Umbelliferone prevents oxidative stress, inflammation and hematological alterations, and modulates glutamate-nitric oxide-cGMP signaling in hyperammonemic rats

Biomedicine & Pharmacotherapy 102 (2018) 392–402

Contents lists available at ScienceDirect

Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha

Umbelliferone prevents oxidative stress, inflammation and hematological alterations, and modulates glutamate-nitric oxide-cGMP signaling in hyperammonemic rats

T

Mousa O. Germousha, Sarah I. Othmanb, Maha A. Al-Qaraawib, Hanan M. Al-Harbib, Omnia E. Husseinc, Gadh Al-Basherd, Mohammed F. Alotaibie, Hassan A. Elgebalya, ⁎ Mansur A. Sandhuf, Ahmed A. Allamg, Ayman M. Mahmoudc,g, a

Biology Department, Faculty of Science, Jouf University, Aljouf, Saudi Arabia Biology Department, Faculty of Science, Princess Nourah bint Abdulrahman University, Riyadh, Saudi Arabia Physiology Division, Zoology Department, Faculty of Science, Beni-Suef University, Beni-Suef, Egypt d Zoology Department, College of Science, King Saud University, Riyadh, Saudi Arabia e Physiology Department, College of Medicine, King Saud University, Riyadh, Saudi Arabia f Biomedical Sciences Department, Faculty of Veterinary & Animal Sciences, PMAS, Arid Agriculture University, Rawalpindi, Pakistan g Zoology Department, Faculty of Science, Beni-Suef University, Beni-Suef, Egypt b c

A R T I C LE I N FO

A B S T R A C T

Keywords: 7-Hydroxycoumarin Ammonia Oxidative stress Inflammation Nitric oxide Na+/K+-ATPase

Hepatic encephalopathy (HE) is a serious neuropsychiatric complication that occurs as a result of liver failure. Umbelliferone (UMB; 7-hydroxycoumarin) is a natural product with proven hepatoprotective activity; however, nothing has yet been reported on its protective effect against hyperammonemia, the main culprit behind the symptoms of HE. Here, we evaluated the effect of UMB against ammonium chloride (NH4Cl)-induced hyperammonemia, oxidative stress, inflammation and hematological alterations in rats. We demonstrated the modulatory role of UMB on the glutamate-nitric oxide (NO)-cGMP pathways in the cerebrum of rats. Rats received intraperitoneal injections of NH4Cl (3 times/week) for 8 weeks and concomitantly received 50 mg/kg UMB. NH4Cl-induced rats showed significantly elevated blood ammonia and liver function markers. Lipid peroxidation and NO were increased in the liver and cerebrum of rats while the antioxidant defenses were declined. UMB significantly reduced blood ammonia, liver function markers, lipid peroxidation and NO, and enhanced the antioxidant defenses in NH4Cl-induced rats. UMB significantly prevented anemia, leukocytosis, thrombocytopenia and prolongation of PT and aPTT. Hyperammonemic rats showed elevated levels of cerebral TNF-α, IL-1β and glutamine as well as increased activity and expression of Na+/K+-ATPase, effects that were significantly reversed by UMB. In addition, UMB down-regulated nitric oxide synthase and soluble guanylate cyclase in the cerebrum of hyperammonemic rats. In conclusion, this study provides evidence that UMB protects against hyperammonemia via attenuation of oxidative stress and inflammation. UMB prevents hyperammonemia associated hematological alterations and therefore represents a promising protective agent against the deleterious effects of excess ammonia.

1. Introduction Ammonia is a major byproduct of nitrogen metabolism and its accumulation has been reported in several metabolic disorders [1]. It is detoxified in the liver by urea cycle in periportally located hepatocytes and glutamine synthesis in perivenous hepatocytes [2]. Hampered detoxification processes lead to increased ammonia levels in the peripheral blood. Hepatic encephalopathy (HE) is a devastating clinical condition associated with increased ammonia levels in the blood as a ⁎

consequence to liver failure [3]. Elevated levels of blood ammonia are correlated with the severity of HE [4] and used as a diagnostic marker for this disease condition [5]. Ammonia is a known neurotoxin and induces senescence in astrocytes and cognitive impairment [6]. The pathogenesis of HE is not fully understood, but several factors are believed to be implicated in its development and progression. Hyperammonemia is known to be the main culprit behind the symptoms of HE [7]. Hyperammonemia decreases glutamate uptake and activates the N-methyl-D-aspartic acid (NMDA) receptors in the cerebral

Corresponding author at: Physiology Division, Zoology Department, Faculty of Science, Beni-Suef University, Salah Salim St., 62514, Beni-Suef, Egypt. E-mail address: [email protected] (A.M. Mahmoud).

https://doi.org/10.1016/j.biopha.2018.03.104 Received 28 September 2017; Received in revised form 2 March 2018; Accepted 17 March 2018 0753-3322/ © 2018 Elsevier Masson SAS. All rights reserved.

Biomedicine & Pharmacotherapy 102 (2018) 392–402

M.O. Germoush et al.

cortex [8], leading to increased intracellular calcium (Ca2+), elevated nitric oxide (NO) generation, activation of soluble guanylate cyclase (sGC) and increased production of cyclic guanosine monophosphate (cGMP) [9]. Other factors, including oxidative stress [10] and inflammatory response [11–13] are believed to be responsible for the development and progression of HE. Excess ammonia can induce surplus production of reactive oxygen species (ROS) [14] and is implicated in the pathogenesis of brain edema [10]. HE manifests as low grade cerebral edema associated with oxidative/nitrosative stress [15]. Previous studies have reported increased lipid peroxidation and NO, and declined antioxidant defenses in the liver, kidney and brain of hyperammonemic rats [16–18]. In addition, inflammation is implicated in the pathogenesis of HE [11–13]. The pro-inflammatory cytokines tumor necrosis factor alpha (TNF-α) and interleukin 1 beta (IL-1β) were upregulated in the brain of mice during acute liver failure [19]. Both TNFα and ammonia showed a significant increase in the blood of patients with HE [20,21] and rats with hyperammonemia [18]. TNF-α has been suggested to increase the levels of blood ammonia in HE patients [20,21]. Current treatments of hyperammonemia aim to reduce ammonia production and maximize the removal of ammonia from the blood. Most treatments target the metabolic processes and organs involved in ammonia detoxification [7]. Drugs with a proven role in the treatment of HE showed a limited effect on blood ammonia levels [7]. Given the role of inflammation and oxidative stress in the pathogenesis of HE, we assume that attenuation of these processes represents a potent strategy for preventing hyperammonemia. Here, we demonstrated the protective efficacy of umbelliferone (UMB; 7-hydroxycoumarin) against hyperammonemia in rats, focusing on oxidative stress and inflammation. UMB is a phenylpropanoid found in many familiar plants from the Apiaceae family [22]. Recent work from our laboratory showed that UMB possesses antioxidant and anti-inflammatory efficacies and protected the liver against drug-induced hepatotoxicity [23]. The beneficial effects of UMB are mediated through activation of the nuclear factor erythroid 2–related factor 2 (Nrf2) and consequent enhancement of antioxidant defenses and reduced inflammation [23]. To date, nothing is known about the possible protective effect of UMB against hyperammonemia. Therefore, the current study scrutinized the effects of UMB against oxidative stress and inflammation in hyperammonemic rats.

chloride dissolved in physiological saline (3 times/week; ip.) and 50 mg/kg body weight UMB dissolved in 0.5% CMC via oral gavage daily for 8 weeks. 2.2. Samples collection and preparation Twenty-four h after the last treatment, overnight fasted rats were sacrificed and blood, liver and brain samples were collected for analysis. Whole blood samples were collected on EDTA and were used to assay ammonia, erythrocytes, hemoglobin, hematocrit (Hct), total leukocyte count and thrombocytes. Citrated blood samples were collected to measure prothrombin time (PT) and activated partial thromboplastin time (aPTT). Other blood samples were left to coagulate for serum preparation to assay alanine aminotransferase (ALT), aspartate aminotransferase (AST) and alkaline phosphatase (ALP). Immediately after sacrifice, liver and brain were excised, washed and weighed. The cerebrum was dissected out and samples from the cerebrum and liver were homogenized in cold phosphate buffered saline (10% w/v). The homogenate was centrifuged and the clear supernatant was kept at −20 °C to determine lipid peroxidation, NO, reduced glutathione (GSH), superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GPx). In addition, tumor necrosis factor alpha (TNF-α) and interleukin-1beta (IL-1β), glutamine and Na+/K+-ATPase were assayed in the cerebral homogenate. Samples from the cerebrum were kept frozen at −80 °C for the gene expression analysis. 2.3. Biochemical analysis 2.3.1. Determination of blood ammonia and liver function markers Ammonia level was assayed in whole blood samples using a reagent kit purchased from Spinreact (Spain) following the method of da Fonseca-Wollheim [24]. Serum was prepared from blood collected on anti-coagulant free tubes and was used to assay ALT [25], AST [25] and ALP [26] using reagent kits purchased from Spinreact (Spain). 2.3.2. Assay of lipid peroxidation, NO and antioxidant defenses Lipid peroxidation was assayed as malondialdehyde (MDA) in the liver and cerebral homogenates according to the method of Preuss et al. [27]. NO in the liver and cerebrum of rats was determined following the method of Grisham et al. [28]. The antioxidants GSH, SOD, CAT and GPx were assayed following the methods of Beutler et al. [29], Marklund and Marklund [30], Cohen et al. [31] and Matkovics et al. [32], respectively.

2. Materials and methods 2.1. Experimental animals and treatments Twenty-four male Wistar rats weighting 130–150 g were used in the present investigation. The animals were obtained from the National Institute of Ophthalmology (Giza, Egypt) and housed in standard cages at 23 ± 2 °C with a 12 h dark/light cycle. The animals were kept under observation for 10 days before the onset of the experiment and were supplied a standard pellet diet and water ad libitum. All animal procedures were approved by the Institutional Animal Ethics Committee of Beni-Suef University (Egypt). The experimental animals were divided into four groups, each comprising six rats as following: Group I (Control): Rats received physiological saline (3 times/week) via intraperitoneal (ip.) injection and 0.5% carboxymethyl cellulose (CMC) via oral gavage daily for 8 weeks. Group II (UMB): Rats received physiological saline (3 times/week) via ip. injection and 50 mg/kg body weight UMB [23] dissolved in 0.5% CMC via oral gavage daily for 8 weeks. Group III (NH4Cl): Rats received 100 mg/kg ammonium chloride (NH4Cl; Sisco Research Laboratories, Mumbai, India) dissolved in physiological saline (3 times/week; ip.) [16] and 0.5% CMC via oral gavage daily for 8 weeks. Group IV (NH4Cl + UMB): Rats received 100 mg/kg ammonium

2.3.3. Determination of pro-inflammatory cytokines The pro-inflammatory cytokines TNF-α and IL-1β were determined in the cerebral homogenate using specific ELISA kits (R&D Systems, USA), according to the manufacturer’s instructions. 2.3.4. Determination of cerebral Na+/K+-ATPase activity and glutamine level The activity of Na+/K+-ATPase in the cerebrum of rats was determined spectrophotometrically through measuring the levels of inorganic phosphate (Pi) liberated from ATP according to the method of Rauchova et al. [33]. The liberated Pi was determined following the method of Fiske and Subbarow [34], using a reagent kit purchased from Spinreact (Spain). The level of glutamine in the cerebral homogenate of rats was assayed according to the method of Lund [35]. 2.4. Hematological and anticoagulation assays White blood cells (WBC), red blood cells (RBCs), hematocrit (Hct), hemoglobin (Hb), mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), and platelet count were measured on Avid CELLDYN 3500 hematology analyzer (Abbot Laboratories, IL, USA). The 393

Biomedicine & Pharmacotherapy 102 (2018) 392–402

M.O. Germoush et al.

and ALP (Table 2). Normal rats received UMB showed non-significant (P > 0.05) changes in serum ALT, AST and ALP when compared with the control group. These enzymes showed a significant (P < 0.001) increase in serum of NH4Cl-induced rats when compared with the corresponding control rats. NH4Cl-induced rats treated with UMB showed a significant (P < 0.001) decline in serum ALT, AST and ALP levels as represented in Table 2.

coagulation pathways were investigated by measuring prothrombin time (PT) and activated partial thromboplastin time (aPTT). Plateletpoor plasma was prepared from citrated blood samples by centrifugation at 3000 rpm for 10 min at 4 °C. PT and aPTT were measured on Sysmex CA-1500 automated blood coagulation analyzer (Sysmex Corporation, Kobe, Japan) using reagents purchased from Siemens Health Care Diagnostics (Marburg, Germany) according to the manufacturer's instruction.

3.2. UMB suppresses lipid peroxidation and NO, and enhances antioxidants in liver of NH4Cl-induced rats

2.5. Gene expression analysis

The lipid peroxidation marker MDA was significantly (P < 0.001) increased in the liver of NH4Cl-induced rats when compared with the control group as depicted in Fig. 1A. NH4Cl-induced rats treated with UMB showed a significant (P < 0.001) decrease in liver MDA levels. Oral supplementation of UMB didn’t induce significant changes in MDA levels in the liver of normal rats. Similarly, NO was significantly (P < 0.001) increased in the liver of NH4Cl-induced rats as represented in Fig. 1B. Concurrent supplementation of UMB produced a significant (P < 0.001) decrease in NO levels in the liver of NH4Cl-induced rats. Normal rats received UMB for 8 weeks showed non-significant (P > 0.05) changes in liver NO levels as compared to the control group (Fig. 1B). NH4Cl administration induced a significant (P < 0.01) reduction in liver GSH content as depicted in Fig. 1C. Concurrent supplementation of UMB significantly (P < 0.5) ameliorated GSH content in the liver of NH4Cl-induced rats. In addition, NH4Cl-induced rats showed a significant reduction in liver SOD (P < 0.01; Fig. 1D), CAT (P < 0.001; Fig. 1E) and GPx (P < 0.001; Fig. 1F) activity when compared with the control rats. Treatment with UMB significantly enhanced the activity of SOD (P < 0.05), CAT (P < 0.05) and GPx (P < 0.01) in the liver of NH4Cl-induced rats. Rats received UMB for 8 weeks showed non-significant (P > 0.05) changes in liver GSH, SOD, CAT and GPx when compared with the control group.

To evaluate the effect of UMB on the expression levels of neuronal NOS (NOS1), Na+/K+-ATPase and sGC in the cerebrum of control and hyperammonemic rats, we used reverse transcriptase-polymerase chain reaction (RT-PCR). In brief, total RNA was isolated from the frozen cerebrum samples using Trizol reagent (Invitrogen, USA). Isolated RNA was treated with DNAse I (Thermo Scientific, USA) and quantified at 260 nm. RNA samples with A260/280 nm ratio of 1.8 or more were selected and the integrity was further confirmed using formaldehydeagarose gel electrophoresis. Two μg RNA was reverse transcribed into first strand cDNA using RT kit (Thermo Scientific, USA). cDNA was then amplified by Green master mix (Fermentas, USA) [36] and the primers for NOS1, Na+/K+-ATPase, sGC and β-actin as listed in Table 1. The PCR products were loaded into 1.5% agarose gel, electrophoresed and visualized using UV transilluminator. The captured images were scanned and analyzed by ImageJ (version 1.32 j, NIH, USA) and presented as % of control using β-actin as housekeeping gene. 2.6. Statistical analysis Statistical analysis was performed using GraphPad Prism 5 software (GraphPad Software, San Diego, CA). The results were expressed as mean ± standard error of the mean (SEM) and all statistical comparisons were made by means of the one-way ANOVA test followed by Tukey’s test post hoc analysis. A P value < 0.05 was considered significant.

3.3. UMB attenuates NH4Cl-induced oxidative stress in the cerebrum of rats Lipid peroxidation, GSH and antioxidant enzymes were determined to evaluate the protective effect of UMB on NH4Cl-induced oxidative stress in the cerebrum of rats. NH4Cl-induced rats showed a significant (P < 0.001) increase in lipid peroxidation levels in the cerebrum when compared with the control group (Fig. 2A). Treatment of the NH4Clinduced rats with UMB significantly (P < 0.01) decreased lipid peroxidation in the cerebrum. Normal rats received UMB for 8 weeks showed non-significant (P > 0.05) changes in cerebral lipid peroxidation levels (Fig. 2A). GSH content in the cerebrum of NH4Cl-induced rats showed a significant (P < 0.001) decrease when compared with the control group as represented in Fig. 2B. NH4Cl-induced rats treated with UMB showed significantly (P < 0.5) increased cerebral GSH content. Rats received UMB showed non-significant changes in cerebral GSH content when compared with the control group. Activity of the antioxidant enzymes SOD (Fig. 2C), CAT (Fig. 2D) and GPx (Fig. 2E) was significantly (P < 0.01) declined in the cerebrum of NH4Cl-induced rats when compared with the control group. Treatment of the NH4Cl-induced rats with UMB significantly (P < 0.05) improved the activity of cerebral SOD, CAT and GPx. UMB exerted non-significant (P > 0.05) effect on the activity of SOD, CAT and GPx in the cerebrum of normal rats.

3. Results 3.1. UMB decreases blood ammonia and liver function markers in NH4Clinduced rats Data summarized in Table 2 show the effect of UMB on blood ammonia and the liver function markers ALT, AST and ALP in control and NH4Cl-induced rats. UMB administration for 8 weeks didn’t significantly alter blood ammonia levels in control rats. Rats received NH4Cl showed a significant (P < 0.001) increase in blood ammonia levels when compared with the control rats. Concurrent supplementation of UMB significantly (P < 0.001) reduced blood ammonia levels in NH4Cl-induced rats. To evaluate the effect of UMB on liver function in control and NH4Cl-induced rats, we determined the circulating levels of ALT, AST Table 1 Primers used for RT-PCR. Gene

GenBank Accession number

Sequence (5'-3')

Na+/K+-ATPase (Atp1a1) NOS1

NM_012504

sGC

M57405

β-actin (Actb)

NM_031144

F: TGGCATCCGAAGTGCTACAG R: CCAGATCACCAACGACGACA F: GGCCCTTTTAATGAGGGTTGC R: TCTGTGCTAAGTAGCCGCTC F: TCACCCCCATACCCTTCTGT R: GGTAGACTCTGTTGCGGCTT F: CCGCGAGTACAACCTTCTTG R: CAGTTGGTGACAATGCCGTG

XM_017598257

3.4. UMB reduces inflammation in the cerebrum of NH4Cl-induced rats TNF-α and IL-1β were determined to evaluate the effect of UMB on inflammation in the cerebrum of NH4Cl-induced rats. Rats received NH4Cl showed a significant (P < 0.001) increase in TNF-α (Fig. 3A) and IL-1β (Fig. 3B) levels in the cerebrum when compared with the 394

Biomedicine & Pharmacotherapy 102 (2018) 392–402

M.O. Germoush et al.

Table 2 Effect of UMB on blood ammonia, ALT, AST and ALP in control and hyperammonemic rats.

Control UMB NH4Cl NH4Cl + UMB

Ammonia (μmol/dl)

ALT (U/L)

AST (U/L)

ALP (U/L)

60.24 50.88 313.7 156.6

32.23 31.54 72.59 42.26

37.44 33.71 106.1 54.81

96.75 92.69 209.6 111.7

± ± ± ±

2.88 3.44 8.01*** 5.83†††

± ± ± ±

2.74 1.70 4.03*** 2.12†††

± ± ± ±

1.72 1.58 3.92*** 3.13†††

± ± ± ±

4.14 3.95 6.93*** 5.10†††

Data are expressed as mean ± SEM (N = 6). *** P < 0.001 versus Control. ††† P < 0.001 versus NH4Cl.

Fig. 1. UMB suppresses lipid peroxidation and NO, and enhances antioxidants in liver of NH4Cl-induced rats. UMB decreases (A) lipid peroxidation and (B) NO, and increases (C) GSH, (D) SOD, (E) CAT and (F) GPx in the liver of NH4Cl-induced hyperammonemic rats. Data are expressed as mean ± SEM (N = 6). *P < 0.05, **P < 0.01 and ***P < 0.001. UMB, Umbelliferone; MDA, Malondialdehyde; NO, Nitric oxide; GSH, Reduced glutathione; SOD, Superoxide dismutase; CAT, Catalase; GPx, Glutathione peroxidase; ns, non-significant.

395

Biomedicine & Pharmacotherapy 102 (2018) 392–402

M.O. Germoush et al.

Fig. 2. UMB prevents oxidative stress in cerebrum of NH4Cl-induced rats. UMB decreases (A) lipid peroxidation, and increases (C) GSH, (D) SOD, (E) CAT and (F) GPx in the cerebrum of NH4Cl-induced hyperammonemic rats. Data are expressed as mean ± SEM (N = 6). *P < 0.05, **P < 0.01 and ***P < 0.001. UMB, Umbelliferone; MDA, Malondialdehyde; GSH, Reduced glutathione; SOD, Superoxide dismutase; CAT, Catalase; GPx, Glutathione peroxidase; ns, non-significant.

UMB showed a significant amelioration of erythrocytes (P < 0.05), Hb content (P < 0.001) and hematocrit (P < 0.001). MCV (Fig. 4D) and MCH (Fig. 4E) of NH4Cl-induced rats showed non-significant (P > 0.05) changes when compared with the control group. Treatment of the NH4Cl-induced rats with UMB significantly (P < 0.05) increased MCV and MCH when compared with the NH4Cl control rats. NH4Cl-induced rats exhibited a significant (P < 0.001) leukocytosis when compared with the control group (Fig. 4F). UMB supplementation significantly (P < 0.001) alleviated the total number of blood leukocyte in NH4Cl-induced rats. The effect of UMB on coagulation system in normal and NH4Cl-induced rats was evaluated via determination of the number of platelets, PT and aPTT. NH4Cl-induced rats showed a significant (P < 0.05)

control rats. NH4Cl-induced rats treated with UMB exhibited significantly (P < 0.001) reduced cerebral levels of TNF-α and IL-1β when compared with the untreated rats. Oral supplementation of UMB for 8 weeks didn’t induces significant changes in TNF-α and IL-1β levels in the cerebrum of normal rats. 3.5. UMB prevents hyperammonemia-associated hematological and coagulation alterations in rats NH4Cl-induced hyperammonemia in rats was associated with a significant decrease in the number of erythrocytes (P < 0.01; Fig. 4A), Hb content (P < 0.001; Fig. 4B) and hematocrit (P < 0.001; Fig. 4C) when compared with the control rats. NH4Cl-induced rats treated with 396

Biomedicine & Pharmacotherapy 102 (2018) 392–402

M.O. Germoush et al.

Fig. 3. UMB reduces inflammation in the cerebrum of NH4Cl-induced rats. UMB decreases (A) TNF-α and (B) IL-1β in the cerebrum of hyperammonemic rats. Data are expressed as mean ± SEM (N = 6). ***P < 0.001. UMB, Umbelliferone; TNF-α, Tumor necrosis factor alpha; IL-1β, Interleukin 1beta; ns, non-significant.

cerebrum of NH4Cl-induced rats when compared with the control rats (Fig. 8A). Similarly, NO levels in the cerebrum of NH4Cl-induced rats showed a significant (P < 0.01) increase when compared with the control rats as depicted in Fig. 8B. Treatment with UMB significantly ameliorated nNOS expression (P < 0.001) and NO levels (P < 0.05) in the cerebrum of NH4Cl-induced rats. Normal rats supplemented with UMB for 8 weeks showed non-significant (P > 0.05) changes in cerebral nNOS expression (Fig. 8A) and NO levels (Fig. 8B). NH4Cl-induced rats showed a significant (P < 0.001) up-regulation of sGC mRNA abundance in the cerebrum when compared with the control group as represented in Fig. 8C. Treatment of the NH4Cl-induced rats with UMB significantly (P < 0.001) decreased sGC expression in the cerebrum. On the other hand, UMB supplementation to normal rats didn’t affect the expression of sGC (P > 0.05).

thrombocytopenia when compared with the control rats as depicted in Fig. 5A. On the other hand, PT (Fig. 5B) and aPTT (Fig. 5C) were significantly increased in NH4Cl-induced rats when compared with the control group. Treatment with UMB significantly alleviated the number of thrombocytes (P < 0.05), PT (P < 0.01) and aPTT (P < 0.05) in NH4Cl-induced rats. UMB supplementation for 8 weeks didn’t alter the measured hematological and coagulation system parameters in normal rats. 3.6. UMB reduces glutamine synthesis in the cerebrum of NH4Cl-induced rats Glutamine is synthesized by the condensation of ammonia with glutamate [37] and therefore we determined its levels in the cerebrum of rats. NH4Cl-induced rats showed a significant (P < 0.001) increase in cerebral glutamine levels when compared with the control rats (Fig. 6). NH4Cl-induced rats treated with UMB exhibited significantly (P < 0.001) reduced glutamine levels. UMB supplementation didn’t alter glutamine levels in the cerebrum of normal rats.

4. Discussion UMB is a natural product of the coumarin family with multiple beneficial effects, including antioxidant, anti-inflammatory and hepatoprotective [23]. To date, nothing is known about the protective effect of UMB against hyperammonemia. Herein, we show for the first time that UMB modulates the glutamate-NO-cGMP pathway and prevents oxidative damage and inflammation in the cerebrum of hyperammonemic rats. In addition, UMB protects against hyperammonemia associated hematological alterations. We demonstrated the protective efficacy of UMB against excess ammonia and liver injury induced by NH4Cl in rats. NH4Cl administration for 8 weeks induced a significant increase in blood ammonia levels as we have previously reported [16–18]. In this animal model, ammonia increased as a consequence of liver injury can induce further damage and contribute to or exacerbate hyperammonemia [18]. Here, NH4Cl-induced liver injury in rats was confirmed by the significantly increased circulating levels of ALT, AST and ALP. Serum levels of these liver function markers are used as indicators for the assessment of hepatocytes damage [38]. These findings are supported by our previous work where we reported elevated serum levels of ALT, AST and ALP in hyperammonemic rats [16,18]. Detoxification is a central role for the liver and this capacity is hampered upon exposure to toxicants causing liver injury. Hyperammonemia is well-known to be a consequence of hepatocellular damage [39] and therefore agents protecting the liver can prevent hyperammonemia. Treatment with UMB in the present study protected against NH4Cl-induced liver injury as indicated by the declined serum levels of ALT, AST and ALP. The hepatoprotective efficacy of UMB prevented NH4Cl-induced hyperammonemia in rats. Recently, we have demonstrated the protective effect of UMB against cyclophosphamide (CP)-induced liver damage [23]. In a dose-

3.7. UMB suppresses the expression and activity of Na+/K+-ATPase in the cerebrum of NH4Cl-induced rats Gene expression analysis showed a significant (P < 0.001) upregulation of Na+/K+-ATPase mRNA abundance in the cerebrum of NH4Cl-induced rats when compared with the control rats (Fig. 7A). Concurrent administration of UMB significantly (P < 0.001) downregulated Na+/K+-ATPase gene expression in the cerebrum of NH4Clinduced rats. Similarly, the activity of Na+/K+-ATPase, determined as Pi liberated from ATP, was significantly (P < 0.001) increased in the cerebrum of NH4Cl-induced rats when compared with the control rats (Fig. 7B). On the other hand, NH4Cl-induced rats received UMB for 8 weeks showed a significant (P < 0.001) decline in Na+/K+-ATPase activity in the cerebrum. Normal rats received UMB for 8 weeks showed non-significant (P > 0.05) changes in cerebral Na+/K+-ATPase expression (Fig. 7A) and activity (Fig. 7B) when compared with the control rats. 3.8. UMB down-regulates nNOS and sGC and reduces NO in the cerebrum of NH4Cl-induced rats To evaluate the effect of UMB on glutamate-NO-cGMP pathway in the cerebrum of control and NH4Cl-induced rats, we assayed the gene expression levels of nNOS and sGC, and levels of NO. nNOS expression was significantly (P < 0.001) up-regulated in the 397

Biomedicine & Pharmacotherapy 102 (2018) 392–402

M.O. Germoush et al.

Fig. 4. UMB prevents anemia and leukocytosis in hyperammonemic rats. Data are expressed as mean ± SEM (N = 6). *P < 0.05, **P < 0.01 and ***P < 0.001. UMB, Umbelliferone; RBCs, Erythrocytes; Hb, Hemoglobin; Hct, Hematocrit; MCV, Mean corpuscular volume; MCH, Mean corpuscular hemoglobin; WBCs, Leukocytes; ns, non-significant.

macromolecules leading to cell death [44]. Here, NH4Cl-induced hyperammonemic rats exhibited significantly increased lipid peroxidation in both liver and cerebrum. In accordance, we have reported increased lipid peroxidation levels in liver and brain of NH4Cl-induced hyperammonemic rats [16–18]. Our findings were supported by other studies where hyperammonemic animals showed increased lipid peroxidation [45–47]. In addition, NH4Cl-induced hyperammonemic rats showed increased levels of hepatic and cerebral NO as we recently reported [18]. Hyperammonemic rats showed up-regulated nNOS expression and hence increased NO production. nNOS has been reported to be upregulated in the brain of animal models of hyperammonemia [18,47]. NO can react with superoxide radical to produce peroxynitrite which induces further cell damage [48]. As a consequence of oxidative stress,

dependent manner, UMB improved histological structure of the liver and decreased the circulating levels of liver function markers [23]. In addition, UMB reduced serum transaminases and protected rats against N-nitrosodiethylamine- [40] and carbon tetrachloride (CCl4)-induced liver injury [41]. Oxidative stress has been believed to play a role in modulating the effects of excess ammonia [10]. Excess ammonia induces excessive production of ROS [14], and systemic oxidative stress aggravates the neuropsychological effects of ammonia and is implicated in the pathogenesis of brain edema [10]. The nervous system is vulnerable to damage by ROS because of its high metabolic rate, high levels of polyunsaturated fatty acids and low levels of antioxidants [42,43]. ROS can initiate peroxidation of the cell membranes and damage cellular

398

Biomedicine & Pharmacotherapy 102 (2018) 392–402

M.O. Germoush et al.

Fig. 5. UMB prevents thrombocytopenia and normalizes PT and aPTT in hyperammonemic rats. UMB increased the number of (A) platelets and alleviated (B) PT and (C) aPTT in NH4Cl-induced rats. Data are expressed as mean ± SEM (N = 6). *P < 0.05 and **P < 0.01. UMB, Umbelliferone; PT, Prothrombin time; aPTT, Activated partial thromboplastin time; ns, non-significant.

Fig. 6. UMB reduces glutamine synthesis in the cerebrum of NH4Cl-induced rats. Data are expressed as mean ± SEM (N = 6). ***P < 0.001. UMB, Umbelliferone; ns, non-significant.

hyperammonemic rats showed declined GSH and SOD, CAT and GPx. GSH is an essential cellular antioxidant and acts as a substrate for GPx which in concert with SOD and CAT protects against the deleterious effects of ROS. GSH depletion and reduced effectiveness of the antioxidant enzymes sensitize the cells to ROS and hence provoke cell damage. We assumed that mitigating oxidative stress mediates the protective effect of UMB against hyperammonemia. Treatment of the NH4Cl-induced hyperammonemic rats with UMB attenuated oxidative stress and boosted hepatic and cerebral antioxidant defenses. UMB has shown antioxidant efficacy in different models of hepatotoxicity [40,41]. In addition, we have demonstrated decreased lipid peroxidation and down-regulation of iNOS in the liver of CP-induced rats treated with UMB [23]. The present study showed significant down-regulation of nNOS in the cerebrum of NH4Cl-induced hyperammonemic rats treated with UMB. This explains the ability of UMB to decrease NO levels in the liver and brain of hyperammonemic rats. Activation of Nrf2 could be a possible mechanism of UMB antioxidant potential. Recent work from our laboratory showed activated Nrf2 signaling in the liver of CP-induced rats treated with UMB [23]. In addition, we reported that Nrf2 is down-regulated in the brain of NH4Cl-induced hyperammonemic rats [18]. Therefore, UMB might exert its protective effect against hyperammonemia via activation of the Nrf2 signaling in the brain of rats; however, further work is required to validate this hypothesis. Inflammation has also been implicated in the pathogenesis of HE [11–13]. Although its precise interaction with excess ammonia is not fully understood, inflammation in hyperammonemia has been associated with neuropsychological alterations as proposed by Shawcross et al. [49]. The role of inflammation in hyperammonemia and HE has been supported by different animal and human studies. In NH4Cl-

Fig. 7. UMB suppresses the expression (A) and activity (B) of cerebral Na+/K+-ATPase in NH4Cl-induced rats. Data are expressed as mean ± SEM (N = 6). ***P < 0.001. UMB, Umbelliferone; ns, non-significant.

induced hyperammonemic rats, we have reported increased circulating levels of the pro-inflammatory cytokine TNF-α [17,18]. Similar findings were demonstrated in patients with liver cirrhosis where circulating TNF-α was significantly increased [20,21]. Here, NH4Cl-induced hyperammonemic rats showed increased levels of TNF-α and IL-1β in the cerebrum. Our findings along with previous studies highlight the role of both localized and systemic inflammation in hyperammonemia. Therefore, attenuation of inflammation can reduce or prevent 399

Biomedicine & Pharmacotherapy 102 (2018) 392–402

M.O. Germoush et al.

Fig. 8. UMB reduces nNOS expression (A) and NO levels (B), and down-regulates sGC (C) and in the cerebrum of NH4Cl-induced rats. Data are expressed as mean ± SEM (N = 6). *P < 0.05, **P < 0.01 and ***P < 0.001. UMB, Umbelliferone; NOS1, Neuronal nitric oxide synthase; NO, Nitric oxide; sGC, Soluble guanylate cyclase; ns, non-significant.

levels of the coagulation factors [61]. Treatment of the NH4Cl-induced rats with UMB normalized the total leukocyte, thrombocytes, PT and aPTT. These findings added further support to the protective effect of UMB against hyperammonemia. Glutamine is a neutral amino acid formed by the condensation of glutamate and ammonia [37]. In the present study, NH4Cl-induced rats showed a significant increase in glutamine levels in the cerebrum. Glutamine functions as a major nontoxic interorgan ammonia carrier in the CNS [37,62]. The synthesis of glutamine is an essential process for ammonia detoxification in liver failure because the brain doesn’t convert ammonia into urea [63]. Within the brain, glutamine synthesis is catalyzed by glutamine synthetase (GS) located in astrocytes [63]. In hyperammonemia, excess glutamine synthesis can cause several alterations, including altered cerebral blood flow, osmotic disturbance, edema and oxidative stress [64]. We have recently reported increased levels of glutamine in the cerebrum of NH4Cl-induced rats [18]. Increased cerebral glutamine levels could be explained in terms of increased activity of GS to remove excess ammonia. Interestingly, treatment with UMB normalized glutamine levels in the cerebrum of NH4Clinduced rats. These findings are attributed to the decreased ammonia levels following treatment with UMB. However, further studies are required to show the effect of UMB on GS in astrocytes. Modulation of Na+/K+-ATPase is one of the exciting effects of UMB observed in this study. NH4Cl-induced rats showed increased expression and activity of Na+/K+-ATPase. Previous work from our laboratory showing increased activity of cerebral Na+/K+-ATPase added support to findings of the present study. Other studies have demonstrated similar findings in hyperammonemia [47,65,66]. In addition, exposure to millimolar concentrations of NH4Cl increased the activity of Na+/K+ATPase in the cerebral cortex. In mouse astrocytes culture, Kala et al. [67] reported that ammonia increases the activity of Na+/K+-ATPase. Ammonia has also been shown to compromise K+ buffering in astrocytes which represents a crucial mechanism in ammonia neurotoxicity [68]. UMB has been shown to influence the activity of Na+/K+-ATPase in erythrocytes, liver, kidney and heart of diabetic rats [69]. Our study is the first to show the effect of UMB on cerebral Na+/K+-ATPase. Decreased expression and activity of cerebral Na+/K+-ATPase point to the ability of UMB to prevent ammonia provoked K+ buffering dysregulation in astrocytes and hence preserve functionality of the principal ammonia removal pathway located in astrocytes. Over-activation of NMDA glutamate receptors in the cerebrum is one of the main effects of hyperammonemia [8]. NMDA activation open the ion channels and allow the entry of Ca2+ which binds to calmodulin

neuropsychological alterations associated with hyperammonemia [18]. In this context, the nonsteroidal anti-inflammatory drug indomethacin prevented ammonia-induced brain edema in rats [50], demonstrating that attenuation of inflammation could be a potent strategy to prevent hyperammonemia-induced alterations. In the present study, treatment with UMB abolished TNF-α and IL-1β in the cerebrum of NH4Cl-induced hyperammonemic rats. UMB has effectively attenuated inflammation in rat models of hepatotoxicity [23] and colon carcinogenesis [51]. The anti-inflammatory efficacy of UMB could be linked to activation of Nrf2 as we recently reported [23]. The anti-inflammatory role of Nrf2 has been well-documented in several studies [52–55]. Recently, we have demonstrated that attenuation of inflammation in hyperammonemic rats was associated with Nrf2 activation [18]. Estimation of hematological parameters is an earlier index to assess the deleterious effects of drugs [56]. In hyperammonemia, studies demonstrating the associated hematological alterations are few. In hyperammonemic rats, we have reported several hematological and coagulation alterations, including anemia, leukocytosis, thrombocytopenia and prolonged PT and aPTT [18]. Hematological and coagulation parameters are frequently altered in liver disease [57]. In the present study, NH4Cl-induced hyperammonemic rats showed significantly decreased RBCs, Hb% and Hct. MCV and MCH were non-significantly decreased in NH4Cl-induced hyperammonemic rats, pointing to the lysis of RBCs as the event behind the lower number of RBCs. In liver transplant candidates with cirrhosis, Kalaitzakis et al. [58] showed that HE is related to anemia. The decreased number of RBCs in this study could be directly linked to the excessive production of ROS in hyperammonemic rats. Through their ability to induce lipid peroxidation, ROS can decrease the deformability of erythrocytes and induce cell damage [59]. Following membrane damage by ROS, erythrocytes undergo immediate lysis in the circulation or within the monocyte-macrophage system. UMB significantly prevented anemia in NH4Cl-induced rats which could be attributed to diminished ROS production and lipid peroxidation. In addition, NH4Cl-induced hyperammonemic rats showed leukocytosis, thrombocytopenia, and prolonged PT and aPTT. These findings added support to our previous work where we demonstrated similar findings in hyperammonemic rats. Here, leukocytosis reflects the inflammation in NH4Cl-induced hyperammonemic rats. Leukocytosis has been shown to be associated with HE [57] and hyperammonemic patients showed mild leukocytosis [60]. Furthermore, defects of blood coagulation occur in liver disease as a consequence of decreased number of platelets as well as deficiency of the coagulation factors. PT and aPTT are prolonged as a result of decreased circulating 400

Biomedicine & Pharmacotherapy 102 (2018) 392–402

M.O. Germoush et al.

and trigger nNOS and increased NO production. NO activates sGC and increased formation of cGMP [9]. In the present study, NH4Cl-induced hyperammonemic rats showed up-regulation of cerebral nNOS and sGC along with increased levels of NO production. Accordingly, the study of Rodrigo et al. [70] showed activated sGC in the cerebral cortex of rats with pure chronic hyperammonemia. In NH4Cl-induced hyperammonemia, Ramakrishnan et al. [47] and Mahmoud et al. [18] reported increased expression of nNOS and sGC in the cerebrum of rats. In vitro, Rodrigo et al. [71] showed increased activity of sGC in neurons from cerebral cortex chronically exposed to 0.1 mM ammonia. Although the glutamate-NO-cGMP pathway modulates many processes in the cerebrum [72], disproportionate activation of this pathway is involved in the neuronal damage and some neurodegenerative diseases [73]. Therefore, modulation of this pathway and removal of excess ammonia is crucial for maintaining normal cerebral processes. Interestingly, treatment of the hyperammonemic rats with UMB normalized nNOS and sGC expression and significantly reduced the levels of NO in the cerebrum. This modulatory effect of UMB on the glutamate-NOcGMP pathway in the cerebrum contributes to its protective efficacy against excess ammonia induced alterations. A recent study by Felipo et al. [74] showed that restoration of the glutamate-NO-cGMP pathway restored cognitive function in rats with minimal HE. In conclusion, our study provides novel information on the protective effect of UMB against hyperammonemia in rats. UMB suppressed oxidative stress, inflammation and glutamine synthesis in the cerebrum of hyperammonemic rats. In addition, UMB reduced the expression and activity of cerebral Na+/K+-ATPase, downregulated the glutamate-NOcGMP pathway and prevented excess ammonia associated hematological alterations. Therefore, UMB represents a promising neuroprotective agent against excess ammonia. Given that UMB reduces glutamine synthesis and activates Nrf2 signaling, this study calls for the need of further in vitro and in vivo investigations to trace the exact involvement of GS and Nrf2 in the neuroprotective effect of UMB.

[11] D. Shawcross, R. Jalan, The pathophysiologic basis of hepatic encephalopathy: central role for ammonia and inflammation, Cell. Mol. Life Sci. 62 (19–20) (2005) 2295–2304. [12] D.L. Shawcross, G. Wright, S.W. Olde Damink, R. Jalan, Role of ammonia and inflammation in minimal hepatic encephalopathy, Metab. Brain Dis. 22 (1) (2007) 125–138. [13] D.L. Shawcross, G.A. Wright, V. Stadlbauer, S.J. Hodges, N.A. Davies, C. WheelerJones, A.A. Pitsillides, R. Jalan, Ammonia impairs neutrophil phagocytic function in liver disease, Hepatology 48 (4) (2008) 1202–1212. [14] C. Lopez-Alarcon, A. Denicola, Evaluating the antioxidant capacity of natural products: a review on chemical and cellular-based assays, Anal. Chim. Acta 763 (2013) 1–10. [15] B. Gorg, N. Qvartskhava, V. Keitel, H.J. Bidmon, O. Selbach, F. Schliess, D. Haussinger, Ammonia induces RNA oxidation in cultured astrocytes and brain in vivo, Hepatology 48 (2) (2008) 567–579. [16] A.M. Mahmoud, Influence of rutin on biochemical alterations in hyperammonemia in rats, Exp. Toxicol. Pathol. 64 (November (7–8)) (2012) 783–789, http://dx.doi. org/10.1016/j.etp.2011.01.016 Epub 2011 Mar 5. (2012). [17] A.M. Mahmoud, M.O. Germoush, A.S. Soliman, Ruta graveolens mitigates ammonium chloride-induced hyperammonemia by modulating antioxidant status and pro-inflammatory cytokines, Life Sci. J. Life Sci. J. 11 (6) (2014) 269–275. [18] A.M. Mahmoud, S. Alqahtani, S.I. Othman, M.O. Germoush, O.E. Hussein, G. AlBasher, J.S. Khim, M.A. Al-Qaraawi, H.M. Al-Harbi, A. Fadel, A.A. Allam, Commiphora molmol modulates glutamate-nitric oxide-cGMP and Nrf2/ARE/HO-1 pathways and attenuates oxidative stress and hematological alterations in hyperammonemic rats, Oxid. Med. Cell. Longevity 2017 (2017) 15 ID 7369671. [19] C. Bemeur, H. Qu, P. Desjardins, R.F. Butterworth, IL-1 or TNF receptor gene deletion delays onset of encephalopathy and attenuates brain edema in experimental acute liver failure, Neurochem. Int. 56 (2) (2010) 213–215. [20] M. Odeh, E. Sabo, I. Srugo, A. Oliven, Serum levels of tumor necrosis factor-alpha correlate with severity of hepatic encephalopathy due to chronic liver failure, Liver Int. 24 (2) (2004) 110–116. [21] M. Odeh, E. Sabo, I. Srugo, A. Oliven, Relationship between tumor necrosis factoralpha and ammonia in patients with hepatic encephalopathy due to chronic liver failure, Ann. Med. 37 (8) (2005) 603–612. [22] L.K.A.M. Leal, A.A.G. Ferreira, G.A. Bezerra, F.J.A. Matos, G.S.B. Viana, Antinociceptive, anti-inflammatory and bronchodilator activities of Brazilian medicinal plants containing coumarin: a comparative study, J. Ethnopharmacol. 70 (2) (2000) 151–159. [23] A.M. Mahmoud, M.O. Germoush, M.F. Alotaibi, O.E. Hussein, Possible involvement of Nrf2 and PPARgamma up-regulation in the protective effect of umbelliferone against cyclophosphamide-induced hepatotoxicity, Biomed. Pharmacother. 86 (2017) 297–306. [24] F. da Fonseca-Wollheim, Preanalytical increase of ammonia in blood specimens from healthy subjects, Clin. Chem. 36 (8 Pt 1) (1990) 1483–1487. [25] G. Schumann, R. Klauke, New IFCC reference procedures for the determination of catalytic activity concentrations of five enzymes in serum: preliminary upper reference limits obtained in hospitalized subjects, Clin. Chim. Acta 327 (January (1–2)) (2003) 69–79. [26] C. Wenger, A. Kaplan, F.F. Rubaltelli, C. Hammerman, Alkaline phosphatase, Clin. Chem. The C.V., Mosby Co., St Louis., Toronto. Princeton, 1984, pp. 1094–1098. [27] H.G. Preuss, S.T. Jarrell, R. Scheckenbach, S. Lieberman, R.A. Anderson, Comparative effects of chromium, vanadium and gymnema sylvestre on sugar-induced blood pressure elevations in SHR, J. Am. Coll. Nutr. 17 (2) (1998) 116–123. [28] M.B. Grisham, G.G. Johnson, J.R. Lancaster Jr, Quantitation of nitrate and nitrite in extracellular fluids, Methods Enzymol. 268 (1996) 237–246. [29] E. Beutler, O. Duron, B.M. Kelly, Improved method for the determination of blood glutathione, J. Lab. Clin. Med. 61 (1963) 882–888. [30] S. Marklund, G. Marklund, Involvement of the superoxide anion radical in the autoxidation of pyrogallol and a convenient assay for superoxide dismutase, FEBS Eur. J. Biochem. 47 (3) (1974) 469–474. [31] G. Cohen, D. Dembiec, J. Marcus, Measurement of catalase activity in tissue extracts, Anal. Biochem. Anal. Biochem. 34 (1) (1970) 30–38. [32] B. Matkovics, L. Szabo, I.S. Varga, Determination of enzyme activities in lipid peroxidation and glutathione pathways (in Hungarian), Laboratoriumi Diagnosztika 15 (1998) 248–249. [33] H. Rauchova, Z. Drahota, J. Koudelova, The role of membrane fluidity changes and thiobarbituric acid-reactive substances production in the inhibition of cerebral cortex Na++/K+-ATPase activity, Physiol. Res. 48 (1) (1999) 73–78. [34] C. Fiske, Y. Subbarow, The colourimetric determination of phosphorus, J. Biol. Chem. 66 (1925) 375–400. [35] P. Lund, L-Glutamine and L-glutamate: UV method with glutaminase and glutamate dehydrogenase, in: H.U. Bergmeyer (Ed.), Methods in Enzymatic Analysis, VCH, Verlagsgesellschaft, Weinheim, Germany, 1986, pp. 357–363. [36] A.M. Mahmoud, Hematological alterations in diabetic rats – role of adipocytokines and effect of citrus flavonoids, EXCLI J. 12 (2013) 647–657. [37] T.B. Hakvoort, Y. He, W. Kulik, J.L. Vermeulen, S. Duijst, J.M. Ruijter, J.H. Runge, N.E. Deutz, S.E. Koehler, W.H. Lamers, Pivotal role of glutamine synthetase in ammonia detoxification, Hepatology 65 (1) (2017) 281–293. [38] S.K. Ramaiah, A toxicologist guide to the diagnostic interpretation of hepatic biochemical parameters, Food Chem. Toxicol. 45 (9) (2007) 1551–1557. [39] M.C. Machado, F. Pinheiro da Silva, Hyperammonemia due to urea cycle disorders: a potentially fatal condition in the intensive care setting, J. Intensive Care 2 (1) (2014) 22. [40] S.R. Subramaniam, E.M. Ellis, Umbelliferone and esculetin protect against N-nitrosodiethylamine-induced hepatotoxicity in rats, Cell Biol. Int. (2016).

Conflict of interest The authors declare that they have no conflict of interests. Acknowledgments The authors would like to thank the Deanship of Scientific Research at Princess Nourah bint Abdulrahman University for funding this work through the Research Groups Program grant no. (RG-1438-002). References [1] B.K. Burton, Urea cycle disorders, CLD Clin. Liver Dis. 4 (4) (2000) 815–830. [2] S.W. Olde Damink, N.E. Deutz, C.H. Dejong, P.B. Soeters, R. Jalan, Interorgan ammonia metabolism in liver failure, Neurochem. Int. 41 (2-3) (2002) 177–188. [3] R.F. Butterworth, The liver-brain axis in liver failure: neuroinflammation and encephalopathy, Nat. Rev. Gastroenterol. Hepatol. 10 (9) (2013) 522–528. [4] J.P. Ong, A. Aggarwal, D. Krieger, K.A. Easley, M.T. Karafa, F. Van Lente, A.C. Arroliga, K.D. Mullen, Correlation between ammonia levels and the severity of hepatic encephalopathy, Am. J. Med. 114 (3) (2003) 188–193. [5] W. Bernal, C. Hall, C.J. Karvellas, G. Auzinger, E. Sizer, J. Wendon, Arterial ammonia and clinical risk factors for encephalopathy and intracranial hypertension in acute liver failure, Hepatology 46 (6) (2007) 1844–1852. [6] B. Gorg, A. Karababa, A. Shafigullina, H.J. Bidmon, D. Haussinger, Ammonia-induced senescence in cultured rat astrocytes and in human cerebral cortex in hepatic encephalopathy, Glia 63 (1) (2015) 37–50. [7] A. Hadjihambi, V. Khetan, R. Jalan, Pharmacotherapy for hyperammonemia, Expert Opin. Pharmacother. Expert Opin. Pharmacother. 15 (12) (2014) 1685–1695. [8] C. Hermenegildo, P. Monfort, V. Felipo, Activation of N-methyl-D-aspartate receptors in rat brain in vivo following acute ammonia intoxication: characterization by in vivo brain microdialysis, Hepatology 31 (3) (2000) 709–715. [9] C. Montoliu, M. Llansola, P. Monfort, R. Corbalan, I. Fernandez-Marticorena, M.L. Hernandez-Viadel, V. Felipo, Role of nitric oxide and cyclic GMP in glutamateinduced neuronal death, Neurotox Res. 3 (2) (2001) 179–188. [10] C.R. Bosoi, X. Yang, J. Huynh, C. Parent-Robitaille, W. Jiang, M. Tremblay, C.F. Rose, Systemic oxidative stress is implicated in the pathogenesis of brain edema in rats with chronic liver failure, Free Radic. Biol. Med. 52 (7) (2012) 1228–1235.

401

Biomedicine & Pharmacotherapy 102 (2018) 392–402

M.O. Germoush et al.

[41] M.R. Mohamed, M.A. Emam, N.S. Hassan, A.I. Mogadem, Umbelliferone and daphnetin ameliorate carbon tetrachloride-induced hepatotoxicity in rats via nuclear factor erythroid 2-related factor 2-mediated heme oxygenase-1 expression, Environ. Toxicol. Pharmacol. 38 (2) (2014) 531–541. [42] M.E. Gotz, G. Kunig, P. Riederer, M.B. Youdim, Oxidative stress: free radical production in neural degeneration, Pharmacol. Ther. 63 (1) (1994) 37–122. [43] K.J. Barnham, C.L. Masters, A.I. Bush, Neurodegenerative diseases and oxidative stress, Nat. Rev. Drug Discov. 3 (3) (2004) 205–214. [44] S.R. Naik, V.S. Panda, Antioxidant and hepatoprotective effects of Ginkgo biloba phytosomes in carbon tetrachloride-induced liver injury in rodents, Liver Int. 27 (April (3)) (2007) 393–399. [45] K.B. Dakshayani, S. Velvizhi, P. Subramanian, Effects of ornithine alpha-ketoglutarate on circulatory antioxidants and lipid peroxidation products in ammonium acetate treated rats, Ann. Nutr. Metab. 46 (3–4) (2002) 93–96. [46] O. Kharoubi, M. Slimani, A. Aoues, L. Seddik, Prophylactic effects of wormwood on lipid peroxidation in an animal model of lead intoxication, Indian J. Nephrol. 18 (2) (2008) 51–57. [47] A. Ramakrishnan, N. Vijayakumar, M. Renuka, Naringin regulates glutamate-nitric oxide cGMP pathway in ammonium chloride induced neurotoxicity, Biomed. Pharmacother. 84 (2016) 1717–1726. [48] S.E. McKim, E. Gäbele, F. Isayama, J.C. Lambert, L.M. Tucker, M.D. Wheeler, H.D. Connor, R.P. Mason, M.A. Doll, D.W. Hein, G.E. Arteel, Inducible nitric oxide synthase is required in alcohol-induced liver injury: studies with knockout mice, Gastroenterology 125 (6) (2003) 1834–1844. [49] D.L. Shawcross, N.A. Davies, R. Williams, R. Jalan, Systemic inflammatory response exacerbates the neuropsychological effects of induced hyperammonemia in cirrhosis, J. Hepatol. 40 (2) (2004) 247–254. [50] C. Chung, J. Gottstein, A.T. Blei, Indomethacin prevents the development of experimental ammonia-induced brain edema in rats after portacaval anastomosis, Hepatology 34 (2) (2001) 249–254. [51] R. Muthu, N. Selvaraj, M. Vaiyapuri, Anti-inflammatory and proapoptotic effects of umbelliferone in colon carcinogenesis, Hum. Exp. Toxicol. (2015) 0960327115618245. [52] S.S. Boyanapalli, X. Paredes-Gonzalez, F. Fuentes, C. Zhang, Y. Guo, D. Pung, C.L. Saw, A.N. Kong, Nrf2 knockout attenuates the anti-inflammatory effects of phenethyl isothiocyanate and curcumin, Chem. Res. Toxicol. 27 (12) (2014) 2036–2043. [53] E.H. Kobayashi, T. Suzuki, R. Funayama, T. Nagashima, M. Hayashi, H. Sekine, N. Tanaka, T. Moriguchi, H. Motohashi, K. Nakayama, M. Yamamoto, Nrf2 suppresses macrophage inflammatory response by blocking proinflammatory cytokine transcription, Nat. Commun. 7 (2016) 11624. [54] A.M. Mahmoud, W.G. Hozayen, S.M. Ramadan, Berberine ameliorates methotrexate-induced liver injury by activating Nrf2/HO-1 pathway and PPARgamma, and suppressing oxidative stress and apoptosis in rats, Biomed. Pharmacother. 94 (2017) 280–291. [55] A.M. Mahmoud, A.R. Zaki, M.E. Hassan, G. Mostafa-Hedeab, Commiphora molmol resin attenuates diethylnitrosamine/phenobarbital-induced hepatocarcinogenesis by modulating oxidative stress, inflammation, angiogenesis and Nrf2/ARE/HO-1, Signal. Chem. Biol. Interact. 270 (2017) 41–50. [56] A. Alya, D.B. Ines, L. Montassar, G. Najoua, E.Fa. Saloua, Oxidative stress, biochemical alterations, and hyperlipidemia in female rats induced by lead chronic toxicity during puberty and post puberty periods, Iran. J. Basic Med. Sci. 18 (10) (2015) 1034–1043. [57] H. Aggarwal, U.A. Rao, S. Singla, G. Dabas, A study on hematological spectrum in patients with alcoholic liver cirrhosis, J. Clin. Exp. Hepatol. 5 (Supplement 2) (2015) S18–S19. [58] E. Kalaitzakis, A. Josefsson, M. Castedal, P. Henfridsson, M. Bengtsson, B. Andersson, E. Bjornsson, Hepatic encephalopathy is related to anemia and fat-

[59]

[60]

[61]

[62] [63]

[64] [65]

[66]

[67]

[68]

[69]

[70]

[71]

[72]

[73]

[74]

402

free mass depletion in liver transplant candidates with cirrhosis, Scand. J. Gastroenterol. 48 (5) (2013) 577–584. K. Kolanjiappan, S. Manoharan, M. Kayalvizhi, Measurement of erythrocyte lipids, lipid peroxidation, antioxidants and osmotic fragility in cervical cancer patients, Clin. Chim. Acta 326 (1–2) (2002) 143–149. D.E. Choi, K.W. Lee, Y.T. Shin, K.R. Na, Hyperammonemia in a patient with lateonset ornithine carbamoyltransferase deficiency, J. Korean Med. Sci. 27 (5) (2012) 556–559. S.H. Caldwell, M. Hoffman, T. Lisman, B.G. Macik, P.G. Northup, K.R. Reddy, A. Tripodi, A.J. Sanyal, Coagulation disorders and hemostasis in liver disease: pathophysiology and critical assessment of current management, Hepatology 44 (4) (2006) 1039–1046. J. Albrecht, M. Dolinska, Glutamine as a pathogenic factor in hepatic encephalopathy, J. Neurosci. Res. 65 (1) (2001) 1–5. C.H. Dejong, N.E. Deutz, P.B. Soeters, Ammonia and glutamine metabolism during liver insufficiency: the role of kidney and brain in interorgan nitrogen exchange, Scand. J. Gastroenterol. Suppl. 218 (1996) 61–77. J. Vaquero, R.F. Butterworth, Mechanisms of brain edema in acute liver failure and impact of novel therapeutic interventions, Neurol. Res. 29 (7) (2007) 683–690. C.A. Ribeiro, F.H. Hickmann, M. Wajner, Neurochemical evidence that 3-methylglutaric acid inhibits synaptic Na++,K++-ATPase activity probably through oxidative damage in brain cortex of young rats, Int. J. Dev. Neurosci. 29 (1) (2011) 1–7. M. Renuka, N. Vijayakumar, A. Ramakrishnan, Chrysin, a flavonoid attenuates histological changes of hyperammonemic rats: a dose dependent study, Biomed. Pharmacother. 82 (2016) 345–354. G. Kala, R. Kumarathasan, L. Peng, F.H. Leenen, L. Hertz, Stimulation of Na++,K+ +-ATPase activity, increase in potassium uptake, and enhanced production of ouabain-like compounds in ammonia-treated mouse astrocytes, Neurochem. Int. 36 (3) (2000) 203–211. V. Rangroo Thrane, A.S. Thrane, F. Wang, M.L. Cotrina, N.A. Smith, M. Chen, Q. Xu, N. Kang, T. Fujita, E.A. Nagelhus, M. Nedergaard, Ammonia triggers neuronal disinhibition and seizures by impairing astrocyte potassium buffering, Nat. Med. 19 (12) (2013) 1643–1648. B. Ramesh, K.V. Pugalendi, Influence of umbelliferone on membrane-bound ATPases in streptozotocin-induced diabetic rats, Pharmacol. Rep. 59 (3) (2007) 339–348. R. Rodrigo, S. Erceg, J. Rodriguez-Diaz, J. Saez-Valero, B. Piedrafita, I. Suarez, V. Felipo, Glutamate-induced activation of nitric oxide synthase is impaired in cerebral cortex in vivo in rats with chronic liver failure, J. Neurochem. 102 (1) (2007) 51–64. R. Rodrigo, S. Erceg, V. Felipo, Neurons exposed to ammonia reproduce the differential alteration in nitric oxide modulation of guanylate cyclase in the cerebellum and cortex of patients with liver cirrhosis, Neurobiol. Dis. 19 (1–2) (2005) 150–161. C.L. Boulton, E. Southam, J. Garthwaite, Nitric oxide-dependent long-term potentiation is blocked by a specific inhibitor of soluble guanylyl cyclase, Neuroscience 69 (3) (1995) 699–703. V. Natesan, R. Mani, R. Arumugam, Clinical aspects of urea cycle dysfunction and altered brain energy metabolism on modulation of glutamate receptors and transporters in acute and chronic hyperammonemia, Biomed. Pharmacother. 81 (2016) 192–202. V. Felipo, M. Llansola, C. Montoliu, A. Agusti, V. Hernandez-Rabaza, A. CabreraPastor, A. Orts, R. Garcia-Garcia, B. Gomez-Gimenez, Restoring the function of the glutamate-nitric oxide –cGMP pathway by treatments acting on different brain targets restores cognitive function in rats with minimal hepatic encephalopathy, New Horiz. Transl. Med. 2 (2) (2015) 63.