The effects of inulin on the mucosal morphology and immune status of specific pathogen-free chickens1

The effects of inulin on the mucosal morphology and immune status of specific pathogen-free chickens1 Jiao Song,∗,2 Qinghe Li,∗,2 Peng Li,∗ RanRan Liu,∗ Huanxian Cui,∗ Maiqing Zheng,∗ Nadia Everaert,† Guiping Zhao,∗ and Jie Wen∗,3 ∗

Institute of Animal Sciences, Chinese Academy of Agricultural Sciences, State Key Laboratory of Animal Nutrition, Beijing 100193, People’s Republic of China; and † Precision Livestock and Nutrition Unit, Gembloux Agro-Bio Tech, University of Li`ege, Gembloux 5030, Belgium SPF chickens fed inulin, as compared with the control group. Also, inulin at a low concentration (0.25 or 0.5%) significantly decreased (P < 0.05) the gene expression of nuclear factor-κB (NF-κB), lipopolysaccharideinduced tumor necrosis factor (LITAF) at 7, 14, and 21 d, and of interleukin-6 (IL-6), and inducible nitric oxide synthase (iNOS) at 7 and 14 d, and increased that of mucin 2 (MUC2) and claudin-1 in the ileum of SPF chickens at 7, 14, and 21 d. High inulin supplementation (2%) significantly increased the gene expression of NF-κB, LITAF, IL-6, iNOS, and Claudin-1 at 14 and 21 d compared to low inulin concentration (0.25 or 0.5%). The results indicated that the effects of inulin on mucosal immune function occurred in a dose-dependent manner. A low concentration (0.25 or 0.5%) of inulin may be beneficial in promoting intestinal immune function.

ABSTRACT This study investigated the effects of inulin on mucosal morphology and immune function of specific pathogen-free (SPF) chickens. A total of 200 one-day-old White Leghorns SPF chickens were divided into 5 groups of 4 replicates of 10 chickens each. All SPF chickens were fed a basal diet supplemented with 0, 0.25, 0.5, 1.0, or 2.0% inulin. The mucosal morphology and immune indexes were analyzed on days 7, 14, and 21, respectively. Our results showed that the concentrations of acetate and propionate in the cecum and serum had increased with dietary inulin supplementation on day 21 (P < 0.05). Butyrate could not be detected in the cecal digesta, but was increased in the serum of 1 and 2% groups, as compared with the control group (P < 0.05). The villi height was increased (P < 0.05) and the crypt depth was decreased (P < 0.05) in the duodenum and ileum of

Key words: inulin, SPF chickens, mucosal morphology, immune 2018 Poultry Science 0:1–9 http://dx.doi.org/10.3382/ps/pey260

INTRODUCTION

of the intestinal mucosal and gut induced by infection of enteric pathogens (Buclaw, 2016; Wilson and Whelan, 2017). Chicory inulin, one of the best studied prebiotics, is generally used to maintain intestinal health (Seifert and Watzl, 2007; Meyer and Stasse-Wolthuis, 2009), modulate immune function (Meyer and StasseWolthuis, 2009; He et al., 2017; Kareem et al., 2017), and improve the intestinal absorptive and barrier functions (Tako and Glahn, 2012; Awad et al., 2012; Pruszynska-Oszmalek et al., 2015) via metabolite fermentation by gut microbiota (Calik et al., 2017; Yang et al., 2016; Chen et al., 2017). In general, inulin depresses the expression of proinflammatory cytokines, such as lipopolysaccharide-induced tumor necrosis factor (TNF) factor (LITAF), interferon-γ (IFN-γ ), interleukin-6 (IL-6), and inducible nitric oxide synthase (iNOS), which modifies intestinal barrier function (Whelan, 2011; Vogt et al., 2015; Ferenczi et al., 2016). However, there are inconsistences in reports of the immune modulation response of inulin on the expression of proinflammatory cytokines and subsequent function

The gut plays a key role in nutrient metabolism and immune function with the intestinal epithelium serving as the main site of nutrient absorption and the first line of defense against many factors, such as stress, toxins, and pathogen infection, which impair the intestinal epithelial barrier, resulting in immune dysfunction and nutrient malabsorption in poultry (Quinteiro-Filho et al., 2010; Awad et al., 2012; Oakley et al., 2014). Therefore, intestinal mucosal integrity is critical for nutrient digestion and absorption, as well as overall health. As substitutes for antibiotics, prebiotics are often used in animal production to attenuate dysfunction

 C 2018 Poultry Science Association Inc. Received February 10, 2018. Accepted May 27, 2018. 1 The feeding trial was carried out in the College of Animal Science and Technology, China Agricultural University, Beijing, China. 2 The authors contributed equally. 3 Corresponding author: E-mail: [email protected]

1 Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey260/5051224 by University of Durham user on 10 July 2018

2

SONG ET AL.

of the intestinal mucosal barrier. For example, inulin was found to increase the expression levels of LITAF, IL-6, and IFN-γ (Yasuda et al., 2009; Capit´ an-Ca˜ nadas et al., 2014), but exhibited no effect on the expression levels of proinflammatory cytokines (Zhang et al., 2017). Meanwhile, inulin exhibited anti-inflammatory effects through the fermentation of short-chain fatty acids (SCFAs) by gut microbes. Among the SCFAs, butyrate has been extensively investigated for its role in the suppression of intestinal inflammation. But, excessive butyrate production induced by apoptosis of intestinal epithelial cells disrupts the integrity of the gut barrier (Peng et al., 2007; Huang et al., 2014). The differences in the findings of these reports can be partly explained by the amount of inulin supplementation. On the other hand, the immunomodulatory effects of inulin are dependent on the types of commensal microbiota present in the gut (Sivaprakasam et al., 2016). The initial level of bifidobacteria and the differences between individual Bifidobacterium species may also affect the roles of inulin on immunoregulation (Alles et al., 1996). In the present study, the immunomodulatory effects of inulin supplementation of specific pathogen-free (SPF) chickens on the elimination of the effects of individual microbial differences were assessed. Therefore, the objectives of present study were to (1) determine the appropriate supplementation of inulin in the chicken diet at different stages of growth; (2) assess the effects of inulin supplementation on mucosal morphology and intestinal immune function. With these objectives, SCFA contents reflecting inulin metabolism and gene expression affecting mucosal integrity and immune function were determined.

MATERIALS AND METHODS The study protocol was approved by the Animal Welfare Committee of the Institute of Animal Sciences (Chinese Academy of Agricultural Sciences, Beijing, China) and conducted in accordance with the Guidelines for Experimental Animals established by the Ministry of Science and Technology (Beijing, China).

Experimental Design A total of 200 Arbor Acres SPF chickens at 1 d of age were acquired from a local hatchery (Meiliya, Beijing, China) and randomly assigned to 1 of 5 groups of 4 replicates of 10 chickens each. All birds were housed in a sterile isolation chamber (IPQ-Type 3 negative pressure isolator; China Agricultural University, Beijing, China) and fed a corn/soybean-based diet on the day of arrival. Starting on day 2, the birds in control group (C) were still fed the basal diet, while those in the other 4 groups were fed basal diets supplemented with 2.5, 5, 10, and 20 g/kg of inulin (equal to concentrations of 0.25, 0.5, 1, and 2%), respectively. Details

of the basal diet ingredients and calculated nutrient contents are provided in Table 1. The temperature in the isolator was maintained at 35◦ C for the first week and then decreased by 2◦ C each week until the end of the experiment. All chickens had free access to feed and water (sterilized at 121◦ C for 15 min).

Sample Collection At 7, 14, and 21 d of age on experimental diets, 1 chicken from each replicate was randomly selected and sacrificed. Blood was sampled from one chicken chosen at random in each replicate and then placed in a 37◦ C incubator (GRP-9050; Shanghai Senxin Test Instrument Co., Ltd, Shanghai, China) for 5 h. The serum was aspirated and stored at –20◦ C to measure the SCFA content. To obtain mucosal samples, 3 to 4-cm segments of the ileum (near the cecum) were dissected aseptically and rinsed with sterile phosphate-buffered saline. After opening lengthwise, the mucosa was collected by scraping with a glass slide, snap-frozen in liquid nitrogen, and then stored at –80◦ C until gene expression analysis. The cecum was opened along both sides with sterile scissors and tweezers, and the cecal contents were squeezed out into frozen tubes and stored at –80◦ C until analysis.

Gut Morphology On each sampling day, segments (2 cm in length) of the mid-duodenum and ileum were cut and gently flushed twice with phosphate-buffered saline to remove the intestinal contents, which were then placed in 2-mL centrifuge tubes and mixed with 4% paraformaldehyde for histological examination after staining with hematoxylin and eosin (performed by Beijing Xuebang Technology Co., Ltd., Beijing, China). Histological sections were examined under a fluorescence microscope (DM6000B; Leica Microsystems, Wetzlar, Germany). Morphological measurements of villus height (VH) and crypt depth (CD) were conducted. The VH was measured from the tip of the villus to the valley between individual villi, and the CD was measured from the valley between individual villi to the basolateral membrane. Then, the ratio of the VH to CD (V/C) was calculated.

Quantitative Real-Time PCR (qPCR) Analysis Total RNA from the ileal mucosa was extracted using the MiniBEST Universal RNA Extraction Kit (TaKaRa, Dalian, China) and reverse transcribed into cDNA using the High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific, Waltham, MA).

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey260/5051224 by University of Durham user on 10 July 2018

3

INULIN AND MUCOSAL IMMUNE IN CHICKEN Table 1. Composition and nutrient levels of basal diets (air-dry basis) (g/kg). Item

Treatment C1

0.25%

0.5%

1%

2%

680.1 0.3 275.6 0 2 4.8 16 3 0.2 10 5 3 0

675.5 0.3 276.1 1.5 2 4.8 16 3.1 0.2 10 5 3 2.5

669.8 0.3 277.8 3 2 4.8 16 3.1 0.2 10 5 3 5

660.2 0.3 279.6 5.8 2 4.8 16 3.1 0.2 10 5 3 10

640.7 0.3 283.5 11.4 2 4.8 16 3.1 0.2 10 5 3 20

11.98 181.0 4.0

11.98 181.0 4.0

11.98 181.0 4.0

11.98 181.0 .4.0

11.98 181.0 4.0

9.0 9.1 3.1 6.2

9.0 9.1 3.1 6.2

9.0 9.0 3.1 6.2

9.0 9.1 3.1 6.2

9.0 9.1 3.0 6.2

Ingredients Corn Choline chloride Soybean meal Corn oil Salt Limestone powder Calcium dihydrogen phosphate Cystine Methionine Vitamin premix2 Microelement premix3 Feed grade silicondioxide/titanium Inulin Calculated nutrient level ME, MJ/kg CP Available phosphorus Analyzed nutrient level Calcium Lysine Methionine Cystine 1

Control group without inulin supplementation. Vitamin premix provided the following per kilogram of diet: vitamin A, 12,000 IU; vitamin D3, 3,500 IU; vitamin E, 25 IU; nicotinic acid, thiamin 60 mg; vitamin B12, 0.014 mg; calcium pantothenate, 20 mg; vitaminK3,2.0 mg; thiamin, 2.0 mg; riboflavin, 8.0 mg; vitamin B6, 7.0 mg; folicacid, 0.8 mg; biotin, 0.2 mg. 3 Microelement premix provided the following per kilogram of diet: Fe, 100 mg; Cu, 8 mg; Mn, 120 mg; Zn, 100 mg; I, 0.7 mg; Se, 0.3 mg. 2

Table 2. Primers used in PCR. Target genes1

Primer sequence (5 -3 )

Gene Bank ID

MUC2

F: ACTCCTCCTTTGTATGCGTGA R: GTTAACGCTGCATTCAACCTT F: GGTGTACGACTCGCTGCTTA R: CGAGCCACTCTGTTGCCATA F: AATCCCTCCTCGCCAATCT R: TCACGGTCTTCTCCATAAACG F: CGTGTTCCACCAGGAGATGT R: ATGACGCCAAGAGTACAGCC F: CCCATCTGCACCACCTTCAT R: CATCTGAACTGGGCGGTCAT F: CAATGGACCAGCTCATGGGAAT R: CTTCGCATACGTATCGGAATCG F: GGAGAAACCAGCCAAGTAT R: CCATTGAAGTCACAGGAGA

NM˙001318434.1

Claudin-1 IL-6 iNOS LITAF NF-kB GAPDH

NM 001013611.2 NM 204628.1 NM 204961.1 NM 204267.1 NM 205134.1 NM 204305.1

1 MUC2: Mucin 2; IL-6: Interleukin-6; NF-κ B: Nuclear factor-κ B; iNOS: inducible nitric oxide synthase; LITAF: Lipopolysaccharide induced tumor necrosis factor factor.

The mRNA expression levels of Mucin-2, iNOS, IL6, LIATF, nuclear factor (NF)-κB, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) in the ileal mucosa were measured by quantitative real-time PCR (qPCR) with primers based on chicken sequences retrieved from the National Center for Biotechnology Information database (https://www. ncbi.nlm.nih.gov/gene; Table 2) using a 7500 Real Time PCR system (Applied Biosystems, Waltham, MA) and a commercially available reagent kit (Kapa Biosystems, Inc., Wilmington, MA). Amplification was performed with the following thermal cycling conditions: initial

denaturation at 95◦ C for 3 min, followed by 40 cycles of 95◦ C for 3 s and 60◦ C for 34 s. Relative gene expression data were analyzed using the 2−Ct (sample—control) method (Livak and Schmittgen, 2001), where

−ΔΔCt (sample − control) = (Ct of target gene −Ct of GAPDH gene)sample −(Ct of target gene −Ct of GAPDH gene)control .

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey260/5051224 by University of Durham user on 10 July 2018

4

SONG ET AL.

SCFA Concentration The concentrations of SCFAs (i.e., acetic acid, propionic acid, and butyric acid) were measured from the contents of 1 cecal sample and 1 serum sample from each SPF chicken. After thawing the cecal and serum samples at room temperature, approximately 0.1 g of the cecal contents and 50 μL of serum were transferred into 2-mL tubes and mixed with 200 μL of 24% metaphosphoric acid with a vortex mixer for 15 min and centrifuged at 5,000 × g for 5 min at 4◦ C. The supernatant was gently drawn from the solution by suction into a bottle and analyzed for SCFA content using a DB-FFAP column (length, 30 cm; internal diameter, 0.25 mm; thickness, 0.25 μm; Agilent Technologies, Santa Clara, CA) and a massselective flame ionization detector with the following parameters: injector volume, 2 μL; split ratio, 50:1; injector temperature, 250◦ C; flame ionization detector temperature, 280◦ C, and carrier gas, helium. The initial oven temperature was 70◦ C for 10 min and increased by 5◦ C per min to 210◦ C, which was maintained for 12 min. The peaks of acetic acid, propionic acid, and butyric acid in a standard solution (Sigma-Aldrich) were analyzed with the parameters described above. The peaks of individual SCFAs in every cecal and serum sample were acquired with the same parameters. The molar concentration of each SCFA was calculated using the ratio of the peak area of individual SCFAs and the peak area of the standard solution multiplied the concentration of the standard solution.

Statistical Analysis The effects of treatment were analyzed by 1-way analysis of variance using SAS ver. 8 software (SAS Institute, Cary, NC). Where significant differences were found, multiple comparisons of means were performed using the Duncan method. A probability (P) value of <0.05 was considered statistically significant. Orthogonal polynomial contrasts were also used to evaluate the linear and quadratic effects of inulin levels.

RESULTS SCFA Content in Cecum and Serum The effects of inulin on the SCFA contents of SPF chickens are described in Table 3. The cecal acetate content in the 0.5 and 1% groups and cecal propionate contents in the 0.5, 1, and 2% groups were increased at day 21, as compared to the control group (P < 0.05). Besides, linear and quadratic increases (P < 0.05) were observed in the cecal acetate and propionate contents on day 21. Dietary inulin supplementation did not affect acetate and propionate content in the cecum at 7 d. No butyrate was detected in the cecal digesta. The serum acetate and propionate contents were increased linearly (P < 0.05) with the increase in dietary

inulin supplementation. At day 7, the serum acetate, propionate, and butyrate contents were significantly elevated in the 1 and 2% groups, as compared with the control group (P < 0.05). At day 21, the SPF chickens supplemented with inulin exhibited higher serum acetate and propionate contents, as compared with those without inulin supplementation (P < 0.05). The serum butyrate contents were increased in the 1 and 2% groups, as compared with the control group (P < 0.05).

Villus Morphology in the Duodenum and Ileum The diets supplemented with different levels of inulin exhibited a linear increase (P < 0.05) in VH and V/C ratio and a decrease (P < 0.05) in CD in the duodenum and ileum (Table 4) at days 7, 14, and 21. Quadratic increases were observed (P < 0.05) in the VH in the duodenum on days 7 and 21, and in the ileum on days 7 and 14 (P < 0.05), and in the CD on days 7, 14, and 21 in the duodenum, and days 7 and 14 in the ileum. There was also a quadratic increase (P < 0.05) in V/C in the duodenum (Table 4) on days 7, 14, and 21, and in the ileum (Table 4) on days 7 and 14.

Gene Expression Related to Mucosal Integrity and Immune Function of the Ileum In order to determine the impact of inulin on mucosal immune function and integrity, gene expression levels of NF-κB, LITAF, IL-6, iNOS, MUC2, and claudin-1 in the ileum were examined. As shown in Figure 1, as compared with the control, inulin at the lowest dietary level (0.25%) had significantly decreased (P < 0.05) the expression levels of NF-κB, LITAF, IL-6 (except day 21), iNOS (except day 21), and increased those of MUC2 and claudin-1 in the ileum at all sampling stages (days 7, 14, and 21). But high inulin concentration (2%) increased (P < 0.05) the relative gene expression levels of NF-κB (14 d), LITAF (14 and 21 d), IL-6 (7 and 21 d), and iNOS (14 and 21 d) compared with control group. Compared with low inulin concentration (0.25 and 0.5%), high inulin concentration (2%) increased (P < 0.05) the relative gene expression levels of NFκB, LITAF, IL-6, iNOS, and claudin-1 at days 14 and 21. At 7 d, the MUC2 gene expression of 1% inulin administration was higher than other (P < 0.05) inulin administration group (0.25, 0.5, and 2%), but at 14 and 21 d, the MUC2 gene expression of 0.5% inulin administration was higher than 0.25% inulin (P > 0.05) , 1% inulin (P < 0.05), and 2% inulin (P < 0.05) administration group.

DISCUSSION Emerging evidence suggested that inulin supplementation has been reported to modulate gut immunity

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey260/5051224 by University of Durham user on 10 July 2018

5

INULIN AND MUCOSAL IMMUNE IN CHICKEN Table 3. The effect of inulin on short-chain fatty acid contents in cecum and serum.1 Inulin dose

Cecum, mmol/kg Acetate

C2 0.25% 0.5% 1.0% 2.0% SEM P-value Main effect Linear Quadratic 1 2

Serum, mmol/L

Propionate

7d 92 95 97 95 93 1.63

21 d 103c 123b,c 147a 137a,b 123b,c 3.20

7d 209 214 219 228 238 6.78

21 d 165c 156c 231b 287a 286a 6.91

0.89 0.87 0.32

< 0.01 < 0.01 0.02

0.62 0.11 0.78

< 0.01 < 0.01 < 0.01

Acetate 7d 0.62c 0.67b,c 0.75b,c 0.81a,b 0.88a 0.02 0.01 < 0.01 0.18

Propionate 21 d 0.63b 0.73a 0.76a 0.75a 0.79a 0.01 0.01 0.02 0.09

7d 0.63c 0.69c 0.77b,c 0.92a,b 1.03a 0.03 < 0.01 < 0.01 0.31

Butyrate 21 d 0.53b 0.63a 0.63a 0.65a 0.69a 0.02

7d 0.44c 0.47b,c 0.48b,c 0.58a,b 0.67a 0.02

< 0.01 < 0.01 0.09

< 0.01 < 0.01 0.56

21 d 0.51b 0.52b 0.57a 0.72a 0.75a 0.02 < 0.01 < 0.01 0.13

Results are the mean of 4 replicate cages, 4 birds per cage. Control group without inulin supplementation.

Table 4. Effects of dietary inulin on villus height and crypt depth of specific pathogen-free chickens.1 Variable

VH3 , μ m Duodenum

Ileum CD3 , μ m Duodenum

Ileum V/C3 Duodenum

Ileum

1 2 3

Inulin dose

P-value

C2

0.25%

0.5%

1%

2%

SEM

Main effect

Linear

Quadratic

7d 14 d 21 d 7d 14 d 21 d

579c 720b 895c 324c 359c 415b

608c 736b 911c 345b,c 378b,c 436a,b

678b 787a 951b 370a,b 410a,b 468a,b

699a,b 802a 971a,b 389a 424a 479a,b

730a 824a 988a 390a 439a 503a

4.85 7.07 5.01 4.37 4.90 9.58

< 0.001 0.002 < 0.001 < 0.001 < 0.001 0.034

< 0.001 < 0.001 < 0.001 < 0.001 < 0.001 0.007

< 0.001 0.06 0.01 0.003 0.03 0.28

7d 14 d 21 d 7d 14 d 21 d

104a 109a 116a 85a 91a 96a

95a,b 99a,b 106a,b 81a,b 85a 91a,b

90b,c 90b,c 100b 74b,c 76b 85b,c

84c,d 86c,d 91c 71c,d 71b,c 81b,c

79d 79d 88c 66c 65c 76c

1.65 1.71 0.99 1.22 1.15 1.87

< 0.001 < 0.001 < 0.001 < 0.001 < 0.001 0.016

< 0.001 < 0.001 < 0.001 < 0.001 < 0.001 0.001

0.04 0.02 < 0.001 0.06 0.01 0.18

7d 14 d 21 d 7d 14 d 21 d

5.61c 6.66c 7.77d 3.81c 3.95c 4.32d

6.39c 7.45c 8.58c 4.29c 4.47c 4.81c,d

7.58b 8.73b 9.54b 5.02b 5.40b 5.53b,c

8.39b 9.39b 10.65a 5.46a,b 5.92b 6.03a,b

9.30a 10.49a 11.28a 5.46a 6.76a 6.66a

0.15 0.17 0.11 0.09 0.09 0.16

< 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001

< 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001

0.01 0.02 < 0.001 0.01 0.01 0.12

Results are the mean of 4 replicate cages, 4 birds per cage. Control group without inulin supplementation. VH, villus height (μ m); CD, crypt depth (μ m); V/C, VH/CD.

and improve intestinal barrier function (Guarner, 2007; Liu et al., 2016; Wilson and Whelan, 2017). Moreover, dietary inulin may be fermented by gut microbiota to produce health-promoting SCFA and exhibits its immunomodulatory effect (Calik et al., 2017; Chen et al., 2017; He et al., 2017). Therefore, SCFAs are important end products of cecum fermentation of inulin. In this study, inulin supplementation increased the acetate and propionate contents in the cecal digesta and serum, which is consistent with the findings of other studies (Meyer and Stasse-Wolthuis, 2009; Weitkunat et al., 2015; Zhong et al., 2015). However, some studies reported that inulin did not affect the total concentration of SCFAs in the cecal digesta (Rehman et al., 2008; Kareem et al., 2017). It was well documented that butyrate played an important role in the maintenance of intestinal health and immune function, but butyrate

was only detected in the serum in this study, partly because butyrate was preferentially absorbed in the gut or used by the microbiota (Guilloteau et al., 2010). LITAF, IL6, and iNOS are multifunctional inflammatory cytokines that played essential roles in intestinal inflammation (Al-Sadi et al., 2014). LITAF and iNOS are expressed in all chicken leukocyte and lymphocyte subpopulations, while IL-6 is specifically secreted by chicken macrophages (Rychlik et al., 2014). The proinflammatory cytokines produced during the inflammatory process induced by infectious factors, including LITAF, IFN-γ , IL-6, and iNOS, can disrupt the intestinal tight junction barrier (Al-Sadi et al., 2016). Many studies have shown that inulin induces an anti-inflammatory response and strengthens intestinal barrier function through its effects on proinflammatory cytokine secretion. Inulin alleviates mucosal damage

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey260/5051224 by University of Durham user on 10 July 2018

6

SONG ET AL.

Figure 1. The gene expression of NF-κ B, LITAF, IL-6, iNOS, MUC2, and Claudin-1 in ileum. Values are expressed as mean ± SE (n = 4). Different superscripts above bar differ significantly between each other (P < 0.05).

by decreasing gene expression of LITAF, IL-1a, IL-1β , and iNOS in mucosal tissue (Whelan, 2011; Vogt et al., 2015; Kareem et al., 2017). However, reports on the regulatory effects of inulin on proinflammatory cytokine secretion have been inconsistent (Capit´ anCa˜ nadas et al., 2014; Shang et al., 2015). In this study, 0.25% inulin supplementation significantly decreased the gene expression of LITAF, IL-6, and iNOS, as compared with the control group, but the immunomodulatory effect of inulin on the secretion of inflammatory

cytokines occurred in a dose-dependent manner. The gene expression levels of these inflammatory cytokines had been increased by high inulin concentration (2%) compared with low inulin concentration (0.25 and 0.5%) at 14 and 21 d, which was partly associated with the SCFA contents in the intestine. Among SCFAs, propionate and butyrate reportedly played important roles in the maintenance of gut health and exerted anti-inflammatory effects (Canani et al., 2011). But, only low concentrations of butyrate may be beneficial

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey260/5051224 by University of Durham user on 10 July 2018

INULIN AND MUCOSAL IMMUNE IN CHICKEN

in promoting intestinal barrier function, as excessive butyrate disrupted the intestinal barrier (Peng et al., 2007; Huang et al., 2014) and induced inflammatory cytokine expression (Yan and Ajuwon, 2017). However, Sunkara et al (2011) demonstrated that butyrate triggered no or minimum flammatory cytokine expression. MUC2 and Claudin-1 are important intestinal epithelial barrier components that prevent harmful substances from reaching the surface of the epithelium. Mucus produced by goblet cells covers the epithelial cells and serves as a protective barrier function. Claudin-1 is an important tight junction protein, and high expression of Claudin-1 led to increased epithelial tightness and decreased solute permeability (Awad et al., 2017). The permeability of the intestinal tight junction barrier is affected by different factors, such as heat stress and bacterial pathogens (Guttman and Finlay, 2009; Song et al., 2013; Dokladny et al., 2016), and functional oligosaccharides can ameliorate the adverse effects on barrier integrity in chickens (Pourabedin and Zhao, 2015). The function of inulin modification of epithelial tight junction integrity and gut immune barrier is attributed to the expression of tight junction proteins (Wu et al., 2017b). It is reported that inulin has an important effect on mucus production and secretion. But, the effects of inulin on the expression of tight junction proteins are dependent on the dose of inulin supplementation. Low concentrations of SCFAs significantly increased MUC2 expression, while higher concentrations had an opposite effect in mice, which is consistent with present studies (Barcelo et al., 2000; Paassen et al., 2009). In this study, high inulin administration (2%) depressed MUC2 expression and increased the claudins1 expression compared with low inulin administration at 21 d. The immunomodulatory effect of inulin on the gene expression levels of MUC2 and claudin-1 may be associated with the secretion of the proinflammatory cytokines LITAF and IL-6, which affects the expression of tight junction proteins (Poritz et al., 2011; GarciaHernandez et al., 2017). Evidence suggested that the NF-κB signaling plays an important role in the secretion of proinflammatory cytokines and intestinal barrier function. The expression of proinflammatory cytokines, such as LITAF and IL-6, is under the control of the NF-κB signaling pathway, which plays a central role in the regulation of intestinal epithelial tight junction permeability (Ma et al., 2004; Huang et al., 2013; Lee et al., 2013; Al-Sadi et al., 2016). Therefore, the inhibition of NF-κB has been suggested as a main target for the treatment of intestinal inflammatory reactions and maintenance of intestinal barrier function (Suenaert et al., 2002). Longchain inulin decreased the expression of p-NF-κB p65 (He et al., 2017; Wu et al., 2017a). The results of the present study also showed that low inulin administration (0.5 to 1.0%) reduced NF-κB expression compared to control. The evidence showed that butyrate, the main end product of inulin fermented by microbia, blocks the NF-κB signaling, and consequently sup-

7

pressed the expression of inflammatory cytokines (Orel and Trop, 2014; Leea et al., 2017). Therefore, NF-κB signaling played an integral role in inulin modulation of intestinal barrier function (Wu et al., 2017b). In conclusion, our results indicated that dietary inulin administration affected the SCFA contents of cecum and serum and gut mucosal morphology. Additionally, the immunomodulatory effect of inulin on the expression of inflammatory cytokines and intestinal tight junction protein exhibited the dose-dependent manner. A low concentration inulin (0.25 or 0.5%) depressed the gene expression of NF-κB, LITAF, IL-6, iNOS, and increased the expression of MUC2 and claudin-1 compared to control. According to these results, the appropriate content of inulin administration in the diet is 0.25 or 0.5% at different growth stages of chickens.

ACKNOWLEDGMENTS This research was supported by the National Key Technology R&D Program (2015BAD03B03), China Agriculture Research System (CARS-41), the Agricultural Science and Technology Innovation Program (ASTIPIAS04 and CAAS-XTCX2016010–03). The authors thank W. Bruce Currie (Cornell University, USA) for language and statistical suggestions on the manuscript.

REFERENCES Alles, M. S., J. G. Hautvast, F. M. Nagengast, R. Hartemink, K. M. Van Laere, and J. B. Jansen. 1996. Fate of fructo-oligosaccharides in the human intestine. Br. J. Nutr. 76:211–221. Al-Sadi, R., S. Guo, D. Ye, M. Rawat, and T. Y. Ma. 2016. TNF-a modulation of intestinal tight junction permeability is mediated by NIK/IKK-a axis activation of the canonical NF-kB pathway. Am. J. Pathol. 186:1151–1165. Al-Sadi, R., D. Ye, M. Boivin, S. Guo, M. Hashimi, L. Ereifej, and T. Y. Ma. 2014. Interleukin-6 modulation of intestinal epithelial tight junction permeability is mediated by JNK pathway activation of Claudin-2 gene. PLoS One 9:e85345. Awad, W. A., J. R. Aschenbach, B. Khayal, C. Hess, and M. Hess. 2012. Intestinal epithelial responses to Salmonella enterica serovar Enteritidis: effects on intestinal permeability and ion transport. Poult. Sci. 91:2949–2957. Awad, W. A., C. Hess, and M. Hess. 2017. Enteric pathogens and their toxin-induced disruption of the intestinal barrier through alteration of tight junctions in chickens. Toxins. 9:60. Barcelo, A., J. Claustre, F. Moro, J. A. Chayvialle, J. C. Cuber, and P. Plaisancie. 2000. Mucin secretion is modulated by luminal factors in the isolated vascularly perfused rat colon. Gut. 46:218– 224; PMID:10644316; http://dx.doi.org/10.1136/gut.46.2.218. Buclaw, M. 2016. The use of inulin in poultry feeding: a review. J. Anim. Physiol. Anim. Nutr. 100:1015–1022. Calik, A., A. Ceylan, B. Ekim, S. G. Adabi, F. Dilber, A. G. Bayrak¨ taroglu, T. Tekinay, D. Ozen, and P. Sacakli. 2017. The effect of intra-amniotic and posthatch dietary synbiotic administration on the performance, intestinal histomorphology, cecal microbial population, and short-chain fatty acid composition of broiler chickens. Poult. Sci. 96:169–183. Canani, R. B., M. D. Costanzo, L. Leone, M. Pedata, R. Meli, and A. Calignano. 2011. Potential beneficial effects of butyrate in intestinal and extraintestinal diseases. World J. Gastroenterol. 17:1519– 1528. Capit´ an-Ca˜ nadas, F., M. Ortega-Gonz´ alez, E. Guadix, A. Zarzuelo, M. D. Su´ arez, F. S. de Medina, and

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey260/5051224 by University of Durham user on 10 July 2018

8

SONG ET AL.

O Mart´ınez-Augustin. 2014. Prebiotic oligosaccharides directly modulate proinflammatory cytokine production in monocytes via activation of TLR4. Mol. Nutr. Food Res. 58:1098–1110. Chen, K., H. Chen, M. M. Faas, B. J. de Haan, J. Li, P. Xiao, H. Zhang, J. Diana, P. de Vos, and J. Sun. 2017. Specific inulin-type fructan fibers protect against autoimmune diabetes by modulating gut immunity, barrier function, and microbiota homeostasis. Mol. Nutr. Food Res. 61: doi:10.1002/mnfr.201601006. Dokladny, K., M. N. Zuhl, and P. L. Moseley. 2016. Intestinal epithelial barrier function and tight junction proteins with heat and exercise. J. Appl. Physiol. 120:692–701. Ferenczi, S., K. Szegi, Z. Winkler, T. Barna, and K. J. Kov´ acs. 2016. Oligomannan prebiotic attenuates immunological, clinical and behavioral symptoms in mouse model of inflammatory bowel disease. Sci. Rep. 6:34132. Garcia-Hernandez, V., M. Quiros, and A. Nusrat. 2017. Intestinal epithelial claudins: expression and regulation in homeostasis and inflammation. Ann. NY. Acad. Sci. 1397:66–79. Guarner, F. 2007. Studies with inulin-type fructans on intestinal infections, permeability, and inflammation. J. Nutr. 137:2568S– 2571S. Guttman, J. A., and B. B. Finlay. 2009. Tight junctions as targets of infectious agents. Biochim. Biophys. Acta. 1788:832–841. Guilloteau, P., L. Martin, V. Eeckhaut, R. Ducatelle, R. Zabielski, and F. Van Immerseel. 2010. From the gut to the peripheral tissues: the multiple effects of butyrate. Nutr. Res. Rev. 23:366–384. He, Y., C. Wu, J. Li, H. Li, Z. Sun, H. Zhang, P. de Vos, L. L. Pan, and J. Sun. 2017. Inulin-type fructans modulates pancreatic–gut innate immune responses and gut barrier integrity during experimental acute pancreatitis in a chain length-dependent manner. Front. Immunol. 8:1209. Huang, H., Y. Liu, J. Daniluk, S. Gaiser, J. Chu, H. Wang, Z. S. Li, C. D. Logsdon, and B. Ji. 2013. Activation of nuclear factor κB in acinar cell increases the severity of pancreatitis in mice. Gastroenterology. 144:202–210. Huang, X. Z., Z. R. Li, L. B. Zhu, H. Y. Huang, L. L. Hou, and J. Lin. 2014. Inhibition of p38 mitogen-activated protein kinase attenuates butyrate-induced intestinal barrier impairment in a Caco-2 cell monolayer model. J. Pediatr. Gastroenterol. Nutr. 59:264–269. Kareem, K. Y., T. C. Loh, H. L. Foo, S. A. Asmara, and H. Akit. 2017. Influence of postbiotic RG14 and inulin combination on cecal microbiota, organic acid concentration, and cytokine expression in broiler chickens. Poult. Sci. 96:966–975. Lee, H. J., H. S. Seo, G. J. Kim, C. Y. Jeon, J. H. Park, B. H. Jang, S. J. Park, Y. C. Shin, and D. G. Ko. 2013. Houttuynia cordata Thunb inhibits the production of pro-inflammatory cytokines through inhibition of the NFkappaB signaling pathway in HMC-1 human mast cells. Mol. Med. Rep. 8:731–736. Leea, C., B. G. Kimc, J. H. Kima, J. Chuna, J. P. Ima, and J. S. Kim. 2017. Sodium butyrate inhibits the NF-kappa B signaling pathway and histone deacetylation, and attenuates experimental colitis in an IL-10 independent manner. Int. Immunopharmacol. 51:47–56. Liu, T. W., K. D. Cephas, H. D. Holscher, K. R. Kerr, H. F. Mangian, K. A. Tappenden, and K. S. Swanson. 2016. Nondigestible fructans alter gastrointestinal barrier function, gene expression, histomorphology, and the microbiota profiles of Diet-Induced obese C57BL/6 J mice. J. Nutr. 146:949–956. Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(−ΔΔCt) method. Methods. 25:402–408. Ma, T. Y., G. K. Iwamoto, N. T. Hoa, V. Akotia, A. Pedram, M. A. Boivin, and H. M. Said. 2004. TNF-alpha-induced increase in intestinal epithelial tight junction permeability requires NFkappa B activation. Am. J. Physiol.-Gastrointest Liver Physiol. 286:G367–G376 Meyer, D., and M. Stasse-Wolthuis. 2009. The bifidogenic effect of inulin and oligofructose and its consequences for gut health. Eur. J. Clin. Nutr. 63:1277–1289 Oakley, B. B., H. S. Lillehoj, M. H. Kogut, W. K. Kim, J. J. Maurer, A. Pedroso, M. D. Lee, S. R. Collett, T. J. Johnson, and N. A. Cox. 2014. The chicken gastrointestinal microbiome. FEMS Microbiol. Lett. 360:100–112.

Orel, R., and T. K. Trop. 2014. Intestinal microbiota, probiotics and prebiotics in inflammatory bowel disease. World J. Gastroenterol. 20:11505–11524. Paassen, N., A. Vincent, P. J. Puiman, M. van der Sluis, J. Bouma, G. Boehm, J. B. van Goudoever, I. van Seuningen, and I. B. Renes. 2009. The regulation of intestinal mucin MUC2 expression by short-chain fatty acids: implications for epithelial protection. Biochem. J. 13:211–219. Peng, L., Z. He, W. Chen, I. R. Holzman, and J. Lin. 2007. Effects of butyrate on intestinal barrier function in a Caco-2 cell monolayer model of intestinal barrier. Pediatr Res. 61:37–41. Poritz, L. S., L. R. Harris, A. A. Kelly, and W. A. Koltun. 2011. Increase in the tight junction protein claudin-1 in intestinal inflammation. Dig. Dis. Sci. 56:2802–2809. Pourabedin, M., and X. Zhao. 2015. Prebiotics and gut microbiota in chickens. FEMS Microbiol. Lett. 362: fnv122. doi: 10.1093/femsle/fnv122. Pruszynska-Oszmalek, E., P. A. Kolodziejski, K. Stadnicka, M. Sassek, D. Chalupka, B. Kuston, L. Nogowski, P. Mackowiak, G. Maiorano, J. Jankowski, and M. Bednarczyk. 2015. In ovo injection of prebiotics and synbiotics affects the digestive potency of the pancreas in growing chickens. Poult. Sci. 94:1909–1916. Quinteiro-Filho, W. M., A. Ribeiro, V. Ferraz-de-Paula, M. L. Pinheiro, M. Sakai, L. R. Sa, A. J. Ferreira, and J. PalermoNeto. 2010. Heat stress impairs performance parameters, induces intestinal injury, and decreases macrophage activity in broiler chickens. Poult. Sci. 89:1905–1914. Rehman, H., P. Hellweg, D. Taras, and J. Zentek. 2008. Effects of dietary inulin on the intestinal short chain fatty acids and microbial ecology in broiler chickens as revealed by denaturing gradient gel electrophoresis. Poult. Sci. 87:783–789. Rychlik, I., M. Elsheimer-Matulova, and K. Kyrova. 2014. Gene expression in the chicken caecum in response to infections with nontyphoid Salmonella. Vet Res. 45:119. Seifert, S., and B. Watzl. 2007. Inulin and oligofructose: review of experimental data on immune modulation. J. Nutr. 137:2563S– 2567S. Shang, Y., A. Regassa, J. H. Kim, and W. K. Kim. 2015. The effect of dietary fructooligosaccharide supplementation on growth performance, intestinal morphology, and immune responses in broiler chickens challenged with Salmonella Enteritidis lipopolysaccharides. Poult. Sci. 94:2887–2897. Sivaprakasam, S., P. D. Prasad, and N. Singh. 2016. Benefits of Short-chain fatty acids and their receptors in inflammation and carcinogenesis. Pharmacol. Ther. 164:144–151. Song, J., L. F. Jiao, K. Xiao, Z. S. Luan, C. H. Hu, B. Shi, and X. A. Zhan. 2013. Cello-oligosaccharide ameliorates heat stress-induced impairment of intestinal microflora, morphology and barrier integrity in broilers. Anim. Feed Sci. Technol. 185:175–181. Suenaert, P., V. Bulteel, L. Lemmens, M. Noman, B. Geypens, G. Van Assche, K. Geboes, J. L. Ceuppens, and P. Rutgeerts. 2002. Anti-tumor necrosis factor treatment restores the gut barrier in Crohn’s disease. Am. J. Gastroenterol. 97:2000–2004. Sunkara, L. T., M. Achanta, N. B. Schreiber, Y. R. Bommineni, G. Dai, W. Jiang, S. Lamont, H. S. Lillehoj, A. Beker, R. G. Teeter, and G. Zhang. 2011. Butyrate enhances disease resistance of chickens by inducing antimicrobial host defense peptide gene expression. PLoS One 6:e27225. Tako, E., and R. P. Glahn. 2012. Intra-amniotic administration and dietary inulin affect the iron status and intestinal functionality of iron-deficient broiler chickens. Poult. Sci. 91:1361–1370. Vogt, L., D. Meyer, G. Pullens, M. Faas, M. Smelt, K. Venema, U. Ramasamy, H. A. Schols, and P. De Vos. 2015. Immunological properties of Inulin-type fructans. Crit. Rev. Food Sci. Nutr. 55:414–436. Weitkunat, K., S. Schumann, K. J. Petzke, M. Blaut, G. Loh, and S. Klaus. 2015. Effects of dietary inulin on bacterial growth, shortchain fatty acid production and hepatic lipid metabolism in gnotobiotic mice. J. Nutr. Biochem. 26:929–937. Whelan, K. 2011. Probiotics and prebiotics in the management of irritable bowel syndrome. Curr. Opin. Clin. Nutr. Metab. Care. 14:581–587. Wilson, B., and K. Whelan. 2017. Prebiotic inulin-type fructans and galacto-oligosaccharides: definition, specificity, function, and

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey260/5051224 by University of Durham user on 10 July 2018

INULIN AND MUCOSAL IMMUNE IN CHICKEN application in gastrointestinal disorders. J. Gastroenterol. Hepatol. 32:64–68. Wu, R. Y., M. Abdullah, P. M¨ aa¨tt¨ anen, A. V. C. Pilar, E. Scruten, K. C. Johnson-Henry, S. Napper, C. O’Brien, N. L. Jones, and P. M. Sherman. 2017a. Protein kinase C δ signaling is required for dietary prebioticinduced strengthening of intestinal epithelial barrier function. Sci. Rep. 7:40820. Wu, R. Y., P. M¨ aa¨tt¨ anen, S. Napper, E. Scruten, B. Li, Y. Koike, K. C. Johnson-Henry, A. Pierro, L. Rossi, S. R. Botts, M. G. Surette, and P. M. Sherman. 2017b. Non-digestible oligosaccharides directly regulate host kinome to modulate host inflammatory responses without alterations in the gut microbiota. Microbiome. 5:135. Yan, H., and K. M. Ajuwon. 2017. Butyrate modifies intestinal barrier function in IPEC-J2 cells through a selective upregulation of tight junction proteins and activation of the Akt signaling pathway. PLoS One 12:e0179586. https://doi.org/10.1371/journal.pone.0179586.

9

Yang, G. Q., Y. Yin, H. Y. Liu, and G. H. Liu. 2016. Effects of dietary oligosaccharide supplementation on growth performance, concentrations of the major odor-causing compounds in excreta, and the cecal microflora of broilers. Poult. Sci. 95:2342– 2351. Yasuda, K., H. D. Dawson, E. V. Wasmuth, C. A. Roneker, C. Chen, J. F. Urban, R. M. Welch, D. D. Miller, and X. G. Lei. 2009. Supplemental dietary inulin influences expression of iron and inflammation related genes in young pigs. J. Nutr. 139:2018– 2023. Zhang, S., J. Yang, S. M. Henning, R. Lee, M. Hsu, E. Grojean, R. Pisegna, A. Ly, D. Heber, and Z. Li. 2017. Dietary pomegranate extract and inulin affect gut microbiome differentially in mice fed an obesogenic diet. Anaerobe. 13:184–193. Zhong, Y., N. Marungruang, F. F˚ ak, and M. Nyman. 2015. Effects of two whole-grain barley varieties on caecal SCFA, gut microbiota and plasma inflammatory markers in rats consuming low- and high-fat diets. Br. J. Nutr. 113:1558–1570.

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey260/5051224 by University of Durham user on 10 July 2018