of this report. The results presented herein show for the first time that sequence heterogeneity in SL RNA gene promoter not only exists among T. cruzi strains but also within CL-Brener strain. The data used in this study correspond to unassembled single pass genomic sequences. Because of that, it is difficult to determine the proportion of atypical SL gene
156
P. Cribb et al. / Infection, Genetics and Evolution 4 (2004) 153–157
promoters, however, the analysis of the results obtained by Blast suggests that it could represent nearly 5% of the SL genes. Moreover, not all these atypical genes are necessarily located at functional SL gene clusters. The fact that some of these sequences showed also mutations at the Spliced Leader region suggests that they could be non functional gene copies. The heterogeneity observed for the SL gene promoter can be interpreted given the possibility of hybridisation events. These hybridisation events could have taken place among T. cruzi I and T. cruzi II strains at the origin of the CL-Brener strain. Nevertheless, an alternative hypothesis, compatible with the hybrid origin of CL-Brener from hybridisation between IIb and IIc strains (Tibayrenc and Miles, 1983; Brisse et al., 1998, 2000, 2003; Barnabé et al., 2000; Machado and Ayala, 2001), could be that the parental IIc and/or IIb lines of CL-Brener were themselves T. cruzi I–T. cruzi II hybrids. Even though a large number of CL-Brener sequences analysed in our laboratory diverged from canonical T. cruzi II SL promoter without exactly matching T. cruzi I sequences, there are suggestive similarities with T. cruzi I SL promoters in these sequences. These “T. cruzi I-like” sequences could be considered a molecular trace of a hybrid origin of the SL RNA gene and a new evidence for the presence of sequences of T. cruzi I origin into a T. cruzi II (IIe) strain. T. cruzi is considered a diploid organism. However, some strains including CL-Brener, have shown to diverge from uniform diploidy, presenting triploid sections in their genomes (Gaunt et al., 2003). This means that T. cruzi harbours at least two copies of the SL gene cluster. Accepting the hybridisation hypothesis, each cluster could derive from each one of the organisms that generated the hybrid. However, highly repetitive sequences, such as SL sequences, constitute regions prone to both inter- and intrachromosomal recombination events. Moreover, the homogeneity observed in most of these sequences in different strains suggests also some mechanism of concerted evolution (Liao, 1999). These mechanisms—and a strong selection pressure due to functional constrains in favour of T. cruzi II sequences—could be responsible for the replacement of T. cruzi I-like by T. cruzi II promoter genes, what would explain the fact that most of the SL genes in CL-Brener harbour T. cruzi II promoters. As we mentioned above, some results suggest a lineage-specific functionality of the SL RNA gene promoter (Nunes et al., 1997). During CL-Brener strain evolution, the prevalence of transcription mechanisms selective for T. cruzi II promoters could have acted as a selection force for these promoters against T. cruzi I sequences, explaining the fact that most of the SL genes harbour T. cruzi II promoters. Recent data suggest that genetic exchange could have played an important role in the evolution of at least some T. cruzi lineages (Tibayrenc and Miles, 1983; Brisse et al., 2000, 2003; Machado and Ayala, 2001; Stolf et al., 2003). In view of this information and our findings, we hypothesise
that hybridisation events could be related to the origin of “T. cruzi I-like” SL promoter sequences found in CL-Brener strain, either by “direct” T. cruzi I–T. cruzi II hybridisation events, or by a previous hybrid origin of the IIb and/or IIc parental lines of CL-Brener.
Acknowledgements This work was supported by Fundación Antorchas, Third Word Academy of Sciences and the National Research Council (CONICET). References Agabian, N., 1990. Trans splicing of nuclear pre-mRNAs. Cell 61, 1157– 1160. Anonymous, 1999. Recommendations from a satellite meeting. Mem. Inst. Oswaldo Cruz 194 (Suppl. 1), 429–432. Barnabé, C., Brisse, S., Tibayrenc, M., 2000. Population structure and genetic typing of Trypanosoma cruzi, the agent of Chagas disease: a multilocus enzyme electrophoresis approach. Parasitology 120, 513– 526. Briones, M.R., Souto, R.P., Stolf, B.S., Zingales, B., 1999. The evolution of two Trypanosoma cruzi subgroups inferred from rRNA genes can be correlated with the interchange of American mammalian faunas in the Cenozoic and has implications to pathogenicity and host specificity. Mol. Biochem. Parasitol. 104, 219–232. Brisse, S., Barnabé, C., Banuls, A.L., Sidibe, I., Noel, S., Tibayrenc, M., 1998. A phylogenetic analysis of the Trypanosoma cruzi genome project CL-Brener reference strain by multilocus enzyme electrophoresis and multiprimer random amplified polymorphic DNA. Mol. Biochem. Parasitol. 92, 253–263. Brisse, S., Barnabé, C., Tibayrenc, M., 2000. Identification of six Trypanosoma cruzi phylogenetic lineages by random amplified polymorphic DNA and multilocus enzyme electrophoresis. Int. J. Parasitol. 30, 35–44. Brisse, S., Verhoef, J., Tibayrenc, M., 2001. Characterization of large and small subunit rRNA and miniexon genes further supports the distinction of six Trypanosoma cruzi lineages. Int. J. Parasitol. 31, 1218–1226. Brisse, S., Henriksson, J., Barnabé, C., Douaery, E.J., Berkvens, D., Serrano, M., de Carvalho, M.R., Buck, G.A., Dujardin, J.C., Tibayrenc, M., 2003. Evidence for genetic exchange and hybridization in Trypanosoma cruzi based on nucleotide sequences and molecular karyotype. Infect. Genet. E 2, 173–183. Campbell, D.A., Ayala, F.J., 2000. Transcription of the kinetoplastid spliced leader RNA gene. Parasitol. Today 16, 78–82. Liao, D., 1999. Concerted evolution: molecular mechanism and biological implications. Am. J. Genet. 64, 24–30. Fernandes, O., Sturm, N.R., Derré, R., Campbell, D.A., 1998. The mini-exon gene: a genetic marker for zymodeme III of Trypanosoma cruzi. Mol. Biochem. Parasitol. 95, 129–133. Gaunt, M.W., Yeo, M., Frame, I.A., Stothard, J.R., Carrasco, H.J., Taylor, M.C., Mena, S.S., Veazey, P., Miles, G.A., Acosta, N., de Arias, A.R., Milles, M.A., 2003. Mechanism of genetic exchange in American Trypanosomes. Nature 421, 936–939. Huelsenbeck, J.P., Ronquist, F., 2001. MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics 17, 754–755. Machado, C.A., Ayala, F.J., 2001. Nucleotide sequences provide evidence of genetic exchange among distantly related lineages of Trypanosoma cruzi. Proc. Natl. Acad. Sci. U.S.A. 98, 7396–7401. Miles, M.A., Souza, A., Povoa, M., Shaw, J.J., Lainson, R., Toyé, P.J., 1978. Isoenzymic heterogeneity of Trypanosoma cruzi in the first
P. Cribb et al. / Infection, Genetics and Evolution 4 (2004) 153–157 autochthonous patients with Chagas’ disease in Amazonian Brazil. Nature 272, 819–821. Nunes, L.R., de Carvalho, M.R., Buck, G., 1997. Trypanosoma cruzi strains partition into two groups based on the structure and function of the spliced leader RNA and rRNA gene promoters. Mol. Biochem. Parasitol. 86, 211–224. Souto, R.P., Fernandes, O., Macedo, A.M., Campbell, D.A., Zingalles, B., 1996. DNA markers define two major phylogenetic lineages of Trypanosoma cruzi. Mol. Biochem. Parasitol. 83, 141–152.
157
Stolf, B.S., Souto, R.P., Pedroso, A., Zingales, B., 2003. Two types of ribosomal RNA genes in hybrid Trypanosoma cruzi strains. Mol. Biochem. Parasitol. 126, 73–80. Sturm, N.R., Vargas, N.S., Westenberger, S.J., Zingales, B., Campbell, D.A., 2003. Evidence for multiple hybrid groups in Trypanosoma cruzi. Int. J. Parasitol. 33, 269–279. Tibayrenc, M., Miles, M.A., 1983. A genetic comparison between Brazilian and Bolivian zymodemes of Trypanosoma cruzi. Trans. R. Soc. Trop. Med. Hyg. 77, 76–83.