Generation of 2 iPSC clones from a patient with DNAJC12 deficiency: DHMCi003-A and DHMCi003-B

Stem Cell Research 36 (2019) 101402

Contents lists available at ScienceDirect

Stem Cell Research journal homepage: www.elsevier.com/locate/scr

Generation of 2 iPSC clones from a patient with DNAJC12 deficiency: DHMCi003-A and DHMCi003-B

T

Sabine Jung-Klawittera, , Selina Wächtera, Maike Hagedornb, Juliane Ebersoldb, Gudrun Göhringb, Thomas Opladena ⁎

a b

Department of General Pediatrics, Division of Neuropediatrics and Metabolic Medicine, University Hospital Heidelberg, Heidelberg, Germany Department of Human Genetics, Hannover Medical School (MHH), Hannover, Germany

ABSTRACT

Skin fibroblasts were isolated from a male patient with DNAJC12 deficiency and reprogrammed to iPSCs using the Cytotune®-iPS 2.0 Sendai Reprogramming Kit (Invitrogen). Two clones, DHMCi003-A and DHMCi003-B, were characterized for expression of pluripotency marker genes (Oct4, Nanog, Lin28, SSEA-4, TRA-1-60) and differentiated into all three germ layers using embryoid body (EB) formation. Karyotype of both clones was normal and presence of the homozygous mutation in the DNAJC12 gene was verified by PCR and Sanger sequencing. Both clones represent a useful tool to study the pathomechanisms underlying the deficiency.

Resource Table Unique stem cell lines identifier Alternative names of stem cell lines Institution Contact information of distributor Type of cell lines Origin Cell Source Clonality Method of reprogramming Multiline rationale Gene modification Type of modification Associated disease

⁎

Gene/locus

1. DHMCi003-A 2. DHMCi003-B 1. DNAJC12-1 iPS 6 (DHMCi003-A) 2. DNAJC12-1 iPS 10 (DHMCi003-B) Department of General Pediatrics, Division of Neuropediatrics and Metabolic Medicine, University Hospital Heidelberg, Heidelberg, Germany Sabine Jung-Klawitter; [email protected] iPSC human Skin fibroblasts clonal Sendai Virus (Cytotune®-iPS 2.0 Sendai Reprogramming Kit; Invitrogen) same disease, isogenic cell lines none N/A DNAJC12-deficiency

DNAJC12; Gene ID: 56521; OMIM: 606060; HGNC: 28908; NC_000010.11; c.[215G > C];[215G > C]/p.[Arg72Pro];[Arg72Pro] Method of modification N/A N/A Name of transgene or resistance Inducible/constitutive N/A system Date archived/stock December 2017 date N/A Cell line repository/ bank Ethical approval Institutional ethics committee approval obtained (No. 2016-02-04 ZB 52315) / Patient written informed consent obtained

1. Resource utility Both clones harbour a homozygous variation in the DNAJC12 gene causing hyperphenylalaninemia, progressive neurodevelopmental delay, dystonia, and a unique neurotransmitter profile in the affected patient. As no other model system is currently available, both clones

Corresponding author. E-mail address: [email protected] (S. Jung-Klawitter).

https://doi.org/10.1016/j.scr.2019.101402 Received 10 January 2019; Received in revised form 28 January 2019; Accepted 31 January 2019 Available online 08 March 2019 1873-5061/ © 2019 Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).

Stem Cell Research 36 (2019) 101402

S. Jung-Klawitter, et al.

Table 1 Summary of lines. iPSC line names

Abbreviation in figures

Gender

Age

Ethnicity

Genotype of locus

Disease

DNAJC12-1 iPS 6 (DHMCi003-A) DNAJC12-1 iPS 10 (DHMCi003-B)

3A 3B

male male

2 2

Turkish Turkish

c.[215G > C];[215G > C] c.[215G > C];[215G > C]

DNAJC12 deficiency DNAJC12 deficiency

counted, and seeded on 1 × 106 Mitomycin-treated murine embryonic fibroblasts (MEF; Merck-Millipore) at a density of 2 × 105, 1 × 105 or 1 × 104 cells/plate, respectively. Remaining cells served as positive control for SeV-specific RT-PCR. The following day, medium was changed to ESC medium (KnockOut DMEM, 20% Serum Replacement, 0.1 mM non-essential amino acids, 50 μM ß-mercaptoethanol, 1% penicillin/streptomycin (Invitrogen) and 4 ng/ml bFGF (Peprotech)). Cells were cultivated for 21–27 days with daily medium change. Colonies with iPS-like morphology were manually picked, transferred to Matrigel™-coated (Corning) 12well plates (Greiner) and further expanded in Essential 8™ Flex Medium (Invitrogen).

can serve as in vitro model to study the pathophysiology of the disease (Table 1). 1.1. Resource details Skin fibroblasts were obtained from a male patient carrying a homozygous variation in the DNAJC12 gene (Gene ID: 56521; c. [215G > C];[215G > C]/p.[Arg72Pro];[Arg72Pro](Anikster et al., 2017)). The cells were reprogrammed using the Cytotune®-iPS 2.0 Sendai Reprogramming Kit (Invitrogen) delivering Oct3/4, Sox2, c-Myc and Klf4. Five weeks after transduction, both clones were manually picked and expanded on Matrigel™ (Corning) coated plates (Greiner). Fluorescence R-banding provided a normal diploid karyotype (46, XY; Fig. 1A). PCR and subsequent Sanger Sequencing verified the presence of the homozygous variant identified in the patient (Fig. 1C). Absence of mycoplasma contamination was verified by using the PCR Mycoplasma Test Kit from AppliChem (Fig. 1H). RT-PCR with Sendai virus specific primers (Table 2) showed absence of Sendai virus vector (SeV; KOS, Myc; actin as loading control; ± Reverse Transcriptase; Fig. 1F) after passage 4. Expression of pluripotency marker genes (Oct3/4, Nanog, Lin28, SSEA-4, TRA-1-60) was analysed by RT-PCR (Fig. 1E; Table 2; Oct4, Sox2, Nanog,; actin as loading control; ± Reverse Transcriptase), immunofluorescence staining (Fig. 1D; Table 2), and FACS analysis (Fig. 1B; Table 2). FACS analysis revealed 95.6% SSEA4+ and 94.8% TRA-1-60+ cells for DHMCi003-A and 99.6% SSEA-4+ and 99.5% TRA-1-60+ cells for DHMCi003-B, respectively (Fig. 1B; Table 2). The ability to differentiate into cells of all three germ layers was confirmed for both clones by embryoid body (EB) formation and subsequent immunofluorescence staining. Both clones expressed endodermal (α-fetoprotein, AFP), mesodermal (smooth muscle actin, SMA), and ectodermal markers (ß3 tubulin; Fig. 1G/1I) upon spontaneous differentiation. Autosomal short tandem repeat (STR) analysis confirmed the identity of both clones as compared to the parental fibroblast line (Table 2).

2.2. RT-PCR analysis RNA was extracted with Trizol® (Invitrogen), digested with DNaseI (Invitrogen) and cDNA was synthesized using SuperScript®III Reverse Transcriptase (Invitrogen). Expression of endogenous pluripotency markers (Oct3/4, Sox2, Nanog) or absence of Sendai virus was shown by PCR with GoTaq® Green Mastermix (Promega) as previously described (Jung-Klawitter et al., 2017). 2.3. In vitro differentiation iPSCs were harvested with ReLeSR™, and 9 × 105 cells/well were transferred to an AggreWell 800™ plate (both StemCell Technologies) containing ESC medium (+10 μM Y-27632; Sigma; without bFGF) to form embryoid bodies (EBs). The next day, EBs were transferred to Ultra-low attachment plates (Greiner) and cultivated for 6 days in ESC medium (-bFGF). On day 8, EBs were dissociated and seeded onto gelatine coated plates containing differentiation medium (ESC medium -bFGF/MEF medium 50:50 (v/v)). On day 15, cells were fixed with 4% paraformaldehyde (PFA; Sigma) in PBS for immunofluorescence staining or lysed with Trizol®. 2.4. Immunofluorescence staining and FACS analysis

2. Materials and methods

Presence of pluripotency marker genes (Oct3/4, Nanog, Lin28, SSEA-4, TRA-1-60) or germ layer markers (AFP, ß3 tubulin, SMA) was shown by immunofluorescence staining as previously described (JungKlawitter et al., 2017; Jung-Klawitter et al., 2016)(Table 3). For FACS analysis cells were singled using ReLeSR™, washed with 2 volumes of DPBS (Invitrogen) and fixed for 20 min at room temperature in 4%PFA/

2.1. iPSC reprogramming Fibroblasts were reprogrammed in passage 8 using Cytotune®-iPS 2.0 Sendai Reprogramming Kit (Invitrogen) following the manufacturer's instructions. On day 7, transduced fibroblasts were trypsinized,

2

Stem Cell Research 36 (2019) 101402

S. Jung-Klawitter, et al.

(caption on next page) 3

Stem Cell Research 36 (2019) 101402

S. Jung-Klawitter, et al.

Fig. 1. DHMCi003-A and DHMCi003-B display a normal diploid karyotype (46, XY; A) and are positive for TRA-1-60 and SSEA-4 as shown by FACS analysis (B). Presence of the disease-causing variant was verified by Sanger sequencing (C). Expression of the pluripotency markers OCT4, NANOG, LIN-28 and SSEA-4 was shown by immunofluorescence staining (D) and RT-PCR analysis (E). Sendai virus was not detectable in untransduced fibroblasts (d0) or in both iPSC clones (3A, 3B) but in fibroblasts seven days after transduction (d7; F). Both iPSC clones can be differentiated into all three germ layers as shown by immunofluorescence staining (G) and RT-PCR (I). Absence of mycoplasma contamination was verified by PCR (H). Abbreviations: +: cDNA synthesis with reverse transcriptase; -: cDNA synthesis without reverse transcriptase; co: positive control to show functionality of mycoplasma PCR; d0: undifferentiated iPSCs; d15: differentiated iPSCs on day 15 of differentiation; d7: patient-specific fibroblasts on d7 after transduction with Sendai virus. Scale bars represent 100 µm. Table 2 Characterization and validation. Classification

Test

Result

Data

Morphology Phenotype

Photography Qualitative analysis (Immunocytochemistry) PCR Quantitative analysis

Normal OCT4, SOX2, NANOG, SSEA-4, LIN28

Fig. Fig. Fig. Fig.

Genotype Identity Mutation analysis

Karyotype (Fluorescence R-banding) and resolution STR analysis

DHMCi003-A: SSEA-4 98,6%, TRA-1-60 94,8% DHMCi003-B: SSEA-4100%, TRA-1-60 99,6% DHMCi003-A: 46XY; DHMCi003-B: 46XY; Resolution min 300 bands 21 sites tested, all matched with parental fibroblasts

Differentiation potential

Sequencing Southern Blot or WGS Mycoplasma Sendai Virus Embryoid body formation

Donor screening

HIV 1, Hepatitis B, Hepatitis C

Patient-specific mutation present, homozygous N/A Mycoplasma testing by PCR; Negative Negative at p4 Spontaneous in vitro differentiation: endoderm (AFP), mesoderm (SMA), and ectoderm (ß3 tubulin) Negative

Genotype additional info

Blood group genotyping HLA tissue typing

N/A N/A

Microbiology and virology

DPBS. Cells were washed twice with 1xBD Perm/Wash buffer (BD Biosciences) and stained for 30 min on ice in the dark (Table 3). Afterwards, cells were washed twice in BD stain buffer (BD Biosciences) and analysed using a FACS Canto II flow cytometer and FlowJo software version 10.5.3.

1 1 1 1

panel panel panel panel

A D E B

Fig. 1 panel A submitted in archive with journal Fig. 1 panel C Fig. 1 panel H Fig. 1 panel F Fig. 1 panel G (PCR); Fig. 1 panel I (IF) not shown but available with author N/A N/A

2.6. STR analysis STR analysis was performed by GATC/MWG Eurofins at 21 different loci (D3S1358, D1S1656, D6S1043, D13S317, Penta E, D16S539, D18S51, D2S1338, CSF1PO, Penta D, TH01, vWA, D21S11, D7S820, D5S818, TPOX, D8S1179, D12S391, D19S433, FGA, amelogenin (Promega, PowerPlex 21 PCR Kit)).

2.5. Karyotyping Metaphases were prepared according to standard procedures and fluorescence R-banding using chromomycin A3 and methyl green was performed. At least 20 metaphase spreads were analysed at a minimum level of 300 bands. Chromosomes were classified according to the International System for Human Cytogenetic Nomenclature (ISCN 2016)(Schlegelberger et al., 1999).

2.7. Genotyping and mycoplasma detection Presence of the homozygous variation in the DNAJC12 gene was shown with specific primers (Table 2) and standard PCR conditions followed by Sanger Sequencing. Mycoplasma contamination was excluded using a PCR Mycoplasma Test Kit (AppliChem).

4

Stem Cell Research 36 (2019) 101402

S. Jung-Klawitter, et al.

Table 3 Reagents details. Antibodies used for immunocytochemistry/flow cytometry

Pluripotency Markers

Differentiation markers Secondary antibodies FACS Antibodies

Antibody

Dilution

Company Cat # and RRID

Mouse anti-Oct4 Mouse anti-Sox2 Mouse anti-Nanog Mouse anti-SSEA-4 Rabbit anti-Lin28 Mouse anti-AFP Rabbit anti-SMA Mouse anti-β3 Tubulin Goat anti-Mouse IgG / IgA / IgM (H + L) Secondary Antibody, Alexa Fluor 488 Goat anti-Rabbit IgG (H + L) Secondary Antibody, TRITC PerCP-Cy5.5 Mouse anti SSEA-4 BD Horizon BV510 Mouse anti human TRA-1-60 Antigen PerCP-Cy™5.5 Mouse IgG3, κ Isotype Control BV510 Mouse IgG1, k Isotype Control

1:100

Santa Cruz Biotechnologie; Cat# sc-5279; RRID: AB_628051 Merck Millipore; Cat# MAB4343; RRID: AB_827493 Thermo Fisher Scientific; Cat# MA1–017; RRID: AB_2536677 Santa Cruz Biotechnologie; Cat# sc-21,704; RRID: AB_628289 Santa Cruz Biotechnologie; Cat# sc-67,266; RRID: AB_2137119 Abcam; Cat# ab3980; RRID: AB_304203 Abcam; Cat# ab5694; RRID: AB_2223021 Abcam: Cat# ab78078; RRID: AB_2256751 Thermo Fisher Scientific; Cat# A10667; RRID: AB_2534057 Thermo Fisher Scientific; Cat# A16101; RRID: AB_2534775

1:100 1:500 1:200

BD BD BD BD

Biosciences; Biosciences; Biosciences; Biosciences;

Cat# 561565; RRID: AB_ 10,894,210 Cat# 563188; RRID: AB_2637036 Cat#561572; RRID: AB_10715580 Cat#562946; RRID: not registered

Primers Target

Forward/Reverse primer (5′-3′)

Sendai Virus

SeV Klf4, Oct4, Sox2 (KOS) c-myc

Pluripotency Markers

Oct4 Sox2 Nanog Lin28

Differentiation Markers

Nestin AFP TBX20 MLC2A

House-Keeping Genes

ß actin

Genotyping

DNAJC12

GGATCACTAGGTGATATCGAGC ACCAGACAAGAGTTTAAGAGATATGTATC ATG CAC CGC TAC GAC GTG AGC GC ACC TTG ACA ATC CTG ATG TGG TAACTGACTAGCAGGCTTGTCG TCCACATACAGTCCTGGATGATGATG GAACCAGTATCGAGAACCG TCAGTTTGAATGCATGGGAG CACATGTCCCAGCACTACCAG CACATGTGTGAGAGGGGCAG AAACAGAAGACCAGAACTGTG CAGTTGTTTTTCTGCCACCTCT CCATATGGTAGCCTCATGTC CAATTCTGTGCCTCCGGG CAGCGTTGGAACAGAGGTTGG TGGCACAGGTGTCTCAAGGGTAG ACTCCAGTAAACCCTGGTGTTG GAAATCTGCAATGACAGCCTCA AGGTACCGCTACGCCTAC GTCAGTGAGCCTGGAGGA GAGGAGAATGGCCAGCAGGAA GAGGAGAATGGCCAGCAGGAA CATGGAGAAAATCTGGCACCAC GCACAGCTTCTCCTTAATGTCAC CCATGATCTTGCTTGTCC GTAGTCACAGGCTCTTCTG

Acknowledgements

Meissner, T., Mayatepek, E., Trefz, F.K., Marek-Yagel, D., Martinez, A., Huttlin, E.L., Paulo, J.A., Berutti, R., Benoist, J.F., Imbard, A., Dorboz, I., Heimer, G., Landau, Y., Ziv-Strasser, L., Malicdan, M.C., Gemperle-Britschgi, C., Cremer, K., Engels, H., Meili, D., Keller, I., Bruggmann, R., Strom, T.M., Meitinger, T., Mullikin, J.C., Schwartz, G., Ben-Zeev, B., Gahl, W.A., Harper, J.W., Blau, N., Hoffmann, G.F., Prokisch, H., Opladen, T., Schiff, M., 2017. Biallelic mutations in DNAJC12 cause hyperphenylalaninemia, dystonia, and intellectual disability. Am. J. Hum. Genet. 100 (2), 257–266. Jung-Klawitter, S., Blau, N., Sebe, A., Ebersold, J., Göhring, G., Opladen, T., 2016. Generation of an iPSC line from a patient with tyrosine hydroxylase deficiency. Stem Cell Res. 17 (3), 580–583. Jung-Klawitter, S., Ebersold, J., Göhring, G., Blau, N., Opladen, T., 2017. Generation of an iPSC line from a patient with GTP cyclohydrolase 1 (GCH1) deficiency: HDMC0061iGCH1. Stem Cell Res. 20, 38–47. Schlegelberger, B., Metzke, S., Harder, S., Zühlke-Jenisch, R., Zhang, Y., Siebert, R., 1999. Diagnostic cytogenetics. Springer.

This work was supported by the Deutsche Forschungsgemeinschaft (DFG, German Research Foundation) for the Cluster of Excellence REBIRTH (From Regenerative Biology to Reconstructive Therapy; EXC 62/3 to G.G.) and by the Dietmar Hopp Stiftung, St. Leon-Rot, Germany (to T.O). We acknowledge the financial support of the Deutsche Forschungsgemeinschaft (DFG, German Research Foundation) and Ruprecht Karls University Heidelberg within the funding programme Open Access Publishing. References Anikster, Y., Haack, T.B., Vilboux, T., Pode-Shakked, B., Thöny, B., Shen, N., Guarani, V.,

5