Use of a species-specific multiplex PCR for the identification of pediococci

International Journal of Food Microbiology 128 (2008) 288–296

Contents lists available at ScienceDirect

International Journal of Food Microbiology j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / i j f o o d m i c r o

Use of a species-specific multiplex PCR for the identification of pediococci Jens Pfannebecker a,⁎, Jürgen Fröhlich a,b,1 a b

Institute of Microbiology and Wine Research, Johannes Gutenberg-University of Mainz, Becherweg 15, D-55099 Mainz, Germany ERBSLÖH Geisenheim AG, Erbslöhstraβe 1, D-65366 Geisenheim, Germany

a r t i c l e

i n f o

Article history: Received 26 February 2008 Received in revised form 13 August 2008 Accepted 28 August 2008 Keywords: Pediococcus Species identification 23S rDNA Multiplex PCR

a b s t r a c t In this study, the 23S rRNA genes of nine different Pediococcus type strains were sequenced. By using a multiple sequence alignment with 23S rDNA sequences of related lactic acid bacteria two primer pairs were constructed, one for the general identification of the genus Pediococcus and one for the identification of the atypical species, P. dextrinicus. Furthermore, a primer set for a rapid multiplex PCR identification of the eight typical Pediococcus species was developed. With this technique, the species P. damnosus, P. parvulus, P. inopinatus, P. cellicola, P. pentosaceus, P. acidilactici, P. claussenii, and P. stilesii could be discriminated simultaneously in a single PCR. Experiments with inoculated grape musts showed that the detection limit was 10 cells ml− 1. The multiplex PCR assay was tested by the usage of 62 Pediococcus strains from different culture collections and 47 strains recently isolated from German wines and musts. In addition, contaminations with P. parvulus and P. damnosus could be detected after purification of DNA from spoilt wine samples. The method demonstrates a rapid and easy to handle tool for the species affiliation of pediococci in beverages and food samples. © 2008 Elsevier B.V. All rights reserved.

1. Introduction Pediococci are Gram-positive lactic acid bacteria (LAB). They are homofermentative as regards their glucose metabolism and grow under facultative aerobic to microaerophilic conditions. Most of the species can be found on plants and particularly occur during fermentation processes (Garvie, 1986). Currently ten species are recognized, comprising P. damnosus, P. parvulus, P. inopinatus, P. cellicola, P. ethanolidurans, P. claussenii, P. stilesii, P. acidilactici, P. pentosaceus and P. dextrinicus. On the basis of its 16S rDNA sequence, P. dextrinicus appears to be only distantly related to the genuine pediococci (Dobson et al., 2002). It has been proposed that this species should be reclassified in the genus Lactobacillus (Collins et al., 1991; Stiles and Holzapfel, 1997). The occurrence of Pediococcus species during the fermentation of grapes (Weiller and Radler, 1970; Back, 1978; Beneduce et al., 2004), and in spoilt beer (Back, 1978; Dobson et al., 2002), has often been reported. Particularly strains of the species P. parvulus, P. damnosus and P. inopinatus have been isolated from grape musts and wines (Peynaud and Domercq, 1967; Back, 1978; Weiller and Radler, 1970; Edwards and Jensen, 1992; Rodas et al., 2003; Beneduce et al., 2004). Although they can be involved in malolactic fermentation in wine, pediococci are mostly undesirable because of their formation of metabolic compounds such as diacetyl and acetoin (Wibowo et al.,

⁎ Corresponding author. Tel.: +49 6131 3923545; fax: +49 6131 3922695. E-mail addresses: [email protected] (J. Pfannebecker), [email protected] (J. Fröhlich). 1 Tel.: +49 6722 708 381; fax: +49 6722 708 175. 0168-1605/$ – see front matter © 2008 Elsevier B.V. All rights reserved. doi:10.1016/j.ijfoodmicro.2008.08.019

1985). Furthermore, the possibility of exopolysaccharide synthesis by some strains can cause ropiness, characterized by a viscous and thick texture of the beverage (Walling et al., 2005). Another detrimental influence on wine quality is the formation of biogenic amines such as histamine (Landete et al., 2005) as a result of amino acid decarboxylase activity of some strains (Bover-Cid and Holzapfel, 1999). P. acidilactici and P. pentosaceus are widely used as starter cultures in the fermentation processes of meat (Raccach, 1987; Luchansky et al., 1992; Kang and Fung, 1999), milk (Bhowmik and Marth, 1990; Back, 1999) and plant products (Gibbs, 1987). Besides the production of lactic acid, some strains of P. acidilactici produce antibacterial compounds like bacteriocins (Stiles, 1996; Albano et al., 2007). Even though pediococci can mostly be found on plants and plant products, they have already been isolated from animals (Juven et al., 1991; Kurzak et al., 1998; Simpson et al., 2002) and human sources (Barros et al., 2001; Walter et al., 2001). There are various molecular identification methods for Pediococcus species, such as sequence analyses of the 16S rDNA, the internal transcribed spacer (ITS) regions and the heat-shock protein 60 gene (Dobson et al., 2002). Fingerprinting methods like ribotyping (Satokari et al., 2000; Barney et al., 2001), restriction analysis of the amplified 16S rDNA (16S-ARDRA) (Rodas et al., 2003), randomly amplified polymorphic DNA (RAPD)-PCR (Nigatu et al., 1998; Mora et al., 2000; Simpson et al., 2002), and pulsed-field gel electrophoresis (PFGE) (Luchansky et al., 1992; Barros et al., 2001; Simpson et al., 2002) were useful for the discrimination of strains at the species and intra-species level. Up to date, no molecular method has been described that provides distinct PCR identification of all Pediococcus species and which is

J. Pfannebecker, J. Fröhlich / International Journal of Food Microbiology 128 (2008) 288–296

suitable for routine application in the food industry. In the present study we sequenced and analyzed the large subunit (LSU) rRNA gene sequences from nine Pediococcus type strains to construct genus- and species-specific PCR primers. The primers could be applied successfully in a multiplex PCR assay for a rapid and simultaneous identification. To validate the results of species affiliation based on 23S rDNA multiplex PCR, all Pediococcus strains examined in this study were tested with a high-resolution genotypic technique, the specifically amplified polymorphic DNA (SAPD)-PCR (Fröhlich and Pfannebecker, 2006). With both methods, strains of the nine examined Pediococcus species could be successfully identified and distinguished from each other.

289

2.3. DNA extraction For DNA isolation, cells were grown in modified MRS broth at 28 °C for several days depending on the strain. Cells were harvested by centrifugation for 5 min at 10,000 rpm in a centrifuge (Eppendorf, Hamburg, Germany), resuspended in 1 ml of washing buffer (50 mM Tris–HCl, pH 7.5) and centrifuged a second time. After incubation for at least 30 min at 37 °C in 180 μl enzymatic lysis buffer (0.02 M Tris–HCl, 0.002 M EDTA, 1.2% Triton-X 100, 20 mg ml− 1 lysozyme (Sigma, Munich, Germany), pH 8) DNA extractions were performed with the

2. Materials and methods

Table 1 List of all Pediococcus strains examined in this study and results of multiplex PCR identification

2.1. Strains and cultivation

Species and organism number

Multiplex PCR Species and organism idefntification number

P. damnosus DSM 20331T P. acidilactici DSM 20284T P. pentosaceus DSM 20336T P. dextrinicus DSM 20335T P. dextrinicus DSM 20293 P. dextrinicus DSM 20334 P. claussenii DSM 14800T P. parvulus DSM 20332T P. inopinatus DSM 20285T P. inopinatus DSM 20287 P. cellicola DSM 17757T P. stilesii DSM 18001T Pediococcus sp. DSM 1056 P. damnosus IMW Hock B2.1 P. damnosus IMW Hock B2.2 Pediococcus sp. IMW B7 Pediococcus sp. IMW B8 Pediococcus sp. IMW B9 P. damnosus IMW B12 P. damnosus IMW B13 P. damnosus IMW B14 P. damnosus IMW B15 P. damnosus IMW B16 P. damnosus IMW B42 P. pentosaceus IMW B44 P. damnosus IMW B47 P. damnosus IMW B55 P. damnosus IMW B68 P. damnosus IMW B69 P. damnosus IMW B78 P. damnosus IMW B89 P. damnosus IMW B91 P. damnosus IMW B93 Pediococcus sp. IMW B97 P. damnosus IMW B98 P. damnosus IMW B99 P. damnosus IMW B123 Pediococcus sp. IMW B125 P. damnosus IMW B140 P. damnosus IMW B141 P. inopinatus IMW B254 P. parvulus IMW B266 P. parvulus IMW B267 P. parvulus IMW B391 P. parvulus IMW B395 P. parvulus IMW B397 P. parvulus IMW B398 P. parvulus IMW B399 P. parvulus IMW B400 P. parvulus IMW B401 P. parvulus IMW B404 P. parvulus IMW B405 Pediococcus sp. IMW B427 Pediococcus sp. IMW B428 Pediococcus sp. IMW B440a

P. P. P. – – – P. P. P. P. P. P. P. P. P. P. P. P. P. P. P. P. P. P. P. P. P. P. P. P. P. P. P. P. P. P. P. P. P. P. P. P. P. P. P. P. P. P. P. P. P. P. P. P. P.

All Pediococcus type strains (Table 1) examined in this study were obtained from the Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSMZ, Brunswick, Germany). We regret that the recently described species Pediococcus ethanolidurans (AS 1.3889T = LMG 23354T) (Liu et al., 2006) was not available neither at the China General Microbiological Culture Collection Center (CGMCC, Beijing, China), nor at Belgian Co-ordinated Collections of Micro-Organisms (BCCM, Gent, Belgium) at the time of writing. Summarized, 54 Pediococcus strains of the culture collection of the Institute for Microbiology and Wine Research (IMW), University of Mainz, Germany, 5 strains of the École d'ingénieurs de Changins (EIC), Nyon, Switzerland, 3 strains from Lallemand (LAL), Toulouse, France and 47 recently isolated strains from German grape musts and wines were examined with the multiplex PCR method (Table 1). Other strains of related LAB belonging to the genera Lactobacillus, Enterococcus, Lactococcus, Streptococcus, Leuconostoc and Oenococcus were used to test the specificity of generated primers (Table 2). All strains were cultivated in MRS broth or on MRS agar containing 5% (v/v) tomato juice adjusted to pH 5.2 (De Man et al., 1960; modified). The cultivation was performed at 20 °C under microaerophilic conditions without shaking. 2.2. Isolation of pediococci from wine samples One hundred wine and must samples from the wine-growing regions Wonnegau, Nierstein, and Bingen (Rhine-Hesse, RhinelandPalatinate, Germany) were chosen for the isolation of new strains. Enrichment cultures were made by using MRS broth containing 5% (v/v) tomato juice adjusted to pH 5.2 (De Man et al., 1960; modified). The growth of yeasts and fungi was prevented by adding 100 mg l− 1 cycloheximide (Sigma, Munich, Germany). Respectively, 8 ml of modified MRS broth was inoculated with 2 ml of grape must or wine and incubated for 10 days at 28 °C. Samples of enrichment cultures were plated on MRS agar (pH 5.2), containing 13 g l− 1 agar (Hartge, Hamburg, Germany) supplemented with cycloheximide at a final concentration of 100 mg l− 1. After incubation for 7 days at 28 °C, colonies were differentiated by their morphology and examined microscopically. Pure cultures were obtained by selecting presumptive Pediococcus colonies on MRS agar (pH 5.2) and streaking them several times. Pediococci could be identified microscopically by their characteristic formation of tetrads. Strains were initially identified by classical microbiological methods: Gram-staining, catalase reaction, homo- or heterofermentative character (see e.g. Fugelsang and Edwards, 2007). Oxidase reaction was assessed with Bactident® Oxidase Test (Merck, Darmstadt, Germany). The production of D/L-lactic acid was determined using the Enzytec™ D/L-lactic acid kit (Scil Diagnostics, Viernheim, Germany). The API 50 CH biochemical system (BioMérieux, Nürtingen, Germany) was used for the determination of substrate fermentation.

damnosus acidilactici pentosaceus

claussenii parvulus inopinatus inopinatus cellicola stilesii acidilactici damnosus damnosus damnosus damnosus damnosus damnosus parvulus damnosus damnosus damnosus parvulus parvulus damnosus damnosus damnosus damnosus damnosus damnosus damnosus damnosus damnosus damnosus damnosus pentosaceus pentosaceus parvulus parvulus pentosaceus parvulus parvulus parvulus parvulus parvulus parvulus parvulus parvulus parvulus parvulus parvulus parvulus parvulus parvulus

Pediococcus sp. IMW B441a Pediococcus sp. IMW B442a Pediococcus sp. IMW B443a Pediococcus sp. IMW B444a Pediococcus sp. IMW B445a Pediococcus sp. IMW B446a Pediococcus sp. IMW B447a Pediococcus sp. IMW B448a Pediococcus sp. IMW B449a Pediococcus sp. IMW B450a Pediococcus sp. IMW B451a Pediococcus sp. IMW B452a Pediococcus sp. IMW B453a Pediococcus sp. IMW B454a Pediococcus sp. IMW B455a Pediococcus sp. IMW B456a Pediococcus sp. IMW B457a Pediococcus sp. IMW B458a Pediococcus sp. IMW B459a Pediococcus sp. IMW B460a Pediococcus sp. IMW B476a Pediococcus sp. IMW B477a Pediococcus sp. IMW B478a Pediococcus sp. IMW B479a Pediococcus sp. IMW B480a Pediococcus sp. IMW B481a Pediococcus sp. IMW B482a Pediococcus sp. IMW B483a Pediococcus sp. IMW B484a Pediococcus sp. IMW B485a Pediococcus sp. IMW B486a Pediococcus sp. IMW B487a Pediococcus sp. IMW B488a Pediococcus sp. IMW B489a Pediococcus sp. IMW B490a Pediococcus sp. IMW B491a Pediococcus sp. IMW B492a Pediococcus sp. IMW B493a Pediococcus sp. IMW B494a Pediococcus sp. IMW B495a Pediococcus sp. IMW B496a Pediococcus sp. IMW B497a Pediococcus sp. IMW B498a Pediococcus sp. IMW B499a Pediococcus sp. IMW B700a Pediococcus sp. IMW B701a Pediococcus sp. EIC 149 Pediococcus sp. EIC 152 Pediococcus sp. EIC 158 Pediococcus sp. EIC 184 Pediococcus sp. EIC 260 P. pentosaceus LAL IA38 P. acidilactici LAL R1001 P. pentosaceus LAL R1044

Multiplex PCR identification P. parvulus P. parvulus P. parvulus P. parvulus P. parvulus P. parvulus P. parvulus P. parvulus P. parvulus P. parvulus P. damnosus P. damnosus P. parvulus P. parvulus P. damnosus P. parvulus P. parvulus P. parvulus P. parvulus P. parvulus P. parvulus P. parvulus P. parvulus P. damnosus P. parvulus P. parvulus P. parvulus P. parvulus P. parvulus P. parvulus P. parvulus P. parvulus P. parvulus P. parvulus P. parvulus P. parvulus P. parvulus P. parvulus P. parvulus P. parvulus P. parvulus P. parvulus P. parvulus P. parvulus P. parvulus P. parvulus P. parvulus P. parvulus P. parvulus P. parvulus P. damnosus P. pentosaceus P. acidilactici P. pentosaceus

Culture collections: DSM, Deutsche Sammlung von Mikroorganismen und Zellkulturen, Brunswick, Germany; IMW, Institute of Microbiology and Wine Research, University of Mainz, Germany; EIC: École d'ingénieurs de Changins, Nyon, Switzerland; LAL: Lallemand, Toulouse, France. a Strains isolated for this study. Abbreviations: P., Pediococcus; T, type strain.

290

J. Pfannebecker, J. Fröhlich / International Journal of Food Microbiology 128 (2008) 288–296

Table 2 Results of 23S rDNA-based PCR identification of lactic acid bacteria examined in this study Species and organism number

Multiplex PCR PCR with identification primers Pedio23S_F/ Pedio23S_R

PCR with primers PDE23S_F/ PDE23S_R

P. damnosus DSM 20331T P. acidilactici DSM 20284T P. pentosaceus DSM 20336T P. claussenii DSM 14800T P. parvulus DSM 20332T P. inopinatus DSM 20285T P. inopinatus DSM 20287 P. cellicola DSM 17757T P. stilesii DSM 18001T P. dextrinicus DSM 20335T P. dextrinicus DSM 20293 P. dextrinicus DSM 20334 Lactobacillus brevis IMW B22 Lactobacillus brevis IMW B260 Lactobacillus buchneri IMW B31 Lactobacillus buchneri IMW B190 Lactobacillus casei IMW B48 Lactobacillus casei IMW B136 Lactobacillus casei IMW B178 Lactobacillus fermentum IMW B170 Lactobacillus fermentum IMW B191 Lactobacillus plantarum DSM 20205 Lactobacillus plantarum IMW B158 Lactobacillus hilgardii DSM 20176T Lactobacillus hilgardii IMW B271 Enterococcus durans IMW Enterococcus faecalis IMW B152 Enterococcus faecalis IMW B153 Enterococcus faecalis IMW B210 Enterococcus sp. IMW J.F. Lactococcus lactis IMW B238 Streptococcus mutans IMW B71 Leuconostoc citreum IMW B28 Leuconostoc mesenteroides subsp. cremoris DSM 20346T Leuconostoc mesenteroides subsp. mesenteroides DSM 20343T Leuconostoc mesenteroides subsp. dextranicum DSM 20484T Oenococcus oeni IMW B236 Oenococcus oeni IMW B325

+ + + + + + + + + − − − − − − − − − − − − − − − − − − − − − − − − −

+ + + + + + + + + − − − − − − − − − − − − − − − − − − − − − − − − −

− − − − − − − − − + + + − − − − − − − − − − − − − − − − − − − − − −

−

−

−

−

−

−

− −

− −

− −

Culture collections: DSM, Deutsche Sammlung von Mikroorganismen und Zellkulturen, Brunswick, Germany. IMW, Institute of Microbiology and Wine Research, University of Mainz, Germany. Abbreviations: +, amplification product; −, no amplification product.

DNeasy® Blood & Tissue Kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions. Purified DNA was washed from mini spin column with 150 μl elution buffer. For the determination of genomic DNA concentrations 5 μl DNA solution respectively was measured at 260 nm with Label Guard microliter cell (Implen, Munich, Germany) in a Biophotometer (Eppendorf, Hamburg, Germany). DNA concentrations varied from 10 to 160 ng μl− 1. For extraction of total DNA from fermenting musts and wines, a 10 ml to 100 ml sample was centrifuged (9000 rpm, 10 min) to collect biomass and washed twice with washing buffer. The cell pellet was resuspended in 180 μl enzymatic lysis buffer and incubated for 30 min at 37 °C. Subsequently, genomic DNA was purified as described for pure cultures with the difference that after resolving the DNA in elution buffer, it was precipitated with 2 volumes of ethanol and purified in a second mini spin column to improve purification. 2.4. 23S rDNA amplification and sequencing The 23S rRNA genes of all Pediococcus type strains were amplified using the primers P23S_F1 and P5S_R (Table 3), whereas the forward

primer binds at the 5′-end of the 23S rRNA gene and the reverse primer binds on a conserved region at the 3′-end of the 5S rRNA gene. The primers were generated by alignment of partial LSU and 5S rRNA gene sequences of Pediococcus species and related LAB species available in a public database (GenBank, NCBI). Amplification reactions were performed in 50 μl reaction mixtures containing 2 μl template DNA (20 ng μl− 1), 2 μl Taq DNA polymerase (1 U μl− 1) (Peqlab, Erlangen, Germany), 1 μl dNTP mix (10 mmol l− 1 each dNTP) (Peqlab, Erlangen, Germany), 1 μl of each primer (10 pmol μl− 1) (Operon, Cologne, Germany), 2 μl MgCl2 (25 mmol l− 1) (Peqlab, Erlangen, Germany), 5 μl 10× PCR buffer (containing 20 mmol l− 1 MgCl2), 5 μl 5× Enhancer Solution P (Peqlab, Erlangen, Germany), and 31 μl purified water (Roth, Karlsruhe, Germany). The amplification conditions were 5 min at 95 °C for initial denaturation followed by 35 cycles consisting of 1 min at 94 °C for denaturation, 1 min at 55 °C for annealing, followed by 3 min at 72 °C for elongation. The final extension at 72 °C was prolonged to 10 min. Reactions were carried out in a thermocycler (Mastercycler gradient, Eppendorf, Hamburg, Germany). The PCR products were purified using the QIAquick® PCR Purification Kit (Qiagen, Hilden, Germany), analyzed by agarose gel electrophoresis, and stained with ethidium bromide (cf. 2.10). Forward and reverse primers (Table 3) for multistep sequencing (500–800 bases per run) were generated within conserved regions found by sequence alignment of different lactic acid bacteria (species names with GenBank sequence accession numbers: P. pentosaceus CP000422, Lactobacillus sakei NC_007576, L. delbrueckii X68426, L. plantarum NC_004567, L. reuteri CP000705). Sequencing of both DNA strands was performed at Eurofins MWG (Martinsried, Germany).

Table 3 List of all primers used in this study Primer

Target

Sequence

Length GC [bp] [%]

Tm [°C]

Primers for 23S rDNA sequencing P23S_F1 Pediococci GTTAAGTTATAAAGGGCGCATG P23S_R1 GGGTGCTTTTCACCTTTCC P23S_F2 GGAAAGGTGAAAAGCACCC P23S_R2 CTAGTGAGCTATTACGCAC P23S_F3 GTGCGTAATAGCTCACTAG P23S_R3 CGAGTTCCTTAACGAGAG P23S_F4 CTCTCGTTAAGGAACTCG P23S_R4 CATTCTGAGGGAACCTTTG P23S_F5 CAAAGGTTCCCTCAGAATG P5S_R GCATGGCAACGTCCTAC

22 19 19 19 19 18 18 19 19 17

40.9 52.6 52.6 47.3 47.3 50.0 50.0 47.3 47.3 58.8

58.9 60.1 60.1 58.0 58.0 57.6 57.6 58.0 58.0 59.6

Primers for genus identification Pedio23S_F Typical GAACTCGTGTACGTTGAAAAGTGCTGA Pedio23S_R pediococci GCGTCCCTCCATTGTTCAAACAAG PDE23S_F P. dextrinicus CAAGGCGTAGTCGATGGCAAG PDE23S_R GGGCTTCAATTCGTACCTTTGGGT

27 24 21 24

44.4 50.0 57.1 50.0

64.6 64.5 64.5 64.5

Multiplex PCR primers PDA23S_F P. damnosus PST23S_F P. stilesii PPE23S_F P. pentosaceus PPA23S_F P. parvulus PCE23S_F P. cellicola PIN23S_F P. inopinatus PCL23S_F P. claussenii PAC23S_F P. acidilactici P23S_R Different LAB

GTTACCGCCACGTGAATACATAA GTTCTTGAAACCATGTGCCTACAAA CCAGGTTGAAGGTGCAGTAAAAT TTAGGGCTAGCCTCGGATTA AACAAGTCTGGTGGAGAGTG GAGGAGAGTATCCTAAGGTGT AGGTCAGCCGCAGTGAAG GTTTCGGAGGAGGCGCAA CTGTCTCGCAGTCAAGCTC

23 25 23 20 20 21 18 18 19

43.4 40.0 43.4 50.0 50.0 47.6 61.1 61.1 57.8

60.9 61.3 60.9 60.4 60.4 60.6 62.1 62.1 62.3

SAPD-PCR primers A-Not Different proC-Not and G-Not eukaryotic T-Not species

AGCGGCCGCA AGCGGCCGCC AGCGGCCGCG AGCGGCCGCT

10 10 10 10

80.0 90.0 90.0 80.0

47.6 51.8 51.8 47.6

Abbreviations: bp, base pairs; GC, GC-content; Tm, melting temperature; LAB, lactic acid bacteria.

J. Pfannebecker, J. Fröhlich / International Journal of Food Microbiology 128 (2008) 288–296

2.5. Phylogenetic analysis Multiple sequence alignments of the 23S rRNA gene sequences of the Pediococcus type strains and closely related lactic acid bacteria were created using Clustal X (Thompson et al., 1997) applying default parameters. The alignment was visualized and edited using GeneDoc (Nicholas and Nicholas, 1997). Phylogenetic trees were constructed by maximum likelihood, neighbor-joining and parsimony method using the Phylip software package, version 3.65 (Felsenstein, 1989). Alignment positions were included which are invariant among at least 50% of all representatives of lactic acid bacteria. Bootstrapping analysis was performed to test the statistical reliability of the topology of all created trees using 100 bootstrap resamplings of the data. The bootstrap values were computed by three different tree reconstruction methods: maximum likelihood, neighbor-joining, and parsimony. The cluster consisting of Staphylococcus aureus and S. carnosus was used as outgroup. Phylogenetic trees were visualized using TreeView (Page, 1996). 2.6. PCR for genus identification On the basis of the 23S rDNA sequence alignments computed by ClustalX (Thompson et al., 1997) and Genedoc (Nicholas and Nicholas, 1997) the primers Pedio23S_F and Pedio23S_R (Table 3) were constructed, as they fit all typical Pediococcus species. For the identification of the phylogenetic distinct species P. dextrinicus a second primer pair, PDE23S_F and PDE23S_R (Table 3) was designed. PCR was carried out in 25 μl reaction mixtures containing 2.5 μl 10× PCR buffer (containing 15 mmol l− 1 MgCl2) (Peqlab, Erlangen, Germany), 0.5 μl dNTP mix (10 mmol l− 1 each dNTP) (Peqlab, Erlangen, Germany), 0.5 μl of each primer (10 pmol μl− 1) (Operon, Cologne, Germany), 19 μl of purified water (Roth, Karlsruhe, Germany), 1 μl of Taq DNA polymerase (1 U μl− 1) (Peqlab, Erlangen, Germany) and 1 μl genomic DNA (20 ng μl− 1). Reactions were performed in a thermocycler (Mastercycler gradient, Eppendorf, Hamburg, Germany). The temperature profile consisted of an initial denaturation at 95 °C for 5 min, followed by 32 cycles of DNA denaturation at 94 °C for 0.5 min, primer annealing for 0.5 min at 69.5 °C and an elongation step at 72 °C for 0.5 min. The final extension step was carried out at 72 °C for 5 min. The estimated band lengths were 701 base pairs (bp) with primers Pedio23S_F and Pedio23S_R for the identification of the typical pediococci and 514 bp with primers PDE23S_F and PDE23S_R for the identification of P. dextrinicus. 2.7. Multiplex PCR assay For multiplex PCR identification of the typical pediococci, specific forward primers and one universal reverse primer were constructed (Table 3). Finally, primer sequences were submitted to a BLAST search on the NCBI website (http://www.ncbi.nlm.nih.gov/blast) to avoid consensus with other relevant LAB. Multiplex PCR was performed in a MJ Mini thermal cycler (BioRad, Munich, Germany) by using the Qiagen® Multiplex PCR Kit (Qiagen, Hilden, Germany). Primers used in multiplex PCR are listed in Table 3. Each 25 μl sample contained 12.5 μl multiplex PCR Mastermix (2×) with HotStar Taq DNA polymerase, 2.5 μl 10× primer mix (2 pmol μl− 1 each primer), 2.5 μl Q-solution (5×), 6.5 μl water and 1 μl of template DNA (20 ng μl− 1). Amplification conditions were one initial DNA denaturation for 15 min at 95 °C followed by 10 cycles consisting of denaturation for 0.5 min at 94 °C, annealing for 1 min, beginning at 69 °C with a decrement of 0.3 °C until 66.3 °C and elongation for 1 min at 72 °C. Then 22 cycles of denaturation for 0.5 min at 94 °C, annealing for 1 min at 66 °C, and extension for 1 min at 72 °C were performed followed by a final extension for 10 min at 72 °C. The estimated band lengths were as follows: P. damnosus: 2244 bp; P. stilesii: 1840 bp; P. pentosaceus: 1647 bp; P. parvulus: 1517 bp; P. cellicola: 866 bp; P. inopinatus: 711 bp; P. claussenii: 620 bp; P. acidilactici: 213 bp.

291

The primer mixture was tested first with the single type strain of every examined species to avoid primer cross reactions and finally with a mixture of each DNA. The amplified gene sequences of the multiplex PCR were successfully verified by sequencing using species-specific forward primers (cf. Table 3). Negative controls were included for each set of experiments to test the presence of DNA contamination in reagents and reaction mixtures. All pediococci presented in this study were checked for precise identification by the developed multiplex PCR assay (Table 1). Furthermore, strains of related LAB were checked with multiplex PCR assay to prevent incorrect positive results (Table 2). 2.8. Evaluation of the multiplex PCR detection limit The detection limit was evaluated by inoculating grape must samples (Müller-Thurgau) with cells of P. damnosus (DSM 20331T) and P. parvulus (DSM 20332T) type strains. Dilutions of the cultures were made starting at 108 cells ml− 1. Respectively, 1 ml of each dilution was used for DNA extraction as described above. Multiplex PCR assay was performed as described above with the difference that the number of PCR cycles was prolonged to 35 to increase product yield. 2.9. Specifically amplified polymorphic DNA (SAPD-) PCR analysis Four separate primers were used for SAPD-PCR, with every primer consisting of an adenine desoxyribonucleotide at 5′ end, followed by the NotI recognition sequence (5′-GCGGCCGC-3′), followed by a further desoxyribonucleotide (A, C, G or T) at 3′ end of the primer (Table 3). Amplification reactions were performed in 25 μl reaction mixtures containing 5 μl template DNA (50 ng μl− 1), 1 μl Taq DNA polymerase (1 U μl− 1) (Peqlab, Erlangen, Germany), 1 μl dNTP mix (10 mmol l− 1 each dNTP) (Peqlab, Erlangen, Germany), 1 μl of primer (50 pmol μl− 1) (Operon, Cologne, Germany), 2 μl of MgCl2 (25 mmol l− 1) (Peqlab, Erlangen, Germany), 2.5 μl of 10× reaction buffer (containing 20 mmol l− 1 MgCl2) (Peqlab, Erlangen, Germany) and 12.5 μl of water (Roth, Karlsruhe, Germany). The amplification conditions were 5 min at 95 °C for initial denaturation, followed by 35 cycles consisting of 1 min at 94 °C for denaturation, 1 min at 35 °C for annealing, followed by a prolonged ramp (15 temperature increments of 0.5 °C for 12 s, 1 min at 42.5 °C, 7 temperature increments of 1.5 °C for 12 s), followed by 5 min at 72 °C for elongation. The final elongation step was carried out at 72 °C for 10 min. SAPD-PCR amplifications were performed in a Mastercycler gradient thermocycler (Eppendorf, Hamburg, Germany). Firstly, the nine Pediococcus type strains were analyzed with every NotI-primer (Table 3) in SAPD-PCR. Moreover, multiple strains of every species were examined to test the ability for species discrimination of the fingerprinting method. Finally, the species affiliation of all Pediococcus strains examined with 23S rDNA-based multiplex PCR was tested with SAPD-PCR. 2.10. Gel electrophoresis For electrophoresis of amplification products 1.5% agarose gels containing 0.035% sodium silicate (Na2SiO3) (Roth, Karlsruhe, Germany) in 1 × TBE buffer were used. Sodium silicate was added to achieve a higher resolution for the separation of gel bands (Fröhlich and Pfannebecker, 2006). PCR products were separated in a horizontal electrophoresis system (BioRad, Munich, Germany) at 120 V. SAPD-PCR amplificates were separated under equal conditions but 60 V was used instead. The GeneRuler™ DNA Ladder Mix SM0331 (Fermentas, St. Leon-Rot, Germany) was used as molecular size marker. The agarose gels were stained with a 0.002 mg ml− 1 ethidium bromide solution (Roth, Karlsruhe, Germany) for 15 min and washed in dH2O for 10 min. Visualization of gel bands under UV light was carried out in a Bio Vision CN 3000 darkroom with the Vision Capt 14.1 software (Vilber Lourmat, Eberhardzell, Germany).

292

J. Pfannebecker, J. Fröhlich / International Journal of Food Microbiology 128 (2008) 288–296

2.11. Cluster analysis of SAPD-PCR patterns After electrophoresis, the SAPD-PCR patterns of the nine Pediococcus type strains (Fig. 3A–D) were analyzed using the Bio-1D software (Vilber Lourmat, Eberhardzell, Germany). The data sets resulting from analyzing the banding patterns generated with every SAPD-PCR primer (Table 3) were combined to a matrix of genetic distances. Cluster analysis based on the neighbor-joining algorithm (Saitou and Nei, 1987) was performed using the Phylip software package, version 3.65 (Felsenstein, 1989). P. dextrinicus was used as outgroup. The tree was visualized by the use of TreeView (Page, 1996). The species definition level within 22 of the examined P. parvulus strains (Fig. S1 A) was calculated by the ratio of identities to alignment positions. The reproducibility of SAPD-PCR banding patterns was determined by analyzing repeated (5×) SAPD-PCR runs of strain DSM 20331T with primer G-Not. 3. Results 3.1. Sequence accession numbers We determined the complete 23S rDNA sequences of all Pediococcus type strains from the DSMZ. The GenBank accession numbers are EF116573 for P. parvulus, EF116574 for P. damnosus, EF116575 for

P. acidilactici, EF116576 for P. inopinatus, EF116577 for P. pentosaceus, EF116578 for P. claussenii, EF116579 for P. dextrinicus, EF397603 for P. cellicola and EF397604 for P. stilesii. 3.2. Phylogeny of pediococci based on 23S rDNA sequences The phylogenetic analysis of the LSU rDNA ClustalX alignment was performed using the Phylip Package 3.65 (Felsenstein, 1989). The phylogenetic tree calculated by maximum likelihood included a dataset of 2644 alignment positions and is presented in Fig. 1. Similar phylogenetic trees were obtained using parsimony and neighbor-joining methods (data not shown). Bootstrap support for all phylogenetic trees was determined from 100 replications (Table 4). All trees were displayed and edited by TreeView (Page, 1996). The analysis of the phylogenetic tree showed that P. damnosus, P. inopinatus, P. parvulus and P. cellicola form one cluster. P. damnosus revealed the highest sequence similarities to P. inopinatus and the P. parvulus 23S rDNA sequence indicated high similarity to P. cellicola. The taxa P. acidilactici, P. stilesii, P. pentosaceus and P. claussenii occupied a distinct branch. Within this branch, P. stilesii is closely related to P. pentosaceus. As expected, the species P. dextrinicus formed its own cluster and phylogenetically differed most from all other pediococci (Fig. 1).

Fig. 1. Maximum likelihood tree of the Pediococcus type strains and related lactic acid bacteria LSU rRNA gene sequences. The phylogenetic tree was constructed by comparison of 2644 bp of the 23S rDNA using the Phylip Package (Felsenstein, 1989). Alignment positions were included which are invariant among at least 50% of all representatives of lactic acid bacteria. GenBank accession numbers of 23S rRNA gene sequences are given in parentheses. The length bar indicates 3% sequence divergence. Bootstrap values according to the numbers at the branches are presented in Table 4.

J. Pfannebecker, J. Fröhlich / International Journal of Food Microbiology 128 (2008) 288–296 Table 4 Bootstrap percentage values according to the numbers at the branches of the 23S rDNA phylogenetic tree (Fig. 1) No. of branch

Maximum likelihood

Neighbor-joining

Parsimony

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29

100 61 39 99 100 38 100 99 89 55 93 65 69 99 100 100 100 100 99 100 97 46 99 91 98 50 55 100 100

100 – – 100 100 – 100 100 100 – – – 79 100 100 100 100 100 100 100 – – 100 100 100 – – 100 100

100 – – 100 100 43 100 99 97 73 96 47 65 100 100 100 100 100 97 98 – – 93 94 95 58 72 100 100

3.3. 23S rDNA-based PCR for species identification of pediococci The 23S rDNA sequence alignment of the Pediococcus type strains showed that there are only few sequence differences between the closely related Pediococcus species. Although only few differences were observed, they were sufficient for the design of species-specific primers. Two primer pairs were developed: one for the identification of the typical Pediococcus species, and one for the identification of the atypical species, P. dextrinicus (Table 3). In addition, a primer set for the identification of the eight typical pediococci was designed for use in a multiplex PCR assay. The results of the species identification of the Pediococcus type strains by multiplex PCR are shown in Fig. 2. A BLAST search on the NCBI website with the 3′ reverse primer used in multiplex PCR showed that it is specific not only for the genus Pediococcus but matches with the 23S rRNA gene of other lactic acid bacteria too. Therefore, the specificity of all primers used in the multiplex PCR primer mix was checked by preparing reactions with different species of related lactic acid bacteria to prevent incorrect positive results. Summarized, 13 different species of the genera Enterococcus, Lactobacillus, Lactococcus, Leuconostoc, Oenococcus and Streptococcus were examined (Table 2). All tested strains of related LAB gave negative results in multiplex PCR. For the evaluation of the multiplex PCR detection limit grape musts were inoculated with cells of P. damnosus DSM 20331T and P. parvulus DSM 20332T and genomic DNA was purified. The experiments showed that the detection limit after 32 cycles of amplification was 102 cells ml− 1 for both examined species. By increasing the PCR cycles to 35, detection limits up to 10 cells ml− 1 could be reached. The multiplex PCR analysis of 62 strains belonging to different Pediococcus species showed that seven strains from our own culture collection (IMW) were formerly misidentified. These results were in congruence with species affiliation by comparing of SAPD-PCR banding patterns (cf. 3.4). Most of the misidentified strains were deposited for 30 years after biochemical testing. In addition, 12 Pediococcus strains from different culture collections whose species

293

affiliation was not previously examined were identified. One strain from the DSMZ (DSM 1056) which was stored as Pediococcus sp. could be identified as P. acidilactici (Table 1). The investigation of the occurrence of pediococci in the German viticultural regions Wonnegau, Nierstein and Bingen (Rhine-Hesse, Rhineland-Palatinate, Germany) resulted in the isolation and identification of 47 Pediococcus strains (Table 1) from 100 wine samples. In 71% of 42 wineries investigated, at least one Pediococcus strain could be isolated. The species identification with the developed 23S rDNAbased multiplex PCR assay showed that 43 strains belong to the species P. parvulus and four strains were identified as P. damnosus. In one wine sample, strains of both species namely P. parvulus (IMW B456) and P. damnosus (IMW B479) were isolated and could be identified. When extracting DNA from spoilt wine samples using the standard DNA purification protocol as described above, at first no PCR product could be obtained. Positive results were perceptible after the DNA was precipitated and purified a second time. With this procedure, the two species P. damnosus and P. parvulus could be detected directly in spoilt wine samples without the preparation of enrichment cultures and cultivation of strains. 3.4 SAPD-PCR for species discrimination of pediococci The results of SAPD-PCR analysis with all nine type strains examined are presented in Fig. 3 (A–D). All primers applied in SAPD-PCR showed a considerable degree of genomic diversity throughout the genus Pediococcus. A characteristic banding pattern of 65% identity was generated for every P. parvulus strain and could thus be used for species affiliation assessment. The SAPD-PCR fragments ranged from about 100 to 6.000 bp. Repeated SAPD reactions with strain DSM 20331T produced patterns with 97% similarity. In Fig. 3 (E), the result of SAPD-PCR with primer A-Not is shown as an example for species discrimination of selected Pediococcus strains belonging to different species. Typical banding patterns were produced for every different species examined with SAPD-PCR. A higher degree of heterogeneity was exclusively observed within different strains of the species P. acidilactici and P. dextrinicus, respectively. With SAPD-PCR, the species affiliation of every strain identified in multiplex PCR (Table 1) was clearly approved by comparison of banding patterns (Figs. 3 E and S1). Overall conformity of multiplex PCR versus SAPD-PCR results was found in 100% of the analyzed Pediococcus strains.

Fig. 2. Image of the PCR products obtained by the specific amplification of the eight typical species of the genus Pediococcus with the multiplex primers described in Table 3. Lane M: marker GeneRuler™ DNA Ladder SM0331 (Fermentas, St. Leon-Rot, Germany); Lanes 1 and 11: mixture of all eight typical Pediococcus type strains; Lane 2: negative control without template DNA, Lanes 3–10: P. damnosus DSM 20331T, P. stilesii DSM 18001T, P. pentosaceus DSM 20336T, P. parvulus DSM 20332T, P. cellicola DSM 17757T, P. inopinatus DSM 20285T, P. claussenii DSM 14800T, P. acidilactici DSM 20284T.

294

J. Pfannebecker, J. Fröhlich / International Journal of Food Microbiology 128 (2008) 288–296

Fig. 3. Results of species identification of pediococci by SAPD-PCR. The images A–D show the PCR products obtained by the amplification of Pediococcus type strains with primers ANot (image A), C-Not (image B), G-Not (image C) and T-Not (image D) as described in Table 3. Image E shows the PCR products obtained by the amplification of selected Pediococcus strains with primer A-Not. Lane M: marker GeneRuler™ DNA Ladder SM0331 (Fermentas, St. Leon-Rot, Germany); Lane 1: negative control without template DNA; Lanes 2–10: P. damnosus DSM 20331T, P. inopinatus DSM 20285T, P. parvulus DSM 20332T, P. cellicola DSM 17757T, P. claussenii DSM 14800T, P. stilesii DSM 18001T, P. acidilactici DSM 20284T, P. pentosaceus DSM 20336T, P. dextrinicus DSM 20335T. Lane 11: negative control without template DNA; Lanes 12–14: P. damnosus DSM 20331T, IMW Hock B2.1, IMW B7, Lanes 15–17: P. parvulus DSM 20332T, IMW B13, IMW B266; Lanes 18–20: P. acidilactici DSM 20284T, LAL R1001, DSM 1056; Lanes 21–23: P. pentosaceus DSM 20336T, IMW B123, LAL IA38; Lanes 24–25: P. inopinatus DSM 20285T, DSM 20287; Lanes 26–28: P. dextrinicus DSM 20335T, DSM 20293, DSM 20334; Lane 29: P. claussenii DSM 14800T; Lane 30: P. cellicola DSM 17757T; Lane 31: P. stilesii DSM 18001T.

J. Pfannebecker, J. Fröhlich / International Journal of Food Microbiology 128 (2008) 288–296

295

Fig. 4. Comparison of the cluster analysis and the phylogenetic LSU rDNA analysis of the nine Pediococcus type strains. Image A shows the cluster analysis based on results of SAPDPCR with primers A-Not, C-Not, G-Not and T-Not (Fig. 3 A–D) calculated by the neighbor-joining method. The bar indicated 10% differences in SAPD-PCR banding patterns. Image B shows the Pediococcus cluster of the LSU rDNA phylogenetic tree (Fig. 1). The length bar indicates 3% sequence divergence. The bootstrap values were computed by the maximum likelihood method.

The cluster analysis of the nine distinct profiles of Pediococcus type strains generated by SAPD-PCR (Fig. 4 A) showed a different tree topology in comparison to the 23S rDNA phylogenetic tree (Fig. 4 B). Only P. damnosus and P. inopinatus were closely related in both analyses. While these two species built an own cluster (C1a) in cluster analysis, they were assigned to P. parvulus and P. cellicola in the phylogenetic analysis (C1b). In cluster analysis, P. parvulus was affiliated to P. stilesii, P. pentosaceus, and P. claussenii (C2a). P. acidilactici built a cluster (C2b) together with the species P. stilesii, P. pentosaceus, and P. claussenii in the phylogenetic tree. Contrary, P. acidilactici was distantly related to these species by cluster analysis. 4. Discussion Species identification of pediococci from foods and beverages by conventional culture techniques is time-consuming and often unreliable. Since molecular methods are fast, reliable and cultureindependent, they are indispensable today. In this study we report the sequencing of the complete 23S rRNA genes of all Pediococcus type strains available in culture collections. New sequence data was provided for taxonomic discrimination, phylogenetic studies and revealed the potential for the construction of specific primers to support PCR approaches (cf. Fig. 2). Relationships between the Pediococcus species (Fig. 1) based on the complete 23S rRNA gene sequence alignments are partially incongruent with the 16S rDNA-based phylogeny known from previous studies (Zhang et al., 2005; Franz et al., 2006; Liu et al., 2006). The relationships within the P. damnosus, P. parvulus, P. inopinatus and P. cellicola cluster differ from those proposed by Zhang et al. (2005) and Liu et al. (2006). Other differences with regard to the P. acidilactici, P. pentosaceus, P. stilessii and P. claussenii cluster can be found in the 16S rRNA phylogenetic study by Franz et al. (2006). As a matter of fact this branch is not supported by high bootstrap values. In the present study, one primer pair was constructed for the detection of the typical Pediococcus species and for the atypical species P. dextrinicus, respectively. Furthermore, a 23S rDNA-based multiplex PCR assay for the simultaneous species identification of eight different pediococci was developed. The occurrence of different Pediococcus species in wine was reported (Davis et al., 1985a,b; Edwards and Jensen, 1992). By the identification of two different species in the same wine sample analyzed with multiplex PCR in this study, it was confirmed that different Pediococcus species can be found in the same habitat at the same time. Therefore, the developed multiplex PCR assay seems to be an excellent tool for the fast identification of multiple species occurring in foods and beverages. It was shown that the multiplex PCR results obtained for the species identification proved to work as readily on extracted DNA from pure cultures as on total DNA extracted from grape musts and wines. The

detection of 10 cells ml− 1 in an inoculated wine showed that 23S based multiplex PCR proved to be a very sensitive tool for the identification of pediococci in wine. In a previous study (Dobson et al., 2002), phylogenetic groupings were elucidated within the genus Pediococcus by the use of the partial 16S rRNA gene, the 16S-23S rRNA internally transcribed spacer region sequence and a part of the 60 kDa heat-shock protein gene. They found that speciation of many Pediococcus isolates was inaccurate. In our study, the examination of Pediococcus strains from our institute culture collection (IMW) with the developed 23S rDNA-based multiplex PCR assay confirmed that biochemical testing of strains can result in misidentified strains and therefore is not always suitable for clear species affiliation assessment. The distant relationship of P. dextrinicus to the other pediococci was reported by Dobson et al. (2002) and it was suggested earlier that this species should be reclassified (Collins et al., 1991; Stiles and Holzapfel, 1997). In regard to the LSU rDNA phylogenetic tree (Fig. 1) constructed in this study, the distant relationship of this species to other pediococci was confirmed. In addition, the species affiliation of all Pediococcus strains examined in this study was approved with SAPD-PCR, a DNAfingerprinting method developed to improve the discrimination power of randomly amplified polymorphic DNA (RAPD)-PCR in combination with high reproducibility and a primer set for general application to every organism (Fröhlich and Pfannebecker, 2006). Until now, the method has been successfully tested for use on other bacteria, yeasts, fungi, plants, mice and humans. By approving the results of multiplex PCR for species affiliation it was also shown that this method is suitable for the discrimination of strains at the intraspecies level with a high reproducibility of results. Heterogeneity of the banding patterns of different strains was relatively low within most of the Pediococcus species analyzed with SAPD-PCR (Figs. 3E and S1). Our study revealed a species definition level of 65% for P. parvulus strains. This value was similar to other fingerprint techniques like RAPD PCR (Simpson et al., 2002). Nevertheless, we observed that strains of P. acidilactici and P. dextrinicus showed a high heterogeneity in SAPD-PCR banding patterns. The fact that different strains of these species were found to be genetically heterogeneous has been well investigated with DNA-fingerprinting methods earlier (Mora et al., 2000; Simpson et al., 2002). It is conceivable that the high genetic variability between strains of one species does not reflect a single gene based phylogenetic analysis. This could explain the different tree topologies in cluster analyses and rDNA-based phylogenetic analyses (Mora et al., 2000; Simpson et al., 2002, Fig. 4). In conclusion, we have developed a novel multiplex PCR for the specific identification and differentiation of all pediococci available in culture collections at the time of writing. In contrast to requirements of other typing methods, e.g. API 50 CH (BioMérieux, Nürtingen, Germany) or DNA-fingerprinting methods, no pure cultures are required for

296

J. Pfannebecker, J. Fröhlich / International Journal of Food Microbiology 128 (2008) 288–296

accurate typing of Pediococcus species. With this method, two or more Pediococcus species can be identified when present in the same sample. Moreover, the comparison with conventional biotyping indicates that identification of Pediococcus species by PCR on the basis of the 23S rRNA as a stable chromosomal target gene is more reliable, less timeconsuming, and less laborious, and thus very cost-effective. In addition, this multiplex PCR may also allow a more systematic study of the occurrence of multiple Pediococcus species in foods and beverages. Acknowledgements We thank Dr. Sibylle Krieger-Weber from Lallemand, KorntalMünchingen, Germany and Serge Hautier from the École d'ingénieurs de Changins, Nyon, Switzerland for providing Pediococcus strains. We thank Susann Thaler and Melanie Larisika for critical reading of the manuscript. The project was funded by the Stiftung Rheinland-Pfalz für Innovation. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.ijfoodmicro.2008.08.019. References Albano, H., Todorov, S.D., Van Reenen, C.A., Hogg, T., Dicks, L.M.T., Teixeira, P., 2007. Characterization of two bacteriocins produced by Pediococcus acidilactici isolated from “Alheira“, a fermented sausage traditionally produced in Portugal. International Journal of Food Microbiology 116, 239–247. Back, W., 1978. Zur Taxonomie der Gattung Pediococcus: Phänotypische und genotypische Abgrenzung der bisher bekannten Arten sowie Beschreibung einer neuen bierschädlichen Art: Pediococcus inopinatus. Brauwissenschaft, 31, 237–250, 312–320, 336–343. Back, W., 1999. Farbatlas und Handbuch der Getränkebiologie, TeiI 2. Verlag Hans Carl, Nürnberg, Germany. Barney, M., Volgyi, A., Navarro, A., Ryder, D., 2001. Riboprinting and 16S rRNA sequencing for identification of brewery Pediococcus isolates. Applied and Environmental Microbiology 67, 553–560. Barros, R.R., Carvalho, M., Peralta, J.M., Facklam, R.R., Teixeira, L.M., 2001. Phenotypic and genotypic characterization of Pediococcus strains isolated from human clinical sources. Journal of Clinical Microbiology 39, 1241–1246. Beneduce, L., Spano, G., Vernile, A., Tarantino, D., Massa, S., 2004. Molecular characterization of lactic acid populations associated with wine spoilage. Journal of Basic Microbiology 44, 10–16. Bhowmik, T., Marth, E.H., 1990. Role of Micrococcus Pediococcus species in cheese ripening: a review. Journal of Dairy Science 73, 859–866. Bover-Cid, S., Holzapfel, W.H., 1999. Improved screening procedure for biogenic amine production by lactic acid bacteria. International Journal of Food Microbiology 53, 33–41. Collins, M.D., Rodrigues, U., Ash, C., Aguirre, M., Farrow, J.A.E., Martinez-Murcia, A., Phillips, B.A., Williams, A.M., Wallbanks, S., 1991. Phylogenetic analysis of the genus Lactobacillus and related lactic acid bacteria as determined by reverse transcriptase sequencing of 16S rRNA. FEMS Microbiology Letters 77, 5–12. De Man, J.C., Rogosa, M., Sharpe, M.E., 1960. A medium for the cultivation of lactobacilli. Journal of Applied Bacteriology 23, 130–135. Davis, C.R., Silveira, N.F.A., Fleet, G.H., 1985a. Occurrence and properties of bacteriophage of Leuconostoc oenos in Australian wines. Applied and Environmental Microbiology 50, 872–876. Davis, C.R., Wibowo, D., Eschenbruch, R., Lee, T.H., Fleet, G.H., 1985b. Practical implications of malolactic fermentation: a review. American Journal of Enology and Viticulture 36, 290–301. Dobson, C.M., Deneer, H., Lee, S., Hemmingsen, S., Glaze, S., Ziola, B., 2002. Phylogenetic analysis of the genus Pediococcus Pediococcus claussenii sp. nov., a novel lactic acid bacterium isolated from beer. International Journal of Systematic and Evolutionary Microbiology 52, 2003–2010. Edwards, C.G., Jensen, K.A., 1992. Occurrence and characterization of lactic acid bacteria from Washington State wines: Pediococcus spp. American Journal of Enology and Viticulture 43, 233–238. Felsenstein, J., 1989. PHYLIP — phylogeny interference package (Version 3.2). Cladistics 5, 164–166.

Franz, C.M.A.P., Vancanneyt, M., Vandemeulebroecke, K., De Wachter, M., Cleenwerck, I., Hoste, B., Schillinger, U., Holzapfel, W.H., Swings, J., 2006. Pediococcus stilesii sp. nov., isolated from maize grains. International Journal of Systematic and Evolutionary Microbiology 56, 329–333. Fröhlich, J., Pfannebecker, J., 2006. Spezies-unabhängiges Nachweisverfahren für biologisches Material. Patent application: DE 10 2006 022 569.4–41. Fugelsang, K.C., Edwards, C.G., 2007. Wine Microbiology, Practical Applications and Procedures, Second edition. Springer, New York. Garvie, E.I., 1986. Genus Pediococcus. In: Sneath, P.H.A., Mair, N.S., Sharpe, M.E., Holt, J.G. (Eds.), Bergey's Manual of Systematic Bacteriology, vol. 2. Williams & Wilkins, Baltimore, pp. 1075–1079. Gibbs, P.A., 1987. Novel uses for lactic acid fermentation in food preservation. Journal of Applied Bacteriology, Symposium Supplement 63, 515–585. Juven, B.J., Meinersmann, R.J., Stern, N.J., 1991. Antagonistic effects of lactobacilli and pediococci to control intestinal colonization by human entero-pathogens in live poultry. Journal of Applied Bacteriology 70, 95–103. Kang, D.H., Fung, D.Y.C., 1999. Reduction of Escherichia coli Pediococcus acidilactici. Letters in Applied Microbiology 29, 206–210. Kurzak, P., Ehrmann, M.A., Vogel, R.F., 1998. Diversity of lactic acid bacteria associated with ducks. Systematic and Applied Microbiology 21, 588–592. Landete, J.M., Ferrer, S., Pardo, I., 2005. Which lactic acid bacteria are responsible for histamine production in wine? Journal of Applied Microbiology 99, 580–586. Liu, L., Zhang, B., Tong, H., Dong, X., 2006. Pediococcus ethanolidurans-spirit-fermenting cellar. International Journal of Systematic and Evolutionary Microbiology 56, 2405–2408. Luchansky, J.B., Glass, K.A., Harsono, K.D., Degnan, A.J., Faith, N.G., Cauvin, B., Baccus-Taylor, G., Arihara, K., Bater, B., Maurer, A.J., Cassens, R.B., 1992. Genomic analysis of Pediococcus Listeria monocytogenes in turkey summer sausage. Applied and Environmental Microbiology 58, 3053–3059. Mora, D., Fortina, M.G., Parini, C., Daffonchio, D., Manachini, P.L., 2000. Genomic subpopulations within the species Pediococcus acidilactici-1 producing and nonproducing strains. Microbiology 146, 2027–2038. Nicholas, K.B., Nicholas, H.B., Jr., 1997. GeneDoc: a tool for editing and annotating multiple sequence alignments. Distributed by the author. Nigatu, A., Ahrne, S., Gashe, B.A., Molin, G., 1998. Randomly amplified polymorphic DNA (RAPD) for discrimination of Pediococcus pentosaceus Ped. acidilactici Pediococcus isolates. Letters in Applied Microbiology 26, 412–416. Page, R.D.M., 1996. Tree view: an application to display phylogenetic trees on personal computers. Computation and Applied Biosciences 12, 357–358. Peynaud, E., Domercq, S., 1967. Étude de quelques bacilles homolactiques isolés de vins. Archiv für Mikrobiologie 57, 255–270. Raccach, M., 1987. Pediococci and biotechnology. CRC Critical Reviews in Microbiology 14, 291–309. Rodas, A.M., Ferrer, S., Pardo, I., 2003. 16S-ARDRA, a tool for identification of lactic acid bacteria isolated from grape must and wine. Systematic and Applied Microbiology 26, 412–422. Saitou, N., Nei, M., 1987. The neighbour-joining method: a new method for reconstructing phylogenetic trees. Molecular Biology and Evolution 4, 406–425. Satokari, R., Mattila-Sandholm, T., Suihko, M.L., 2000. Identification of pediococci by ribotyping. Journal of Applied Microbiology 88, 260–265. Simpson, P.J., Stanton, C., Fitzgerald, G.F., Ross, R.P., 2002. Genomic diversity within the genus Pediococcus-field gel electrophoresis. Applied and Environmental Microbiology 68, 765–771. Stiles, M.E., 1996. Biopreservation by lactic acid bacteria. Antonie van Leeuwenhoek 70, 331–345. Stiles, M.E., Holzapfel, W.H., 1997. Lactic acid bacteria of foods and their current taxonomy. International Journal of Food Microbiology 36, 1–29. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research 24, 4876–4882. Walling, E., Gindreau, E., Lonvaud-Funel, A., 2005. A putative glucan synthase gene dpsproducing Pediococcus damnosus Oenococcus oeni strains isolated from wine and cider. International Journal of Food Microbiology 98, 53–62. Walter, J., Hertel, C., Tannock, G.W., Lis, C.M., Munro, K., Hammes, W.P., 2001. Detection of Lactobacillus Pediococcus Leuconostoc Weissella-specific PCR primers and denaturing gradient gel electrophoresis. Applied and Environmental Microbiology 67, 2578–2585. Weiller, H.G., Radler, F., 1970. Milchsäurebakterien aus Wein und von Rebenblättern. Zentralblatt für Bakteriologie, Parasitenkunde, Infektionskrankheiten und Hygiene, 2. Abteilung 124, 707–732. Wibowo, D., Eschenbruch, R., Davis, C.R., Fleet, G.H., Lee, T.H., 1985. Occurrence and growth of lactic acid bacteria in wine — a review. American Journal of Enology and Viticulture 36, 302–313. Zhang, B., Tong, H., Dong, X., 2005. Pediococcus cellicola-spirit-fermenting cellar. International Journal of Systematic and Evolutionary Microbiology 55, 2167–2170.