The DNA binding subunit of NF-κB is identical to factor KBF1 and homologous to the rel oncogene product

Cell, Vol. 62, 1007-1018,

September

7, 1990, Copyright

0 1990 by Cell Press

The DNA Binding Subunit of NFKB Is Identical to Factor KBFI and Homologous to the rel Oncogene Product Mark Kieran:t Volker Blank,’ Ftiderique Logeat, JoGI Vendekemkhove,* Friedrich Lottspeich,B Odlle Le Bail: Manuela B. Urban,11 Philippe Kourllsky: Patrick A. Baeuerle,II and Alain Isra81’ * Unite de Biologie Moleculaire du Gene U.277 INSERM, U.A.C. 115 CNRS lnstitut Pasteur 25, rue du Dr. Roux 75724 Paris Cedex 15 France *Laboratorium voor Genetica Rijksuniversiteit Gent K.L. Ledeganckstraat 35 B-9000 Gent Belgium §Genzentrum Max Planck lnstitut fur Biochemie D-8033 Martinsried bei Miinchen Federal Republic of Germany IIGenzentrum Laboratorium fur Molekulare Biologie der Ludwig Maximilians Universitat Munchen Am Klopferspitz D-8033 Martinsried bei Miinchen Federal Republic of Germany Summary The major determinant in the transcriptional control of class I genes of the major histocompatibility complex is an enhancer sequence located around -170 from the transcription start sfte, which binds a factor named KBFl. We have isolated a complementary cDNA coding for KBFl and identified the DNA binding and dimerixation domain of the protein. Because KBFl and the transcription factor NF-KB bind to similar sequences, we investigated the relationshlp between these two molecules. It appeared that KBFl Is, by all criteria used, identical to the 50 kd DNA binding subunit of NFKB. KBFl (and therefore pS0) also displays extensive amino acid sequence homology wlth the v-ml oncogene and the Dmsophlla maternal morphogen dorsal. In vitro experiments suggest functional homologies between KBFl and v-rel.

Class I antigens of the major histocompatibility complex (MHC) serve as recognition elements for cytotoxic T cells during the detection of foreign molecules on the surface of infected cells. Their expression is developmentally regulated (Morello et al., 1985). In the adult, it varies in different cells or tissues and can be modulated by various ex7 Present address: Montreal Children’s Hospital, 2300 Tuppsr Avenue, Montreal, Quebec,Canada.

ternal stimuli: viral infection, or stimulation in response to cytokines such as interferons (IFNs) and tumor necrosis factor (TNFa) (reviewed in Singer and Maguire, 1989; DavfdWatine et al., 1990). In the mouse, the promoters of the Kb and Ld class I MHC genes have served as models for transcription studies. Various &-acting elements and interacting DNA binding proteins have been characterized in detail (Kimura et al., 1988; Baldwin and Sharp, 1987, 1988; Israel et al., 1987; Korber et al., 1988; Shirayoshi et al., 1987; Burke et al., 1989; Israel et al., 1989a). A critical element is made up of an enhancer sequence (enhancer A; Kimura et al., 1986) which can potentiate the effect of an overlapping interferon response sequence. Enhancer A contains a 13 bp perfect palindrome that is recognized by the DNA binding factor KBFl (Kimura et al., 1986; Baldwin and Sharp, 1988). The protein interacts also with a related motif upstream of the mouse 6P-microglobulin gene. KBFl activity can be detected in lymphoid and nonlymphoid cells but not in embryonal carcinoma (EC) cells, where class I genes are not expressed (Israel et al., 1987, 1989a; Yano et al., 1987). In vivo competition experiments suggest that KBFl acts as a positive regulatory factor (Baldwin and Sharp, 1987; Israel et al., 1987), and several reports have established a correlation between class I expression and the presence of KBFl binding activity (Burke et al., 1989; Israel et al., 1989a; Lenardo et al., 1989; Zachow and Orr, 1989). The factor has been purified to homogeneity as a 48 kd protein (Yano et al., 1987). KBFl is apparently related to the factor H2TF1, which also shows affinity to the H-2@ enhancer and the 72 repeat enhancer of SV4O (Baldwin and Sharp, 1987; Israel et al., 1989b; Lenardo et al., 1989). The pleiotropic nuclear factor NF-KB, which was first described as a protein binding to the immunoglobulin K enhancer (Sen and Baltimore, 1986) also binds to the H-2@ palindrome (Baldwin and Sharp, 1988). This factor is present in an active form in the nucleus of a restricted set of cell types (mature B cells, differentiated monocytes, and some T cell lines). In most other cell types, it is present in an inactive form in the cytoplasm. Following activation by various stimuli (cytokines, phorbol ester, the tax protein of HTLV-I, double-stranded RNA), NF-KB is translocated into the nucleus (for review see Lenardo and Baltimore, 1989). In its inactive cytoplasmic form, NFKB is complexed with an inhibitory protein, IKB, which prevents its translocation into the nucleus and interferes with its binding to DNA in vitro (Baeuerle and Baltimore, 1988a, 1988b). Some of the various stimuli that can activate NF-KB appear to trigger the phosphorylation of IKB, which is then released from the NF-KB-IKB complex (Ghosh and Baltimore, 1990). Active NF-KB has recently been shown to be constituted of two molecules of a DNA binding 50 kd subunit (~50) associated with two molecules of a non-DNA-binding 65 kd subunit (~85) which is indispensable for the inactivation of NF-KB by IKB (Baeuerle and Baltimore, 1989). Experiments carried out by several groups have demonstrated

Cdl 1008

functional differences between NF-KB and KBFlIH2TFl (Baldwin and Sharp, 1987,1988; Mauxion and Sen, 1989; Isra&l et al., 1989b; Macchi et al., 1989). To further analyze KBFl and its relationship with other molecules such as NFKB, we isolated KBFl cDNA clones. We found that KBFl cDNA encodes a 105 kd protein, which includes KBFl in its N-terminal portion. We demonstrated that KBFl is, by all criteria used, identical to the p50 subunit of NF-KB. Furthermore, we observed that 386 amino acids of the N-terminal part of KBFl display strong homology with proteins encoded by the tel oncogene and the Drosophila maternal effect gene dorsal. We found that this homology region includes a DNA binding and dimerization domain, and that v-rel is a sequence-specific DNA binding protein that can form heterodimers with KBFl in vitro. Furthermore, the C-terminal part of the 105 kd protein contains six repeats of 33 amino acids similar to those found in the human erythrocyte protein ankyrin. Results Isolation of cDNA Clones Encoding KBFl KBFl was purified from HeLa cells as described for mouse cells (Yano et al., 1987). Band shift assays using various labeled oligonucleotide binding sites and SDS-PAGE analysis did not reveal any differences in the binding specificity and size of purified KBFl from either human or mouse. Cryptic peptides of KBFl were separated by high pressure liquid chromatography (HPLC) and sequenced (Figure 1A). The sequence of peptide 1 was used to design two degenerate oligonucleotides that allowed the amplification by the polymerase chain reaction (PCR) of a 66 bp DNA fragment. An oligonucleotide corresponding to the internal sequence was then used to screen a I.gtlO library derived from the human T47D carcinoma (kindly provided by H. Loosfelt). Several overlapping clones were isolated that, by sequence analysis, were shown to contain the coding information for the three peptides. The combined sequence from the overlapping clones is shown in Figure 1B. Three in-frame ATG codons are present at the beginning of the open reading frame, preceded by an in-frame nonsense codon. The 5’ noncoding region is extremely GC-rich, a characteristic feature of several proto-oncogenes (Kozak, 1988). The most 5’ of the 3 ATGs shows a surrounding sequence AGAATGG that fits well with the consensus established by Kozak (1984) giving rise to an open reading frame of 2997 bp (969 amino acids). In addition, there is an in-frame termination codon 57 bases upstream of this ATG. Translation of this 969 amino acid reading frame should yield a 105 kd protein, suggesting that the 48 kd KBFl protein represents a truncated form of a larger precursor, resulting either from proteolysis during purification or from controlled processing. Northern analysis using human RNA from various origins detected a single 4.4 kb transcript, which was also detectable in mouse RNA (data not shown). To establish the authenticity of the isolated cDNA sequence, we tested the in vitro translation products of KBFl cDNA in a band shift assay (Figure 2). The complete open reading frame was cloned into a pBluescript vector (Strata-

gene); RNA was transcribed with T7 RNA polymerase and translated in a rabbit reticulocyte lysate or wheat germ extract. A protein with an apparent molecular weight of about 105,000 was obtained with both extracts, together with several lower molecular weight bands, probably as a result of initiation at internal methionines or premature termination (not shown). Because the 105 kd protein does not bind DNA (see below), we compared an in vitro translation product corresponding to amino acids 1 to 399 with purified 48 kd HeLa KBFl protein. Several sequences displaying distinct apparent affinities for KBFl were tested in a competition assay, using as a probe the palindromic sequence derived from the enhancer. A specific retarded band was observed with both proteins, and their respective affinities for various sequences were similar (Figure 2A): a strong competition was observed with the Kb- and µglobulin-derived sequences (lanes 2, 3, 2’, and 3’) (Israel et al., 1987) whereas NF-KB binding sequence from the immunoglobulin K enhancer competed less efficiently (lanes 4 and 4’). A Kb sequence with a CC+GG double transversion did not compete (Figure 2A, lanes 5 and 5’) in accordance with previously described results (Israel et al., 1987). These results confirm the identity between the DNA binding domains of purified KBFl and the in vitro translated product of the cloned cDNA. Localization of the DNA Binding Domain of KBFl To localize the DNA binding domain of KBFl, we performed 3’ as well as internal deletions of the full-length cDNA, followed by in vitro transcription-translation and band shift assay. Because the rabbit reticulocyte lysate yields a high background of an endogenous NF-KB-like activity, we used wheat germ extract. Figures 28 and 2C show that DNA binding activity was retained by truncated proteins translated from cDNA cut by various enzymes: Bgll (resulting in a protein of 670 amino acids; Figure 2B, lane 11, and see below); Tthllll (544 amino acids; lanes 6 and 10); Xbal (502 amino acids; lanes 4, 5, and 9) and Rsal (399 amino acids; lanes 1 and 2). Unexpectedly, the slowest-migrating band we could obtain in the band shift assay was with the Tthllll truncation (544 amino acids). The Bgll construct, which encodes a 670 amino acid protein (as confirmed by SDS-PAGE of in vitro translated proteins; data not shown), gave rise, when assayed by retardation, to a band migrating like that due to the Xbal construct (502 amino acids; Figure 28, lanes 9-11). This band was shown by UV cross-linking experiments to be due to a protein with a size similar to the Xbal construct, probably as a result of premature termination (not shown). Translation of the full-length cDNA was less efficient, and a protein-DNA complex could not be detected. We observed that any protein made of 670 amino acids from the N-terminusor more did not bind DNA in a band shift assay (not shown), but we have not precisely mapped the region where DNA binding can no longer be detected. Further 3’ deletions (Spel[341 amino acids; lanes 7 and 81, Pstl [201 amino acids; not shown]) abolished binding activity. We then introduced internal deletions in the Xbal construct (ASP, removing amino acids 10 to 201; ASS, removing amino acids 10 to 341; ABB, removing amino acids 132 to

Molecular Cloning of DNA Binding Subunit of NF-KS 1009

119 22 239 62 359 102 4J9 142 599 182 719 222 839 262 959 302 1019 342 1199 382 1319 422 1439 462 1559 502 1679 542 1799 582 1919 622 2039 662 2159 702 2219 742 2399 782 2519 822 2639 862 2759 942 2819 912 2999 969 3119

3189

Figure 1. Amino Acid Sequence of Cryptic Peptides of KBFl, and Nucleotide and Deduced Amino Acid Sequence of the Full-Length KEFl cDNA (A) Sequence of the three peptides obtained after tryptic digestion. The degenerate oligonucleotides used for PCR are shown. The sequence of the amplified fragment used as a probe to screen the library is underlined. I, deoxyinosine. (B) Nucleotide sequence of the full-length KSFl cDNA and deduced amino acid sequence. The three in-frame ATGs are underlined, as well as the three peptides described in (A). The stop codon is indicated by an asterisk. Both strands were sequenced by the dideoxy method.

Cdl 1010

B

9”ll

12345676

C homology 'AT6

969 4 670

502

801 I Tth

111

Xba

I

Rsa

Pst

201

3Ll 132

10 19

502

201

66

206

I

spr I

341

-10

I

NCO I

435

-10

bindlng activity

construct nam.

502

I

A

SP

A

SS

502

A

EB

502

A

SN

502

Gax

BX

Figure 2. Binding Properties of Purified and Cloned KBFl and Deletion Mapping of the DNA Binding Domain (A) Binding properties of KBFI. Sand shift assay using purified HeLa cell KBFl (lanes l-5) or the in vitro (rabbit reticulocyte lysate) translation product corresponding to amino acids 1-399 of the cloned KBFl cDNA (lanes l’-5’). Conditions of the assay are as in Isra6l et al. (1969b). The binding site is an end-labeled double-stranded oligonucleotide corresponding to the palindrome in the H-2@ enhancer (TGGGGATTCCCCAT) (Yano et al., 1967). Lanes 1 and l’, without competitor, The upper band in lane 1’is due to endogenous activity of the rabbit reticulocyte lysate. Lanes 2 and 2’, with an E-fold molar excess of the homologous unlabeled double-stranded oligonucleotide. Lanes 3 and 3’, with an E-fold molar excess of a bsmicroglobulin-derived oligonucleotide (AAGGGACTTTCCCAT). Lanes 4 and 4’, with an 8fold molar excess of an immunoglobulin K-derived NF-KS binding site (GAGGGGACTTTCCG). Lanes 5 and 5’, with an E-fold molar excess of a mutated H-2@ binding site (TGGGGATTCCGGAT). This double-stranded oligonucleotide binds very little, if any, KBFl (lsra6l et al., 1967). (B) Deletion mapping of KBFl DNA binding domain, Deletion derivatives were produced by in vitro transcription-translation of a template containing the full-length cDNA truncated at various restriction sites (see [Cl). Band shift assay was carried out as usual, using the palindromic KBFt binding site and 1-2 ul of in vitro translated product. Lane 1, Rsal truncation translated in wheat germ extract. Lane 2, same in rabbit reticulocyte lysate. Lane 3, wheat germ extract with no RNA added. Lane 4, Xbal truncation in rabbit reticulocyte @ate. Lane 5, same in wheat germ extract. Lane 6, Tthllll truncation in wheat germ extract. Lane 7, Spel truncation in wheat germ extract, Lane 6, same in rabbit reticufocyte lysate. Lane 9, Xbat truncation in reticulocyte lysate. Lane 10, Tthllll truncation in reticulocyte lysate. Lane 11, Bgll truncation in reticulocyte &sate. The endogenous activity of the rabbit reticulocyte lysate is indicated by a dot. (C) Summary of deletion mapping. The full-length cDNA is indicated at the top. The various deletion derivatives are represented with amino acid coordinates. Binding activity is indicated at right. The three ATGs are indicated by arrows, and the region of homology with m/and dorsal is shown by a horizontal bar.

206; ASN, removing amino acids 10 to 66) which ail destroyed binding activity. A BamHi-Xbal fragment (amino acids 19 to 502) cloned in a bacterial expression vector (see below) can also bind DNA. in summary, the DNA binding domain lies within amino acids 19 to 399, and the C-terminal portion of the precursor protein directly or indirectly prevents binding of the N-terminal portion.

Dimerization of KBFl The palindromic nature of the KBFl binding site as well as other indirect evidence (Israel et al., 1989a) suggested that KBFl binds to DNA as a dimer. We tested this hypothesis by generating a mixture of Rsai-truncated (399 amino acids) and Tthllli-truncated (544 amino acids) proteins. The two proteins were either cotransiated or mixed after

Molecular Cloning of DNA Binding Subunit of NF-KS 1011

B 12345 ‘. cLC&

123456

Figure 3. KBFl Binds to its Site As a Dimer (A) Band shift assay. Wheat germ extracts were programmed with various truncation products of KBFl, and a band shift assay was performed using 1 $ of the translated products and the labeled palindromic KBFl binding site. Lane 1. Rsal truncation (amino acids 1 to 3sS). Lane 2, Tthll II truncation (amino acids 1 to 544). Lane 3, cotranslation of Rsal and Rhllll. Lane 4, competition with an &fold excess of unlabeled homologous oligonucleotide. Lane 5, Rsal and Tthllll products were mixed after translation. Bands l-4 are described in the text. (B) UV cross-linking experiments. An assay similar to the one shown in (A) was carried out with a BlJdR-substituted probe derivedfrom the &-microglobulin enhancer: AATGGGAAAGTCCCTTTGTAA UUACCCUUUCAGGGAAACATT Following electrophoresis, the wet gel was irradiated for 15 min at 4OC on a 312 nm UV light lamp, and autoradlographed. The retarded bands were excised, incubated for 10 min at 65% in SDS+mercaptoethanoI protein sample buffer, and loaded directly in the slots of a 12% SDSpolyacrylamide gel that was then fixed, dried, and autoradiographed. Lane 1, band 1 of (A) (Rsal construct). Lane 2, band 2 (Tthllll construct). Lane 3, band 3. Lane 4, band 4. Lane 5. band 1 in Figure 66 (v-m/ construct). Lane 6, band 2 in Figure 68 (heterodimer of v-ml and the Tthllll construct). The upper band in lane 5 probably represents a homodimer of v-re/.

translation, and then analyzed by band shift assay. Figure 3A shows that upon cotranslation, a new band was generated (lane 3). The lower band (band 3) comigrated with the Rsal band (band 1). The new band (band 4) had an mobility intermediated between that of the Rsal and Tthllll bands, suggesting that a heterodimer was formed. To confirm this, we performed UV cross-linking experiments (Figure 3B), which showed that both Rsal and Tthllll proteins were contained in the intermediate band (lane 4). Mixing of the two proteins after translation did not give rise to the intermediate band (Figure 3A, lane 5), suggesting that rather stable homodimers were formed during translation. Thus, it is very likely that KBFI binds to its site as a dimer. Both DNA binding and dimerization domains are contained within amino acids 19 to 399. KBFI and the ~50 Subunlt of NFKB Am Identical The similarities between KBFI and NFKB binding sites and the observation that an antiserum directed against KBFl was able to react with NFKB (data not shown)

prompted us to carefully monitor the biochemical properties of the two proteins. Functional differences between KBFI and NF-KB (Baeuerle and Baltimore, 1989) have been documented (Baldwin and Sharp, 1988; Macchi et al., 1989; Israel et al., 1989b; Mauxion and Sen, 1989). In particular, KBFl binds with lower affinity to the immunoglobulin K enhancer site than to the class I site, while NF KB binds to both sites with similar affinities. Contact points on the MHC class I site are also slightly different (see Figures 4C and 6C), as are mobilities in a band shift assay. However, the NF-KB complex has recently been demonstrated to be a heterotetramer of two 50 kd and two 65 kd subunits (Baeuerle and Baltimore, 1989), the DNA binding activity being carried by the 50 kd subunit (p50), the size of which is close to that estimated for KBFl (48 kd). We therefore undertook a detailed comparison of KBFI and the purified ~50 subunit of NF-KB, using proteins (including ~65) that had been eluted from SDS gels and renatured. Figure 4C shows a dimethyl sulfate interference experiment indicating that ~50 and KBFI make similar contacts on the Kb site, different from those of NF-KB. Competition with various oligonucleotides indicated that KBFl and ~50 display the same respective affinities for a series of binding sites (not shown). These results show that the binding characteristics of ~50 and KBFl are indistinguishable and different from those of the NF-KB heterotetramer. This can best be explained by assuming that the 65 kd subunit (~65) modifies the DNA binding specificity of ~50. We then used a series of polyclonal antisera in conjunction with purified KBFl, NFKB, and ~50 in a band shift assay. Rabbits were immunized with purified fusion proteins expressed in Escherichia coli. The fusion proteins included glutathione transferase linked either to amino acids 19-969 (sera 2 and 4) or 19-502 (sera 1,3, and 5) of KBFI. Figure 4A shows that the five antisera interfere with binding of KBFl or ~50, giving rise to identical patterns (disappearance of the retarded band and/or upshifting), while the pattern seen with NF-KB is different. These results are in agreement with the assumption that KBFI and ~50 are highly homologous, if not identical, and that ~65 can either modify the conformation of ~50 or prevent its recognition by the antisera. We next investigated whether KBFI can associate with the ~65 subunit. Purified ~50 and ~65 have been shown to reassociate in vitro (Baeuerle and Baltimore, 1989), especially if they are first denatured followed by corenaturation, giving rise in a band shift assay to the band corresponding to the native heterotetrameric NFKB. Figure 48 (lanes 5 and 6) shows that purified KBFI can associate with ~65, giving rise to a slower-migrating complex, as seen with ~50 derived from heterotetrameric NFKB (lanes 1 and 4). This further confirms the identity of KBFl with the ~50 subunit of NFKB. We also tried to reassociate recombinant KBFI derived from E. coli with p65, but without success; this may be due to the N-terminal glutathione transferase moiety of the recombinant protein. We then purified the wheat germ-derived, in vitro translated Rsaltruncated protein (399 amino acids) on a DNA affinity column, followed by codenaturation and renaturation with

Cell 1012

S.r”Kl

-12345

-12345

_

12345

NF-kB KBFllP5o

7

123456

B

5O65

6565 kB5oFl

Fl

6

9

101112 c ?4

13141516

1716

12345

NF-kB KBFllP5F

123456

Figure 4. Comparison of KBFl and the pS0 Subunit of NFKB (A) Reactivity of KBFl, NFKS, and p50 with various antisera. Antisera obtained from five rabbits (see text) were included in a band shift assay using the MHC class I palindromic binding site and either of the three purified proteins. Lanes 1 to 5, purified NF-KB complex. Lanes 7 to 12, purified ~50. Lanes 13 to 16, purified KBFl. In each series of six lanes, the first lane represents the control (with preimmune serum) while the five following lanes correspond to the five antisera. (5) Reassociation with the p65 subunit of NFKB. Band shift assay was performed with the class I palindromic binding site, using purified ~50, ~65. and KBFI, which were denatured and renatured. Lane 1, ~50. Lane 2, ~65. Lane 3. purified Nf+B. Lane 4, corenatured ~50 and p65. Lane 5, corenatured KBFl and ~65. Lane 6, KBFl. (C) Methylation interference experiment using purified ~50, KBFl, and N&B. As a probe, an oligonucleotide corresponding to the palindromic KBFI binding site followed by the interferon response sequence of the H-2Kb promoter (coordinates -197 to -152 in Israel et al., 1969b) was used. This double-stranded oligonucleotide was labeled by kinasing the noncoding strand before annealing. Lane 1, unretarded band. Lanes 2 and 5, two different preparations of NF-~5. Lane 3, KBFI. Lane 4, ~50.

~65. The band shift assay showed the presence of a slower-migrating complex in addition to the one due to bona fide Rsal product, indicating efficient reassociation (data not shown). Finally, we purified enough p50 to be able to determine the amino acid sequence from a endo-Asp-C proteasecleaved peptide. The sequence obtained was DSKAPNASNLKIVRM. As seen in Figure lB, this sequence corresponds exactly to amino acids 242 to 256 of KBFl. Homologies between KBFl, rel, and dorsal A search in the NBRF data base indicated that the sequence of KBFl from amino acids 43 to 366 is strongly homologous to a sequence found in the turkey oncogene v-r@, as well as in the Drosophila maternal effect gene dor-

sal (Steward, 1989). An alignment with dorsal, V-M and several c-relproto-oncogenes is shown in Figure 5. Within the homology region, 33% of the amino acid residues are identical among KBFl, turkey c-ml, and dorsal; 51% of the KBFl residues are conserved in either rel or dorsal, and if one includes conservative substitutions, this percentage reaches 66%. A region of about 30 amino acids is unique to KBFl. Interestingly, a potential protein kinase A phosphorylation site (RRXS; underlined in Figure 5) located at amino acids 335 to 338 is conserved between the three proteins. Similarly, a potential nuclear localization signal (in boldface) has been postulated in dorsal and demonstrated to be functional in ml (Gilmore and Temin, 1988; Hannink and Temin, 1989). A similar type of sequence is present and functional in the KBFl protein (V. Blank et al., unpublished data). The DNA binding and dimerization domain described above for KBFl overlaps closely the region of homology with ml and dorsal. This region is also well conserved within the c-rel proto-oncogenes from turkey, chicken, mouse, and human, while the remaining parts of these molecules display no visible homology. Various hybrid proteins between v-and c-m/ have been shown to be transcriptional activators, irrespective of their apparent subcellular localization (Gelinas and Temin, 1988; Hannink and Temin, 1989). On the other hand, dorsal regulates gene expression when in the nucleus (Roth et al., 1989; Rushlow et al., 1989), but no common DNA sequence has so far been identified among the several minimal promoters induced by this protein. We thus investigated whether fel and dorsal would bind to a KBFl binding site. Plasmids carrying v-&or dorsalunder the control of the T7 promoter were truncated after the homology region, transcribed, and translated in wheat germ extract. Figure 6A shows that v-rel specifically binds to the H-2Kb palindromic KBFl binding site and shows affinities for the various sites similar to those of KBFl. Truncation experiments indicated that v-rel binds also as a dimer (not shown). Cotranslation experiments (Figure 6B) demonstrate that v-m/ can form heterodimers with KBFl. This was confirmed by UV cross-linking experiments, shown in Figure 38, lanes 2 (Tthllll), 5 (v-rel), and 6 (heterodimer, band 2 in Figure 68) demonstrating the presence of the two proteins in the intermediate band (lane 6). We then carried out methylation interference experiments in order to characterize the contact points of v-ml on the KBFl binding site. The results (Figure 6C) indicate that v-ml contacts the 4 G residues of the site but that the external G is less critical than the other three (lanes 2 and 5). This is reminiscent of the behavior of NF-KB (Figure 6C, lane 4). The heterodimer between KBFl and rel shows a &like pattern of interference, but the second internal G seems to be more important than for v-rel alone (lane 3). Similar results were obtained on the other strand (data not shown). On the other hand, none of a series of constructs derived from dorsal (a kind gift of Dr. C. Niisslein-Volhard) and including the region of homology display binding to any of the KBFl binding sites (not shown).

$;llar

Cloning of DNA Binding Subunit of NF-KB

Figure 5. Comparison of the Sequences of Human KBFl and Related Proteins KBFl is compared with dorsal(Steward, 1969), v-ml (Stephens et al., 1963), turkey c-rel protooncogene (tC-REL) (Wilhelmsen et al., 1964), and mouse (mC-REL) (Grumont and Gerondakis, 1969) and human (hC-REL) (Brownell et al., 1969) proto-oncogenes. Gaps (dots) have been introduced for optimal alignment. Dashes indicate identical amino acids. A nonhomology region, including a 30 amino acid “insertion” in KBFl, is overlined. A potential Ser phosphory lation site is underlined, and a nuclear localization signal (functionally characterized in v-n?/) (Gilmore and Temin, 1966; Hannink and Temin, 1969) is in boldface. Numbers in brackets at the beginning of each sequence indicate amino acid coordinates. Numbers at right indicate KBFl amino acid coordinates.

A

B

Figure 6. Heterodimer Formation between v-r& and KBFl

C

(A) Binding characteristics of v-r-e/. v-rel truncated at amino acid 331 (36 amino acids after the end of the homology with KBFI) was transcribed and translated in vitro and assayed by +snttserum gel retardation using the H-2Kb palindromic KBFI binding site and various unlabeled competitors at an &fold molar excess. Lane 1, no competitor. Lane 2, competition with unlabeled homologous double-stranded oligonucleotide. Lane 3, competition with the a,microglobulinderived KBFl binding site. Lane 4, competition with the immunoglobulin K-derived NF-KB binding site. (B) Band shift assay of heterodimers. Conditions are similar to those in Figure 3A. Lane 1, v-n?/ truncated at amino acid 331. Lane 2, cotranslation of v-n31 with the Xbal construct of KBFl (amino acids 1 to 502). Lane 3, KBFI truncated at Xbal (amino acid 502). Lane 4, cotranslation of v-re/ with the Tthllll construct of KBFl (amino acids 1 to 544). Lane 5, KBFl truncated at Tthllll (amino acid 544). Lanes 1 and 2 were exposed for 5 hr, lanes 3 to 5 for 15 hr, to correct for variations in translation efficiency. (C) Methylation interference experiments. Methods and labeled probe were as in Figure 4C. The bands obtained were similar to those observed in (B) and will be designated with the same number. Lane 1, unretarded band. Lane 2, v-rel (band 1 in [B]). Lane 3, heterodimer between v-rel and KBFl derivative Tthllll (band 2 in panel [B]). Lane 4, NF-KB (purified from human placenta). Lane 5, v-re/ (band 3 in lb]). Lane 6, KBFl derivative Tthl 11 I (544 amino acids; lane 5 in [B]). (D) Heterodimer formation in the absence of DNA. Two microliters of 35S-labeled in vttro translated products of v-re/ (amino acids 1 10 331) and KBFl (amino acids 1 to 544) were immunoprecipitated with 2 ~1 of the anti-KBFl polyclonal antiserum no. 2 (see Figure 4A) in a 50 ~1 volume containing 20 pl of protein A-Sepharose CL-4B (Pharmacia) and analyzed on a 12% SDS-polyacrylamide gel as described in Murre et al. (1989). As a control, I ul of untreated in vitro translation products was run in lanes 1 to 3. Lane 1, v-ml. Lane 2, cotranslation of we/ and KBFl Lane 3. KBFl (intermediate-sized bands are due to initiation at internal methionines; data not shown). Lane 4, immunoprecipitation of v-rel. Lane 5, immunoprecipitation of v-rel-KBFl cotranslation. Lane 6. immunoprecipitation of KBFl. Molecular weight markers (kd) are on the left 123456

Cell 1014

Position 544-674 683-613 616 -640 688-713 780-760 '773-803

“TSG

TKQE

AGAD El HKKA

EGHD cl HDNI

HVDSTT

RGST cl

PLVENF GKPY

WQVF

-G-TPLH’I’AA--GHSA

EPEF

cl

TSDDLL

Figure 7. Alignment of Six Ankyrin-like Repeal Motifs Found in the KBFllp50 Precursor Boxed amino acids show a match with a consensus sequence (bottom) delineated from the 22 repeats found in the ankyrin molecule (Lux et al., 1990). w, hydrophobic amino acids. Coordinates on the left correspond to amino acids 2 and 32 in each repeat, since amino acids 1 and 33 are not conserved.

-~v--LL--GA-----DA

N

KBFl and rel Can Associate In Vitro in the Absence of DNA To demonstrate association between KBFl and rel in the absence of DNA, we used the anti-KBFl polyclonal antiserum no. 2 (see Figure 4A; the results obtained with the other antisera were essentially the same) in an immunoprecipitation assay. In vitro translated KBFl (in this case the 544 amino acid protein; Figure 6D, lane 6) but not the v-rel protein (truncated after the homology region; lane 4) is immunoprecipitated by the antiserum. However, immunoprecipitation of an extract containing cotranslated KBFl and v-ml proteins results in the appearance of a new band that comigrates with v-re/(Figure 6D, lane 5; compare with lane 1). These results indicate that the two proteins can associate in vitro in the absence of a DNA binding site, consistent with the idea that the homology region between v-ml and KBFl contains both a DNA binding and a dimerization domain. Similar experiments using dorsal protein (truncated at various positions) did not reveal any association with KBFl.

amino acid sequence analysis. The predicted size of the protein encoded by this cDNA is about 105 kd. A protein of this size is produced upon in vitro translation of the fulllength cDNA in a rabbit reticulocyte lysate or in a wheat germ extract (not shown), while a protein of about 130 kd is synthesized by bacteria containing a fusion gene encoding glutathione transferase (27 kd) connected to amino acids 19 to 969 of KBFl. Experiments to be published elsewhere demonstrate that the 105 kd precursor can be detected by immunoprecipitation in transfected cell lines and is actually processed to give rise to the 48-50 kd mature protein (V. Blank et al., unpublished data). Deletion analysis of KBFl allowed us to localize the DNA binding domain to amino acids 19 to 399, and to demonstrate that this region is also responsible for dimer formation. We did not detect motifs previously shown to be responsible for DNA binding or dimerization, such as the zinc finger, various types of homeodomains, leucine zipper, or helix-loop-helix domains (Murre et al., 1989; for review see Mitchell and Tjian, 1989).

Homology of the C-Terminal Part of the 105 kd Protein with Ankyrin The precursor molecule of KBFllp50 contains a 33 amino acid repeat structure that was recently found in human erythrocyte ankyrin and several tissue differentiation and cell cycle control proteins (Lux et al., 1990). Among the latter are the notch protein from Drosophila melanogaster and the h-12 and g/p-l gene products from Caenorhabditis elegans, and the proteins encoded by the yeast genes CDClO, SW/S, and SW14. Only the KBFllp50 precursor part but not the DNA binding p50 product contains six of these repeats. They are located between sequence positions 544 and 803 and show a high degree of homology with a consensus sequence delineated from the 89 kd domain of ankyrin (Figure 7).

Identity between KBFl and the ~50 Subunit of NF-KB By all criteria used, KBFl is indistinguishable from the p50 subunit of NF-kB: molecular weight, mobility of the protein-DNA complex in a band shift assay, affinity for various binding sites, contact points with the cognate DNA, association with ~65, reactivity with several antisera, and partial amino acid sequence. Yet, we cannot rule out the possibility that the two proteins display so far undetected posttranslational differences (e.g., phoshorylation). For the sake of simplicity, we designate below as KBFllp50 the two so far undistinguishable molecules. It thus appears that we have cloned the precursor of the DNA binding subunit of NF-KB. In cotransfection experiments using a reporter gene driven by a minimal promoter and a multimerized KBFl binding site together with an expression vector containing full-length or truncated KBFl cDNA, we did not observe detectable trans-activation in mouse L cells or F9 cells, human HeLa cells, or monkey COS cells (data not shown). This raises the possibility that KBFllp50 is devoid of an activation domain. Since purified heterotetrameric NF-KB can activate transcription in vitro (Kawakami et al., 1986) it is possible that the p50 subunit displays only DNA binding activity and that the ~65 subunit is necessary for transcriptional activation. However, our previous results (Israel et al., 1989b) suggest that the presence of KBFl on the Kb promoter correlates with

Discussion Cloning of KBFl Previous work from this and other laboratories (Baldwin and Sharp, 1987; Israel et al. 1987, 1989a, 1989b) has shown that the binding of a factor named KBFl to the palindromic sequence of enhancer A (Kimura et al., 1986) located in the promoter of human and mouse MHC class I genes plays a crucial role in their expression. From HeLa cells we have purified a48 kd protein responsible for KBFl binding activity, and isolated cDNA clones using partial

Molecular 1015

Cloning of DNA Binding Subunit of NF-KB

gene expression (which can be overinduced by NF-KB activated through the TNF pathway). It is possible that cofactors other than ~65 may work in conjunction with KBF11 ~50. IMore work is needed to resolve these issues. Homology of the C-lWmhal Part of the 105 kd Pmcufsor with Ankyrin The exclusive presence of six copies of the ankyrin-like repeat structure in the precursor molecule of KBFl/p50 could indicate that this precursor or the part that is cleaved from KBFl/pBO serves a special function related to those of the ceil cycle and tissue differentiation control proteins. Alternatively, the repeats could be required to control the subcellular distribution of the KBFl/p50 precursor. It has been speculated that the ankyrin repeats form binding sites for cytoskeletal proteins or integral membrane proteins (Lux et al., 1990). An association of the KBFl/p50 precursor with the cytoskeleton or cell membrane would ensure, for instance, that it is not transported into the nucleus despite its presumed nuclear translocation signal. Homologies of KBFl/p50 with rel and dorsal The sequence between amino acids 43 and 366 of KBFl is strongly homologous to the N-terminal region of the oncogene v-m/ (and various related protooncogenes) and the N-terminal region of the Drosophila maternal effect gene dorsal, and the same homology should hold for the ~50 subunit of NF-KB. The C-terminal parts of the the proteins m/, dorsal, and KBFl show no detectable homology, and their functions are so far unknown. A stretch of glytines located in KBFI after the DNA binding domain is suggestive of a linker separating two functional domains of the protein. In particular, the C-terminal parts of v-rel and dorsal have been shown to be important for determining the nuclear or cytoplasmic localization of the protein (Gilmore and Temin, 1966) and various mechanisms have been invoked to explain their interaction with the nuclear localization signal. Experiments are in progress to analyze the subcellular localization of KBFl using the antisera described in Figure 4A. The homologies between KBFl/pSO, re/, and dorsal prompted us to look for a functional homology of the two latter proteins with KBFl: we found that v-rel was indeed able to recognize the Kb KBFl binding site and displayed the same respective DNA binding affinities for various other KBFl binding sites. Furthermore, KBFl and v-rel could form heterodimers in vitro, even in the absence of DNA, and this dimerization required the region of homology between the two proteins. We have thus shown that v-&is a sequence-specific DNA binding protein, although the l-l-2Kb site may not be its physiological target. This result is not totally unexpected, since v-re/ has been shown to be a transcriptional activator (Gelinas and Temin, 1968). However, rrans-activation was observed even when the v-r&protein (or chimeras made with v&and chicken c-rel) was apparently located in the cytoplasm (Hannink and Temin, 1989). Further experiments are necessary to correlate the DNA binding activity with the trans-activation properties of ml. One may wonder whether heterodimers between KBFl and c-rel are formed in vivo and what their

function could be, as well as whether rel plays a role in the expression of MHC genes. The mouse c-rel has also been found to be essentially expressed in mature B and T lymphocytes and much less in immature thymocytes (Brownell et al., 1967) and to be induced by serum and phorbol 1Bmyristate 13-acetate and superinduced by cycloheximide in resting 3T3 fibroblasts (Bull et al., 1989). KBFl transcription is also increased by similar types of stimuli (V Blank, unpublished data). It has been shown that mutations in the N-terminal and central parts of the turkey c-r& proto-oncogene can activate it to a fully transforming gene (Sylla and Temin, 1986). An interesting possibility is that a deregulated or mutated KBFl gene may turn into an oncogene. In the case of dorsal, we have not been able to demonstrate DNA binding nor heterodimer formation with KBFl. We do not know whether the region of dorsal that is homologous to KBFl cannot bind DNA at all, or whether it binds to a site that is different from the various KBFl sites tested so far. Functional Implications Since KBFl/pBO is structurally homologous to rel and dorsal, how related are the mechanisms responsible for subcellular localization of these three proteins? In particular, can re/ interact with IkB? How is the 105 kd precursor processed? What is the function of the C-terminal part that is clipped off the DNA binding domain and is distinct from ~65 as shown by its partial amino acid sequence (P A. Baeuerle, unpublished data)? There is now a large family of factors known to bind to KBFllNF-KB sites: H2TFl (Baldwin and Sharp, 1987, 1988) NF-kB, EBPl (Clark et al., 1988), MBPl (Baldwin et al., 1990) or PRDllBFl (Fan and Maniatis, 1990), KBFl, TC-IIB (Macchi et al., 1989) HIVEN 86 (Franza et al., 1967) and v-rel. H2TFl is a 110 kd protein as measured by UV cross-linking (Baldwin et al., 1990). It is unlikely that H2TFl corresponds to the 105 kd KBFl precursor since the latter does not bind to the Kb motif (see above), but molecular cloning of H2TFl will be necessary to demonstrate this unambiguously. MBPl/PRDIIBFl is a zinc finger protein, while KBFl and v-re/ are not; this indicates that factors with different types of DNA binding domains can bind to the same site, with the same affinities for variants of this site (Baldwin et al., 1990). This raises an important issue concerning the relevance of these various factors to the regulation of genes containing such binding sites: for example, MBPl expression is low in B cell lines (Mitchell and Tjian, 1969) while levels of expression of MHC class 1, KBFl, and NF-kB are high (our unpublished data). Much more work will be needed to assess which factor is physiologically relevant in a given cell under given conditions. Ex~rimenwl Procedures Plasmids v-re/, vcc-rel, and WC-& expression vectors were obtained from Dr.?.. M. Hannink and H. Temin. The cDNAs were excised and subcloned in pBluescript. The dorsal cDNA in pBluescript was obtained from Dr. Niisslein-Volhard.

Cdl 1016

Purlflcstlon of KBFl KBFI was purified as described (Yano et al., 1967) with a few moditications. Commercially prepared HeLa cells (555 g, obtained from Prof. Miller, Mans University, Belgium) were resuspended in I liter of buffer A (Mno et al., 1987). All steps were performed at 4%. Aliquots were placed in a loos<ting Dounce homogenizer and stroked 40 times. The material was centrifuged at 7,000 rpm for 8 min. The pellet was resuspended in 500 ml of buffer A, centrifuged, and resuspended in 500 ml of buffer 6 containing 50 mM NaCI, stroked once with a Dounce to break up the clumps of nuclei, and centrifuged again at 7,ooOrpm for 8 min. The pellet was resuspended in buffer B containing 350 mM NaCl and shaken gently at 4% for I hr. The nuclei were centrifuged at 7,000 rpm for 8 min. then recentrifuged at 12,000 rpm in an SS34 rotor for 30 min at 4%. To the supernatant, 0313 g of ammonium sulfate per ml was added and incubated at 4% overnight with gentle shaking. The centrlfugatlln was repeated at 12,000 rpm for 30 min at 4%. The pellet was then resuspended in 200 ml of buffer C (phosphate buffer, pH 75). The protein was dialyzed three times against buffer C, filtered, and loaded onto a hydmxylapatlte column in aliquots. The eluted fractions were tested in a standard band shift assay and the active fractions selected. The active fractions comprised 160 ml and were dialyzed against buffer D @H 6; 1x binding buffer containing 0.1 M NaCI). One milligram of poly(dl-dC) per 80 mg of protein was added, and the preparation was loaded on an affinity column containing the H-2@derived KBFl binding site. The column was washed with increasing NaCl concentrations, and fractions were tested in a band shift assay. The active fractions were pooled, dialyzed against buffer D, and reloaded onto the affinity column, which was eluted as before. To test the purity of the KBFl preparation, aliquots were loaded on a 12% SDSpolyacrylamide gel. Fractions containing KBFl were pooled, dialyzed three times against 1 liter of 10 mM ammonium acetate (pH 6). 0.02% SDS at 4oC, and then lyophilized. Protein Baquanclug of KBFI The protein purified from 500 g of HeLa cells was subjected to SDS-PAGE and electroblotted onto a polyvinylidene difluoride membrane (Bauw et al., 1989). The KBFl spot (containing approximately 10 pg of protein) was subjected to membrane in situ trypsin degradation (Bauw et al., 1987) and the peptides released from the membrane in the digestion mixture were saparated by reverse-phase HPLC on a C4 column (0.46 x 25 cm; Vydac Separations Group, Hesperia. CA). Peptide separation, detection, and collection were as described (Bauw et al., 1987). The major peptldes ol the chromatogram were selected for automated amino acid sequence analysis using an Applied Biosysterns Inc. 470A sequenator equipped with a 12OAPTH-amino acid analyzer. PCR We synthesized two degenerate sets of oligonucleotides corresponding to the N-and C-termini of peptide 1 (Figure lA), respectively, using an Applied BkJsystems 381A synthesizer. PCR was carried out as described (Lee et al., 1988), using 30 cycles of the following: 2 min at 92oc, 2 min at 3pc, 2 min at 7ooC. The DNA substrate was a QtlO cDNA library constructed with RNA from human T47D carcinoma (kindly provided by H. Loosfelt, Kremlin-BicBtre. France). The 66 bp amplified band was cut out from the agamse gel. cloned in M13mp8, and sequenced, giving rise to an internal 27 bp sequence corresponding to amino acids 7 to 15 of the peptide. Llbmry Scmenlng From the internal sequence of the amplified fragment, a 27-mer was synthesized and used to screen IO* clones fmm the 5gtIO library. Hybridization conditions were 6x SSC at 3pc, and washing was in 3 M tetramethylammonium chloride at 83oc (Wood et al., 1985). Seven independent clones were isolated. The longest one, M4, contained an insert of2870 bp. Sequence analysis showed the presence of a long open reading frame, but the absence ol a stop codon indicated that the C-terminal part ot the protein was missing. We then used a 200 bp fragment derived from the 3’part of XI4 to rescreen the cDNA library. Several additional clones were obtained, and a composite sequence derived from 514 and one of these 3’ ctones is shown. cDNAs were subcloned Into a pBluescript vector, a restriction map was established, and suitable subfragments were subcloned in Ml3 and sequenced,

using a United States Biochemical Co. Sequenase kit. The two strands were seauenced for the entire cDNA. Purlflcstion and Proteln Sequencing of pM Subunlt of NF-xB N&B was purified from the cytosol of human placenta as a complex of the 50 kd DNA binding subunit with the 65 kd non-DNA-binding subunit as described (Babel and Baeuerle, 1990; Zabel et al., 1990). The eluate from a DNA affinity resin (Baeuerle and Baltimore, 1969) was subjected to SDS-PAGE, proteins were visualized using 45 M so dium acetate (Higgins and Dahmus. 1979), and the band wrresponding to ~50 was excised. The gel piece was minced and incubated in 0.1 M sodium phosphate buffer (pH 8) in the presence of 0.5 pg of endoAspC protease (Boehringer) at 33% overnight. Peptides were separated by HPLC (LKB) and N-terminally sequenced (Applied Biosystems 477). In Vltm Thnscrlption and Wanrlstlon Four micrograms of pBluescript (Stratagene) containing full-length cDNA was digested with various restriction enzymes, followed by phenol extraction and ethanol precipitation. RNA was synthesized in 20 pl reactions using T7 or T3 RNA polymerase for 1 hr at 3pc, according to the manufacturer’s recommendations (Stratagene), followed by phenol extraction and ethanol precipitation. RNA was redissolved in 20 pl of water, and 1 pi was used for in vitro translation, using a rabbit reticulocyte lysate or wheat germ extract, in 20 pl reactions, as recommended by the manufacturer (Pmmega). In the case of the wheat germ extract, the potassium acetate concentration was adjusted to 60 mM. Bsnd Shift Assays and Methylatlon Interfemnce Experiments These analyses were performed as described in Israel et al. (1969b). UV Cross-Llnklng Experiments UV cross-linking was performed as in Is&i et al. (1989a),using a BUdRsubstituted probe derived from the 6s-microglobulin enhancer. Synthesis of KBFl In Becterls snd Antibody Pnpsmtlon The KBFl cDNA was cloned in the pGex.1 vector (Smith and Johnson, 1986) as a fusion with glutathione transferase and introduced into E. coli strain JMlOl. After induction of an 600 ml culture with IPTG for 2 hr, the fusion protein was purified as described (Smith and Johnson, 1988). Rabbit antisera were obtained by subcutaneous injection of fusion protein with complete Freund’s adjuvant. Booster injections were given every month with incomplete adjuvant. Serum was collected 2 weeks after each immunization. Sera 2 and 4 are against a fusion pmtein containing amino acids 19 to 969 of KBFl, while sera 1, 3, and 5 are against a fusion protein containing amino acids 19 to 502. Threetenths micmliter of unpurified antiserum was included in a 10 pl band shift assay, together with the purified binding protein. Reassoclstlon Experiments Proteins purified by SDS-PAGE were acetone precipitated either alone or in combination, redissolved in saturated urea, and progressively renatured as described (Baeuerle and Baltimore, 1989) before being used in a band shift assay. Immunopmclpltstlons lmmunoprecipitations were carried out as described in Murre et al. (1989) in a 50 pl volume containing 2 pl of ssS-labeled in vitm translated proteins, 2 pl of antiserum, and 20 pl of protein ASephamse CL48 (Pharmacia).

We thank H. Loosfelt for kindly providing the QtIO human library, M. Hannink and H. M. Temin for the re/ expression vectors, C. NiissleinVolhard for the doraa/ cDNA, and E. Mottez for her help in the preparation of oligonucleotldes. We alao thank A. Prochnicka-Chalufour for her help in sequence analysis on the computer. V. B. is supported by the Deutscher Akademischer Austauschdienst; M. K. ,is supported by the National Cancer Institute of Canada. J. V. is the recipient of a grant from the National Fund for Scientific Research of Belgium (no. 39083.69). We would like to acknowledge the excellent assistance of J. VanDamine, M. F’aype, and Susi Kunz.

Molecular Cloning of DNA Binding Subunit of NF-KB 1017

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “edvertisement” in accordance with 16 U.S.C. Section 1734 solely to indicete this fact. Received July 9, 1990; revised July 31, 1990.

Baeuerle, P A., and Baltimore, D. (19663. Activation of DNA-binding activity in an apparently cytoplasmic precursor of the NF-KB transcription factor. Cell 53, 211-217. Baeuerle, F! A., and Baltimore, D. (1966b). I-xB: a specific inhibitor of the NF-KB transcription factor. Science 242, 540-546. Baeuerle, P A., and Baltimore, D. (1969). A Mkd subunit of active NFKB is required for inhibition of NF-KB by I-KB. Genes Dev. 3, 16691699. Baldwin, A. S., and Sharp, f? A. (1967). Binding of a nuclear factor to a regulatory sequence in the promoter of the mouse l-l-2@ class I major histocompatibility gene. Mol. Cell. Biol. 7: 305-313. Baldwin, A. S., and Sharp, l? A. (1968). Two transcription factors, NFKB and H2TF1, interact with a single regulatory sequence in the class I major histocompatibility complex promoter. Proc. Natl. Acad. Sci. USA 85, 723-727. Baldwin, A. S., LeClair, K. f?, Singh, H., and Sharp, P A. (1990). A large protein containing zinc finger domains binds to related sequence elements in the enhancers of the class I major histocompatibility complex and K immunoglobulin genes. Mol. Cell. Biol. 70, 1406-1414. Bauw, G., Deloose, M., In& D., VanMontagu, M., and Vendekerckhove, J. (1967). Alterations in the phenotype of plant cells studied by NH2 -terminal amino acid sequence analysis of proteins electroblotted from 2D gel-separated total extracts. Proc. Natl. Acad. Sci. USA 84, 4606-4610. Bauw, G., Van Damme, J., Puype, M., Vandekerckhove, J., Gesser, B., Ratz, G. P, Lauridsen, J. B., and Celis, J. E. (1969). Protein-electroblotting and -microsequencing strategies in generating protein data bases from two-dimensional gels. Proc. Natl. Acad. Sci. USA 86,77017705. Brownell, E., Mathieson, B.. Young, H. A., Keller, J., Ihle, J. N., and Rice, N. R. (1967). Detection of ore/-related transcripts in mouse hematopoietic tissues, fractionated lymphocyte populations and cell lines. Mol. Cell. Biol. 7; 1304-1309. Brownell. E., Mittereder, N., and Rice, N. R. (1969). A human relprotooncogene cDNA containing an A/u fragment as a potential coding exon. Oncogene 4, 935-942. Bull, P, Hunter, T., and Verma, I. M. (1969). Transcriptional induction of the murine c-ml gene with serum and phorbol-12-myristate-13acetate in fibroblasts. Mol. Cell. Biol. 9, 5239-5243. Burke, l? A., Hirschfeld, S., Shirayoshi, Y., K&k, J. W., Hamada, K., Appella, E., and Ozato, K. (1969). Developmental and tissue-specific expression of nuclear proteins that bind the regulatory elements of the major histocompatibility complex class I gene. J. Exp. Med. 169, 1309-1321. Clark, L., Pollock, R. M., and Hay, R. T (1966). Identification and purification of EBPl: a HeLa cell protein that binds to a region overlapping the “core” sequence of the SV40 enhancer. Genes Dev. 2,991-1002. David-Watine, B., Israel, A., and Kourilsky, P (1990). The expression of class I MHC genes and their regulation. Immunol. Today, 77,266-292. Fan, C-M., and Maniatis, T (1990). A DNA binding protein containing two widely separated zinc finger motifs that recognize the same DNA sequence. Genes Dev. 4, 29-42. Franza, B. R., Josephs, S. F., Oilman, M. Z., Ryan, W., and Clarkson, B. (1967). Characterization of cellular proteins recognizing the HIV enhancer using a microscale DNA-affinity precipitation assay. Nature 330, 391395. Gelinas, C., and Temin, H. M. (1966). The v-rel oncogene encodes a cell-specific transcriptional activator of certain promoters. Oncogene 3, 349455. Ghosh, S., and Baltimore, D. (1990). Activation in vitro of NF-KB by phosphoryletion of its inhibitor IKB. Nature 344, 676662.

Gilmore, 1. D., and Temin, H. M. (1988). w oncoproteins in the nucleus and in the cytoplasm transform chicken spleen cells. J. Virol. 62, 703-714. Grumont, R. J., and Gerondakis, S. (iQ69). Structure of a mammalian c-r-e/protein deduced from the nucleotide sequence of murine cDNA clones. Oncogen Res. 4, 1-6. Hannink, M., and Temin, H. M. (1989). Tmnsactivation of gene expression by nuclear and cytoplasmic rel proteins. Mol. Cell. Biol. 9, 4323-4336. Higgins, R. C.. and Dahmus, M. E. (1979). Rapid visualization of protein bands in preparative SDS-polyacryfamide gels. Anal. B&hem. 93, 257-260. Isra61,A., Kimura, A., Fournier, A., Fellous, M., and Kourilsky, F! (1966). Interferon response sequence potentiates activity of an enhencer in the promoter region of a mouse H-2 gene. Nature 322, 743-746. Isra61,A., Kimura, A., Kieran, M., Yano, S., Kanellopoulos, J., Le Bail, O., and Kourilsky, P (1987). A common positive trans-acting factor binds to enhancer sequences in the promoters of mouse K2 and µglobulin genes. Proc. Natl. Acad. Sci. USA 84, 2653-2657. Israel, A., Yano, O., Logeat, F., Kieran, M., and Kourilsky, f? (1969a). Two purified factors bind to the seme sequence in the enhancer of mouse class I genes: one of them is a positive regulator induced upon differentiation of teratocarcinoma cells. Nucl. Acids Res. 77, 5245-5257. Israel, A., Le Bail, O., Hatat, D., Piette, J., Kieran, M., Logeat, F, Wallath, D., Fellous, M., and Kourilsky, R (1969b). TNF stimulates expression of mouse MHC class I genes by inducing an NF-KB-like enhancer binding activity which displaces constitutive factors. EMBO J. 8. 3793-3800. Kawakami, K., Scheidereit, C., and Roeder, R. G. (lQ66). Identification and purification of a human immunoglobulin-enhancer-binding protein (N&B) that activates transcription from a human immunodeftciency virus type 1 promoter in vitro. Proc. Natl. Acad. Sci. USA 85, 47004704. Kimura, A., Israel, A., Le Bail, O., and Kourilsky, P (1966). Detailed analysis of the mouse H-2Kb promoter: enhancer-like sequences and their role in the regulation of class I gene expression. Cell 44,261-272. Korber, B., Mermod, N., Hood, L., and Btroynowski, I. (1966). Regulation of gene expression by interferons: control of H-2 promoter responses. Science 239, 1302-1306. Kozak, M. (1964). Compilation and analysis of sequences upstream from the translational start site in eukaryotic mRNAs. Nucl. Acids Res. 12, 057-672.

Kozak, M. (1966). Leader length and secondary structure modulate mRNA function under conditions of stress. Mol. Cell. Biol. 8, 27372744. Lee, C. C., Wu. X., Gibbs, R. A., Cook, R. G., Muzny, D. M., and Caskey, C. T (1966). Generation of cDNA probes directed by amino acid sequence: cloning of urate oxidase. Science 239, 1266-1291. Lenardo, M. J.. and Baltimore, D. (1969). NFxB: a pleiotropic mediator of inducible and tissue-specific gene control. Cell 58, 227-229. Lenardo, M., Rustgi. A. K., Schievella, R., end Bernard, R. (1969). Sup pression of MHC class I gene expression by N-m through enhancer inactivation. EMBO J. 8, 3351-3355. Lux, S. E., John, K. M., and Bennett, V. (1990). Analysis of cDNA for human erythrocyte ankyrin indicates a repeated structure with homology to tissue-differentiation and cell-cycle control proteins. Nature 344, 36-42. Macchi, M., Bornert, J.-M., Davidson, I., Kanno, M., Resales, R., Vigneron, M.. Xiao, J.-H., Fromental, C., end Chambon, P. (1969). The SV40 TC-II (KB) enhanson binds ubiquitous and cell type specifically inducible nuclear proteins from lymphoid and non-lymphoid cell lines. EMBO J. 8, 4215-4227. Mauxion, F., and Sen, R. (1969). Alteration of a single nucleotideallows efficient binding of H2TFlIKBFl to the immunoglobulin K enhancer B motif. Mol. Cell. Biol. 9, 3548-3552. Mitchell, P J., and Tjian, R. (1969). Transcriptional regulation in mammalian cells by sequence-specific DNA binding proteins. Science 245, 371-376

Cell 1018

Morello, D., Duprey, P., Isra(il, A., and Babinet, C. (1985). Asynchronous regulation of mouse H-2D and 8rmicroglobulin RNA transcripts. Immunogenetics 22, 441-452. Murre, C., McCaw, R S., Vaessin, H., Caudy, M., Jan, L. Y., Jan, Y. N., Cabrera, C. V., Buskln, J. N.. Hauschka, B. D., Lassar, A. B., Weintraub, H.. and Baltimore, D. (1989). Interactions between heterologous helix-loophelix proteins generate complexes that bind specifically to a common DNA sequence. Cell 58, 837-544. Roth, S., Stein, D., and Ntlsslein-Volhard, C. (1989). A gradient of nuclear localization of the dorsal protein determines dorsoventral pattern in the Drosophila embryo. Cell 59, 1189-1292. Rushlow, C. A., Han, K., Manley, J. L., and Levine, M. (1989). The graded distribution of the dom~morphogen is initiated by selective nuclear transport in Drosophila. Cell 59. 1185-1177 San, R.. and Baltimore, D. (1988). lnducibility of K immunoglobulin enhancer-binding protein NFKB by a posttranslational mechanism. Cell 47, 921-928. Shirayoshi, Y., Miyazaki, J., Burke, P A., Hamada, K., Appella, E., and Ozato, K. (1987). Binding of multiple nuclear factors to the 5’upstream regulatory element of the murine major histocompatibility class I gene. Mol. Cell. Biol. 7, 4542-4548. Singer, D. S., and Maguire, J. E. (1989). Regulation of the expression of class I MHC genes. Crit. Rev. Immunol. IO, in press. Smith, D. B., and Johnson, K. J. (1988). Single step purification of poly peptidesexpressed in E. coliasfusions with glutathione S-transferase. Gene 67, 31-48. Stephens, R. M., Riche, N. R., Hiebsch, R. R., Bose, H. R., Jr., and Gilden, R. V. (1983). Nucleotide sequence of v-ml: the oncogene of reticuloendotheliosis virus. Proc. Natl. Acad. Sci. USA 80,6229-8233. Steward, R. (1989). Relocalization of the doma/ protein from the cytoplasm to the nucleus correlates with its function. Cell 59, 1179-l 188. Sytla, B. S., and Temin, H. M. (1988). Activation of oncogenicity of the c-m/ proto-oncogene. Mol. Cell. Biol. 6, 4789-4718. Wilhelmsen, K. C., Egg&on, K., and Temin, H. M. (1984). Nucleic acid sequences of the oncogene v-m/ in reticuloendotheliosis virus strain T and its cellular homolog, the protooncogene c-m/. J. Virol. 52, 172182. Wood, W. I., Gitschier, J., La&y, L. A., and Lawn, R. M. (1985). Base composition-independent hybridization in tetramethylammonium chloride: a method for oligonucleotide screening of highly complex gene libraries. Proc. Natl. Acad. Sci. USA 82, 1585-1588. Yano, O., Kanellopoulos, J., Kieran, M., Le Bail, O., Isra(ll, A., and Kourilsky, R (1987). Purification of KBFl, a Common factor binding to both H-2 and 8Tmicroglobulin enhancers. EMBO J. 8, 3317-3324. Zabel, U., and Baeuerle, F! A. (1990). Purified human IKB can rapidly dissociate the complex of the NFKB transcription factor with its cog nate DNA. Cell 67, 255-285. Zabel. U., Schreck. R., and Baeuerle. P. A. (1998). DNA-binding of purified transcription factor NFKB: affinity, specificity, Zn2+-dependence and differential half site recognition. J. Biol. Chem., in press. Zachow, K. R., and Orr, H. T. (1989). Regulation of HLA class I transcription in T cells. J. Immunol. 143, 3385-3389. Acceeelon Number The nucleotide sequence reported in this paper will appear in the EMBL, GenBank, and DDBJ sequence data bases under accession number M37492.