- Email: [email protected]
Generation of an integration-free iPSC line(SYSUi001-A) from a sporadic Alzheimer's disease patient
Stem Cell Research 35 (2019) 101375
Contents lists available at ScienceDirect
Stem Cell Research journal homepage: www.elsevier.com/locate/scr
Lab resource: Stem Cell Line
Generation of an integration-free iPSC line(SYSUi001-A) from a sporadic Alzheimer's disease patient
T
Rui Weia,1, Hongying Hane,1, Mingxin Yea,1, Lu Hea, Qingfeng Leia, Tiancheng Zhoud, ⁎ Xiujuan Caid, Zhong Lia,b,c, a
Department of Neurology, The Sixth Affiliated Hospital of Sun Yat-Sen University, 26 Yuancun Erheng Rd, Guangzhou 510655, PR China Guangdong Province Key Laboratory of Brain Function and Disease, Zhongshan School of Medicine, Sun Yat-sen University, 74 Zhongshan 2nd Road, Guangzhou 510080, PR China c Shenzhen Research Institute of Sun Yat-Sen University, Southern District of Nanshan Science Park, Shenzhen 518019, PR China d Guangdong Provincial Key Laboratory of Stem Cell and Regenerative Medicine, South China Institute for Stem Cell Biology and Regenerative Medicine, Guangzhou Institutes of Biomedicine and Health, Chinese Academy of Sciences, Guangzhou, PR China e Department of Psychiatry, The Third Affiliated Hospital of Sun Yat-Sen University, 600 Tianhe Rd, Guangzhou 510630, PR China b
ABSTRACT
Human iPSC line, iPSC-ADM01(SYSUi001-A), was generated from a 70-year-old male patient with sporadic Alzheimer's disease, using non-integrative reprogramming method. This cell line shows pluripotency both in vitro and in vivo, and has a normal karyotype.
Resource table Unique stem cell line identifier SYSUi001-A Alternative name(s) of stem cell line iPSC-ADM01 Institution The sixth affiliated hospital of Sun Yat-sen university Contact information of distributor Address: 26 Yuancun Erheng Road, Tianhe District, Guangzhou Tel: 020-38254072 Type of cell line iPSC Origin human Additional origin info Age:70 Sex: Male Ethnicity if known: Chinese Cell Source Urinary epithelial cell Clonality Clonal Method of reprogramming Transgene free Genetic Modification NO Type of Modification N/A Associated disease Alzheimer's disease Gene/locus N/A Method of modification N/A Name of transgene or resistance N/A Inducible/constitutive system N/A Date archived/stock date N/A Cell line repository/bank N/A
Ethical approval
The AD patient has signed informed consent for donating human UCs for stem cell generation. The experiments involving human subject and animal research had been reviewed and approved by IRB at GIBH (NO. 2010012).
Resource utility The SYSUi001-A bears the specific genetic background of Alzheimer's disease (AD) patient, which will be useful in investigating mechanisms of such disease. The integration-free reprogramming method also makes it a potential resource for cell-based therapy in the future. Resource details Alzheimer's disease is the most common cause of age-related dementia, characterized by a deterioration of memory and other cognitive domains that leads to death within 3 to 9 years after diagnosis (Querfurth and LaFerla, 2010). Reprogramming iPSC lines from AD patients allows us obtaining cell models with patient-specific genetic background, which facilitates future studies on Alzheimer's disease. In this study, the SYSUi001-A was generated from a 70-year-old
Corresponding author at: Neurology Department, The Sixth Affiliated Hospital of Sun Yat-Sen University, 26 Yuancun Erheng Road, Guangzhou 510655, PR China. E-mail address: [email protected] (Z. Li). 1 Co-first author. ⁎
https://doi.org/10.1016/j.scr.2018.101375 Received 12 August 2018; Received in revised form 11 December 2018; Accepted 17 December 2018 Available online 18 December 2018 1873-5061/ © 2018 Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Stem Cell Research 35 (2019) 101375
R. Wei et al.
Fig. 1. Characterization of human iPSC line SYSUi001-A.
sporadic AD patient with typical clinical manifestations. Urinary cells were reprogrammed to iPSC by transfecting 4 transcript factors (OCT4, SOX2, KLF4 and SV40LT) carried on an episomal plasmid. After reprogramming,the SYSUi001-A shows typical embryonic stem cell-like morphology (Fig.1A), expresses stem cell markers such as OCT4, SSEA4, TRA1–60 and TRA1–81 (Fig. 1B). Furthermore, these iPSCs are integration-free (Fig. 1D) and maintains a normal karyotype (Fig. 1E). RT-qPCR analysis also showed the pluripotency genes (OCT4, SOX2, and NANOG) expression levels were comparable to hESC line (Fig. 1B). Teratoma assay confirmed the pluripotency of the SYSUi001-A in vivo, by detection of the presence of three germ-layer structures (Fig. 1E). STR analysis showed that the SYSUi001-A have the same DNA profile as the patient's primary urinary cells (UC-ADM01), indicating that they are of the same origin (data archived).
pCEP4-E02S-ET2K (Addgene#20927), containing 4 transcript factors (OCT4, SOX2, KLF4 and SV40LT), together with another episomal vector pCEP4-hsa-miR-302-367, expressing human miR-302-367 cluster. For transfection, we used the LONZA electroporation system (LONZA Nucleofector™ 2b Device, Cat# AAB-1001; LONZA Primary Cell Nucleofector™ Kit, Cat# VVPI-1005), and for every 1 million urinary cells, 6 μg of pCEP4-E02S-ET2K and 4 μg of pCEP4-has-miR-302367 were used for reprogramming. After transfection, cells were seeded into a Matrigel (BD, Cat# 354277)-coated well with epithelial growth medium (LONZA, Cat# CC3190). Then we changed to defined medium mTeSR1 (Stem Cell, #85850) on the next day or after the cells well attached. Medium was changed every other day. Embryonic stem cell-like clones appeared at day 20, then these clones were picked out for further proliferation and purification.
Materials and methods
mRNA isolation and quantitative real-time PCR
Reprogramming of IPSC from urinary cells
Total mRNA was isolated using TRIzol reagent (Invitrogen, Cat# 15596026) according to the manufacturer's protocol. Then 1 μg mRNA were subjected to cDNA synthesis using Reverse Transcription Kit (Takara, Cat# RR036A). The expression of pluripotent stem cell
Urinary cells were collected from AD patient using previously published method (Zhou et al., 2012). When reprogramming, we transfected two episomal plasmids into patient's urinary epithelial cells: 2
Stem Cell Research 35 (2019) 101375
R. Wei et al.
Table 1 Characterization and validation. Classification
Test
Result
Data
Morphology Phenotype
Photography Immunocytochemistry RT-qPCR
Fig. 1 panel A Fig. 1 panel D Fig. 1 panel B
Genotype Identity
Karyotype (G-banding) and resolution STR analysis
Normal Expression of pluripotency markers: OCT4, SSEA4, TRA1–60, TRA1–81 The expression of OCT4, SOX2, and NANOG are respectively 1.79, 1.81, and 1.69 folds higher compared to H1. 46 XY, Resolution 450–500 20 STR loci tested, all matched
Mutation analysis (IF APPLICABLE)
Sequencing Southern Blot OR WGS Mycoplasma Teratoma formation HIV 1 + 2 Hepatitis B, Hepatitis C Blood group genotyping HLA tissue typing
N/A N/A Negative Three germ layers formation N/A N/A N/A
Microbiology and virology Differentiation potential Donor screening (OPTIONAL) Genotype additional info (OPTIONAL)
Fig. 1 panel C Achieved with journal N/A N/A N/A Fig. 1 panel E N/A N/A N/A
Table 2 Reagents details. Antibodies used for immunocytochemistry/flow-citometry
Pluripotency Markers
Secondary antibodies
Antibody
Dilution
Company Cat # and RRID
Goat anti-human Oct-3/4 Antibody (N-20) Mouse anti-human SSEA4 Mouse Anti-Human TRA-1-60 Monoclonal Antibody Mouse Anti-Human TRA-1-81 Monoclonal Antibody Rabbit Anti-Mouse IgG Antibody, Alexa Fluor 488 Conjugated Rabbit Anti-Goat IgG Antibody, Alexa Fluor 488 Conjugated
1: 200 1:200 1: 200 1: 200 1:500 1:500
Santa Cruz Biotechnology Cat# sc-8630, RRID: AB_677312 Stemgent, Cat# 09–0006, RRID: AB_1512169 Abcam Cat# ab16288, RRID: AB_778563 Abcam Cat# ab16289, RRID: AB_2165986 Thermo Fisher Scientific, Cat# A11059; RRID: AB_142495 Thermo Fisher Scientific Cat# A21222, RRID: AB_10373853
Primers Target Episomal Plasmids (PCR)
Pluripotency Markers (qPCR) House-Keeping Gene (qPCR)
Exogenous Exogenous Exogenous Exogenous OCT4 SOX2 NANOG GAPDH
Forward/Reverse primer (5′-3′) OCT4 SOX2 KLF4 SV40LT
AGTGAGAGGCAACCTGGAGA/AGGAACTGCTTCCTTCACGA ACCAGCTCGCAGACCTACAT/CCCCCTGAACCTGAAACATA CCCACACAGGTGAGAAACCT/CCCCCTGAACCTGAAACATA TGGGGAGAAGAACATGGAAG/AGGAACTGCTTCCTTCACGA GACGCCATCAACACCGAGTT/CTTTGTCGTTGGTTAGCTGGT CCCAGCAGACTTCACATGT/CCTCCCATTTCCCTCGTTTT TTTGTGGGCCTGAAGAAAACT/AGGGCTGTCCTGAATAAGCAG GTGGACCTGACCTGCCGTCT/GGAGGAGTGGGTGTCGCTGT
markers (OCT4, SOX2, NANOG) and endogenous control gene (GAPDH) were amplified using primers listed in Table 1. hESC line H1 was used as positive control.
Teratoma assay Teratoma assay was performed for confirmation of pluripotency in vivo. About 3 × 106 iPSCs were suspended in 50% Matrigel with PBS, then injected subcutaneously into NOD-SCID mice. After 1 month, teratomas were harvested and processed for haematoxylin and eosin staining.
Fluorescent immunocytochemistry For immunofluorescence assay, the SYSUi001-A clones were subseeded on Matrigel-coated coverslips. They were fixed with 4% paraformaldehyde for 20 min at room temperature, permeabilized with Triton-100, incubated with primary antibodies at 4 °C overnight, and secondary antibodies at room temperature for 1 h. Then the coverslips were gently mounted on microscope slides using antifade reagent with DAPI (ThermoFisher, Cat# P36931). Images were captured under fluorescence microscope (Zeiss, Axioskop 2 Plus). Antibodies used are listed in Table 2.
Acknowledgment This study was funded by grant 2015A030313128 from the Natural Science Foundation of Guangdong Province, China,grant JCYJ20150403151851068 from the Science and Technology Project of Shenzhen City, China and grant 201404KW028 from the Key Science and Technology Project of Guangzhou Tianhe District, China.
Karyotyping
References
The SYSUi001-A clones at 60–80% confluency were treated with 0.2 μg/ml colchicine for 130 min, then dissociated and fixed in 25% acetic acid and 75% methanol. Karyotyping was performed on Gbanded mitotic metaphase chromosomes. At least 20 metaphases were analysed with a band resolution of 400–450.
Querfurth, H.W., LaFerla, F.M., 2010. Alzheimer's disease. N. Engl. J. Med. 362, 329–344. Zhou, T., et al., 2012. Generation of human induced pluripotent stem cells from urine samples. Nat. Protoc. 7 (12), 2080–2089.
3
Contents lists available at ScienceDirect
Stem Cell Research journal homepage: www.elsevier.com/locate/scr
Lab resource: Stem Cell Line
Generation of an integration-free iPSC line(SYSUi001-A) from a sporadic Alzheimer's disease patient
T
Rui Weia,1, Hongying Hane,1, Mingxin Yea,1, Lu Hea, Qingfeng Leia, Tiancheng Zhoud, ⁎ Xiujuan Caid, Zhong Lia,b,c, a
Department of Neurology, The Sixth Affiliated Hospital of Sun Yat-Sen University, 26 Yuancun Erheng Rd, Guangzhou 510655, PR China Guangdong Province Key Laboratory of Brain Function and Disease, Zhongshan School of Medicine, Sun Yat-sen University, 74 Zhongshan 2nd Road, Guangzhou 510080, PR China c Shenzhen Research Institute of Sun Yat-Sen University, Southern District of Nanshan Science Park, Shenzhen 518019, PR China d Guangdong Provincial Key Laboratory of Stem Cell and Regenerative Medicine, South China Institute for Stem Cell Biology and Regenerative Medicine, Guangzhou Institutes of Biomedicine and Health, Chinese Academy of Sciences, Guangzhou, PR China e Department of Psychiatry, The Third Affiliated Hospital of Sun Yat-Sen University, 600 Tianhe Rd, Guangzhou 510630, PR China b
ABSTRACT
Human iPSC line, iPSC-ADM01(SYSUi001-A), was generated from a 70-year-old male patient with sporadic Alzheimer's disease, using non-integrative reprogramming method. This cell line shows pluripotency both in vitro and in vivo, and has a normal karyotype.
Resource table Unique stem cell line identifier SYSUi001-A Alternative name(s) of stem cell line iPSC-ADM01 Institution The sixth affiliated hospital of Sun Yat-sen university Contact information of distributor Address: 26 Yuancun Erheng Road, Tianhe District, Guangzhou Tel: 020-38254072 Type of cell line iPSC Origin human Additional origin info Age:70 Sex: Male Ethnicity if known: Chinese Cell Source Urinary epithelial cell Clonality Clonal Method of reprogramming Transgene free Genetic Modification NO Type of Modification N/A Associated disease Alzheimer's disease Gene/locus N/A Method of modification N/A Name of transgene or resistance N/A Inducible/constitutive system N/A Date archived/stock date N/A Cell line repository/bank N/A
Ethical approval
The AD patient has signed informed consent for donating human UCs for stem cell generation. The experiments involving human subject and animal research had been reviewed and approved by IRB at GIBH (NO. 2010012).
Resource utility The SYSUi001-A bears the specific genetic background of Alzheimer's disease (AD) patient, which will be useful in investigating mechanisms of such disease. The integration-free reprogramming method also makes it a potential resource for cell-based therapy in the future. Resource details Alzheimer's disease is the most common cause of age-related dementia, characterized by a deterioration of memory and other cognitive domains that leads to death within 3 to 9 years after diagnosis (Querfurth and LaFerla, 2010). Reprogramming iPSC lines from AD patients allows us obtaining cell models with patient-specific genetic background, which facilitates future studies on Alzheimer's disease. In this study, the SYSUi001-A was generated from a 70-year-old
Corresponding author at: Neurology Department, The Sixth Affiliated Hospital of Sun Yat-Sen University, 26 Yuancun Erheng Road, Guangzhou 510655, PR China. E-mail address: [email protected] (Z. Li). 1 Co-first author. ⁎
https://doi.org/10.1016/j.scr.2018.101375 Received 12 August 2018; Received in revised form 11 December 2018; Accepted 17 December 2018 Available online 18 December 2018 1873-5061/ © 2018 Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Stem Cell Research 35 (2019) 101375
R. Wei et al.
Fig. 1. Characterization of human iPSC line SYSUi001-A.
sporadic AD patient with typical clinical manifestations. Urinary cells were reprogrammed to iPSC by transfecting 4 transcript factors (OCT4, SOX2, KLF4 and SV40LT) carried on an episomal plasmid. After reprogramming,the SYSUi001-A shows typical embryonic stem cell-like morphology (Fig.1A), expresses stem cell markers such as OCT4, SSEA4, TRA1–60 and TRA1–81 (Fig. 1B). Furthermore, these iPSCs are integration-free (Fig. 1D) and maintains a normal karyotype (Fig. 1E). RT-qPCR analysis also showed the pluripotency genes (OCT4, SOX2, and NANOG) expression levels were comparable to hESC line (Fig. 1B). Teratoma assay confirmed the pluripotency of the SYSUi001-A in vivo, by detection of the presence of three germ-layer structures (Fig. 1E). STR analysis showed that the SYSUi001-A have the same DNA profile as the patient's primary urinary cells (UC-ADM01), indicating that they are of the same origin (data archived).
pCEP4-E02S-ET2K (Addgene#20927), containing 4 transcript factors (OCT4, SOX2, KLF4 and SV40LT), together with another episomal vector pCEP4-hsa-miR-302-367, expressing human miR-302-367 cluster. For transfection, we used the LONZA electroporation system (LONZA Nucleofector™ 2b Device, Cat# AAB-1001; LONZA Primary Cell Nucleofector™ Kit, Cat# VVPI-1005), and for every 1 million urinary cells, 6 μg of pCEP4-E02S-ET2K and 4 μg of pCEP4-has-miR-302367 were used for reprogramming. After transfection, cells were seeded into a Matrigel (BD, Cat# 354277)-coated well with epithelial growth medium (LONZA, Cat# CC3190). Then we changed to defined medium mTeSR1 (Stem Cell, #85850) on the next day or after the cells well attached. Medium was changed every other day. Embryonic stem cell-like clones appeared at day 20, then these clones were picked out for further proliferation and purification.
Materials and methods
mRNA isolation and quantitative real-time PCR
Reprogramming of IPSC from urinary cells
Total mRNA was isolated using TRIzol reagent (Invitrogen, Cat# 15596026) according to the manufacturer's protocol. Then 1 μg mRNA were subjected to cDNA synthesis using Reverse Transcription Kit (Takara, Cat# RR036A). The expression of pluripotent stem cell
Urinary cells were collected from AD patient using previously published method (Zhou et al., 2012). When reprogramming, we transfected two episomal plasmids into patient's urinary epithelial cells: 2
Stem Cell Research 35 (2019) 101375
R. Wei et al.
Table 1 Characterization and validation. Classification
Test
Result
Data
Morphology Phenotype
Photography Immunocytochemistry RT-qPCR
Fig. 1 panel A Fig. 1 panel D Fig. 1 panel B
Genotype Identity
Karyotype (G-banding) and resolution STR analysis
Normal Expression of pluripotency markers: OCT4, SSEA4, TRA1–60, TRA1–81 The expression of OCT4, SOX2, and NANOG are respectively 1.79, 1.81, and 1.69 folds higher compared to H1. 46 XY, Resolution 450–500 20 STR loci tested, all matched
Mutation analysis (IF APPLICABLE)
Sequencing Southern Blot OR WGS Mycoplasma Teratoma formation HIV 1 + 2 Hepatitis B, Hepatitis C Blood group genotyping HLA tissue typing
N/A N/A Negative Three germ layers formation N/A N/A N/A
Microbiology and virology Differentiation potential Donor screening (OPTIONAL) Genotype additional info (OPTIONAL)
Fig. 1 panel C Achieved with journal N/A N/A N/A Fig. 1 panel E N/A N/A N/A
Table 2 Reagents details. Antibodies used for immunocytochemistry/flow-citometry
Pluripotency Markers
Secondary antibodies
Antibody
Dilution
Company Cat # and RRID
Goat anti-human Oct-3/4 Antibody (N-20) Mouse anti-human SSEA4 Mouse Anti-Human TRA-1-60 Monoclonal Antibody Mouse Anti-Human TRA-1-81 Monoclonal Antibody Rabbit Anti-Mouse IgG Antibody, Alexa Fluor 488 Conjugated Rabbit Anti-Goat IgG Antibody, Alexa Fluor 488 Conjugated
1: 200 1:200 1: 200 1: 200 1:500 1:500
Santa Cruz Biotechnology Cat# sc-8630, RRID: AB_677312 Stemgent, Cat# 09–0006, RRID: AB_1512169 Abcam Cat# ab16288, RRID: AB_778563 Abcam Cat# ab16289, RRID: AB_2165986 Thermo Fisher Scientific, Cat# A11059; RRID: AB_142495 Thermo Fisher Scientific Cat# A21222, RRID: AB_10373853
Primers Target Episomal Plasmids (PCR)
Pluripotency Markers (qPCR) House-Keeping Gene (qPCR)
Exogenous Exogenous Exogenous Exogenous OCT4 SOX2 NANOG GAPDH
Forward/Reverse primer (5′-3′) OCT4 SOX2 KLF4 SV40LT
AGTGAGAGGCAACCTGGAGA/AGGAACTGCTTCCTTCACGA ACCAGCTCGCAGACCTACAT/CCCCCTGAACCTGAAACATA CCCACACAGGTGAGAAACCT/CCCCCTGAACCTGAAACATA TGGGGAGAAGAACATGGAAG/AGGAACTGCTTCCTTCACGA GACGCCATCAACACCGAGTT/CTTTGTCGTTGGTTAGCTGGT CCCAGCAGACTTCACATGT/CCTCCCATTTCCCTCGTTTT TTTGTGGGCCTGAAGAAAACT/AGGGCTGTCCTGAATAAGCAG GTGGACCTGACCTGCCGTCT/GGAGGAGTGGGTGTCGCTGT
markers (OCT4, SOX2, NANOG) and endogenous control gene (GAPDH) were amplified using primers listed in Table 1. hESC line H1 was used as positive control.
Teratoma assay Teratoma assay was performed for confirmation of pluripotency in vivo. About 3 × 106 iPSCs were suspended in 50% Matrigel with PBS, then injected subcutaneously into NOD-SCID mice. After 1 month, teratomas were harvested and processed for haematoxylin and eosin staining.
Fluorescent immunocytochemistry For immunofluorescence assay, the SYSUi001-A clones were subseeded on Matrigel-coated coverslips. They were fixed with 4% paraformaldehyde for 20 min at room temperature, permeabilized with Triton-100, incubated with primary antibodies at 4 °C overnight, and secondary antibodies at room temperature for 1 h. Then the coverslips were gently mounted on microscope slides using antifade reagent with DAPI (ThermoFisher, Cat# P36931). Images were captured under fluorescence microscope (Zeiss, Axioskop 2 Plus). Antibodies used are listed in Table 2.
Acknowledgment This study was funded by grant 2015A030313128 from the Natural Science Foundation of Guangdong Province, China,grant JCYJ20150403151851068 from the Science and Technology Project of Shenzhen City, China and grant 201404KW028 from the Key Science and Technology Project of Guangzhou Tianhe District, China.
Karyotyping
References
The SYSUi001-A clones at 60–80% confluency were treated with 0.2 μg/ml colchicine for 130 min, then dissociated and fixed in 25% acetic acid and 75% methanol. Karyotyping was performed on Gbanded mitotic metaphase chromosomes. At least 20 metaphases were analysed with a band resolution of 400–450.
Querfurth, H.W., LaFerla, F.M., 2010. Alzheimer's disease. N. Engl. J. Med. 362, 329–344. Zhou, T., et al., 2012. Generation of human induced pluripotent stem cells from urine samples. Nat. Protoc. 7 (12), 2080–2089.
3